DOCSLIB.ORG

Prediction and Prognostic Significance of BCAR3 Expression in Patients

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Prediction and Prognostic Significance of BCAR3 Expression in Patients Zhang et al. J Transl Med (2018) 16:363 https://doi.org/10.1186/s12967-018-1728-8 Journal of Translational Medicine RESEARCH Open Access Prediction and prognostic signifcance of BCAR3 expression in patients with multiple myeloma Weilong Zhang1†, Yuansheng Lin2†, Xiaoni Liu3†, Xue He4, Ye Zhang5, Wei Fu6, Zuozhen Yang1, Ping Yang1, Jing Wang1, Kai Hu1, Xiuru Zhang4, Weiyou Liu3*, Xiaoliang Yuan3* and Hongmei Jing1* Abstract Background: Multiple myeloma (MM) is the plasma cell tumor, which is characterized by clonal proliferation of tumor cells, with high risk of progression to renal impairment, bone damage and amyloidosis. Although the survival rate of patients with MM has improved in the past decade, most people inevitably relapse. The treatment and progno- sis of MM are still urgent problems. Breast Cancer Antiestrogen Resistance 3 (BCAR3) is a protein-coding gene that is associated with many tumors. However, there have been few studies on the relationship of BCAR3 and MM. Methods: We analyzed 1878 MM patients (1930 samples) from 7 independent datasets. First, we compared the BCAR3 expression level of MM patients in diferent stages and MM patients with diferent amplifcation of 1q21. Sec- ond, we analyzed BCAR3 expression levels in MM patients with diferent molecular subtypes. Finally, we explored the event-free survival rate (EFS) and overall survival rate (OS) of MM patients with high or low BCAR3 expression, includ- ing patients before and after relapse, and their therapeutic responses to bortezomib and dexamethasone. Results: The expression of BCAR3 showed a decreasing trend in stages I, II and III (P 0.00068). With the increase of 1q21 amplifcation level, the expression of BCAR3 decreased (P 0.022). Patients with= high BCAR3 expression had higher EFS and OS (EFS: P < 0.0001, OS: P < 0.0001). The expression= of BCAR3 gene before relapse was higher than that after relapse (P 0.0045). BCAR3 is an independent factor afecting prognosis (EFS: P 5.17E 03; OS: P 3.33E 04). = = − = − Conclusion: We found that high expression level of BCAR3 predicted better prognosis of MM patients. Low expres- sion of BCAR3 at diagnosis can predict early relapse. BCAR3 is an independent prognostic factor for MM. BCAR3 can be used as a potential biomarker. Keywords: BCAR3, Multiple myeloma, Prognosis, Gene expression profle Background heterogeneous disease with diferent clinical characteris- MM is a B cell diferentiated tumor characterized tics [4]. By recognizing genetic mechanism and mutation, by clonal proliferation of tumor cells [1–3]. MM is a a normal plasma cell transited into the following disease stages: monoclonal gammopathy of undetermined sig- nifcance, smouldering myeloma, myeloma and plasma *Correspondence: [email protected]; [email protected]; [email protected] cell leukaemia [5]. Te International Staging System (ISS) †Weilong Zhang, Yuansheng Lin and Xiaoni Liu contributed equally to uses the staging criteria to divide MM into three phases, this work combining serum albumin levels with β2-microglobulin 1 Department of Hematology, Lymphoma Research Center, Peking University Third Hospital, No. 49 North Garden Road, Haidian District, to determine the prognosis of MM patients [6]. Revised Beijing 100191, People’s Republic of China International Staging System (R-ISS) is a simple and 3 Department of Respiratory Medicine, The First Afliated Hospital efective prognostic staging system that combines of Gannan Medical University, No. 23 Qingnian Road, Zhanggong District, Ganzhou 341000, People’s Republic of China three prognostic tools (ISS: International Staging Sys- Full list of author information is available at the end of the article tem, CA: chromosomal abnormalities, LDH: lactate © The Author(s) 2018. