US008298756B2

(12) United States Patent (10) Patent No.: US 8,298,756 B2 Condeelis (45) Date of Patent: Oct. 30, 2012

(54) ISOLATION, GENE EXPRESSION, AND Jang et al (Clinical and Experimental Metastasis, 1997, vol. 15, pp. CHEMOTHERAPEUTC RESISTANCE OF 469-483).* MOTLE CANCER CELLS Wyckoff JB et al., entitled “The Collection of the Motile Population of Cells from a Living Tumor.” Cancer Research 60:5401-5404, Oct. (75) Inventor: John S. Condeelis, City Island, NY (US) 2000. Wang W et al., Gene expression analysis on Small numbers of (73) Assignee: Albert Einstein College of Medicine of invasive cells collected by chemotaxis from primary mammary Yeshiva University, Bronx, NY (US) tumors of the mouse, BMC Biotechnology 3:13, Aug. 2003, 12 pageS. Wang Wet al., entitled "Single cell behavior in metastatic primary (*) Notice: Subject to any disclaimer, the term of this mammary tumors correlated with gene expression patterns revealed patent is extended or adjusted under 35 by molecular profiling.” Cancer Research 62: 6278-6288, Nov. 2002. U.S.C. 154(b) by 318 days. Santala Met al., entitled “Synthesis and breakdown of fibrillar col lagens: concomitant phenomena in ovarian cancer. British Journal (21) Appl. No.: 11/659,514 of Cancer 77(11):1825-1831, 1998, Abstract Only. LiT et al., entitled "Inhibiting Ras signaling in the therapy of breast (22) PCT Filed: Aug. 4, 2005 cancer.” Cinical Breast Cancer 3(6):405-416, 2003, Abstract Only. Thigpen JT, entitled "Chemotherapy for advanced ovarian cancer: (86). PCT No.: PCT/US2005/027680 overview of randomized trails.” Semin. Oncol. 27(3 Suppl7): 11-16, 2000, Abstract Only. S371 (c)(1), Supplementary European Search Reportdated Jun. 2, 2008 for Appli (2), (4) Date: Sep. 26, 2007 cation No. EP 05807467.5, 2 pages. Goswami S. et al., entitled “Breast Cancer Cells Isolated by (87) PCT Pub. No.: WO2006/017635 Chemotaxis from Primary Tumors Show Increased Survival and Resistance to Chemotherapy,” Cancer Research, Nov. 1, 2004, vol. PCT Pub. Date: Feb. 16, 2006 64, pp. 7664-7667. Santala Met al., entitled “Synthesis and breakdown of fibrillar col (65) Prior Publication Data lagens: concomitant phenomena in ovarian cancer. British Journal US 2008/O138805 A1 Jun. 12, 2008 of Cancer (1998) 77(11), 1825-1831. Thigpen JT, entitled “Chemotherapy for Advanced Ovarian Cancer. Related U.S. Application Data Overview of Randomized Trials.” Seminars in Oncology, vol. 27. No. 3, Suppl 7 Jun. 2000, 11-16. (60) Provisional application No. 60/600,697, filed on Aug. LiT et al., entitled "Inhibiting Ras Signaling in the Therapy of Breast 11, 2004. Cancer.” Clinical Breast Cancer, Feb. 2003, 405-416. (51) Int. Cl. * cited by examiner CI2O I/68 (2006.01) Primary Examiner — Karen Canella GOIN33/574 (2006.01) (74) Attorney, Agent, or Firm — Amster, Rothstein & (52) U.S. Cl...... 435/4; 435/6.14; 435/6.17; 435/723; Ebenstein LLP 435/7.24 (58) Field of Classification Search ...... None (57) ABSTRACT See application file for complete search history. Methods of isolating motile cells of interest from an animal (56) References Cited tissue is provided. Also provided are methods of determining mRNA or protein expression of a gene in motile cells of U.S. PATENT DOCUMENTS interest from an animal tissue. Additionally, methods of deter 2005/0014208 A1 1/2005 Krehan et al...... 435/723 mining whether a cancer in a tissue of a mammal is likely to metastasize are provided. Methods are also provided for FOREIGN PATENT DOCUMENTS inhibiting metastasis of a cancer in a tissue of a mammal. WO WOO3,O23060 * 3/2003 Further provided are methods of determining resistance of a WO WO2004/O15396 * 2/2004 motile cancer cell population in an animal tissue to a chemo OTHER PUBLICATIONS therapeutic agent. Dong et al (Cancer Research, 2001, vol. 61, pp. 4797-4808).* 14 Claims, 11 Drawing Sheets U.S. Patent Oct. 30, 2012 Sheet 1 of 11 US 8,298,756 B2 FIG. 1

.

