DOCSLIB.ORG

Dnmt3a and Dnmt3b-Decommissioned Fetal Enhancers Are Linked to Kidney Disease

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Dnmt3a and Dnmt3b-Decommissioned Fetal Enhancers Are Linked to Kidney Disease BASIC RESEARCH www.jasn.org Dnmt3a and Dnmt3b-Decommissioned Fetal Enhancers are Linked to Kidney Disease Yuting Guan, Hongbo Liu , Ziyuan Ma , Szu-Yuan Li, Jihwan Park , Xin Sheng, and Katalin Susztak Department of Medicine, Renal Electrolyte and Hypertension Division, Department of Genetics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania ABSTRACT Background Cytosine methylation is an epigenetic mark that dictates cell fate and response to stimuli. The timing and establishment of methylation logic during kidney development remains unknown. DNA meth- yltransferase 3a and 3b are the enzymes capable of establishing de novo methylation. Methods We generated mice with genetic deletion of Dnmt3a and Dnmt3b in nephron progenitor cells (Six2CreDnmt3a/3b) and kidney tubule cells (KspCreDnmt3a/3b). We characterized KspCreDnmt3a/3b mice at baseline and after injury. Unbiased omics profiling, such as whole genome bisulfite sequencing, reduced representation bisulfite sequencing and RNA sequencing were performed on whole-kidney samples and isolated renal tubule cells. Results KspCreDnmt3a/3b mice showed no obvious morphologic and functional alterations at baseline. Knockout animals exhibited increased resistance to cisplatin-induced kidney injury, but not to folic acid–induced fibrosis. Whole-genome bisulfite sequencing indicated that Dnmt3a and Dnmt3b play an important role in methylation of gene regulatory regions that act as fetal-specific enhancers in the de- veloping kidney but are decommissioned in the mature kidney. Loss of Dnmt3a and Dnmt3b resulted in failure to silence developmental genes. We also found that fetal-enhancer regions methylated by Dnmt3a and Dnmt3b were enriched for kidney disease genetic risk loci. Methylation patterns of kidneys from patients with CKD showed defects similar to those in mice with Dnmt3a and Dnmt3b deletion. Conclusions Our results indicate a potential locus-specific convergence of genetic, epigenetic, and de- velopmental elements in kidney disease development. JASN 31: 765–782, 2020. doi: https://doi.org/10.1681/ASN.2019080797 Cytosine methylation is erased and reestablished to 50% of the genome.4 Recent studies indicated that between generations. DNA methylation is removed Dnmt1 deletion in Six2-positive nephron progenitors fromthezygotebytheblastocyststageandrein- stated during embryonic development.1 De novo meth- Dnmt3a Dnmt3b yltransferases 3a ( )and3b( )playkey Received August 10, 2019. Accepted December 24, 2019. roles in establishing new methylation patterns.2 Y.G. and H.L. contributed equally to this work. Dnmt3a-deficient animals die several weeks after birth and Dnmt3b-deficient animals die in utero, indicating Published online ahead of print. Publication date available at the essential roles of Dnmt3a-andDnmt3b-mediated www.jasn.org. de novo methylation in development. Correspondence: Dr. Katalin Susztak, Renal Electrolyte and Cytosine methylation has several important Hypertension Division, Department of Medicine, Department of Genetics, Perelman School of Medicine, University of Pennsyl- functions. Most cytosines in the genome are meth- vania, 12-123 Smilow Translational Research Center, 3400 Civic ylated for efficient silencing of transposable ele- Center Boulevard, Philadelphia, PA 19104. Email: ksusztak@ ments.3 Transposable elements are the footprint pennmedicine.upenn.edu of ancient integrated retroviruses, making up close Copyright © 2020 by the American Society of Nephrology JASN 31: 765–782, 2020 ISSN : 1046-6673/3104-765 765 BASIC RESEARCH www.jasn.org resulted in a release of transposable-element silencing, endoge- Significance Statement nous retroviral expression, cytokine release, and a downstream severe kidney developmental defect.5 Cytosine methylation plays a key role in determining cell fate and Cytosine methylation is believed to be a key regulator of response to stimuli. Using mice with kidney-specific deletion of de novo gene expression.6 Gene regulatory regions, such as promoters genes encoding DNA methyltransferases Dnmt3a and – Dnmt3b, the authors showed that these genes are responsible for and enhancers, contain cytosine-guanine (CpG) rich regions methylation of gene regulatory regions that act as enhancers during (islands). In general, unmethylated promoters are permissive kidney development but are then decommissioned in adult mice. to transcription-factor binding and are associated with active Although the knock-out mice displayed no obvious kidney abnor- gene expression. Methylated promoters exclude transcription malities at baseline, they showed resistance to induced AKI. The factors, therefore they are associated with gene repression. authors also discovered that human kidney disease risk loci were enriched on fetal regulatory regions (enhancers) that were de- Methylation of promoter and enhancer regions plays a key commissioned by Dnmt3a/3b and no longer active in the adult role in stabilizing linage decisions and restricting lineage fates. kidney. These