Reproductive Interference Explains Persistence of Aggression Between Species

Downloaded from http://rspb.royalsocietypublishing.org/ on March 4, 2015

Reproductive interference explains rspb.royalsocietypublishing.org persistence of aggression between species

Jonathan P. Drury1,†, Kenichi W. Okamoto2, Christopher N. Anderson3 and Gregory F. Grether1

Research 1Department of Ecology and Evolutionary Biology, University of California, 621 Charles E. Young Drive South, Los Angeles, CA 90095-1606, USA Cite this article: Drury JP, Okamoto KW, 2Department of Entomology, North Carolina State University, Campus Box 7613, Raleigh, NC 27695-7613, USA 3 Anderson CN, Grether GF. 2015 Reproductive Department of Biological Sciences, Dominican University, 7900 West Division St., River Forest, IL 60305, USA interference explains persistence of aggression Interspecific territoriality occurs when individuals of different species fight between species. Proc. R. Soc. B 282: over space, and may arise spontaneously when populations of closely related 20142256. territorial species first come into contact. But defence of space is costly, and http://dx.doi.org/10.1098/rspb.2014.2256 unless the benefits of excluding heterospecifics exceed the costs, natural selection should favour divergence in competitor recognition until the species no longer interact aggressively. Ordinarily males of different species do not compete for mates, but when males cannot distinguish females of sympatric Received: 11 September 2014 species, females may effectively become a shared resource. We model how Accepted: 27 January 2015 reproductive interference caused by undiscriminating males can prevent interspecific divergence, or even cause convergence, in traits used to recognize competitors. We then test the model in a genus of visually orienting insects and show that, as predicted by the model, differences between species pairs in the level of reproductive interference, which is causally related to species Subject Areas: differences in female coloration, are strongly predictive of the current level evolution, ecology, behaviour of interspecific aggression. Interspecific reproductive interference is very common and we discuss how it may account for the persistence of interspecific Keywords: aggression in many taxonomic groups. interspecific territoriality, species recognition, interference competition, character displacement, damselfly, Hetaerina 1. Introduction Interspecific territoriality [1] is expected to be evolutionarily stable under a Author for correspondence: narrower range of conditions than intraspecific territoriality, for two principal reasons. First, resource competition is generally weaker between than within Gregory F. Grether species, because of past niche divergence and competitive exclusion [2–4]. e-mail: [email protected] Second, attracting and maintaining priority of access to mates is one of the primary benefits of intraspecific territoriality [5], and members of different species generally do not compete for mates [6]. Interspecific territoriality may initially arise as a by-product of intraspecific territoriality when species that still share a common competitor recognition system first come into contact [6–8]. But defence of space is costly, and unless the benefits of excluding individuals of other species exceed the costs, selection should favour divergence in competitor recognition until interspecific aggression is eliminated [3,6–9]. Orians & Willson [6] concluded that interspecific territoriality ought to persist only between species that compete for resources that cannot be partitioned and otherwise should only be seen in cases of very recent sympatry caused by range shifts or where gene flow from allopatry prevents local adaptation in sympatry. The data available on birds 50 years ago appeared to support these predictions, but a taxonomically broader view shows that the theory † Present address: Institut de Biologie de l’ENS, is incomplete. In insects, fishes, frogs and lizards it is common for males of clo- 46 Rue d’Ulm, 75005 Paris, France. sely related species to compete over mating territories with no apparent common resources at stake [10–29]. This is often interpreted as a maladaptive Electronic supplementary material is available by-product of intraspecific territoriality and transient overlap between species at http://dx.doi.org/10.1098/rspb.2014.2256 or in territorial signals [7,16,19,30]. However, an alternative hypothesis is that interspecific territoriality persists in these cases because males of different via http://rspb.royalsocietypublishing.org. species actually are in competition for mates [19,31,32].

Indeed, interspecifically territorial species, including birds, populations may explain the failure of particular species pairs to 2 often interfere with each other reproductively, i.e. males court, diverge in competitor recognition, but the finding that most rspb.royalsocietypublishing.org attempt to mate or actually mate with heterospecific females sympatric species have not diverged argues for an adaptive (for examples, see electronic supplementary material, table explanation. Besides the unexplained variation in interspecific S1). In hybridizing taxa, the benefits of mating with hetero- aggression, there are other reasons to think the reproductive specifics may outweigh the costs in some contexts [33,34]. interference hypothesis applies to Hetaerina. Males have con- In non-hybridizing taxa, reproductive interference is most spicuous, species-specific coloration, but females are cryptic likely to occur when males cannot easily distinguish between and variable in coloration and can be difficult to identify to conspecific and heterospecific females. Although females the species level [43]. To examine whether the male damselflies would benefit from being discriminable in a mating context, can distinguish between conspecific and heterospecific females, ecological factors may prevent reproductive character displace- we presented territory holders at eight sympatric sites with live, ment in female traits. For example, selection for crypsis caused flying, tethered females. This is a realistic test of male mate rec- B Soc. R. Proc. by visually orienting predators [35] or prey [36] may constrain ognition because natural mating sequences begin with the male divergence in female coloration because mutations that enhance clasping the female (i.e. no pre-clasping courtship) and males discriminability tend to reduce crypsis [37]. When females cannot usually clasp tethered conspecific females. easily be distinguished, indiscriminate behaviour on the part of The results of this study provide striking support for our 282 males may be the best tactic for maximizing mating opportu- model: variation in the level of reproductive interference, nities. Regardless of the reasons, reproductive interference caused by variation in the ability of males to distinguish 20142256 : betweenspeciesisquitecommon[38]. between conspecific and heterospecific females, explains the Species that interfere with each other reproductively effec- variability in the level of aggressive interference between tively compete for mates [39]. Interspecific territoriality may species. Hence, we conclude that both divergent and con- therefore be profitable even when no other resources are vergent agonistic character displacement processes can defended [19,31,32]. To formally evaluate this hypothesis, we occur within a single taxon, depending on the degree to modified an existing individual-based model of agonistic char- which the interacting species are reproductively isolated. acter displacement [40] to simulate the evolutionary effects of secondary contact between two species in which males compete for mating territories. Reproductive interference was 2. Material and methods incorporated into the model as the fractional reduction (d)in a male’s expected mating success caused by sharing a territory (a) Model with one heterospecific male relative to sharing a territory with The full details and justifications for the underlying ACD model one conspecific male. This approach to modelling reproductive (without reproductive interference) can be found in [40]. Here, interference allowed us to use a single, composite parameter to we describe the key features of the model germane to our present encapsulate the aggregate effects of multiple factors, such as study. The model is individual-based [44] and the loci and alleles male mate recognition, microhabitat partitioning, etc., that underlying the evolvable traits are tracked explicitly. We model a sexually reproducing diploid population without overlapping might influence the intensity of reproductive interference. generations, which is appropriate for Hetaerina and many other The evolvable traits in the model are the central location (m) insects with seasonal reproduction cycles. The agonistic signal (z) s and width ( ) of the male competitor recognition template and the mean (m) and width (s) of the competitor recognition func- and the male trait (z) upon which competitor recognition is tion are each assumed to be quantitative traits whose breeding based (for further details, including descriptions of population values are determined by the additive effects of five autosomal, dynamics and the cost of territorial fights, see [40]). In simu- unlinked loci subject to mutation, and allelic values can take on lations carried out over 104 generations, we systematically any real number. The width (s) of the competitor recognition func- varied d and the initial values of m and z. The results show tion is expressed as the absolute value of its additive genetic value that moderate levels of reproductive interference are sufficient to ensure that this quantity is non-negative. Mutations occur with a 24 to allow interspecific territoriality to be maintained or even probability 10 at each locus. If a mutation occurs, a new allelic evolve de novo. value for the locus is drawn from a Gaussian distribution with the mean at the allelic value prior to mutation and a standard We tested the model in Hetaerina, a damselfly (Zygoptera) deviation given by 10% of the mean initial allelic value. This genus in which the level of interspecific aggression varies value thus describes the average magnitude of the mutation- across the species pairs included in our study (electronic sup- induced variance (e.g. [45]). During the breeding season plementary material, table S2). Males compete for small (90 days), the model proceeds on a daily time step. On each simu- 2 mating territories (1–2 m ) in fast flowing sections of rivers lated day, mature males either occupy or do not occupy territories. where females oviposit in submerged vegetation. Females Males without territories attempt to occupy individual territories usually oviposit outside the territories of their mates and that may or may not be occupied by other males. If the territory feeding occurs elsewhere [41]. There is no a priori reason to is occupied, three outcomes are possible: mutual recognition as expect interspecific territoriality in Hetaerina, and yet it competitors, one-sided recognition as a competitor and mutual occurs in most sympatric species pairs [13]. In some cases, non-recognition as competitors. Which of these outcomes is rea- m interspecific fighting is reduced by divergence in male com- lized is a probabilistic function of the individual values of z, and s of the males encountering each other [40]. Either mutual petitor recognition [13,42] or by species differences in or one-sided recognition results in a fight, in which males must microhabitat use [13], but in most cases, territory holders expend finite energetic reserves, which reduces their future fight- are equally aggressive to conspecific and heterospecific ing ability. The winner of the fight occupies the territory and the male intruders (electronic supplementary material, table S3) loser is ejected. If mutual non-recognition occurs, the resident and interspecific fights often occur just as frequently as intra- and intruding males share the territory. Following the assignment specific fights (electronic supplementary material, tables S4 of territories to males on each day, mating occurs. The probability and S5). Evolutionary time lags or gene flow from allopatric that a given male mates with a given female (and hence his relative Downloaded from http://rspb.royalsocietypublishing.org/ on March 4, 2015