U.S. Patent Oct. 30, 2012 Sheet 2 of 11 US 8,298,756 B2

FG. 2 F. Anti-apoptotic genes Description le 3 immediate early response 3 Ubl 1a2 ubiquitin-like 1 (sentrin) activating enzyme subunit 2 TXI Hsp105 heat shock protein, 105 kDa Odc ornithine decarboxylase, structural 4. Dad Trp53 2 5 Hsp60

A. i4 P Cldn3 Apis o

Ap il apoptosis inhibitor 1 o Adam17 2 O

Pdcd4 rogrammed cell death 4 Femb eminization 1 b homolog (C. elegans) f Apaf1 apoptotic protease activating factor 1 Pdcd8 programmed cell death 8 (apoptosis inducing factor) Cellular apoptosis susceptibility protein ESTs. Highly similar to apoptosiss

Apoptosis-inducing factor AlF D

4.5 ra B 4.) 3.5 3D 20 RT-PCR 1.5 1) .5 0. Apia Brca2 Dad 1 Flsp60 Itabi if Od Genes tested U.S. Patent Oct. 30, 2012 Sheet 3 of 11 US 8,298,756 B2

FIG. 3

S83 eVEO3e3 at 0. U.S. Patent Oct. 30, 2012 Sheet 4 of 11 US 8,298,756 B2

F.G. 4

/

A?traeaeaer,

U.S. Patent Oct. 30, 2012 Sheet 5 of 11 US 8,298,756 B2

cDNA microarray profiling-gene Neele collection expression of of it wasive cells invasive cells (i)

FACS churciulon a general population of cells from pittay carcinoma cells (ii) to'

cDNA microarray profiling-gene Marigel expression altered by:

Mathigel, EGF

EGF.Matrigel (iv) application U.S. Patent Oct. 30, 2012 Sheet 6 of 11 US 8,298,756 B2

F.G. 6

Annotated genes ESS

1. Cell Cycle F.Cytoskeletan & ECM 2. Apoptosis 8.Membrane associated O3. Tumor suppressor & Oncogenes 9.Growth factors & Signal Transduction 4. Development & Differentiation 0.ucleic acid chemistry 5. Metabolisrn 1.Others

E. S. Protein fetablish U.S. Patent US 8,298,756 B2

Ioun Aleuci pe3elop speeN U.S. Patent US 8,298,756 B2 U.S. Patent Oct. 30, 2012 Sheet 9 of 11 US 8,298,756 B2

FIG. 8

U.S. Patent Oct. 30, 2012 Sheet 10 of 11 US 8,298,756 B2

FG, 9 A

us

EGF(N)

it as Siano Eof. E25nM EGF U.S. Patent Oct. 30, 2012 Sheet 11 of 11 US 8,298,756 B2