findings suggest that adult kidney diseases could In addition to promoters, enhancers are critical for establish- have a developmental origin and that genetic and epigenetic (such ing cell type–specific gene regulation and gene expression. as Dnmt3a/3b) factors could converge on the same genetic regions Enhancers are enriched for cell type–specifictranscription resulting in kidney disease development. factor binding sites to ensure cell-specificgeneregulation. Cell type–specific genes often have multiple enhancers that glycemic control on diabetic kidney disease development loop around and join promoters to establish a cell type—specific can be observed even decades after improved metabolic gene expression pattern. Six2 is a critical transcription factor in control.19,20 It also remains unclear how environmental kidney development. Six2-positive progenitors can undergo a and genetic factors interact and lead to kidney disease symmetric and asymmetric division to renew or to commit development. and differentiate into specialized nephron epithelium seg- To understand the role of de novo methylation in kidney cell ments.7,8 The role of cytosine methylation in this process is differentiation, we generated mice with genetic deletion of poorly understood. Dnmt3a and Dnmt3b in nephron progenitor cells (NPCs) Cre Cre Cre Kidney disease is a complex gene environmental disease, and tubule cells, using Six2 and Ksp (Six2 Dnmt3a/3b Cre affecting 800-million people worldwide. Genome-wide asso- and Ksp Dnmt3a/3b), respectively. Whole-genome bisulfite ciation analyses have been conducted to understand the her- sequencing (WGBS) and reduced representation bisulfite se- itability of kidney function, which uncovered close to 300 loci quencing (RRBS) identified significant changes in the meth- associated with disease risk.9–11 Each nucleotide variation only ylome of kidney tubule cells. We showed that Dnmt3a and increases disease risk by a minuscule amount, however, they Dnmt3b play important roles in de novo methylation of fetal should explain close to 50% of disease risk in aggregate. It has enhancers that were initially bound by Six2. The decline in been proposed that human disease-associated genetic variants Six2 expression during development was associated with a loss are enriched on cell type–specificenhancerregions.12 of H3K27ac and an increase in methylation. These fetal en- Nucleotide-sequence changes at enhancer regions could alter hancers decommissioned by Dnmt3a and Dnmt3b were en- transcription-factor binding, leading to quantitative differ- riched for kidney disease risk loci. Diseased kidney samples ences in gene expression contributing to disease development. showed a methylation pattern that was similar to the Dnmt3a/ Upon analyzing kidney disease risk loci, we found that only 3b knockout animals. Overall, our data suggest that changes 20%–30% of identified loci are located in regions annotated as broughtonbyDnmt3a/3b might be important for human enhancers in adult kidney samples. The underlying mecha- kidney disease. nism explaining the disease development that is associated with regions with no detectable regulatory function in the adult human kidney remains unknown. These regions might METHODS be specific for rare kidney cell types or a disease or develop- mental stage that is not captured by bulk analysis of adult Animal Strains human kidney tissue samples. Mice were raised and maintained in a barrier facility. Exper- Environmental and nutritional alterations play equally im- iments were reviewed and approved by the Institutional portant roles in kidney disease development.13–15 Intrauterine Animal Care and Use Committee of the University of Penn- nutrient availability is known to be an important determinant sylvania and were performed in accordance with the institu- of hypertension and kidney disease development, so called tional guidelines. For folic acid–induced nephropathy mouse “prenatal programming.”16,17 Because epigenome-editing en- models, 8-week-old male mice were injected with folic acid zymes need substrates from the intermediate metabolism, it (250 mg/kg, dissolved in 300 mM sodium bicarbonate) intra- has been proposed that the epigenome might play a key role in peritoneally and euthanized on day 7. For the cisplatin- prenatal programming. Nutrient availability, such as the pres- induced injury model, 8-week-old male mice were injected ence of diabetes, remains the most significant risk factor for with cisplatin (25 mg/kg) intraperitoneally and euthanized kidney disease
Load more

Recommended publications
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Homeobox Genes D11–D13 and A13 Control Mouse Autopod Cortical