reproductive contribution to the next generation) depends on: fights. Observers recorded the location of each male to the nearest 3 (i) whether the male occupies a territory or not, (ii) whether the 0.1 m by reference to numbered flags. We considered males terri- male and the female are conspecifics, and (iii) the number of tory holders if they perched near the bank of the river at the rspb.royalsocietypublishing.org other males with which the male shares a territory who could same location (within a 1.5 m radius) for 2 or more consecutive potentially interfere with his ability to mate with the female. days [42]. When fights occurred, we recorded the location, species Thus, the direction and strength of selection on competitor recog- involved, ID of individuals (if marked) and the level of escalation nition depend on the time-varying relative densities of mates for (1, one-way chase; 2, two-way back-and-forth chase; 3, escalated each species, the frequency distribution in the current generation ‘circle’ fight between two males and 4, escalated fight involving of the competitor recognition traits (z, m and s) in each species, three or more males). Prior to analysis, multiple recorded bouts and the variable frequency in territorial encounters. of fighting between the same two males on the same day were In contrast to the model in [40], the current model assumes reduced to a single fight. For fights involving unmarked or uniden- that females cannot control which males attempt to mate with tified individuals, we only recorded one fight within a 5 m radius them, and that heterospecific pairings arise from indiscriminate per day. B Soc. R. Proc. male behaviour. Heterospecific pairs are assumed to break up To determine whether interspecific fights occur less often before sperm transfer, which is realistic for Hetaerina. For a than expected by chance, following [13] we generated chance given clutch of eggs, females re-mate until they mate with a con- expectations from binomial expansions of the relative frequencies specific male, at which point the eggs are fertilized by that male’s of males of each species and conducted a x2 goodness-of-fit test sperm and oviposition occurs. The larval stages of the life cycle, on the observed number of fights. 282

during which density-dependent population regulation is 20142256 : assumed to occur, are modelled implicitly. We simulated 104 generations following secondary contact, (d) Interspecific aggression after a 1000-generation allopatric burn-in period. At the start of To measure interspecific aggression relative to intraspecific each simulation, the mean values of m and z were set to equal aggression, we followed the protocol of Anderson & Grether each other within species, which means that males initially recog- [42]: territory holders were presented with live male intruders nized most conspecific males as competitors. The model is based that were tethered with a transparent thread and flown into the on a damselfly-like system in which intraspecific territoriality is territory with a fishing pole. Each territory holder was presented adaptive [40]. However, because the underlying loci are with one conspecific intruder and one heterospecific intruder, unlinked, m and z can diverge from each other within species, with the order of presentation trials balanced across males. resulting in a loss of intraspecific territoriality. The initial magni- During each trial, a field assistant recorded the behaviour of tude @ of divergence between species in m and z, which the territory holder, including the amount of time spent chasing determines whether males of the two species initially respond the tethered male and the number of slams (defined as attempts aggressively to each other, was set at 0, 1.5 or 3 standard devi- to ram the tethered male, whether successful or not) and grabs ation units. A @ value of 1.5 corresponds to probability of (defined as extended physical contact with the tethered male) approximately 0.33 that encounters between males of the two on a continuously running voice recorder. It was not possible species will result in heterospecific recognition (one-sided or for field assistants to be blind to the treatments, but they had two-sided), while a @ value of 3 corresponds to a heterospecific no knowledge of our theoretical model or the prediction being recognition probability of about 0.01. We varied the level of tested. Trials were 2 min in duration with at least a 5-min inter- reproductive interference between species (d) across simulations trial interval. Cases in which we were only able to carry out (d ¼ 0.1, 0.21, 0.27, 0.30, 0.33 or 0.45). A d-value of 0.5 would one of the two trials or in which the territory holder did not mean that sharing a territory with one heterospecific male is chase either tethered intruder for at least 60 s were excluded just as costly, in terms of lost mating opportunities, as sharing from the analysis (the latter were interpreted as cases in which a territory with a one conspecific male. We ran 15 replicates for the male was not actively defending the site; if possible, these each combination of @ and d values. males were retested on a subsequent day). We tested for differences in the attack rate (slams and grabs divided by the duration of the trial) directed at heterospecific (b) Study sites versus conspecific males using paired t-tests when log(x þ 0.01)- We conducted the fieldwork from March to August in the years transformed data met the assumptions of normality and homosce- 2005–2013 at 11 locations in North America, most with two dasticity. Paired Wilcoxon paired signed rank tests were used species of Hetaerina damselflies present at moderate population when the data did not meet parametric assumptions. Sample densities (electronic supplementary material, table S2). We treat sizes are given in electronic supplementary material, table S3. one of the locations as two separate sites (PA1 and PA2) because the wing coloration of female H. titia undergoes a dramatic seasonal shift from the spring (PA1) to summer (PA2) months. The (e) Male mate recognition seasonal colour shift affects the predictions of our model because We measured male mate recognition by presenting territorial males of the sympatric congener (H. occisa) only distinguish holders with tethered females of both sympatric species at a dis- between females of the two species after the colour shift (PA2, tance of 0.5 m from the male’s perch. The presentation order of see electronic supplementary material, table S3). Pooling data conspecific and heterospecific females was balanced. Presentations from PA1 and PA2 did not change the overall results, however lasted 5 s each, or until the focal male returned to his perch, which- (see electronic supplementary material, figure S1). ever came last. If the female was clasped during her first presentation, we ended the trial; otherwise, we presented her to the same male for another 5 s. There is no courtship display in (c) Behavioural observations Hetaerina. A mating sequence begins with the male clasping the At each site, we captured most of the adult Hetaerina along a female, usually in mid-air. Just prior to clasping, the male flies 100–200 m river transect with aerial nets and marked individ- towards the female, curls his abdomen forward and grasps the uals with unique IDs using a previously described method intersternite region of the female’s thorax with his claspers. We [46]. We conducted behavioural observations (i) to determine considered a male to have responded sexually if he either clasped which males were defending territories and thus eligible for or attempted to clasp the female—that is, if he pursued her with his inclusion in the experiments (see below) and (ii) to record the fre- abdomen curled forward. In most recorded clasping attempts, the quency of naturally occurring conspecific and heterospecific male’s claspers made contact with the female’s intersternite Downloaded from http://rspb.royalsocietypublishing.org/ on March 4, 2015

4 (a)(b) ( f ) clasped not clasped rspb.royalsocietypublishing.org 10

8 (c)

100 (e) htness g li 75 6 g rc .Sc B Soc. R. Proc.

(d) female win 4 25 282 20142256 :

female wing reflectance (%) 0

300 400 500 600 700 2 wavelength (nm) amer. occisa male species Figure 1. Female wing coloration and male sexual responses. Photographs females of four Hetaerina species: (a) H. cruentata (mating), (b) H. americana (marked for identification), (c) H. occisa, (d) H. titia. Sample reflectance spectra of female wings (e), with line colours matching the frames of the respective species’ photographs (a–d). Wing lightness (f) affects whether H. titia females elicit a sexual response (stars) or not (circles) from H. americana (two-sided Mann–Whitney test, n ¼ 14, p ¼ 0.01) and H. occisa males (n ¼ 77, p , 0.0001). (Online version in colour.)

(96.7%), and in a majority of such cases (63.6%) the male clasped imagej.nih.gov/), we used the ‘Color Balance’ plugin in the MBF the female at least momentarily. Cases in which the male did not package to standardize the white balance in each photo rela- respond sexually to either female or we were unable to complete tive to the white background of the scale paper included in each the set of trials were excluded from the analysis. To test for dis- photograph. We then used the polygon tool and the ‘Measure crimination between females of different species, we used RGB’ plugin to analyse the RGB profile of each wing. The average, Fisher’s exact tests (for sample sizes, see electronic supplementary weighted greyscale calculated in ‘Measure RGB’ provided a material, table S3). photographic measure of wing lightness that correlated well with the spectroradiometric measure of wing lightness (Pearson’s product-moment correlation r ¼ 0.78, n ¼ 49, p , 0.001). (f) Female wing coloration measurements The wings of female Hetaerina vary from nearly clear to nearly black (figure 1a–e). To quantify this variation, we measured (g) Female wing colour manipulation wing reflectance spectra using an Ocean Optics spectrometer To determine whether female wing colour per se influenced male (USB 2000) equipped with a reflectance probe (Ocean Optics mate recognition, we presented territorial males of H. occisa and R200–7-UV-VIS) and a pulsed xenon light source (Ocean H. americana at several sites (CT, CV, ES, LM, PA2) with (i) unma- Optics PX-2), with reference to a Labsphere certified reflectance nipulated conspecific females and (ii) conspecific females with standard using Ocean Optics’ OOIBase32 software. We placed wings experimentally darkened to resemble dark H. titia females’ the reflectance standard behind the wings when taking readings, wings. Females were assigned to treatments at random with and the light path was oriented 458 relative to the wing surface to respect to their natural wing coloration in an alternating order eliminate glare. The resulting measurements include both light so as to maintain a balanced design. The same females were reflected off the wings and light transmitted through the also presented to H. titia territory holders at PA2 and CV. The wings. We took three repeat measurements at three positions darkening treatment involved colouring the hindwings from (base, middle and tip) on the forewings and hindwings and aver- the base to the tip with a grey marker (Warm Gray 90%, Prisma- aged the repeats. From the average spectra, we calculated color PM-107) and the forewings from base to the nodus with a ‘lightness’ (L) as the sum of per cent reflectance at 2 nm intervals grey marker and from the nodus to the tip with a sepia marker from 300 to 700 nm (scaled by 1023 for presentation). To account (Prismacolor PM-62). We chose these marker colours because for the proportionally larger mid-wing area, a weighted measure their reflectance spectra best approximated the late season of lightness was obtained with the formula: Ltotal ¼ 0.1Lbase þ wing coloration of female H. titia. We used the same tethering 0.8Lmiddle þ 0.1Ltip, where the coefficients represent the relative protocol and criteria for male sexual responses and inclusion in area of each region of the wing. analyses as above (for sample sizes, see figure 2). To examine the effect of female wing coloration on males’ responses to females, we measured the coloration of H. titia females that were presented to males in the mate recognition trials. It was (h) Statistical analysis not practical to scan the wings of all of the females with a spec- To obtain a relative measure of interspecific aggression, we trometer, so we instead took measurements from digital wing divided the mean attack rate towards heterospecific tethered photographs. Photographs were taken with the wings flattened males by the mean attack rate towards conspecific tethered against a white background using a Canon 10D or 20D digital males. Likewise, to obtain a relative measure of reproductive camera equipped with a Canon 100 mm macro lens and Canon interference, we divided the proportion of tethered females that MT-24 macro flash (Canon Inc., Tokyo). In ImageJ (http:// elicited sexual responses in trials with heterospecific males by Downloaded from http://rspb.royalsocietypublishing.org/ on March 4, 2015

