DOCSLIB.ORG

Regulation of Leukocyte Integrin Binding to Ig-Family Ligands

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Regulation of Leukocyte Integrin Binding to Ig-Family Ligands Recent Publications in this Series LIISA UOTILA Regulation of Leukocyte Integrin Binding to Ig-Family Ligands 17/2014 Anita Wasik Molecular Mechanisms Regulating Glucose Uptake into Podocytes: Role of Ezrin, Septin 7 and Nonmuscle Myosin IIA 18/2014 Karita Peltonen Small Molecule Modulators of Tumor Suppressor p53 and RNA Polymerase I Activity: Identifi cation, Anticancer Activity and Mechanism of Action DISSERTATIONES SCHOLAE DOCTORALIS AD SANITATEM INVESTIGANDAM 19/2014 Aino Sesilja Aranko UNIVERSITATIS HELSINKIENSIS 37/2014 Intermolecular Protein Splicing and Its Use in Biotechnological Applications 20/2014 Rahul Raj Prognostic Models in Traumatic Brain Injury 21/2014 Mikko Nieminen Candida Yeasts and Carcinogenic Acetaldehyde in Upper Digestive Tract Carcinogenesis 22/2014 Janne Hakanen LIISA UOTILA Molecular Regulation of Forebrain Development and Neural Stem/Progenitor Cells 23/2014 Kari-Pekka Skarp Dynamics of Nuclear Actin Regulation of Leukocyte Integrin Binding to 24/2014 Linda Ahonen Method Development for the Analysis of Steroids, Vitamin D and Oxysterols Ig-Family Ligands 25/2014 Jenni Liljavirta Bovine B Cells: Antibody Repertoire Diversifi cation in Fetal Cattle 26/2014 Denis Đermadi Bebek Biochemical Effects of Inherited MMR Gene Mutations and Diet on Colon Cancer Risk 27/2014 Helka Sahi Subgroups of Merkel Cell Carcinoma Patients Defi ned by Young Age, Immunodefi ciency and Polyomavirus Infection 28/2014 Heidi Sillanpää Novel Immunological Markers of Lyme Borreliosis 29/2014 Tuomas Herva Animal Welfare and Economics in Beef Production 30/2014 Sofi a Ahola Diagnosis and Therapy for Mitochondrial Diseases 31/2014 Johanna Mattsson Antiangiogenic and Proteolytic Activities of Prostate-Specifi c Antigen 32/2014 Olli Pietiläinen Rare Genomic Deletions Underlying Schizophrenia and Related Neurodevelopmental Disorders 33/2014 Salla Jaakkola Evolution in Salt: Genomic and Structural Approaches to Halophilic archaea and Their Viruses 34/2014 Kati Ahlqvist The Effects of Mitochondrial DNA Mutagenesis on Somatic Stem Cells and Ageing 35/2014 Liisa Lilja-Maula Canine Idiopathic Pulmonary Fibrosis in West Highland White Terriers: DIVISION OF BIOCHEMISTRY AND BIOTECHNOLOGY Natural History of the Disease and TGF-β Related Molecular Pathways DEPARTMENT OF BIOSCIENCES Involved 36/2014 Saija Ahonen FACULTY OF BIOLOGICAL AND ENVIRONMENTAL SCIENCES Canine Models of Human Vision Disorders: Identifi cation of New Loci DOCTORAL PROGRAMME IN INTEGRATIVE LIFE SCIENCE and Genes for Glaucoma and Retinal Degeneration UNIVERSITY OF HELSINKI 37/2014 Helsinki 2014 ISSN 2342-3161 ISBN 978-951-51-0338-3 ccover.inddover.indd 1 222.10.20142.10.2014 77:29:55:29:55 RegulaƟ on of leukocyte integrin binding to Ig-family ligands Liisa UoƟ la Division of Biochemistry and Biotechnology Department of Biosciences Faculty of Biological and Environmental Sciences and Integrative Life Sciences Doctoral Program University of Helsinki ACADEMIC DISSERTATION To be presented for public examination with the permission of the Faculty of Biological and Environmental Sciences of the University of Helsinki in the lecture hall B2 of Viikki B-building (VI B LS 2), Latokartanonkaari 7, on 21st November at 12 noon. Helsinki 2014 Supervisor Carl Gahmberg, professor Division of Biochemistry and Biotechnology Department of Biosciences Faculty of Biological and Environmental Sciences University of Helsinki Reviewers Jorma Keski-Oja, professor Translational Cancer Biology Research Program Haartman Institute University of Helsinki Manuel Patarroyo, professor Department of Dental Medicine Karolinska Institutet Stockholm, Sweden Opponent Francisco Sánchez-Madrid, professor Servicio de Inmunología, Hospital de la Princesa Instituto de Investigación Sanitaria de la Princesa Universidad Autónoma de Madrid Madrid, Spain Custos Jukka Finne, professor Division of Biochemistry and Biotechnology Department of Biosciences Faculty of Biological and Environmental Sciences University of Helsinki Dissertationes Scholae Doctoralis Ad Sanitatem Investigandam Universitatis Helsinkiensis ISBN 978-951-51-0338-3 (paperback) ISSN 2342-3161 (print) ISBN 978-951-51-0339-0 (PDF) ISSN2342-317X (Online) http://ethesis.helsinki.fi Layout: Tinde Päivärinta/PSWFolders Oy Hansaprint Oy, Vantaa, Finland 2014 Le plus grand bonheur de l’étude consiste à trouver les raisons soi-même. René Descartes Table of contents Original publications Abbreviations Summary REVIEW OF THE LITERATURE .......................................................................................................1 1 Introduction to blood cell adhesion .............................................................................................1 1.1 Interactions of erythrocytes with other cells and ECM .......................................................1 1.1.1 Erythropoiesis ...............................................................................................................1 1.1.2 Erythrophagocytosis, removal of senescent red cells ..............................................3 1.1.3 Pathological conditions of red blood cell adhesion .................................................3 1.2 Leukocyte adhesion ..................................................................................................................4 1.2.1 Th e immunological synapse ........................................................................................4 1.2.2 Extravasation .................................................................................................................6 1.2.3 Phagocytosis ..................................................................................................................7 1.2.4 Pathological conditions involving leukocyte adhesion ...........................................8 1.3 Haemostasis and thrombosis ..................................................................................................9 2 Th e Ig-superfamily ...........................................................................................................................9 2.1 ICAM family members are important in leukocyte adhesion ............................................9 2.2 ICAM-4 ....................................................................................................................................11 2.2.1 Th e LW blood group antigen is ICAM-4 (CD242) ................................................11 2.2.2 ICAM-4 contains two Ig domains ............................................................................12 2.2.3 Ligands and functions of ICAM-4 ...........................................................................13 2.3 VCAM-1 ..................................................................................................................................15 3 Leukocyte integrins .......................................................................................................................15 3.1 Introduction ..........................................................................................................................15 3.2 Integrin structure and conformational changes .................................................................16 3.3 LFA-1 (αLβ2, CD11a/CD18) .................................................................................................19 3.4 Mac-1 (αMβ2, CD11b/CD18, CR3) .....................................................................................19 3.5 αDβ2 .......................................................................................................................................20 3.6 VLA-4 (α4β1, CD49d/CD29) ...............................................................................................20 3.7 Th e β7 integrins αEβ7 and α4β7 ...........................................................................................21 3.8 CR4 (αXβ2, CD11c/CD18, p150.95) ....................................................................................21 3.8.1 Structure ......................................................................................................................21 3.8.2 Ligands and functions of CR4 ..................................................................................22 4 Regulation of integrin activity ....................................................................................................25 4.1 Affi nity/avidity ........................................................................................................................25 4.2 Inside-out activation of integrins .........................................................................................26 4.3 Outside-in signalling initiated by integrin ligand binding ...............................................29 4.4 Phosphorylation .....................................................................................................................33 4.4.1 β2 integrins ..................................................................................................................33 4.4.2 VLA-4 ...........................................................................................................................34 4.5 Transdominant regulation of integrins ................................................................................35 4.5.1 Leukocyte integrins ....................................................................................................35 4.5.2 Other integrins in cross talk .....................................................................................36 SUMMARY OF THE STUDY