    Research article Homeobox genes d11–d13 and a13 control mouse autopod cortical bone and joint formation Pablo Villavicencio-Lorini,1,2 Pia Kuss,1,2 Julia Friedrich,1,2 Julia Haupt,1,2 Muhammed Farooq,3 Seval Türkmen,2 Denis Duboule,4 Jochen Hecht,1,5 and Stefan Mundlos1,2,5 1Max Planck Institute for Molecular Genetics, Berlin, Germany. 2Institute for Medical Genetics, Charité, Universitätsmedizin Berlin, Berlin, Germany. 3Human Molecular Genetics Laboratory, National Institute for Biotechnology & Genetic Engineering (NIBGE), Faisalabad, Pakistan. 4National Research Centre Frontiers in Genetics, Department of Zoology and Animal Biology, University of Geneva, Geneva, Switzerland. 5Berlin-Brandenburg Center for Regenerative Therapies (BCRT), Charité, Universitätsmedizin Berlin, Berlin, Germany. The molecular mechanisms that govern bone and joint formation are complex, involving an integrated network of signaling pathways and gene regulators. We investigated the role of Hox genes, which are known to specify individual segments of the skeleton, in the formation of autopod limb bones (i.e., the hands and feet) using the mouse mutant synpolydactyly homolog (spdh), which encodes a polyalanine expansion in Hoxd13. We found that no cortical bone was formed in the autopod in spdh/spdh mice; instead, these bones underwent trabecular ossification after birth. Spdh/spdh metacarpals acquired an ovoid shape and developed ectopic joints, indicating a loss of long bone characteristics and thus a transformation of metacarpals into carpal bones. The perichon- drium of spdh/spdh mice showed abnormal morphology and decreased expression of Runt-related transcription factor 2 (Runx2), which was identified as a direct Hoxd13 transcriptional target. Hoxd11–/–Hoxd12–/–Hoxd13–/– tri- ple-knockout mice and Hoxd13–/–Hoxa13+/– mice exhibited similar but less severe defects, suggesting that these Hox genes have similar and complementary functions and that the spdh allele acts as a dominant negative.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis Reveals Molecular Subtypes of Pancreatic Cancer
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 17), pp: 28990-29012 Research Paper Genome-wide DNA methylation analysis reveals molecular subtypes of pancreatic cancer Nitish Kumar Mishra1 and Chittibabu Guda1,2,3,4 1Department of Genetics, Cell Biology and Anatomy, University of Nebraska Medical Center, Omaha, NE, 68198, USA 2Bioinformatics and Systems Biology Core, University of Nebraska Medical Center, Omaha, NE, 68198, USA 3Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE, 68198, USA 4Fred and Pamela Buffet Cancer Center, University of Nebraska Medical Center, Omaha, NE, 68198, USA Correspondence to: Chittibabu Guda, email: [email protected] Keywords: TCGA, pancreatic cancer, differential methylation, integrative analysis, molecular subtypes Received: October 20, 2016 Accepted: February 12, 2017 Published: March 07, 2017 Copyright: Mishra et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Pancreatic cancer (PC) is the fourth leading cause of cancer deaths in the United States with a five-year patient survival rate of only 6%. Early detection and treatment of this disease is hampered due to lack of reliable diagnostic and prognostic markers. Recent studies have shown that dynamic changes in the global DNA methylation and gene expression patterns play key roles in the PC development; hence, provide valuable insights for better understanding the initiation and progression of PC. In the current study, we used DNA methylation, gene expression, copy number, mutational and clinical data from pancreatic patients.
    [Show full text]
  • Serial Deletions and Duplications Suggest a Mechanism for the Collinearity of Hoxd Genes in Limbs
    articles Serial deletions and duplications suggest a mechanism for the collinearity of Hoxd genes in limbs Marie Kmita*, Nadine Fraudeau*, Yann He´rault*† & Denis Duboule* * Department of Zoology and Animal Biology, NCCR Frontiers in Genetics, University of Geneva, Sciences III, Quai Ernest Ansermet 30, 1211 Geneva 4, Switzerland ........................................................................................................................................................................................................................... Hox genes, located at one end of the HoxD cluster, are essential for the development of the extremities of our limbs; that is, the digits. This ‘collinear’ correspondence is accompanied by a gradual decrease in the transcriptional efficiency of the genes. To decipher the underlying regulatory mechanisms, and thus to understand better how digits develop, we engineered a series of deletions and duplications in vivo. We find that HoxD genes compete for a remote enhancer that recognizes the locus in a polar fashion, with a preference for the 5 0 extremity. Modifications in either the number or topography of Hoxd loci induced regulatory reallocations affecting both the number and morphology of digits. These results demonstrate why genes located at the extremity of the cluster are expressed at the distal end of the limbs, following a gradual reduction in transcriptional efficiency, and thus highlight the mechanistic nature of collinearity in limbs. During vertebrate evolution, Hox genes were co-opted to achieve a ing that modifications in the presence, the absence, the position or variety of functions in addition to their ancestral role in organizing the number of genes would provide insights into both aspects. We structures along the trunk axis. One example is the limb skeleton, used targeted meiotic recombination (TAMERE19) to produce which is patterned by genes from the HoxA and HoxD clusters1,2.