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creat​iveco​mmons​.org/licen​ses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creat​iveco​mmons​.org/ publi​cdoma​in/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Zhang et al. J Transl Med (2018) 16:363 Page 2 of 9 dehydrogenase) to better assess patient prognosis [7]. criteria for patient selection in our research were stated. Gene expression profling (GEP) is important for reveal- 1) All MM patients with the published high throughput ing MM molecular heterogeneity of diferent patients. gene expression data. 2) All the patients should have Te molecular classifcation established by UAMS (Te some information such as clinical features, biochemical University of Arkansas for Medical Sciences) based on examination, karyotype, therapy or therapy response. GEP data [8]. Te molecular basis of MM is defned by Te study was approved by the Human Research Eth- unsupervised clustering analysis of mRNA expression ics Committee of Peking University third hospital. Te profles, which are divided into seven molecular subtypes research was conducted in accordance International [9]. Recurrence is a major problem in most MM patients. Conference on and the Declaration of Helsinki. Among all MM patients, early recurrence and poor prog- nosis are about 10% to 15% [10]. 1q21 amplifcation is the most common chromosomal Microarray analysis aberration in MM and is considered a high-risk genetic All microarray data were analyzed, and the signif- feature [11]. Te function of the BCAR3 (Breast Cancer cantly abnormal expression genes were systemati- Antiestrogen Resistance 3) gene is varied. BCAR3 can cally screened as predictive biomarkers. Te diferent promote cell migration, proliferation, and BCAR3 was expression of genes between BCAR3-low to BCAR3- identifed as a molecular linkage between PTP and Cas high group were also analyzed and ranked by fold- [12–14]. BCAR3 protein participates in the signaling change values (log2, FC > 0.8 or < − 0.8, P < 0.05). pathway of EGF through its SH2 domain, leading to cell We retrieved GSE24080 (559 samples) from the NCBI cycle progression, and BCAR3 itself belong to a mitogenic GEO database and analyzed the expression of BCAR3 signaling pathway [15, 16]. BCAR3 and p130Cas were among diferent ISS stages, diferent molecular sub- associated with anti-estrogen in breast cancer, Rac activa- types, diferent 1q21 amplifcation levels, and difer- tion. BCAR3 can regulate the Src signal transmission of ent survival (EFS and OS). We retrieved GSE82307 (66 BCAR3-p130 (cas) complex dependence mode [17–19]. samples) from the NCBI GEO database. We analyzed During the initial stage of gonadal development, BCAR3 the expression of BCAR3 before and after recurrence in in gonad development is very important and is expressed the same patient. We retrieved GSE19554 (38 samples) in XY gonads [20]. Studies have shown that the BCAR3 in 19 MM patients from the NCBI GEO database, and gene is the frst spontaneous mutation associated with we analyzed BCAR3 expression between the baseline cataracts caused by lens compression. Tis new cataract (before chemotherapy) and pre-1st (after induction of model could provide further knowledge about the func- chemotherapy, before bone marrow transplantation) in tion of BCAR3 protein [21]. In the study of tamoxifen in the same sample. We retrieved GSE19784 (308 samples) the treatment of metastatic breast cancer, high expres- from the NCBI GEO database and analyzed the expres- sion of BCAR3 is related to good progression-free sur- sion of BCAR3 in diferent molecular subtypes. We vival, and the expression level of BCAR3 in primary breast retrieved GSE83503 (585 samples) from the NCBI GEO tumors is relatively low, which is related to the survival database and analyzed the expression of BCAR3 in the rate of distant metastasis [14]. Ovarian cancer is a dis- recurrence and non-recurrence groups. We retrieved ease characterized by tumor heterogeneity, which is dif- GSE9782 (238 samples) from the NCBI GEO database cult to be diagnosed and treated. Studies have shown that and analyzed the expression of BCAR3 between the inhibiting the expression of BCAR3 gene can inhibit the diferent treatment response of bortezomib and dexa- cell proliferation of ovarian cancer [22]. However, there is methasone. All patients from GSE39754 (136 samples) no study reporting the relationship between BCAR3 and were treated with vincristine, adriamycin, and