Load more

Recommended publications
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • Role of C5ar1 and C5L2 Receptors in Ischemia-Reperfusion Injury
    Journal of Clinical Medicine Article Role of C5aR1 and C5L2 Receptors in Ischemia-Reperfusion Injury Carlos Arias-Cabrales 1,* , Eva Rodriguez-Garcia 1, Javier Gimeno 2, David Benito 3, María José Pérez-Sáez 1, Dolores Redondo-Pachón 1, Anna Buxeda 1, Carla Burballa 1, Marta Crespo 1, Marta Riera 3,* and Julio Pascual 1,* 1 Department of Nephrology, Parc de Salut Mar, 08003 Barcelona, Spain; [email protected] (E.R.-G.); [email protected] (M.J.P.-S.); [email protected] (D.R.-P.); [email protected] (A.B.); [email protected] (C.B.); [email protected] (M.C.) 2 Department of Pathology, Parc de Salut Mar, 08003 Barcelona, Spain; [email protected] 3 Kidney Research Group, Hospital del Mar Medical Research Institute, IMIM, 08003 Barcelona, Spain; [email protected] * Correspondence: [email protected] (C.A.-C.); [email protected] (M.R.); [email protected] (J.P.) Abstract: The role of C5a receptors (C5aR1 and C5L2) in renal ischemia-reperfusion injury (IRI) is uncertain. We generated an in vitro model of hypoxia/reoxygenation with human proximal tubule epithelial cells to mimic some IRI events. C5aR1, membrane attack complex (MAC) and factor H (FH) deposits were evaluated with immunofluorescence. Quantitative polymerase chain reaction evaluated the expression of C5aR1, C5L2 genes as well as genes related to tubular injury, inflammation, and profibrotic pathways. Additionally, C5aR1 and C5L2 deposits were evaluated in kidney graft biopsies (KB) from transplant patients with delayed graft function (DGF, n = 12) and compared with Citation: Arias-Cabrales, C.; a control group (n = 8). We observed higher immunofluorescence expression of C5aR1, MAC and FH Rodriguez-Garcia, E.; Gimeno, J.; as higher expression of genes related to tubular injury, inflammatory and profibrotic pathways and Benito, D.; Pérez-Sáez, M.J.; of C5aR1 in the hypoxic cells; whereas, C5L2 gene expression was unaffected by the hypoxic stimulus.
    [Show full text]
  • The Membrane Complement Regulatory Protein CD59 and Its Association with Rheumatoid Arthritis and Systemic Lupus Erythematosus
    Current Medicine Research and Practice 9 (2019) 182e188 Contents lists available at ScienceDirect Current Medicine Research and Practice journal homepage: www.elsevier.com/locate/cmrp Review Article The membrane complement regulatory protein CD59 and its association with rheumatoid arthritis and systemic lupus erythematosus * Nibhriti Das a, Devyani Anand a, Bintili Biswas b, Deepa Kumari c, Monika Gandhi c, a Department of Biochemistry, All India Institute of Medical Sciences, New Delhi 110029, India b Department of Zoology, Ramjas College, University of Delhi, India c University School of Biotechnology, Guru Gobind Singh Indraprastha University, India article info abstract Article history: The complement cascade consisting of about 50 soluble and cell surface proteins is activated in auto- Received 8 May 2019 immune inflammatory disorders. This contributes to the pathological manifestations in these diseases. In Accepted 30 July 2019 normal health, the soluble and membrane complement regulatory proteins protect the host against Available online 5 August 2019 complement-mediated self-tissue injury by controlling the extent of complement activation within the desired limits for the host's benefit. CD59 is a membrane complement regulatory protein that inhibits the Keywords: formation of the terminal complement complex or membrane attack complex (C5b6789n) which is CD59 generated on complement activation by any of the three pathways, namely, the classical, alternative, and RA SLE the mannose-binding lectin pathway. Animal experiments and human studies have suggested impor- Pathophysiology tance of membrane complement proteins including CD59 in the pathophysiology of rheumatoid arthritis Disease marker (RA) and systemic lupus erythematosus (SLE). Here is a brief review on CD59 and its distribution, structure, functions, and association with RA and SLE starting with a brief introduction on the com- plement system, its activation, the biological functions, and relations of membrane complement regu- latory proteins, especially CD59, with RA and SLE.