    [Show full text]
  • Pig Antibodies
    Pig Antibodies gene_name sku Entry_Name Protein_Names Organism Length Identity CDX‐2 ARP31476_P050 D0V4H7_PIG Caudal type homeobox 2 (Fragment) Sus scrofa (Pig) 147 100.00% CDX‐2 ARP31476_P050 A7MAE3_PIG Caudal type homeobox transcription factor 2 (Fragment) Sus scrofa (Pig) 75 100.00% Tnnt3 ARP51286_P050 Q75NH3_PIG Troponin T fast skeletal muscle type Sus scrofa (Pig) 271 85.00% Tnnt3 ARP51286_P050 Q75NH2_PIG Troponin T fast skeletal muscle type Sus scrofa (Pig) 266 85.00% Tnnt3 ARP51286_P050 Q75NH1_PIG Troponin T fast skeletal muscle type Sus scrofa (Pig) 260 85.00% Tnnt3 ARP51286_P050 Q75NH0_PIG Troponin T fast skeletal muscle type Sus scrofa (Pig) 250 85.00% Tnnt3 ARP51286_P050 Q75NG8_PIG Troponin T fast skeletal muscle type Sus scrofa (Pig) 266 85.00% Tnnt3 ARP51286_P050 Q75NG7_PIG Troponin T fast skeletal muscle type Sus scrofa (Pig) 260 85.00% Tnnt3 ARP51286_P050 Q75NG6_PIG Troponin T fast skeletal muscle type Sus scrofa (Pig) 250 85.00% Tnnt3 ARP51286_P050 TNNT3_PIG Troponin T, fast skeletal muscle (TnTf) Sus scrofa (Pig) 271 85.00% ORF Names:PANDA_000462 EMBL EFB13877.1OrganismAiluropod High mobility group protein B2 (High mobility group protein a melanoleuca (Giant panda) ARP31939_P050 HMGB2_PIG 2) (HMG‐2) Sus scrofa (Pig) 210 100.00% Agpat5 ARP47429_P050 B8XTR3_PIG 1‐acylglycerol‐3‐phosphate O‐acyltransferase 5 Sus scrofa (Pig) 365 85.00% irf9 ARP31200_P050 Q29390_PIG Transcriptional regulator ISGF3 gamma subunit (Fragment) Sus scrofa (Pig) 57 100.00% irf9 ARP31200_P050 Q0GFA1_PIG Interferon regulatory factor 9 Sus scrofa (Pig)
    [Show full text]
  • Role of HOX Genes in Stem Cell Differentiation and Cancer
    Thomas Jefferson University Jefferson Digital Commons Kimmel Cancer Center Papers, Presentations, and Grand Rounds Kimmel Cancer Center 7-22-2018 Role of HOX Genes in Stem Cell Differentiation and Cancer. Seema Bhatlekar Helen F. Graham Cancer Center and Research Institute; University of Delaware Jeremy Z Fields CATX Inc. Bruce M. Boman Thomas Jefferson University; Helen F. Graham Cancer Center and Research Institute; University of Delaware; CATX Inc. Follow this and additional works at: https://jdc.jefferson.edu/kimmelgrandrounds Part of the Oncology Commons Let us know how access to this document benefits ouy Recommended Citation Bhatlekar, Seema; Fields, Jeremy Z; and Boman, Bruce M., "Role of HOX Genes in Stem Cell Differentiation and Cancer." (2018). Kimmel Cancer Center Papers, Presentations, and Grand Rounds. Paper 62. https://jdc.jefferson.edu/kimmelgrandrounds/62 This Article is brought to you for free and open access by the Jefferson Digital Commons. The Jefferson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The Commons is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The Jefferson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Kimmel Cancer Center Papers, Presentations, and Grand Rounds by an authorized administrator of the Jefferson Digital Commons. For more information, please contact: [email protected]. Hindawi Stem Cells International Volume 2018, Article ID 3569493, 15 pages https://doi.org/10.1155/2018/3569493 Review Article Role of HOX Genes in Stem Cell Differentiation and Cancer 1,2 3 1,2,3,4 Seema Bhatlekar , Jeremy Z.