** ** 5 1.00 * ** * rspb.royalsocietypublishing.org ** 0.75 ** female species and wing color treatment: ** 0.50 oc.am. control darkened 0.25

proportion of sexual responses proportion of sexual *p < 0.05 0 **p < 0.001 23 15 16 13 4361 22 32 27 B Soc. R. Proc. CV LM CT ES PA1 PA2 CV PA1 PA2 americana occisa titia site/male species

Figure 2. Results of female wing colour manipulation. Female H. americana and H. occisa with experimentally darkened wings elicited fewer sexual responses from 282

conspecific males and more sexual responses from H. titia males than did controls. The plotted values are sample proportions (number of males that responded 20142256 : sexually divided by the total number). Whiskers depict the standard error of the proportion. Some whiskers are covered by the plotted symbols. Sample sizes of males tested are given above the site labels. Significance levels from Fisher’s exact tests are shown above the plotted symbols. For study site locations, see electronic supplementary material, table S2. the proportion of tethered females that elicited sexual responses in the other four species pairs tested (electronic supplementary in trials with conspecific males. We obtained two measures of material, table S3). In the species pairs in which males discrimi- interspecific aggression and reproductive interference at each nate between conspecific and heterospecific females, females study site, one for each species, but only one measure of the that are more similar to heterospecific females in wing color- species difference in female wing coloration. To test for corre- ation are more likely to be clasped by heterospecific males lations between these variables, while circumventing potential (figure 1f), and experimental manipulations confirmed that non-independence caused by the data structure, we used the fol- female wing coloration directly affects male sexual responses lowing randomization approach: one of the two species at each site was dropped at random and a Spearman correlation coeffi- (figure 2). cient (r) was calculated using the remaining data points in In striking support of our model’s predictions, rates of STATA 12.1 (Statacorp, TX, USA). This procedure was repeated reproductive interference and aggressive interference are 104 times to yield a distribution of r, from which we calculated strongly, positively correlated across sites (mean + s.d. Spear- the mean and standard deviation. We then used phylogenetic man r ¼ 0.84 + 0.11, p , 0.001; figure 4). Both of these rates simulations to estimate the probability, under Brownian motion are negatively correlated with the species differences in (BM) and Ornstein–Uhlenbeck (OU) models of evolution, of obtain- female wing lightness (figure 4). The mean Spearman corre- ing null mean r as large as the observed mean r (see electronic lation between species differences in female wing lightness supplementary material, appendix S1). and the level of reproductive interference remained highly significant after phylogenetic correction (r ¼ 20.77 + 0.09; BM model of evolution, t ¼ 59.11, d.f. ¼ 999, p , 0.001; OU 3. Results model of evolution, t ¼ 57.78, d.f. ¼ 999, p , 0.001). Likewise, the mean Spearman correlation between species differences (a) Model results in female wing lightness and the magnitude of interspecific With low levels of reproductive interference (d , 0.28), the aggression remained highly significant after the phylogenetic species diverged in their mean values of m and z until inter- correction (r ¼ 20.80 +0.07; BM model of evolution, t ¼ 55.31, specific aggression was eliminated (figure 3a–c and electronic d.f. ¼ 999, p , 0.001; OU model of evolution, t ¼ 53.55, supplementary material, figure S2). By contrast, in the presence d.f. ¼ 999, p , 0.001). of moderate levels of reproductive interference (d 0.28), the species converged in their respective values of m and z until interspecific territoriality was established (figure 3d–fand electronic supplementary material, figure S2). The initial level of 4. Discussion divergence (@) between species had no qualitative effect on Mutually costly interspecific interactions, such as resource the final outcome if d . 0.1 (electronic supplementary material, competition and hybridization, can drive divergence between figure S2). With @ ¼ 0andd 0.1, intraspecific territoriality species over evolutionary time [2,47]. It is less intuitive that was lost in about one-third of the simulation runs (i.e. m and z costly interactions can also prevent divergence or cause evol- diverged within species; electronic supplementary material, utionary convergence. Here we formalize the hypothesis that figure S3), but @ ¼ 0 is biologically unrealistic. reproductive interference, resulting from indiscriminate male mating behaviour, can render interspecific territoriality adap- (b) Empirical results tive and prevent divergence or cause convergence between We found that males discriminate between heterospecific species in territorial signals. We then test the model’s pre- and conspecific females in the same two species pairs in dictions in the field and find that it explains the pattern of which they discriminate between heterospecific and conspeci- variation in interspecies fighting in Hetaerina damselflies. fic males (i.e. H. occisa–H. titia, H. americana–H. titia), and not Recent reviews have highlighted the prevalence of interspecific Downloaded from http://rspb.royalsocietypublishing.org/ on March 4, 2015

(a)(d) 6

8 rspb.royalsocietypublishing.org

6 3.0 4

2 (b) (e)

8 rc .Sc B Soc. R. Proc. 6 1.5 4 trait value ( m or z) trait value 2 282 20142256 : (c) ( f ) ( ∂ ) of divergence initial level 8

6 0 4

2 0246810 0246810 generations (thousands) Figure 3. Simulations showing the effects of reproductive interference on the evolution of interspecific aggression. Panels (a–c) illustrate the usual outcome of secondary contact between species with low levels of reproductive interference while (d–f) represent cases with higher levels of reproductive interference. Plotted values: mean of the male trait z (black, species 1; blue, species 2) and mean of the competitor recognition template m (red, species 1; green, species 2). Generation 0 is the time of secondary contact. In the examples shown here, d ¼ 0.1 (a–c) and d ¼ 0.33 (d–f). (Online version in colour.)

species difference 1.0 in female wing lightness

150

100 0.5 50 relative attack rate (heterospecific/conspecific) relative

0 0.5 1.0 relative clasping rate (heterospecific/conspecific) Figure 4. Evidence for a link between reproductive interference and interspecific aggression in Hetaerina damselflies. Relative attack rate (a measure of interspecific aggression): the number of attacks elicited by heterospecific male intruders divided by the number of attacks elicited by conspecific male intruders. Relative clasping rate (a measure of reproductive interference): the proportion of tethered females that elicited sexual responses in trials with heterospecific males divided by the proportion of tethered females that elicited sexual responses in trials with conspecific males. Grey scale: species differences in female wing lightness, as measured by reflectance spectrometry. Each point represents a population at a sympatric site. See text for statistical analysis. Downloaded from http://rspb.royalsocietypublishing.org/ on March 4, 2015

aggression and reproductive interference [8,14,16,38,48]. Our Another logical extension of our model would be to evaluate 7 model formally links these two costly interspecific interactions the effects of asymmetries in reproductive interference and/or rspb.royalsocietypublishing.org and provides a mechanism through which aggression between competitive ability between the interacting species. It is possible species can be maintained by natural selection. for selection to favour trait divergence in one species and conver- Overlap between species in female coloration appears to be gence in the other, resulting in evolutionary dynamics similar to the root cause of reproductive interference in Hetaerina,and Batesian mimicry. thus it is reasonable to ask why all sympatric species have Whether character displacement is common or rare remains not diverged substantially in female coloration. A plausible controversial [47,53,54], but researchers can probably agree explanation, which has been invoked for other taxa [35,49], is that current theory does a poor job of predicting whether that selection in other contexts, such as visual predation species will diverge from each other in sympatry. Indeed, a [36,50], overwhelms selection in a mating context and prevents recent large-scale phylogenetic study of song variation in oven- reproductive character displacement in female traits. In the birds (Furnariidae) revealed a striking pattern of character B Soc. R. Proc. damselflies, divergent selection on female coloration caused convergence between sympatric lineages [55]. Our model by reproductive interference may be quite weak, because the shows that evolutionary convergence (or stasis maintained fitness cost of temporary heterospecific pairings is likely to be by selection) can result, paradoxically, from species being too much lower, for both sexes, than the cost to males of failing similar phenotypically to be fully reproductively isolated. 282 to clasp conspecific females. Thus, it pays for males to be rela- This finding defies conventional thinking on the evolutionary tively non-discriminating, which undermines the potential effects of cross-species mating, but it appears to account for 20142256 : advantage to females of small increments in discriminability. the variable patterns of character displacement in Hetaerina While some species clearly have diverged sufficiently in damselflies. Our empirical results suggest that selection can female coloration for males to discriminate between the favour divergence between some sympatric species and con- females easily, we have no evidence that this is a product of vergence between others within a single genus. Such mixed reproductive character displacement. evolutionary outcomes of within-clade interactions may actu- Our model predicts a steep sigmoidal relationship between ally lead to an underestimation of the true effects of species reproductive interference and whether selection favours interactions on character evolution in large comparative divergence or convergence between species in competitor rec- studies. We anticipate that our combined modelling and ognition (electronic supplementary material, figure S2). While empirical results will provide strong impetus for further our empirical results are consistent with the existence of such research on the links between reproductive interference and a sigmoidal relationship (figure 4), we cannot yet evaluate aggression between species. whether the switch point occurs at the level of reproductive interference predicted by our model because reproductive Data accessibility. Our data files have been uploaded to Dryad (doi:10. interference depends on more than just the relative clasping 5061/dryad.3rg5m). rate. Other factors, such as microhabitat partitioning and the Acknowledgements. We thank A. Gonza´lez-Karlsson, F. Gould, K. Peiman, distance heterospecific pairs travel before the female is T. B. Smith and two anonymous reviewers for comments and discus- released, must also affect the intensity of reproductive interfer- sion. For assistance in the field, we thank T. Alvey, M. Benitez, ence. Quantifying the influence of such factors, and testing E. Berlin, A. Chao, S. Giovanetti, P. Green, K. Henderson, S. Hu, L. Karlen, E. Khazan, R. Musker and S. Sanford. For assistance with quantitative predictions of the model, is a goal for further transcription and image analyses, we thank C. Antaky, S. Ellis, research on this system. N. Gentry, O. Mckenzie, L. Perng and N. Synstelien. We thank The hypothesis that reproductive interference accounts for S. Bybee for providing extracted DNA or tissue for several specimens, interspecific aggression and territoriality was first proposed by E. Toffelmier, R. Ellingson, S. Lao and S. Chin for assistance with Payne [31] for parasitic Vidua finches, which, like the damsel- laboratory work and sample processing, T. B. Smith for use of laboratory facilities, R. Garrison for access to the Hetaerina morphological flies, only defend mating sites. The hypothesis has also been character data, M. Alfaro and J. Buckner for assistance with the phylo- applied to hybridizing species that defend multi-purpose terri- geny reconstruction, and T. Garland for suggesting the phylogenetic tories, on the basis that excluding heterospecific males is simulation approach. We also thank the staff at the Estacio´n Biolo´gica advantageous at the pair formation stage [51] and prevents inter- de Los Tuxtlas and Castroville Regional Park and several private land- specific extra-pair paternity [51,52]. Yet very few researchers owners for their hospitality. Author contributions. K.W.O. and G.F.G developed the theoretical model have explicitly linked interspecific aggression to reproductive and K.W.O. wrote the code and ran the simulations. J.P.D, G.F.G. and interference, and ours is the first formal model of the phenom- C.N.A. designed and conducted the field experiments and J.P.D. and enon. While interspecifically territorial species do not always G.F.G. analysed the empirical data. J.P.D. conducted the laboratory interfere with each other reproductively, not all species that com- work, constructed the phylogeny and carried out phylogenetic pete for common resources are interspecifically territorial either analyses. G.F.G. wrote the main paper and K.W.O, J.P.D. and G.F.G. created the figures. All authors discussed the manuscript drafts at all stages. [4]. Even when resource defence is the primary function of terri- Funding statement. J.P.D. received an NSF Graduate Research Fellowship toriality, reproductive interference might tip the balance in and fellowship support from UCLA’s Graduate Division and Depart- favour of excluding heterospecifics. Our model can be readily ment of Ecology & Evolutionary Biology. This research was extended to species that defend resources other than mates. supported by NSF DEB-1020586 (to G.F.G).