dexa- MM so far. By integrating data of 1878 MM patients, we methasone (VAD), followed by autologous stem cell found that BCAR3 gene is closely related to MM. transplantation (ASCT). Ten measuring “therapeutic response” after ASCT. Analysis of BCAR3 expression in Methods each treatment response compared to the average of all Data source treatment responses. Terapeutic response: complete In our study, gene expression microarrays of 1878 response (CR), very good partial response (VGPR), par- MM patients (1930 samples) were derived from Gene tial response (PR), no response, stable disease (NR), no Expression Omnibus database, including datasets response, progressive disease (Prog). GSE24080 (559 samples) [23], GSE82307 (66 samples) Gene ontology (GO) analysis [24], GSE19784 (308 samples) [25], GSE83503 (585 samples) [26], GSE9782 (238 samples) [27], GSE39754 Use the DAVID to analyze the 559 samples (dataset (136 samples) and GSE19554 (38 samples) [28, 29]. Te GSE24080), and fnd out the enrichment pathways for Zhang et al. J Transl Med (2018) 16:363 Page 3 of 9 diferent expressed genes between BCAR3-low and Result BCAR3-high group [30]. Te results were ranked by the BCAR3 is expressed in multiple myeloma of diferent molecular types P value (− log10, P < 0.05). We compared BCAR3 gene expression level of diferent 1q21 amplifcation. With the increase of the amplifcation Statistical analyses level of 1q21, the expression level of BCAR3 showed an Statistical analyses were performed by R software v3.1.3 overall downward trend (Fig. 1a, P = 0.022, Kruskal–Wal- (ggplot2 and survminer package). Te log-rank test and lis test).
Load more

Recommended publications
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Effect of Low Doses of Estradiol and Tamoxifen on Breast Cancer Cell Karyotypes
    238 M Rondón-Lagos et al. Breast cancer cell karyotypes, 23:8 635–650 Research E2 and tamoxifen Effect of low doses of estradiol and tamoxifen on breast cancer cell karyotypes Milena Rondón-Lagos1, Nelson Rangel1,2, Ludovica Verdun Di Cantogno3, Laura Annaratone1, Isabella Castellano1, Rosalia Russo1, Tilde Manetta4, Caterina Marchiò1,* and Anna Sapino1,5,* 1Department of Medical Sciences, University of Turin, Turin, Italy Correspondence 2Natural and Mathematical Sciences Faculty, Universidad del Rosario, Bogotá, Colombia should be addressed 3Pathology Division, Azienda Ospedaliera Città della Salute e della Scienza di Torino, Turin, Italy to C Marchiò or A Sapino 4Department of Public Health and Pediatrics, University of Turin, Turin, Italy Email 5Candiolo Cancer Institute, FPO-IRCCS, Candiolo, Italy [email protected] or *(C Marchiò and A Sapino contributed equally to this work) [email protected] Abstract Evidence supports a role of 17β-estradiol (E2) in carcinogenesis and the large majority Key Words of breast carcinomas are dependent on estrogen. The anti-estrogen tamoxifen (TAM) f breast cancer cells is widely used for both treatment and prevention of breast cancer; however, it is also f estradiol carcinogenic in human uterus and rat liver, highlighting the profound complexity of its f tamoxifen actions. The nature of E2- or TAM-induced chromosomal damage has been explored using f chromosomal relatively high concentrations of these agents, and only some numerical aberrations abnormalities Endocrine-Related Cancer Endocrine-Related and chromosomal breaks have been analyzed. This study aimed to determine the effects f chromosomal instability −8 −1 −6 −1 of low doses of E2 and TAM (10 mol L and 10 mol L respectively) on karyotypes of MCF7, T47D, BT474, and SKBR3 breast cancer cells by comparing the results of conventional karyotyping and multi-FISH painting with cell proliferation.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name breast cancer anti-estrogen resistance protein 3 Gene Symbol Bcar3 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.7383 Ensembl Gene ID ENSRNOG00000013737 Entrez Gene ID 310838 Assay Information Unique Assay ID qRnoCIP0035724 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000065111 Amplicon Context Sequence GCAAGGTTGCTAGGATACTGGAAGTCTCTGAAGACATGAAGAGGAGCATGGGC GTGAGCTCGGGACTGGAACTCATTACCTTGCCTCACGGACGCCAGCTGCGCCT GGACATTATTGAAAGACACAACACCATGGCCATTG Amplicon Length (bp) 111 Chromosome Location 2:246024723-246034495 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 103 R2 0.9986 cDNA Cq 21.98 cDNA Tm (Celsius) 85.5 gDNA Cq 37.5 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Bcar3, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • Protein Annotation of Breast-Cancer-Related Proteins with Machine-Learning Tools