    [Show full text]
  • C3did PNAS Pure
    Structure of the CR3 I domain in complex with C3d Structural insight on the recognition of surface-bound opsonins by the integrin I domain of complement receptor 3 Goran Bajic1, Laure Yatime1, Robert B. Sim2, Thomas Vorup-Jensen3†, and Gregers R. Andersen1,† 1Dept. of Molecular Biology and Genetics, Aarhus University, Gustav Wieds Vej 10C, DK- 8000 Aarhus, Denmark 2Dept. of Pharmacology, University of Oxford, Mansfield Road, Oxford OX1 3QT, United Kingdom 3Dept. of Biomedicine, Aarhus University, Wilhelm Meyers Allé 4, DK-8000 Aarhus, Denmark †Contact: Dr. Thomas Vorup-Jensen, Biophysical Immunology Laboratory, Dept. of Biomedicine, Aarhus University, Wilhelm Meyers Allé 4, DK-8000 Aarhus, Denmark. Tel: +45 87167853; E-mail: [email protected] Dr. Gregers R. Andersen, Dept. of Molecular Biology and Genetics , Aarhus University, Gustav Wieds Vej 10C, DK-8000 Aarhus, Denmark. Tel: +45 87 15 55 07; E-mail: [email protected] 1 Structure of the CR3 I domain in complex with C3d Complement receptors (CR), expressed notably on myeloid and lymphoid cells, play an essential function in the elimination of complement-opsonized pathogens and apoptotic/necrotic cells. In addition, these receptors are crucial for the cross-talk between the innate and adaptive branches of the immune system. CR3 (also known as Mac-1, integrin M2, or CD11b/CD18) is expressed on all macrophages and recognizes iC3b on complement-opsonized objects, enabling their phagocytosis. We demonstrate that the C3d moiety of iC3b harbours the binding site for the CR3 I domain, and our structure of the C3d:I domain complex rationalizes the CR3 selectivity for iC3b.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • Paxillin Binding to the Cytoplasmic Domain of CD103 Promotes Cell Adhesion and Effector
    Author Manuscript Published OnlineFirst on October 11, 2017; DOI: 10.1158/0008-5472.CAN-17-1487 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Paxillin binding to the cytoplasmic domain of CD103 promotes cell adhesion and effector functions for CD8+ resident memory T cells in tumors Ludiane Gauthier1, Stéphanie Corgnac1, Marie Boutet1, Gwendoline Gros1, Pierre Validire2, Georges Bismuth3 and Fathia Mami-Chouaib1 1 INSERM UMR 1186, Integrative Tumor Immunology and Genetic Oncology, Gustave Roussy, EPHE, Fac. de médecine - Univ. Paris-Sud, Université Paris-Saclay, 94805, Villejuif, France 2 Institut Mutualiste Montsouris, Service d’Anatomie pathologique, 75014 Paris, France. 3 INSERM U1016, CNRS UMR8104, Université Paris Descartes, Institut Cochin, 75014 Paris. S Corgnac, M Boutet and G Gros contributed equally to this work. M Boutet current address: Department of Microbiology and Immunology Albert Einstein College of Medecine, NY 10461 USA. Corresponding author: Fathia Mami-Chouaib, INSERM UMR 1186, Gustave Roussy. 39, rue Camille Desmoulins, F-94805 Villejuif. Phone: +33 1 42 11 49 65, Fax: +33 1 42 11 52 88, e-mail: [email protected] and [email protected] Running title: CD103 signaling in human TRM cells Key words: TRM cells, CD103 integrin, T-cell function and signaling, paxillin. Abbreviations: IS: immune synapse; LFA: leukocyte function-associated antigen; FI: fluorescence intensity; mAb: monoclonal antibody; phospho: phosphorylated; Pyk2: proline- rich tyrosine kinase-2; NSCLC: non-small-cell lung carcinoma; r: recombinant; sh-pxn: shorthairpin RNA-paxillin; TCR: T-cell receptor; TIL: tumor-infiltrating lymphocyte; TRM: tissue-resident memory T.