References

1. Simmons KEL. 1951 Interspecific territorialism. Ibis 2. Brown Jr WL, Wilson EO. 1956 Character 3. Lorenz K. 1962 The function of colour in 93, 407–413. (doi:10.1111/j.1474-919X.1951. displacement. Syst. Zool. 5, 49–64. (doi:10.2307/ coral reef fishes. Proc. R. Inst. Gt. Britain 39, tb05443.x) 2411924) 282–296. Downloaded from http://rspb.royalsocietypublishing.org/ on March 4, 2015

4. Dhondt AA. 2012 Interspecific competition in birds. 19. Singer F. 1989 Interspecific aggression in interference or misidentification? Anim. Behav. 35, 8 Oxford, UK: Oxford University Press. Leucorrhinia dragonflies—a frequency-dependent 263–270. (doi:10.1016/S0003-3472(87)80232-4) rspb.royalsocietypublishing.org 5. Payne RB, Groschupf KD. 1984 Sexual selection and discrimination threshold hypothesis. Behav. Ecol. 33. Pfennig KS. 2007 Facultative mate choice drives interspecific competition: a field experiment on Sociobiol. 25, 421–427. (doi:10.1007/BF00300188) adaptive hybridization. Science 318, 127–134. territorial behavior of nonparental finches 20. Jones MJ, Lace LA, Harrison EC, Stevens-Wood B. (doi:10.1126/science.1146035) (Vidua spp.). Auk 101, 140–145. 1998 Territorial behaviour in the speckled wood 34. Willis PM. 2013 Why do animals hybridize? Acta 6. Orians GH, Willson MF. 1964 Interspecific territories butterflies Pararge xiphia and P. aegeria of Madeira: Ethol. 16, 127–134. (doi:10.1007/s10211-013- of birds. Ecology 45, 736–745. (doi:10.2307/ a mechanism for interspecific competition. 0144-6) 1934921) Ecography 21, 297–305. (doi:10.1111/j.1600-0587. 35. Stamps JA, Gonn SMI. 1983 Sex-biased pattern 7. Murray BG. 1971 The ecological consequences of 1998.tb00567.x) variation in the prey of birds. Ann. Rev. Ecol. Syst. interspecific territorial behavior in birds. Ecology 52, 21. Shimoyama R. 1999 Interspecific interactions 14, 231–253. (doi:10.1146/annurev.es.14.110183.

414–423. (doi:10.2307/1937624) between two Japanese pond frogs, Rana porosa 001311) B Soc. R. Proc. 8. Grether GF, Losin N, Anderson CN, Okamoto K. brevipoda and Rana nigromaculata. Japanese 36. Grether GF, Grey RM. 1996 Novel cost of a sexually 2009 The role of interspecific interference J. Herpetol. 18, 7–15. selected trait in the rubyspot damselfly Hetaerina competition in character displacement and the 22. Tynkkynen K, Rantala MJ, Suhonen J. 2004 americana: conspicuousness to prey. Behav. Ecol. 7, evolution of competitor recognition. Biol. Rev. Interspecific aggression and character displacement 465–473. (doi:10.1093/beheco/7.4.465) 84, 617–635. (doi:10.1111/j.1469-185X.2009. in the damselfly Calopteryx splendens. J. Evol. Biol. 37. Endler JA. 1991 Interactions between predators and 282 00089.x) 17, 759–767. (doi:10.1111/j.1420-9101.2004. prey. In Behavioural ecology, an evolutionary 20142256 : 9. Brown WD, Alcock J. 1990 Hilltopping by the red 00733.x) approach (eds JR Krebs, NB Davies), pp. 169–201. admiral butterfly: mate searching alongside 23. McLain DK, Pratt AE. 1999 The cost of sexual Oxford: Blackwell. congeners. J. Res. Lepid. 29, 1–10. (doi:10.1016/ coercion and heterospecific sexual harassment on 38. Gro¨ning J, Hochkirch A. 2008 Reproductive 0163-7827(90)90004-5) the fecundity of a host-specific, seed-eating insect interference between animal species. Q. Rev. Biol. 10. Schwartz JJ, Wells KD. 1985 Intra- and interspecific (Neacoryphus bicrucis). Behav. Ecol. Sociobiol. 46, 83, 257–282. (doi:10.1086/590510) vocal behavior of the Neotropical treefrog Hyla 164–170. (doi:10.1007/s002650050606) 39. Reitz SR, Trumble JT. 2002 Competitive displacement microcephala. Copeia 1985, 27–38. (doi:10.2307/ 24. Singer F. 1990 Reproductive costs arising from among insects and arachnids. Annu. Rev. Entomol. 47, 1444787) incomplete habitat segregation among three species 435–465. (doi:10.1146/annurev.ento.47.091201. 11. Gerhardt HC, Ptacek MB, Barnett L, Torke KG. 1994 of Leucorrhinia dragonflies. Behaviour 115, 145227) Hybridization in the diploid–tetraploid treefrogs: 188–202. (doi:10.1163/156853990X00572) 40. Okamoto KW, Grether GF. 2013 The evolution of Hyla chrysoscelis and Hyla versicolor. Copeia 1994, 25. Nomakuchi S, Higashi K. 1996 Competitive habitat species recognition in competitive and mating 51–59. (doi:10.2307/1446670) utilization in the damselfly, Mnais nawai contexts: the relative efficacy of alternative 12. Anderson CN, Grether GF. 2010 Character (Zygoptera: Calopterygidae) coexisting with a mechanisms of character displacement. Ecol. Lett. displacement in the fighting colours of Hetaerina related species, Mnais pruinosa. Res. Popul. Ecol. 38, 16, 670–678. (doi:10.1111/ele.12100) damselflies. Proc. R. Soc. B 277, 3669–3675. 41–50. (doi:10.1007/BF02514969) 41. Grether GF. 1996 Intrasexual competition alone (doi:10.1098/rspb.2010.0935) 26. Outomuro D. 2009 Patrones morfolo´gicos favors a sexually dimorphic ornament in the 13. Anderson CN, Grether GF. 2011 Multiple routes to latitudinales en poblaciones ibe´ricas de Calopteryx rubyspot damselfly Hetaerina americana. Evolution reduced interspecific territorial fighting in Hetaerina Leach, 1815 (Odonata, Calopterygidae): posibles 50, 1949–1957. (doi:10.2307/2410753) damselflies. Behav. Ecol. 22, 527–534. (doi:10. causas ambientales y evolutivas. Boln. Asoc. esp. 42. Anderson CN, Grether GF. 2010 Interspecific 1093/beheco/arr013) Ent. 33, 299–319. aggression and character displacement of 14. Peiman KS, Robinson BW. 2010 Ecology and 27. Tynkkynen K, Grapputo A, Kotiaho JS, Rantala MJ, competitor recognition in Hetaerina damselflies. evolution of resource-related heterospecific Va¨a¨na¨nen S, Suhonen J. 2008 Hybridization in Proc. R. Soc. B 277, 549–555. (doi:10.1098/rspb. aggression. Q. Rev. Biol. 85, 133–158. (doi:10. Calopteryx damselflies: the role of males. Anim. 2009.1371) 1086/652374) Behav. 75, 1431–1439. (doi:10.1016/j.anbehav. 43. Garrison RW. 1990 A synopsis of the genus 15. Dijkstra PD, Groothuis TGG. 2011 Male–male 2007.09.017) Hetaerina with descriptions of four new species competition as a force in evolutionary 28. Tynkkynen K, Kotiaho JS, Luojumaki M, Suhonen J. (Odonata: Calopterygidae). Trans. Am. Entomol. Soc. diversification: evidence in haplochromine cichlid 2006 Interspecific territoriality in Calopteryx 116, 175–259. fish. Int. J. Evol. Biol. 2011, 1–9. (doi:10.4061/ damselflies: the role of secondary sexual characters. 44. DeAngelis DL, Mooij WM. 2005 Individual-based 2011/689254) Anim. Behav. 71, 299–306. (doi:10.1016/j.anbehav. modeling of ecological and evolutionary processes. 16. Ord TJ, King L, Young AR. 2011 Contrasting theory 2005.03.042) Annu. Rev. Ecol. Evol. Syst. 36, 147–168. (doi:10. with the empirical data of species recognition. 29. Svensson EI, Karlsson K, Friberg M, Eroukhmanoff F. 1146/annurev.ecolsys.36.102003.152644) Evolution 65, 2572–2591. (doi:10.1111/j.1558- 2007 Gender differences in species recognition and 45. Bu¨rger R. 2000 The mathematical theory of selection, 5646.2011.01319.x) the evolution of asymmetric sexual isolation. Curr. recombination, and mutation. Chichester, UK: Wiley. 17. Lailvaux SP, Huyghe K, Van Damme R. 2012 Why Biol. 17, 1943–1947. (doi:10.1016/j.cub.2007. 46. Anderson CN, Cordoba-Aguilar A, Drury JP, Grether can’t we all just get along? Interspecific aggression 09.038) GF. 2011 An assessment of marking techniques for in resident and non-resident Podarcis melisellensis 30. Schultz JK, Switzer PV. 2001 Pursuit of odonates in the family Calopterygidae. Entomol. lizards. J. Zool. 288, 207–213. (doi:10.1111/j.1469- heterospecific targets by territorial amberwing Exp. Appl. 141, 258–261. (doi:10.1111/j.1570- 7998.2012.00943.x) dragonflies (Perithemis tenera Say): a case of 7458.2011.01185.x) 18. Iyengar VK, Castle T, Mullen SP. 2014 Sympatric mistaken identity. J. Insect Behav. 14, 607–620. 47. Pfennig DW, Pfennig KS. 2012 Evolution‘s Wedge. sexual signal divergence among North American (doi:10.1023/A:1012223217250) Competition and the origins of diversity. Berkeley, Calopteryx damselflies is correlated with increased 31. Payne RB. 1980 Behavior and songs of hybrid CA: University of California Press. intra- and interspecific male–male aggression. parasitic finches. Auk 97, 118–134. 48. Grether GF, Anderson CN, Drury JP, Kirschel ANG, Behav. Ecol. Sociobiol. 68, 275–282. (doi:10.1007/ 32. Nishikawa KC. 1987 Interspecific aggressive Losin N, Okamoto K, Peiman KS. 2013 The s00265-013-1642-2) behaviour in salamanders: species-specific evolutionary consequences of interspecific Downloaded from http://rspb.royalsocietypublishing.org/ on March 4, 2015