    Makara Journal of Science Volume 24 Issue 2 June Article 6 6-26-2020 Protein Annotation of Breast-cancer-related Proteins with Machine-learning Tools Arli Aditya Parikesit Department of Bioinformatics, School of Life Sciences, Indonesia International Institute for Life Sciences, Jakarta 13210, Indonesia, [email protected] David Agustriawan Department of Bioinformatics, School of Life Sciences, Indonesia International Institute for Life Sciences, Jakarta 13210, Indonesia Rizky Nurdiansyah Department of Bioinformatics, School of Life Sciences, Indonesia International Institute for Life Sciences, Jakarta 13210, Indonesia Follow this and additional works at: https://scholarhub.ui.ac.id/science Recommended Citation Parikesit, Arli Aditya; Agustriawan, David; and Nurdiansyah, Rizky (2020) "Protein Annotation of Breast- cancer-related Proteins with Machine-learning Tools," Makara Journal of Science: Vol. 24 : Iss. 2 , Article 6. DOI: 10.7454/mss.v24i1.12106 Available at: https://scholarhub.ui.ac.id/science/vol24/iss2/6 This Article is brought to you for free and open access by the Universitas Indonesia at UI Scholars Hub. It has been accepted for inclusion in Makara Journal of Science by an authorized editor of UI Scholars Hub. Protein Annotation of Breast-cancer-related Proteins with Machine-learning Tools Cover Page Footnote The authors would like to thank the Institute for Research and Community Services of the Indonesia International Institute for Life Sciences (i3l) for their heartfelt support. Thanks also goes to Direktorat Riset dan Pengabdian Masyarakat, Direktorat Jenderal Penguatan Riset dan Pengembangan Kementerian Riset, Teknologi dan Pendidikan Tinggi Republik Indonesia for providing Hibah Penelitian Dasar DIKTI/ LLDIKTI III 2019 No. 1/AKM/PNT/2019.
    [Show full text]
  • Breast Cancer Antiestrogen Resistance-3 (BCAR3) in Mammary Gland Development and Breast Cancer
    Breast Cancer Antiestrogen Resistance-3 (BCAR3) in mammary gland development and breast cancer Allison Margarethe Cross Royersford, PA B.S. Lycoming College 2010 A Dissertation presented to the Graduate Faculty of the University of Virginia in Candidacy for the Degree of Doctor of Philosophy Department of Microbiology, Immunology, and Cancer University of Virginia May, 2016 i Abstract Despite increased early detection and improved treatment options, breast cancer remains the second leading cause of cancer deaths among women. The majority of breast cancer mortalities are the consequence of therapeutic-resistant metastatic disease. A better understanding of the genetic alterations and signaling pathways involved in breast cancer progression and therapeutic resistance is required to identify new and better therapeutic targets to combat this disease. Breast Cancer Antiestrogen-3 (BCAR3) has been identified as an adaptor molecule that is upregulated in aggressive breast cancer cell lines, where it contributes to increased proliferation, migration, and invasion. The work presented in this thesis focuses on understanding BCAR3 signaling in breast cancer progression as well as mammary gland morphogenesis. The data presented demonstrate that BCAR3 controls adhesion turnover, migration, and invasion through interactions with the adaptor molecule p130Cas (Cas). In addition, BCAR3 was found to be upregulated and differentially expressed during tumor progression in the MMTV-polyoma middle T (PyMT) mouse model of spontaneous breast cancer. Preliminary xenograft studies in mice reveal that BCAR3 expression accelerates tumor formation and controls total tumor burden in MDA-MB-231 breast tumors. Future studies are needed to determine if BCAR3 can regulate the growth of established tumors and promote metastasis, and if interactions with Cas are required for its functions in vivo.