    [Show full text]
  • An Anticomplement Agent That Homes to the Damaged Brain and Promotes Recovery After Traumatic Brain Injury in Mice
    An anticomplement agent that homes to the damaged brain and promotes recovery after traumatic brain injury in mice Marieta M. Rusevaa,1,2, Valeria Ramagliab,1, B. Paul Morgana, and Claire L. Harrisa,3 aInstitute of Infection and Immunity, School of Medicine, Cardiff University, Cardiff CF14 4XN, United Kingdom; and bDepartment of Genome Analysis, Academic Medical Center, Amsterdam 1105 AZ, The Netherlands Edited by Douglas T. Fearon, Cornell University, Cambridge, United Kingdom, and approved September 29, 2015 (received for review July 15, 2015) Activation of complement is a key determinant of neuropathology to rapidly and specifically inhibit MAC at sites of complement and disability after traumatic brain injury (TBI), and inhibition is activation, and test its therapeutic potential in experimental TBI. neuroprotective. However, systemic complement is essential to The construct, termed CD59-2a-CRIg, comprises CD59a linked fight infections, a critical complication of TBI. We describe a to CRIg via the murine IgG2a hinge. CD59a prevents assembly targeted complement inhibitor, comprising complement receptor of MAC in cell membranes (16), whereas CRIg binds C3b/iC3b of the Ig superfamily (CRIg) fused with complement regulator CD59a, deposited at sites of complement activation (17). The IgG2a designed to inhibit membrane attack complex (MAC) assembly at hinge promotes dimerization to increase ligand avidity. CD59- sites of C3b/iC3b deposition. CRIg and CD59a were linked via the 2a-CRIg protected in the TBI model, demonstrating that site- IgG2a hinge, yielding CD59-2a-CRIg dimer with increased iC3b/C3b targeted anti-MAC therapeutics may be effective in prevention binding avidity and MAC inhibitory activity. CD59-2a-CRIg inhibited of secondary neuropathology and improve neurologic recovery MAC formation and prevented complement-mediated lysis in vitro.
    [Show full text]
  • Human Integrin Alpha L Gene Cdna Clone Plasmid
    Human Integrin alpha L Gene cDNA clone plasmid Catalog Number: HG10812-M General Information Plasmid Resuspension protocol Gene : integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; 1.Centrifuge at 5,000×g for 5 min. alpha polypeptide) 2.Carefully open the tube and add 100 l of sterile water to dissolve the DNA. Official Symbol : ITGAL 3.Close the tube and incubate for 10 minutes at room temperature. 4.Briefly vortex the tube and then do a quick spin to concentrate Synonym : CD11A, LFA-1, LFA1A, ITGAL the liquid at the bottom. Speed is less than 5000×g. 5.Store the plasmid at -20 ℃. Source : Human The plasmid is ready for: cDNA Size: 3513bp • Restriction enzyme digestion • PCR amplification RefSeq : NM_002209.2 • E. coli transformation • DNA sequencing Plasmid: pMD-ITGAL E.coli strains for transformation (recommended Description but not limited) Lot : Please refer to the label on the tube Most commercially available competent cells are appropriate for Sequence Description : the plasmid, e.g. TOP10, DH5α and TOP10F´. Identical with the Gene Bank Ref. ID sequence except for the point mutation 2928 A/G not causing the amino acid variation. Vector : pMD18-T Simple Shipping carrier : Each tube contains approximately 10 μg of lyophilized plasmid. Storage : The lyophilized plasmid can be stored at ambient temperature for three months. Quality control : The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. Sequencing primer list : M13-47 ： 5’ GCCAGGGTTTTCCCAGTCACGAC 3’ RV-M ： 5’ GAGCGGATAACAATTTCACACAGG 3’ Other M13 primers can also be used as sequencing primers.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Characterization of Kindlin3 in Integrin Functions
    This document is downloaded from DR‑NTU (https://dr.ntu.edu.sg) Nanyang Technological University, Singapore. Characterization of kindlin3 in Integrin functions Feng, Chen 2013 Feng, C. (2013). Characterization of kindlin3 in Integrin functions. Doctoral thesis, Nanyang Technological University, Singapore. https://hdl.handle.net/10356/54828 https://doi.org/10.32657/10356/54828 Downloaded on 27 Sep 2021 23:43:18 SGT Characterization of kindlin3 in Integrin functions Feng Chen School of Biological Sciences 2013 Characterization of kindlin3 in Integrin functions Feng Chen School of Biological Sciences A thesis submitted to the Nanyang Technological University in partial fulfillment of the requirement for the degree of Doctor of Philosophy 2013 Acknowledgements First, I would like to thank my supervisor Dr. Tan Suet Mien, for his guidance during the course of my studies. He gave me many helpful suggestions for my project and has been supportive of me for trying out new ideas. I’m grateful to Dr. Yau Yin Hoe and Assoc Prof. Shochat for helping me with the SPR analyses. I wish to thank my lab mates Man Li, Yan Feng, Zhi Hong, Xiao Yan, Rhoda, Henni, Sze Wah, Manisha, Joel, Li Teng, and Jessie for their helpful suggestions and assistance. Special thanks to Dr. Tang Man Li for her guidance at the beginning of my study and Tang Xiao Yan and Ong Li Teng for the support they gave me when I encounter problems in my studies. Finally, I am indebted to my parents, husband, and friends. They provided me selfless help and encouragement during the course of my Ph.D.