    [Show full text]
  • BMC Biology Biomed Central
    BMC Biology BioMed Central Research article Open Access Classification and nomenclature of all human homeobox genes PeterWHHolland*†1, H Anne F Booth†1 and Elspeth A Bruford2 Address: 1Department of Zoology, University of Oxford, South Parks Road, Oxford, OX1 3PS, UK and 2HUGO Gene Nomenclature Committee, European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, CB10 1SA, UK Email: Peter WH Holland* - [email protected]; H Anne F Booth - [email protected]; Elspeth A Bruford - [email protected] * Corresponding author †Equal contributors Published: 26 October 2007 Received: 30 March 2007 Accepted: 26 October 2007 BMC Biology 2007, 5:47 doi:10.1186/1741-7007-5-47 This article is available from: http://www.biomedcentral.com/1741-7007/5/47 © 2007 Holland et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: The homeobox genes are a large and diverse group of genes, many of which play important roles in the embryonic development of animals. Increasingly, homeobox genes are being compared between genomes in an attempt to understand the evolution of animal development. Despite their importance, the full diversity of human homeobox genes has not previously been described. Results: We have identified all homeobox genes and pseudogenes in the euchromatic regions of the human genome, finding many unannotated, incorrectly annotated, unnamed, misnamed or misclassified genes and pseudogenes.
    [Show full text]
  • Effect of Low Doses of Estradiol and Tamoxifen on Breast Cancer Cell Karyotypes
    238 M Rondón-Lagos et al. Breast cancer cell karyotypes, 23:8 635–650 Research E2 and tamoxifen Effect of low doses of estradiol and tamoxifen on breast cancer cell karyotypes Milena Rondón-Lagos1, Nelson Rangel1,2, Ludovica Verdun Di Cantogno3, Laura Annaratone1, Isabella Castellano1, Rosalia Russo1, Tilde Manetta4, Caterina Marchiò1,* and Anna Sapino1,5,* 1Department of Medical Sciences, University of Turin, Turin, Italy Correspondence 2Natural and Mathematical Sciences Faculty, Universidad del Rosario, Bogotá, Colombia should be addressed 3Pathology Division, Azienda Ospedaliera Città della Salute e della Scienza di Torino, Turin, Italy to C Marchiò or A Sapino 4Department of Public Health and Pediatrics, University of Turin, Turin, Italy Email 5Candiolo Cancer Institute, FPO-IRCCS, Candiolo, Italy [email protected] or *(C Marchiò and A Sapino contributed equally to this work) [email protected] Abstract Evidence supports a role of 17β-estradiol (E2) in carcinogenesis and the large majority Key Words of breast carcinomas are dependent on estrogen. The anti-estrogen tamoxifen (TAM) f breast cancer cells is widely used for both treatment and prevention of breast cancer; however, it is also f estradiol carcinogenic in human uterus and rat liver, highlighting the profound complexity of its f tamoxifen actions. The nature of E2- or TAM-induced chromosomal damage has been explored using f chromosomal relatively high concentrations of these agents, and only some numerical aberrations abnormalities Endocrine-Related Cancer Endocrine-Related and chromosomal breaks have been analyzed. This study aimed to determine the effects f chromosomal instability −8 −1 −6 −1 of low doses of E2 and TAM (10 mol L and 10 mol L respectively) on karyotypes of MCF7, T47D, BT474, and SKBR3 breast cancer cells by comparing the results of conventional karyotyping and multi-FISH painting with cell proliferation.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name breast cancer anti-estrogen resistance protein 3 Gene Symbol Bcar3 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.7383 Ensembl Gene ID ENSRNOG00000013737 Entrez Gene ID 310838 Assay Information Unique Assay ID qRnoCIP0035724 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000065111 Amplicon Context Sequence GCAAGGTTGCTAGGATACTGGAAGTCTCTGAAGACATGAAGAGGAGCATGGGC GTGAGCTCGGGACTGGAACTCATTACCTTGCCTCACGGACGCCAGCTGCGCCT GGACATTATTGAAAGACACAACACCATGGCCATTG Amplicon Length (bp) 111 Chromosome Location 2:246024723-246034495 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 103 R2 0.9986 cDNA Cq 21.98 cDNA Tm (Celsius) 85.5 gDNA Cq 37.5 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Bcar3, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]