    [Show full text]
  • Downregulation of Carnitine Acyl-Carnitine Translocase by Mirnas
    Page 1 of 288 Diabetes 1 Downregulation of Carnitine acyl-carnitine translocase by miRNAs 132 and 212 amplifies glucose-stimulated insulin secretion Mufaddal S. Soni1, Mary E. Rabaglia1, Sushant Bhatnagar1, Jin Shang2, Olga Ilkayeva3, Randall Mynatt4, Yun-Ping Zhou2, Eric E. Schadt6, Nancy A.Thornberry2, Deborah M. Muoio5, Mark P. Keller1 and Alan D. Attie1 From the 1Department of Biochemistry, University of Wisconsin, Madison, Wisconsin; 2Department of Metabolic Disorders-Diabetes, Merck Research Laboratories, Rahway, New Jersey; 3Sarah W. Stedman Nutrition and Metabolism Center, Duke Institute of Molecular Physiology, 5Departments of Medicine and Pharmacology and Cancer Biology, Durham, North Carolina. 4Pennington Biomedical Research Center, Louisiana State University system, Baton Rouge, Louisiana; 6Institute for Genomics and Multiscale Biology, Mount Sinai School of Medicine, New York, New York. Corresponding author Alan D. Attie, 543A Biochemistry Addition, 433 Babcock Drive, Department of Biochemistry, University of Wisconsin-Madison, Madison, Wisconsin, (608) 262-1372 (Ph), (608) 263-9608 (fax), [email protected]. Running Title: Fatty acyl-carnitines enhance insulin secretion Abstract word count: 163 Main text Word count: 3960 Number of tables: 0 Number of figures: 5 Diabetes Publish Ahead of Print, published online June 26, 2014 Diabetes Page 2 of 288 2 ABSTRACT We previously demonstrated that micro-RNAs 132 and 212 are differentially upregulated in response to obesity in two mouse strains that differ in their susceptibility to obesity-induced diabetes. Here we show the overexpression of micro-RNAs 132 and 212 enhances insulin secretion (IS) in response to glucose and other secretagogues including non-fuel stimuli. We determined that carnitine acyl-carnitine translocase (CACT, Slc25a20) is a direct target of these miRNAs.
    [Show full text]
  • Small Chromosomal Regions Position Themselves Autonomously
    Downloaded from genome.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Small chromosomal regions position themselves autonomously according to their chromatin class Harmen J. G. van de Werken 1,5, Josien C. Haan 2, Yana Feodorova 3,7, Dominika Bijos 4, An Weuts 2, Koen Theunis 2, Sjoerd J. B. Holwerda 5,8, Wouter Meuleman 4,9, Ludo Pagie 4, Katharina Thanisch 3,10, Parveen Kumar 2, Heinrich Leonhardt 3, Peter Marynen 6, Bas van Steensel 4, Thierry Voet 2, Wouter de Laat 5, Irina Solovei 3, Boris Joffe 3† 1 Cancer Computational Biology Center, Erasmus MC Cancer Institute & Department of Urology, Erasmus MC Cancer Institute,, Erasmus University Medical Center, Wytemaweg 80, 3015 CN, Rotterdam, the Netherlands 2 Laboratory of Reproductive Genomics, Department of Human Genetics, KU Leuven, Leuven, 3000, Belgium 3 Department of Biology II, Ludwig Maximilians University Munich, Grosshadernerstrasse 2, 82152 Planegg-Martinsried, Germany 4 Division of Gene Regulation, Netherlands Cancer Institute, 1066 CX Amsterdam, the Netherlands 5 Hubrecht Institute‐KNAW & University Medical Center Utrecht, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands 6 Human Genome Laboratory, Department of Human Genetics, KU Leuven, Leuven, 3000, Belgium ---------------------------------------------------------------------------------------------------------------------------------------- 7 Present address: Department of Medical Biology, Medical University-Plovdiv, Blvd. Vasil Aprilov 15A, Plovdiv 4000, Bulgaria. 8 Present address: Developmental
    [Show full text]
  • GPCR Activation of Ras and PI3KΓ in Neutrophils