aggression. Ann. NY. Acad. Sci. 1289, 48–68. 51. Sedlacek O, Cikanova B, Fuchs R. 2006 Ecol. Evol. 28, 402–408. (doi:10.1016/j.tree.2013. 9 (doi:10.1111/nyas.12082) Heterospecific rival recognition in the black 02.014) rspb.royalsocietypublishing.org 49. Seddon N et al. 2013 Sexual selection accelerates redstart (Phoenicurus ochruros). Ornis Fenn. 83, 54. Gerhardt HC. 2013 Geographic variation in acoustic signal evolution during speciation in birds. Proc. 153–161. communication: reproductive character displacement R. Soc. B 280, 20131065. (doi:10.1098/rspb. 52. Baker MC. 1991 Response of male indigo and lazuli and speciation. Evol. Ecol. Res. 15, 605–632. 2013.1065) buntings and their hybrids to song playback in 55. Tobias JA, Cornwallis CK, Derryberry EP, Claramunt 50. Grether GF. 1997 Survival cost of an intrasexually allopatric and sympatric populations. Behaviour S, Brumfield RT, Seddon N. 2013 Species coexistence selected ornament in a damselfly. Proc. R. Soc. 119, 225–242. (doi:10.1163/156853991X00454) and the dynamics of phenotypic evolution in Lond. B 264, 207–210. (doi:10.1098/rspb. 53. Stuart YE, Losos JB. 2013 Ecological character adaptive radiation. Nature 506, 359–363. (doi:10. 1997.0029) displacement: glass half full or half empty? Trends 1038/nature12874) rc .Sc B Soc. R. Proc. 282 20142256 : ELECTRONIC SUPPLEMENTARY MATERIAL

Reproductive interference explains persistence of aggression between species

Drury, J.P., Okamoto, K.W, Anderson, C.N., & Grether, G.F.

species difference 1.0 in female wing lightness 160

120

80 0.5 40 relative attack rate (heterospecific/conspecific) rate attack relative

0.0 0.0 0.5 1.0 relative clasping rate (heterospecific/conspecific)

Figure S1. Evidence for a link between reproductive interference and interspecific aggression in Hetaerina damselflies. This alternative version of figure 4 shows that the results remain qualitatively unchanged if data from the early (PA1) and late (PA2) season at the La Palma site are pooled (relative clasping rate vs. relative attack rate, mean ± s.d. Spearman ρ = 0.87 ± 0.07, P < 0.01; relative clasping rate vs. lightness difference, mean ± s.d. ρ = -0.75 ± 0.10, P < 0.01; relative attack rate vs. lightness difference, mean ± s.d. ρ = -0.73 ± 0.10, P < 0.01).

1.0 (a) 0.8

0.6 3.0 generations

4 0.4

0.2

0.0

1.0 initial level of divergence ( ∂ ) (b) 0.8

0.6 1.5 0.4

0.2

0.0

1.0 (c) 0.8

0.6 0.0 0.4

proportion of heterospecific encounters resulting in non-recognition after 10 after non-recognition in resulting encounters heterospecific of proportion 0.2

0.0 0.1 0.2 0.3 0.4 reproductive interference (d)

Figure S2. Summary of simulation results. (a-c) illustrate the proportion of heterospecific encounters resulting in mutual non-recognition 10000 generations after secondary contact begins as a function of the intensity d of reproductive interference. Except when d = 0.1 and ∂ = 0, open circles represent the average of 15 simulation runs, and the ends of the error bars represent the 5th and 95th percentiles for each set of runs. When d = 0.1 and ∂ = 0, simulations resulting in the loss of territoriality were excluded.

Figure S3. Example of a simulation in which intraspecific territoriality was lost as the species diverged from each other. In this and all other cases in which territoriality was lost, the species had the same mean values of z and µ at the time of secondary contact (∂ = 0) and reproductive interference was minimal (d = 0.1). Instead of tracking each other within species, the male trait z and central location of the recognition parameter µ diverged from each other within (as well as between) species. Territoriality was lost in 5 of 15 simulations with ∂ = 0 and d = 0.1, but 0 of 255 simulations with ∂ > 0 or d > 0.1. The color scheme matches figure 1. Table S1. Examples of interspecifically territorial species pairs in which reproductive interference occurs.

Taxon Species Location References Insects Speckled wood butterflies Madeira [1] (Pararge xiphia & P. aegeria) Seed-eating bugs United States [2] (Neacoryphus bicrucis & Margus obscurator) Whiteface dragonflies United States [3,4] (Leucorrhinia spp.) Mnais damselflies Japan [5] (Mnais nawai & M. pruinosa) Beautiful & western demoiselles Spain [6] (Calopteryx virgo & C. xanthostoma) Beautiful & banded demoiselles Finland [7–10] (Calopteryx virgo & C. splendens) River & ebony jewelwings United States [11] (Calopteryx aequabilis & C. maculata) Crustaceans European & signal crayfish Sweden [12] (Astacus astacus & Pacifastacus leniusculus) Fiddler crabs United States [13–15] (Uca spp.) Amphibians Red-cheeked & Northern slimy salamanders United States [16] (Plethodon jordani & P. glutinosus) Cope’s gray tree & gray tree frogs United States [17,18] (Hyla chrysoscelis & H. versicolor) Daruma pond & dark-spotted frogs Japan [19] (Pelophylax porosa brevipoda & P. nigromaculata)

Table S1 (cont.)

Birds Barred & spotted owls United States [20] (Strix varia & S. occidentalis) Anna’s and Allen’s hummingbirds United States [21] (Calypte anna & Selasphorus sasin) Indigo & lazuli buntings United States [22] (Passerina cyanea & P. amoena) Chiffchaffs & willow warblers Norway [23] (Phylloscopus collybita & P. trochilus) Redstarts & black redstarts Czech Republic [24] (Phoenicurus phoenicurus & P. ochruros) Eastern & western meadowlarks United States [25] (Sturnella magna & S. neglecta) Seaside sparrow & short-tailed sparrow United States [26] (Ammodramus maritimus & A. sp.) Dusky indigobirds & paradise whydahs Zambia [27] (Vidua purpurascens & V. paradisaea) Vinaceous & ring-necked doves Uganda [28] (Streptopelia vinacea & S. capicola) Hermit & Townsend’s warblers United States [29] (Setophaga occidentalis & S. townsendii) Melodious & Icterine warblers Northern Europe [30] (Hippolais polyglotta & H. icterina) Pied & collared flycatchers Sweden [31] (Ficedula hypoleuca & F. albicollis) Reed warblers Europe [32–34] (Acrocephalus spp.) Common & thrush nightingales Europe [35] (Luscinia megarhynchos & L. luscinia) Mammals Wolves & coyotes United States [36] (Canis lupus & C. latrans) Lar & pileated gibbons Thailand [37] (Hylobates lar & H. pileatus) Table S2. Study site locations (in decimal degrees) and Hetaerina species present.

Site name Species 1 Species 2 Latitude Longitude Armeria (AR) H. americana H. titia 18.95001 -103.93351 Bonita Creek (BC) H. americana H. vulnerata 32.91627 -109.49282 Castroville (CV) H. americana H. titia 29.34079 -98.88156 Cuetzalapan (CT) H. cruentata H. occisa 18.37100 -95.00148 El Limon (EL) H. americana H. cruentata 21.36673 -104.61673 Laguna Escondida (ES) H. sempronia H. occisa 18.59245 -95.08390 Lampasas (LM) H. americana — 31.08271 -98.01973 La Palma (PA) H. occisa H. titia 18.56187 -95.06134 Otapa (OT) H. occisa H. titia 18.68339 -96.38350 Pixquiac (PX) H. vulnerata H. cruentata 19.46679 -96.95018 Upper Cuetzalapan (UC) H. sempronia H. capitalis 18.36733 -94.96500

Table S3. Comparisons of territorial males’ responses to tethered conspecifics and heterospecifics of both sexes.