    [Show full text]
  • APC Anti-Human Cd11b (ICRF44) Catalog Number: 20-0118
    TECHNICAL DATA SHEET APC Anti-Human CD11b (ICRF44) Catalog Number: 20-0118 PRODUCT INFORMATION Count Contents: APC Anti-Human CD11b (ICRF44) Isotype: Mouse IgG1, kappa 0 0 1 2 3 4 10 10 10 10 10 Human CD11b (ICRF44) APC Concentration: 5 uL (1 ug)/test Clone: ICRF44 Human peripheral blood monocytes were stained with 5 uL (1 ug) APC Anti-Human CD11b (20-0118) (solid line) or 1 ug APC Mouse Reactivity: Human IgG1 isotype control (dashed line). Formulation: 10 mM NaH2PO4, 150 mM NaCl, 0.09% NaN3, 0.1% gelatin, pH7.2 DESCRIPTION The ICRF44 antibody reacts with human CD11b, also known as integrin alpha M. This 165-170 kDa cell surface glycoprotein is part of a family of integrin receptors that mediate adhesion between cells (cell-cell) and components of the extracellular matrix, e.g. fibrinogen (cell-matrix). In addition, integrins are active signaling receptors which recruit leukocytes to inflammatory sites and promote cell activa- tion. Complete, functional integrin receptors consist of distinct combinations of integrin chains which are differentially expressed. Integrin alpha M (CD11b) assembles with Integrin beta-2 (CD18) into a receptor known as Macrophage Antigen-1 (Mac-1) or complement receptor type 3 (CR3). This receptor binds and induces intracellular signaling through ICAM-1, ICAM-2, ICAM-3 and ICAM-4 on endothelial cells and can also facilitate removal of iC3b bearing foreign cells.The ICRF44 antibody is widely used as a marker for CD11b expression on macrophages, granulocytes, and subsets of NK cells. It is reported to be cross-reactive with a number of non-human species including Baboon, Chimpanzee, Cynomolgus, Rhesus and Swine.
    [Show full text]
  • CD Markers Are Routinely Used for the Immunophenotyping of Cells
    ptglab.com 1 CD MARKER ANTIBODIES www.ptglab.com Introduction The cluster of differentiation (abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules. So-called CD markers are routinely used for the immunophenotyping of cells. Despite this use, they are not limited to roles in the immune system and perform a variety of roles in cell differentiation, adhesion, migration, blood clotting, gamete fertilization, amino acid transport and apoptosis, among many others. As such, Proteintech’s mini catalog featuring its antibodies targeting CD markers is applicable to a wide range of research disciplines. PRODUCT FOCUS PECAM1 Platelet endothelial cell adhesion of blood vessels – making up a large portion molecule-1 (PECAM1), also known as cluster of its intracellular junctions. PECAM-1 is also CD Number of differentiation 31 (CD31), is a member of present on the surface of hematopoietic the immunoglobulin gene superfamily of cell cells and immune cells including platelets, CD31 adhesion molecules. It is highly expressed monocytes, neutrophils, natural killer cells, on the surface of the endothelium – the thin megakaryocytes and some types of T-cell. Catalog Number layer of endothelial cells lining the interior 11256-1-AP Type Rabbit Polyclonal Applications ELISA, FC, IF, IHC, IP, WB 16 Publications Immunohistochemical of paraffin-embedded Figure 1: Immunofluorescence staining human hepatocirrhosis using PECAM1, CD31 of PECAM1 (11256-1-AP), Alexa 488 goat antibody (11265-1-AP) at a dilution of 1:50 anti-rabbit (green), and smooth muscle KD/KO Validated (40x objective). alpha-actin (red), courtesy of Nicola Smart. PECAM1: Customer Testimonial Nicola Smart, a cardiovascular researcher “As you can see [the immunostaining] is and a group leader at the University of extremely clean and specific [and] displays Oxford, has said of the PECAM1 antibody strong intercellular junction expression, (11265-1-AP) that it “worked beautifully as expected for a cell adhesion molecule.” on every occasion I’ve tried it.” Proteintech thanks Dr.
    [Show full text]