    The EMBO Journal (2012) 31, 3118–3129 | & 2012 European Molecular Biology Organization | All Rights Reserved 0261-4189/12 www.embojournal.org TTHEH E EEMBOMBO JJOURNALOURN AL GPCR activation of Ras and PI3Kc in neutrophils depends on PLCb2/b3 and the RasGEF RasGRP4 Sabine Suire1, Charlotte Le´ cureuil1,3, seconds to hours, are GPCR and context dependent and far Karen E Anderson1, George Damoulakis1,4, from understood. There are, however, a relatively limited Izabella Niewczas2, Keith Davidson1, number of primary intracellular signals that encode the Herve´ Guillou1,5, Dingxin Pan1, spatiotemporal characteristics of GPCR and G-protein Jonathan Clark2, Phillip T Hawkins1,6 activation that are of known physiological importance. and Len Stephens1,6,* These include class I PI3Ks (phosphoinositide 3 kinases, particularly PI3Kg), PLCbs (phospholipase C) and small 1 The Inositide Laboratory, The Babraham Institute, Babraham Research GTPases such as Rac1 and 2, cdc42, RhoA and Rap1 and 2. Campus, Cambridge, UK and 2Babraham Bioscience Technologies Ltd., In this work, we have focused on mechanisms controlling Babraham Research Campus, Cambridge, UK activation of PI3Kg. The molecular mechanisms by which receptors regulate PI3Kg is a key effector in a number of myeloid-derived cells (Hirsch et al, 2000; Li et al, 2000; Sasaki et al, 2000) that can the Ras Binding Domains of the PIP3-generating, class I et al PI3Ks remain poorly understood, despite their importance be activated directly by Gbg subunits (Stoyanov , 1995; et al in a range of biological settings, including tumorigenesis, Stephens , 1997). PI3Kg synthesizes the signalling lipid activation of neutrophils by pro-inflammatory mediators, PIP3 and hence can drive activation of PIP3-binding proteins, chemotaxis of Dictyostelium and cell growth in such as PKB and several specific regulators of small GTPases.
    [Show full text]
  • Parental Infections Disrupt Clustered Genes Encoding Related Functions
    bioRxiv preprint doi: https://doi.org/10.1101/448845; this version posted October 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 1 Parental infections disrupt clustered genes encoding related functions required for nervous system development in newborns Bernard Friedenson Department of Biochemistry and Molecular Genetics College of Medicine University of Illinois Chicago Chicago, IL [email protected] bioRxiv preprint doi: https://doi.org/10.1101/448845; this version posted October 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 2 Abstract The purpose of this study was to understand the role of infection in the origin of chromosomal anomalies linked to neurodevelopmental disorders. In children with disorders in the development of their nervous systems, chromosome anomalies known to cause these disorders were compared to viruses and bacteria including known teratogens. Results support the explanation that parental infections disrupt elaborate multi-system gene coordination needed for neurodevelopment. Genes essential for neurons, lymphatic drainage, immunity, circulation, angiogenesis, cell barriers, structure, and chromatin activity were all found close together in polyfunctional clusters that were deleted in neurodevelopmental disorders. These deletions account for immune, circulatory, and structural deficits that accompany neurologic deficits. In deleted gene clusters, specific and repetitive human DNA matched infections and passed rigorous artifact tests.
    [Show full text]
  • Function Marginal Zone B Cell Development and the Adaptor
    The Adaptor Protein Sh2d3c Is Critical for Marginal Zone B Cell Development and Function This information is current as Amin Al-Shami, Carrie Wilkins, Jeannette Crisostomo, of September 29, 2021. Dhaya Seshasayee, Flavius Martin, Nianhua Xu, Adisak Suwanichkul, Stephen J. Anderson and Tamas Oravecz J Immunol 2010; 185:327-334; Prepublished online 26 May 2010; doi: 10.4049/jimmunol.1000096 Downloaded from http://www.jimmunol.org/content/185/1/327 Supplementary http://www.jimmunol.org/content/suppl/2010/05/26/jimmunol.100009 Material 6.DC1 http://www.jimmunol.org/ References This article cites 42 articles, 16 of which you can access for free at: http://www.jimmunol.org/content/185/1/327.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 29, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2010 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology The Adaptor Protein Sh2d3c Is Critical for Marginal Zone B Cell Development and Function Amin Al-Shami,* Carrie Wilkins,* Jeannette Crisostomo,* Dhaya Seshasayee,† Flavius Martin,† Nianhua Xu,* Adisak Suwanichkul,* Stephen J.