Female tethering Male tethering Focal species Sympatric congener Site n P* n Statistic† P H. americana H. titia AR — — 16 t = 3.611‡ 0.002 H. americana H. vulnerata BC 18 0.69 16 t = -0.051 0.96 H. americana H. titia CV 24 0.0065 33 t = 7.78‡ <0.0001 H. americana H. cruentata EL — — 17 t = 0.02‡ 0.98

H. cruentata H. occisa CT 17 0.28 15 t = 0.71‡ 0.49 H. cruentata H. americana EL — — 10 t = 0.85‡ 0.42 H. cruentata H. vulnerata PX 14 0.22 17 t = 0.68 0.50

H. occisa H. cruentata CT 20 1 16 t = 0.14‡ 0.89 H. occisa H. sempronia ES 20 0.80 19 t = 1.32 0.20 H. occisa H. titia OT 7 0.0006 39 t = 7.33‡ <0.0001 H. occisa H. titia PA1 64 0.09 54 V = 1144.5 <0.0001 H. occisa H. titia PA2 42 <0.0001 68 V = 1653 <0.0001

H. sempronia H. occisa ES 10 0.37 14 t = 3.98 0.002§ H. sempronia H. capitalis UC — — 16 V = 59 0.6685

H. titia H. americana AR — — 14 t = 5.91‡ <0.0001 H. titia H. americana CV 22 <0.0001 30 t = 8.26‡ <0.0001 H. titia H. occisa OT 17 <0.0001 23 t = 6.56‡ <0.0001 H. titia H. occisa PA1 38 0.037 19 V = 4 0.0004 H. titia H. occisa PA2 24 <0.0001 22 V = 8 0.006

H. vulnerata H. americana BC 18 0.15 16 t = 2.42 0.03§ H. vulnerata H. cruentata PX 11 1 10 t = 0.04 0.97

Sample sizes are the number of males tested with tethered individuals of both species. Dashes indicate where, for logistical reasons, responses to females were not measured. *Fisher’s exact tests; in all cases where P < 0.05, males responded more strongly to conspecific females than to heterospecific females. †Paired t-tests (t) or Wilcoxon paired sign rank tests (V); if P < 0.05, males responded more strongly to conspecific males than to heterospecific males, except where noted otherwise. ‡Previously published data [38]. §Cases in which males responded more strongly to heterospecific males than to conspecific males.

Table S4. Variation in the level of interspecific territoriality relative to intraspecific territoriality, inferred from behavioral observations, including all observed fights.

Number of fights, observed (expected)* Site Year Species 1 Interspecific Species 2 χ2 P† AR 2005‡ 10(8) 20(36) 58(44) 12.74 0.002 AR 2008‡ 6(2) 8(18) 42(35) 12.63 0.002 BC 2012 31(28) 12(16) 4(2) 2.57 0.28 CT 2006‡ 9(7) 2(9) 8(3) 15.78 <0.001 CV 2008 April‡ 6(2) 8(18) 42(35) 9.4 0.009 CV 2008 August‡ 24(19) 18(30) 18(12) 23.9 <0.001 CV 2012 15(5) 7(25) 39(31) 34.27 <0.001 EL 2008‡ 37(30) 7(19) 8(3) 17.9 <0.001 ES 2013 26(17) 12(26) 16(10) 15.61 <0.001 OT 2006‡ 13(11) 14(59) 120(77) 58.55 <0.001 OT 2007‡ 8(8) 4(25) 41(19) 42.00 <0.001 OT 2010 13(4) 10(60) 244(203) 66.67 <0.001 PA2 2007‡ 13(19) 6(24) 32(8) 88.18 <0.001 PA1 2011 87(133) 120(136) 97(35) 126.44 <0.001 PA2 2011 20(22) 21(35) 29(14) 23.06 <0.001 PA1 2012 16(16) 11(21) 17(7) 17.46 <0.001 PA2 2012 30(19) 14(41) 38(22) 35.55 <0.001 PX 2010 38(40) 23(24) 7(3) 4.46 0.10 PX 2011 25(22) 13(15) 2(3) 0.64 0.76

Species numbers follow table S2. *Expected number of fights generated through binomial expansion of the relative proportiosn of each species at the site. When expected values were < 5, we calculated P values using Monte Carlo simulations. †In all cases with P < 0.05, the rate of interspecific fighting was reduced relative to intraspecific fighting. ‡Previously published data [39].

Table S5. Variation in the level of interspecific territoriality relative to intraspecific territoriality, inferred from behavioral observations, including only escalated fights.

Number of fights, observed (expected)* Site Year Species 1 Interspecific Species 2 χ2 P† BC 2012 19(18) 8(10) 2(1) 0.74 0.69 CV 2012 8(2) 2(11) 17(14) 22.78 < 0.001 ES 2013 23(14) 9(21) 11(8) 13.93 <0.001 OT 2010 6(2) 0(33) 142(113) 44.83 <0.001 PA1 2011 69(101) 90(102) 70(26) 82.64 <0.001 PA2 2011 15(17) 15(28) 26(11) 27.32 <0.001 PA1 2012 11(9) 4(13) 11(4) 16.33 <0.001 PA2 2012 26(14) 9(29) 23(15) 29.11 <0.001 PX 2010 15(16) 7(9) 4(1) 6.43 0.04 PX 2011 13(11) 6(8) 1(1) 0.62 0.78

Species numbers follow table S2. *Expected number of fights generated through binomial expansion of the relative proportion of each species at the site. When expected values were < 5, we calculated P values using Monte Carlo simulations. †In all cases with P < 0.05, the rate of interspecific fighting was reduced relative to intraspecific fighting.

Appendix S1. Phylogenetic correction (i) Statistical approach We employed a simulation approach to calculate phylogenetically corrected test statistics (after [40–42]. In the R program we wrote, species’ female wing lightness values are simulated 1,000 times under Brownian motion [BM] and Ornstein-Uhlenbeck [OU] models of evolution across a phylogeny (see Phylogeny reconstruction, below) using the fastBM() function in the phytools package for R [43]. We used the empirical data and the fitContinuous() function in geiger [44] to scale the simulation data. After each simulation, differences between sympatric species are calculated. In this way, only the relevant species comparisons are included, and a full species interaction matrix is not necessary, as it is in phylogenetically permuted partial Mantel tests (for other issues with partial Mantel tests, see [42,45,46]). Using these simulated differences, the Spearman correlation simulations described in the main text were carried out between the raw (observed) response variables (i.e., heterospecific clasping ratio or heterospecific aggression ratio) and the simulated species differences in female wing lightness. For each simulated dataset, we created a distribution of 1,000 ρ values from simulated female wing lightness and empirical clasping and aggression ratios and stored the mean value of this distribution. We then compared a distribution of 1,000 simulated mean ρ values (each the mean of 1,000 simulations) to the empirically calculated mean ρ value using a one-sample t-test. Hetaerina titia female wings exhibit a seasonal polyphenism in their wing lightness (Drury et al. MS). In the overall analysis, one site’s (PA1) measurements were taken on light- morph females. To determine if the phylogenetically corrected statistic is robust to changes in how we modeled the evolution of wing color, we ran analyses including a mean value of H. titia female wings calculated across all sites and another analysis excluding data from PA1 where most females were light-phase morphs.

(ii) Phylogeny reconstruction To construct the phylogeny, we included 32 specimens from 9 Hetaerina species, sampling several individuals from different populations where possible (table S6). We included individuals of Calopteryx maculata and Calopteryx aqueabilis as outgroups. We obtained a matrix of adult female and male morphological characters used in the creation of the key to the genus Hetaerina [47] (R. Garrison, pers. comm.). We also included morphological character data from a published account of Hetaerina larvae (see table 3 in [48]). We extracted DNA from wing muscle tissue of ethanol-preserved specimens using Qiagen DNEasy kits (Qiagen, Valencia, CA, USA). Several target mitochondrial and nuclear sequences (table S7) were amplified using the polymerase chain reaction (PCR) and sequenced at a sequencing core (UCLA GenoSeq Core, Los Angeles, CA, Cornell Genomics Facility, Ithaca, NY, or Beckman Coulter Genomics, Danvers, MA). Resulting forward and reverse chromatograms were aligned in Geneious 4.8.3 (Biomatters, Inc.), checked, and assembled into contigs. Consensus sequences for each locus were aligned using Muscle v.3.8.31 alignment software [49], inspected visually, and altered manually if necessary. We excluded three sequences referenced with BLAST (Altschul et al. 1990) that returned taxonomically distant matches. Concatenated sequence files were created using SequenceMatrix [50]. Our final concatenated matrix totaled 3853 nucleotides (table S7) and 89 morphological characters, which were added to one individual for each species. When it was possible to verify sequence alignments to ensure the accuracy of codon partitioning using BLAST [51], we partitioned loci at the codon level. We then used PartitionFinder v. 1.1.1 [52] to identify the best-fit partitioning scheme and suitable models of evolution for each partition using BIC model selection and the “greedy” search algorithm. Final phylogenetic inferences were conducted on alignments with the partitions identified in PartitionFinder and three additional partitions for morphological characteristics (females, males, and larvae). We used MrBayes 3.2.2 for Bayesian reconstruction of the phylogeny [53]. The analysis was run for 20 million generations, sampling every 5000 generations, with four chains (one cold, three heated). Chain convergence was assessed using Tracer 1.6 [54], 25% of trees were discarded as burnin, and the maximum clade credibility tree was calculated from post-burnin trees using TreeAnnotator v.1.7.4 [55] (figure S4). Analyses were run using the Cipres Web Portal [56]. To obtain an ultrametric tree for modeling trait evolution, we rendered the maximum clade credibility tree obtained from mrBayes ultrametric using the chronos() function in the ape package in R [57] and dropped tips so that the topology had a single tip for each species in our analyses.