    [Show full text]
  • Transposon Mutagenesis Identifies Genetic Drivers of Brafv600e Melanoma
    ARTICLES Transposon mutagenesis identifies genetic drivers of BrafV600E melanoma Michael B Mann1,2, Michael A Black3, Devin J Jones1, Jerrold M Ward2,12, Christopher Chin Kuan Yew2,12, Justin Y Newberg1, Adam J Dupuy4, Alistair G Rust5,12, Marcus W Bosenberg6,7, Martin McMahon8,9, Cristin G Print10,11, Neal G Copeland1,2,13 & Nancy A Jenkins1,2,13 Although nearly half of human melanomas harbor oncogenic BRAFV600E mutations, the genetic events that cooperate with these mutations to drive melanogenesis are still largely unknown. Here we show that Sleeping Beauty (SB) transposon-mediated mutagenesis drives melanoma progression in BrafV600E mutant mice and identify 1,232 recurrently mutated candidate cancer genes (CCGs) from 70 SB-driven melanomas. CCGs are enriched in Wnt, PI3K, MAPK and netrin signaling pathway components and are more highly connected to one another than predicted by chance, indicating that SB targets cooperative genetic networks in melanoma. Human orthologs of >500 CCGs are enriched for mutations in human melanoma or showed statistically significant clinical associations between RNA abundance and survival of patients with metastatic melanoma. We also functionally validate CEP350 as a new tumor-suppressor gene in human melanoma. SB mutagenesis has thus helped to catalog the cooperative molecular mechanisms driving BRAFV600E melanoma and discover new genes with potential clinical importance in human melanoma. Substantial sun exposure and numerous genetic factors, including including BrafV600E, recapitulate the genetic and histological hallmarks skin type and family history, are the most important melanoma risk of human melanoma. In these models, increased MEK-ERK signaling factors. Familial melanoma, which accounts for <10% of cases, is asso- initiates clonal expansion of melanocytes, which is limited by oncogene- ciated with mutations in CDKN2A1, MITF2 and POT1 (refs.
    [Show full text]
  • Comprehensive Mutation Screening in 55 Probands with Type 1 Primary Hyperoxaluria Shows Feasibility of a Gene- Based Diagnosis
    Comprehensive Mutation Screening in 55 Probands with Type 1 Primary Hyperoxaluria Shows Feasibility of a Gene- Based Diagnosis Carla G. Monico,* Sandro Rossetti,† Heidi A. Schwanz,‡ Julie B. Olson,* Patrick A. Lundquist,§ D. Brian Dawson,§ Peter C. Harris,† and Dawn S. Milliner* *Mayo Clinic Hyperoxaluria Center and †Department of Biochemistry and Molecular Biology, Division of Nephrology, and §Clinical Molecular Genetics Laboratory, Mayo Clinic College of Medicine, Rochester, Minnesota; and ‡Luther College, Decorah, Iowa Mutations in AGXT, a locus mapped to 2q37.3, cause deficiency of liver-specific alanine:glyoxylate aminotransferase (AGT), the metabolic error in type 1 primary hyperoxaluria (PH1). Genetic analysis of 55 unrelated probands with PH1 from the Mayo Clinic Hyperoxaluria Center, to date the largest with availability of complete sequencing across the entire AGXT coding region and documented hepatic AGT deficiency, suggests that a molecular diagnosis (identification of two disease alleles) is feasible in 96% of patients. Unique to this PH1 population was the higher frequency of G170R, the most common AGXT mutation, accounting for 37% of alleles, and detection of a new 3؅ end deletion (Ex 11_3؅UTR del). A described frameshift mutation (c.33_34insC) occurred with the next highest frequency (11%), followed by F152I and G156R (frequencies of 6.3 and 4.5%, respectively), both surpassing the frequency (2.7%) of I244T, the previously reported third most common pathogenic change. These sequencing data indicate that AGXT is even more variable than formerly believed, with 28 new variants (21 mutations and seven polymorphisms) detected, with highest frequencies on exons 1, 4, and 7. When limited to these three exons, molecular analysis sensitivity was 77%, compared with 98% for whole-gene sequencing.
    [Show full text]