(iii) Phylogenetic results excluding data from PA1 As with the results based on data from all sites, species differences in female wing lightness (excluding PA1) were negatively correlated with the level of reproductive interference after the phylogenetic correction (excluding early season La Palma: mean observed ρ = -0.730; BM model of evolution, t = 52.16, d.f. = 999, p < 0.001; OU model of evolution, t = 50.74, d.f. = 999, p < 0.001). Likewise, species differences in female wing lightness (excluding PA1) were negatively correlated with the magnitude of interspecific aggression after the phylogenetic correction (mean observed ρ = -0.804; BM model of evolution, t = 55.31, d.f. = 999, p < 0.001; OU model of evolution, t = 53.55, d.f. = 999, p < 0.001; excluding early season La Palma: mean observed ρ = - 0.722; BM model of evolution, t = 51.34, d.f. = 999, p < 0.001; OU model of evolution, t = 50.65, d.f. = 999, p < 0.001) Table S6. Specimens used in the reconstruction of the phylogeny and their GenBank accession numbers. Locus numbers follow codes in table S7 (shaded cells correspond to missing sequences). decimal degrees Locus new tree name collection location (lat, long) 1 2 3 4 5 6 7 8 Calopteryx aequabilis Horse Creek, CA 41.824, -123.000 KM383956 KM383925 KM383900 KM383991 KM383865 KM383796 C. maculata Burr Ferry, LA 31.076, -93.489 KM383849 KM383957 KM383926 KM383992 KM383864 Hetaerina americana 1 Arroyo de Piedra 19.456, -96.479 KM383858 KM383984 KM383951 KM384000 KM383870 KM383832 KM383824 H. americana 2 Bonita Creek, AZ 32.916, -109.493 KM383853 KM383982 KM383950 KM383899 KM383872 KM383833 KM383825 H. americana 3 Bonita Creek, AZ 32.916, -109.493 KM383854 KM383983 KM383949 KM383898 KM383999 KM383871 KM383834 KM383826 H. capitalis 1 Los Organos 18.657, -95.151 KM383978 KM383928 KM383914 KM383889 KM383813 H. capitalis 2 Upper Cuetzalapan 18.367, -94.965 KM383979 KM383929 KM383915 KM383890 KM383811 H. capitalis 3 Upper Cuetzalapan 18.367, -94.965 KM383980 KM383930 KM383916 KM383891 KM383812 H. capitalis 4 Río Limón 21.367, -104.617 KM383861 KM383981 KM383927 KM383913 KM384009 KM383888 KM383810 H. cruentata 1 Cuetzalapan 18.371, -95.001 KM383986 KM383954 KM383918 KM383998 KM383893 KM383842 KM383818 H. cruentata 2 Los Organos 18.657, -95.151 KM383850 KM383987 KM383955 KM383919 KM383996 KM383894 KM383841 KM383819 H. cruentata 3 Pixquiac 19.467, -96.95 KM383985 KM383953 KM383917 KM383997 KM383892 KM383840 KM383820 H. miniata 1 Bartola 10.989, -84.334 KM383966 KM383939 KM383922 KM384014 KM383884 KM383831 KM383801 H. miniata 2 Bartola 10.989, -84.334 KM383967 KM383942 KM384015 KM383885 KM383828 KM383802 H. miniata 3 Bartola 10.989, -84.334 KM383968 KM383940 KM383905 KM384016 KM383886 KM383829 H. miniata 4 Bartola 10.989, -84.334 KM383969 KM383941 KM384017 KM383887 KM383830 KM383803 H. occisa 1 La Palma 18.550, -95.067 KM383972 KM383933 KM383906 KM384001 KM383866 KM383848 H. occisa 2 Benito Juarez 18.359, -95.000 KM383971 KM383934 KM383904 KM384002 KM383868 KM383846 H. occisa 3 Benito Juarez 18.359, -95.000 KM383973 KM383935 KM383911 KM384004 KM383869 KM383847 KM383809 H. occisa 4 La Palma 18.550, -95.067 KM383857 KM383970 KM383932 KM383902 KM384003 KM383867 KM383845 KM383808 H. pilula 1 Cuetzalapan 18.371, -95.001 KM383962 KM383945 KM383903 KM384011 KM383881 KM383804 H. pilula 2 Laguna Escondida 18.592, -95.084 KM383964 KM383943 KM384012 KM383883 KM383827 KM383806 H. pilula 3 Laguna Escondida 18.592, -95.084 KM383965 KM383944 KM384010 KM383882 KM383807 H. pilula 4 Balzapote 18.614, -95.073 KM383859 KM383963 KM384013 KM383805 H. sempronia 1 Laguna Escondida 18.592, -95.084 KM383856 KM383975 KM383948 KM383908 KM384005 KM383878 KM383814 H. sempronia 2 Laguna Escondida 18.592, -95.084 KM383855 KM383974 KM383946 KM383901 KM384006 KM383877 KM383815 H. sempronia 3 Los Organos 18.657, -95.151 KM383976 KM383947 KM383909 KM384007 KM383879 KM383816 H. sempronia 4 Upper Cuetzalapan 18.367, -94.965 KM383977 KM383910 KM384008 KM383880 KM383817 H. titia 1 La Palma 18.550, -95.067 KM383863 KM383959 KM383937 KM384019 KM383873 KM383838 KM383800 H. titia 2 Bartola 10.989, -84.334 KM383960 KM383923 KM384021 KM383874 KM383836 KM383799 H. titia 3 Burr Ferry, LA 31.076, -93.489 KM383958 KM383936 KM383907 KM384018 KM383875 KM383837 KM383798 H. titia 4 Armeria 18.950, -103.934 KM383860 KM383961 KM383938 KM383912 KM384020 KM383876 KM383835 KM383797 H. vulnerata 1 Pixquiac 19.467, -96.95 KM383851 KM383989 KM383952 KM383921 KM383993 KM383896 KM383839 KM383822 H. vulnerata 2 Pixquiac 19.467, -96.95 KM383852 KM383990 KM383924 KM383995 KM383897 KM383844 KM383823 H. vulnerata 3 Sierra Vista, AZ 31.480, -110.337 KM383862 KM383988 KM383931 KM383920 KM383994 KM383895 KM383843 KM383821

Table S7. Loci and primers used to generate sequence data for the phylogeny locus primers total min/max length reference (5'→3' forward top, 5'→3' reverse bottom) alignme of sequenced nt product (bp) length mitochondrial 1. cytochrome oxidase I GGTCAACAAATCATAAAGATATTGG 664 611/664 [58] TAAACTTCAGGGTGACCAAAAAATCA 2. 16s rRNAp GCTCCGDTTTGAACTCAGAT 534 512/523 [59] AGTTCTCGCCTGTTTATCAAA 3. 12s rRNAp, tRNA-valinec, 16s rRNAp GATCTGATGAAGGTGGATTT 421 363/411 [59] TAGCTCTTCTGAAATCGAGA 4. 16s rRNAp, tRNA-leucinec, NADH TTCAAACCGGTGTAAGCCAGG 534 387/532 [60] dehydrogenase Ip TAGAATTAGAAGATCAACCAG nuclear 5. elongation factor αp GCYGARCGYGARCGTGGTATYAC 459 421/449 [61] CATGTTGTCGCCGTGCCAAC 6. histone 3 ATGGCTCGTACCAAGCAGACVGC 328 328/328 [62] ATATCCTTRGGCATRATRGTGAC 7. tubulin alpha GAAACCRGTKGGRCACCAGTC 155* 447/466 [63] GARCCCTACAAYTCYATTCT 8. 18s & 28s rRNAp 5.8s rRNAc TAGAGGAAGTAAAAGTCG 758 460/697 [64] GCTTAAATTCAGCGG p=partial c=complete *only one codon was variable

H. americana 1 ! H. americana 3 ! H. americana 2 ! H. vulnerata 3 H. vulnerata 1 ! ! H. vulnerata 2 ! H. cruentata 3 ! H. cruentata 1 ! ! H. cruentata 2 H. capitalis 4 ! H. capitalis 3 ! H. capitalis 1 ! H. capitalis 2 H. sempronia 2 ! ! H. sempronia 1 ! H. sempronia 3 ! H. sempronia 4 H. pilula 1 ! ! H. pilula 3 ! H. pilula 2 ! H. pilula 4 H. occisa 1 ! ! H. occisa 3 ! H. occisa 4 ! H. occisa 2

! H. titia 4 ! H. titia 3 ! H. titia 1 ! ! H. titia 2 H. miniata 3 ! H. miniata 4 ! H. miniata 2 ! H. miniata 1

Figure S4. Maximum clade credibility tree calculated from partitioned data set using Bayesian tree inference. Black circles indicate mean posterior probability >0.95, gray circles >0.75 and < 0.95, and empty circles <0.75.

References 1. Jones, M. J., Lace, L. A., Harrison, E. C. & Stevens-Wood, B. 1998 Territorial behaviour in the speckled wood butterflies Pararge xiphia and P. aegeria of Madeira: a mechanism for interspecific competition. Ecography 21, 297–305. 2. McLain, D. K. & Pratt, A. E. 1999 The cost of sexual coercion and heterospecific sexual harassment on the fecundity of a host-specific, seed-eating insect (Neacoryphus bicrucis). Behav. Ecol. Sociobiol. 46, 164–170. 3. Singer, F. 1989 Interspecific aggression in Leucorrhinia dragonflies - a frequency- dependent discrimination threshold hypothesis. Behav. Ecol. Sociobiol. 25, 421– 427. 4. Singer, F. 1990 Reproductive costs arising from incomplete habitat segregation among three species of Leucorrhinia dragonflies. Behaviour 115, 188–202. 5. Nomakuchi, S. & Higashi, K. 1996 Competitive habitat utilization in the damselfly, Mnais nawai (Zygoptera: Calopterygidae) coexisting with a related species, Mnais pruinosa. Res. Popul. Ecol. 38, 41–50. (doi:10.1007/BF02514969) 6. Outomuro, D. 2009 Patrones morfológicos latitudinales en poblaciones ibéricas de Calopteryx Leach , 1815 (Odonata , Calopterygidae): posibles causas ambientales y evolutivas. Boln. Asoc. esp. Ent. 33, 299–319. 7. Tynkkynen, K., Grapputo, A., Kotiaho, J. S., Rantala, M. J., Väänänen, S. & Suhonen, J. 2008 Hybridization in Calopteryx damselflies: the role of males. Anim. Behav. 75, 1431–1439. (doi:10.1016/j.anbehav.2007.09.017) 8. Tynkkynen, K., Kotiaho, J. S., Luojumaki, M. & Suhonen, J. 2006 Interspecific territoriality in Calopteryx damselflies: the role of secondary sexual characters. Anim. Behav. 71, 299–306. 9. Tynkkynen, K., Rantala, M. J. & Suhonen, J. 2004 Interspecific aggression and character displacement in the damselfly Calopteryx splendens. J. Evol. Biol. 17, 759–767. 10. Svensson, E. I., Karlsson, K., Friberg, M. & Eroukhmanoff, F. 2007 Gender differences in species recognition and the evolution of asymmetric sexual isolation. Curr. Biol. 17, 1943–1947. (doi:10.1016/j.cub.2007.09.038|ISSN 0960- 9822) 11. Iyengar, V. K., Castle, T. & Mullen, S. P. 2014 Sympatric sexual signal divergence among North American Calopteryx damselflies is correlated with increased intra- and interspecific male–male aggression. Behav. Ecol. Sociobiol. 68, 275–282. (doi:10.1007/s00265-013-1642-2) 12. Söderbäck, B. 1995 Replacement of the native crayfish Astacus astacus by the introduced species Pacifastacus leniusculus in a Swedish lake: possible causes and mechanisms. Freshw. Biol. 33, 291–304. 13. Aspey, W. 1971 Inter-species sexual discrimination and approach-avoidance conflict in two species of fiddler crabs, Uca pugnax and Uca pugilator. Anim. Behav. 19, 669–676. 14. Booksmythe, I., Jennions, M. D. & Backwell, P. R. Y. 2011 Male fiddler crabs prefer conspecific females during simultaneous, but not sequential, mate choice. Anim. Behav. 81, 775–778. (doi:10.1016/j.anbehav.2011.01.009) 15. Hyatt, G. W. & Salmon, M. 1977 Combat in the fiddler crabs Uca pugilator and U. pugnax: a quantitative analysis. Behaviour 65, 182–211. 16. Nishikawa, K. C. 1987 Interspecific aggressive behaviour in salamanders: species- specific interference or misidentification? Anim. Behav. 35, 263–270. 17. Gerhardt, H. C., Ptacek, M. B., Barnett, L. & Torke, K. G. 1994 Hybridization in the diploid-tetraploid treefrogs: Hyla chrysoscelis and Hyla versicolor. Copeia 1994, 51–59. 18. Reichert, M. S. & Gerhardt, H. C. 2014 Behavioral strategies and signaling in interspecific aggressive interactions in gray tree frogs. Behav. Ecol. 25, 520–530. (doi:10.1093/beheco/aru016) 19. Shimoyama, R. 1999 Interspecific interactions between two Japanese pond frogs, Rana porosa brevipoda and Rana nigromaculata. Japanese J. Herpetol. 18, 7–15. 20. Gutiérrez, R. J., Cody, M., Courtney, S. & Franklin, A. B. 2006 The invasion of barred owls and its potential effect on the spotted owl: a conservation conundrum. Biol. Invasions 9, 181–196. (doi:10.1007/s10530-006-9025-5) 21. Pitelka, F. A. 1951 Ecologic overlap and interspecific strife in breeding populations of Anna and Allen hummingbirds. Ecology 32, 641–661. 22. Baker, M. C. 1991 Response of male indigo and lazuli buntings and their hybrids to song playback in allopatric and sympatric populations. Behaviour 119, 225–242. 23. Saether, B. 1983 Mechanism of interspecific spacing out in a territorial system of the chiffchaff Phylloscopus collybita and the willow warbler P. trochilus. Ornis Scand. 14, 154–160. 24. Sedlacek, O., Cikanova, B. & Fuchs, R. 2006 Heterospecific rival recognition in the Black Redstart (Phoenicurus ochruros). Ornis Fenn. 83, 153–161. 25. Lanyon, W. E. 1979 Hybrid sterility in meadowlarks. Nature 279, 557–558. 26. Post, W. & Greenlaw, J. S. 1975 Seaside sparrow displays: their function in social organization and habitat. Auk 92, 461–492. 27. Payne, R. B. 1980 Behavior and songs of hybrid parasitic finches. Auk 97, 118– 134. 28. Den Hartog, P. M., de Kort, S. R. & ten Cate, C. 2007 Hybrid vocalizations are effective within, but not outside, an avian hybrid zone. Behav. Ecol. 18, 608–614. 29. Krosby, M. & Rohwer, S. 2010 Ongoing movement of the hermit warbler X Townsend’s warbler hybrid zone. PLoS One 5, e14164. (doi:10.1371/journal.pone.0014164) 30. Secondi, J., Bordas, P., Hipsley, C. A. & Bensch, S. 2011 Bilateral song convergence in a passerine hybrid zone: genetics contribute in one species only. Evol. Biol. 38, 441–452. (doi:10.1007/s11692-011-9133-8) 31. Vallin, N., Rice, A. M., Arntsen, H., Kulma, K. & Qvarnström, A. 2012 Combined effects of interspecific competition and hybridization impede local coexistence of Ficedula flycatchers. Evol. Ecol. 26, 927–942. (doi:10.1007/s10682-011-9536-0) 32. Leisler, B. 1988 Interspecific interactions among European march-nesting passerines. In Acta XIX Congressus Internationalis Ornithologici, Vol. 2, pp. 2635–2667. Ottawa: University of Ottawa Press. 33. Hoi, H., Eichler, T. & Dittami, J. 1991 Territorial spacing and interspecific competition in three species of reed warblers. Oecologia 87, 443–448. (doi:10.1007/BF00634604) 34. Catchpole, C. & Leisler, B. 1986 Interspecific territorialism in reed warblers - a local effect revealed by playback experiments. Anim. Behav. 34, 299–300. 35. Sorjonen, J. 1986 Mixed singing and interspecific territoriality - consequences of secondary contact of 2 ecologically and morphologically similar nightingale species in Europe. Ornis Scand. 17, 53–67. 36. Benson, J. F. & Patterson, B. R. 2013 Inter-specific territoriality in a Canis hybrid zone: spatial segregation between wolves, coyotes, and hybrids. Oecologia 173, 1539–1550. (doi:10.1007/s00442-013-2730-8) 37. Suwanvecho, U. & Brockelman, W. Y. 2012 Interspecific territoriality in gibbons (Hylobates lar and H. pileatus) and its effects on the dynamics of interspecies contact zones. Primates. 53, 97–108. (doi:10.1007/s10329-011-0284-0) 38. Anderson, C. N. & Grether, G. F. 2010 Interspecific aggression and character displacement of competitor recognition in Hetaerina damselflies. Proc. R. Soc. B 277, 549–555. (doi:10.1098/rspb.2009.1371) 39. Anderson, C. N. & Grether, G. F. 2011 Multiple routes to reduced interspecific territorial fighting in Hetaerina damselflies. Behav. Ecol. 22, 527–534. (doi:10.1093/beheco/arr013) 40. Martins, E. & Garland, T. 1991 Phylogenetic analyses of the correlated evolution of continuous characters: A simulation study. Evolution 45, 534–557. 41. Garland, T., Dickerman, A., Jones, C. M. & Jones, J. A. 1993 Phylogenetic analysis of covariance by computer simulation. Syst. Biol. 42, 265–292. 42. Lapointe, F., Garland, T. & Jr 2001 A generalized permutation model for the analysis of cross-species data. J. Classif. 18, 109–127. (doi:10.1007/s00357-001- 0007-0) 43. Revell, L. J. 2012 phytools: An R package for phylogenetic comparative biology (and other things). Methods Ecol. Evol. 3, 217–223. 44. Harmon, L. J., Weir, J. T., Brock, C. D., Glor, R. E. & Challenger, W. 2008 GEIGER: investigating evolutionary radiations. Bioinformatics 24, 129–131. 45. Harmon, L. J. & Glor, R. E. 2010 Poor statistical performance of the Mantel test in phylogenetic comparative analyses. Evolution 64, 2173–8. (doi:10.1111/j.1558- 5646.2010.00973.x) 46. Guillot, G. & Rousset, F. 2013 Dismantling the Mantel tests. Methods Ecol. Evol. 4, 336–344. 47. Garrison, R. W. 1990 A synopsis of the genus Hetaerina with descriptions of four new species (Odonata: Calopterygidae). Trans. Am. Entomol. Soc. 116, 175–259. 48. Zloty, J., Pritchard, G. & Esquivel, C. 1993 Larvae of the Costa Rican Hetaerina (Odonata: Calopterygidae) with comments on distribution. Syst. Entomol. 18, 253– 265. 49. Edgar, R. C. 2004 MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797. 50. Vaidya, G., Lohman, D. J. & Meier, R. 2011 SequenceMatrix: concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 27, 171–180. 51. Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. 1990 Basic local alignment search tool. J. Mol. Biol. 215, 403–410. 52. Lanfear, R., Calcott, B., Kainer, D., Mayer, C. & Stamatakis, A. 2014 Selecting optimal partitioning schemes for phylogenomic datasets. BMC Evol. Biol. 14, 82. 53. Ronquist, F. & Huelsenbeck, J. P. 2003 MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. 54. Rambaut, A. & Drummond, A. J. 2013 Tracer 1.6.0 MCMC trace analysis tool. 55. Rambaut, A. & Drummond, A. J. 2012 TreeAnnotator v. 1.7.4 MCMC Output analysis. 56. Miller, M. A., Pfeiffer, W. & Schwartz, T. 2010 Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In Gateway Computing Environments Workshop (GCE), 2010, pp. 1–8. 57. Paradis, E., Claude, J. & Strimmer, K. 2004 APE: analyses of phylogenetics and evolution in R language. Bioinformatics 20, 289–290. 58. Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. 1994 DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3, 294–299. 59. Fleck, G., Ullrich, B., Brenk, M., Wallnisch, C., Orland, M., Bleidissel, S. & Misof, B. 2008 A phylogeny of anisopterous dragonflies (Insecta, Odonata) using mtRNA genes and mixed nucleotide/doublet models. J. Zool. Syst. Evol. Res. 46, 310–322. (doi:10.1111/j.1439-0469.2008.00474.x) 60. Rach, J., Desalle, R., Sarkar, I. N., Schierwater, B. & Hadrys, H. 2008 Character- based DNA barcoding allows discrimination of genera, species and populations in Odonata. Proc. R. Soc. B Biol. Sci. 275, 237–247. (doi:10.1098/rspb.2007.1290) 61. Monteiro, A. & Pierce, N. E. 2001 Phylogeny of Bicyclus (Lepidoptera : Nymphalidae) inferred from COI, COII, and EF-1alpha gene sequences. Mol. Phylogenet. Evol. 18, 264–281. (doi:10.1006/mpev.2000.0872) 62. Terry, M. D. & Whiting, M. F. 2005 Mantophasmatodea and phylogeny of the lower neopterous insects. Cladistics 21, 240–257. 63. Mugleston, J. D., Song, H. & Whiting, M. F. 2013 A century of paraphyly: A molecular phylogeny of katydids (Orthoptera: Tettigoniidae) supports multiple origins of leaf-like wings. Mol. Phylogenet. Evol. 69, 1120–1134. (doi:10.1016/j.ympev.2013.07.014) 64. Dumont, H. J., Vanfleteren, J. R., De Jonckheere, J. F. & Weekers, P. H. H. 2005 Phylogenetic relationships, divergence time estimation, and global biogeographic patterns of calopterygoid damselflies (Odonata, Zygoptera) inferred from ribosomal DNA sequences. Syst. Biol. 54, 347–362.