F.G. 10

Bigot once

T3-1 -21

s 2 s i

Tugnor growth

s

f A321 Ln31 US 8,298,756 B2 1. 2 ISOLATION, GENE EXPRESSION, AND Clark, E. A., Golub, T. R. Lander, E. S., and Hynes, R. O. CHEMOTHERAPEUTC RESISTANCE OF Genomic analysis of metastasis reveals an essential role for MOTILE CANCER CELLS RhoC. Nature, 406: 532-535, 2000. Condeelis, J. and Segall, J. E. Intravital imaging of cell move CROSS-REFERENCE TO RELATED ment in tumours. Nat Rev Cancer, 3: 921-930, 2003. APPLICATION Condeelis, J., Song. X., Backer, J., Wyckoff, J., and Segall, J. Chemotaxis of cancer cells during invasion and metastasis. This is a U.S. national phase of PCT Application No. In: 5th Abercrombie Symposium on Cell Behaviour, St. PCT/US2005/027680 filed Aug. 4, 2005, which claims the Catherine's College, Oxford, UK, 2003. benefit of U.S. Provisional Application No. 60/600,697, filed 10 Cooper, J.A. and Schafer, D. A. Control of actin assembly and Aug. 11, 2004. disassembly at filament ends. Curr Opin Cell Biol, 12: 97-103, 2000. STATEMENT OF GOVERNMENT SUPPORT Coulombe, P. A. and Omary, M. B. Hard and soft prin 15 ciples defining the structure, function and regulation of This invention was made with government Support under keratin intermediate filaments. Curr Opin Cell Biol, 14: grant numbers CA089829 and CA 100324 awarded by the 110-122, 2002. National Institutes of Health. The government has certain Dal Canto, R.A., Shaw, M.K., Nolan, G.P., Steinman, L., and rights in the invention. Fathman, C. G. Local delivery of TNF by retrovirus-trans duced T lymphocytes exacerbates experimental autoim BACKGROUND mune encephalomyelitis. Clin Immunol, 90:10-14, 1999. Davila, M., Frost, A. R., Grizzle, W. E., and Chakrabarti, R. (1) Field of the Invention LIM Kinase 1 Is Essential for the Invasive Growth of The present invention generally relates to the characteriza Prostate Epithelial Cells: IMPLICATIONS IN PROSTATE tion of motile cells and invasive cells of tumors. More spe 25 CANCER. J. Biol Chem, 278: 36868-36875, 2003. cifically, the invention is directed to methods of isolating Edwards, D.C., Sanders, L. C., Bokoch, G. M., and Gill, G. motile cells, in particular invasive cells, and the characteriza N. Activation of LIM-kinase by Pak1 couples Rac/Cdc42 tion of gene expression in those cells. GTPase signalling to actin cytoskeletal dynamics. Nat Cell (2) Description of the Related Art Biol, 1:253-259, 1999. References Cited 30 Evan, G. I. and Vousden, K. H. Proliferation, cell cycle and Awada, A., Cardoso, F., Atalay, G., Giuliani, R., Mano, M., apoptosis in cancer. Nature, 411: 342-348, 2001. and Piccart, M.J. The pipeline of new anticancer agents for Farina, A.R., Coppa, A., Tiberio, A., Tacconelli, A., Turco, A., breast cancer treatment in 2003. Crit Rev. Oncol Hematol, Colletta, G., Gulino, A., and Mackay, A. R. Transforming 48: 45-63, 2003. growth factor-betal enhances the invasiveness of human Bailly, M. and Condeelis, J. Cell motility: insights from the 35 MDA-MB-231 breast cancer cells by up-regulating uroki backstage. Nat Cell Biol. 4: E292-294, 2002. nase activity. IntJ Cancer, 75: 721-730, 1998a. Bailly, M., Ichetovkin, I., Grant, W., Zebda, N., Machesky, L. Farina, K. L., Wyckoff, J. B., Rivera, J., Lee, H., Segall, J. E., M., Segall, J. E., and Condeelis, J. The F-actin side binding Condeelis, J. S., and Jones, J. G. Cell motility of tumor activity of the Arp2/3 complex is essential for actin nucle cells visualized in living intact primary tumors using green ation and lamellipod extension. Curr Biol. 11: 620-625, 40 fluorescent protein. Cancer Res, 58: 2528-2532, 1998b. 2001. Farina, K. L., Huttelmaier, S., Musunuru, K., Darnell, R., and Bear, J. E., Svitkina, T. M., Krause, M., Schafer, D. A., Singer, R. H. Two ZBP1 KH domains facilitate beta-actin Loureiro, J. J., Strasser, G. A., Maly, I. V., Chaga, O.Y., mRNA localization, granule formation, and cytoskeletal Cooper, J. A., Borisy, G. G., and Gertler, F. B. Antagonism attachment. J Cell Biol, 160: 77-87, 2003. between Ena/VASP proteins and actin filament capping 45 Fidler, I.J. and Kripke, M. L. Metastasis results from preex regulates fibroblast motility. Cell, 109:509-521, 2002. isting variant cells within a malignant tumor. Science, 197: Bonner, R. F., Emmert-Buck, M., Cole, K., Pohida, T., Chua 893-895, 1977. qui, R., Goldstein, S., and Liotta, L. A. Laser capture Hanahan, D. and Weinberg, R. A. The hallmarks of cancer. microdissection: molecular analysis of tissue. Science, Cell, 100: 57-70, 2000. 278: 1481, 1483, 1997. 50 Huigsloot, M., Tijdens, I. B., Mulder, G.J., and van de Water, Brakebusch, C., Wennerberg, K. Krell, H. W., Weidle, U. H., B. Differential regulation of doxorubicin-induced mito Sallmyr, A., Johansson, S., and Fassler, R. Betal integrin chondrial dysfunction and apoptosis by Bcl-2 in mammary promotes but is not essential for metastasis of ras-myc adenocarcinoma (MTLn3) cells. J Biol Chem,277:35869 transformed fibroblasts. Oncogene, 18:3852-3861, 1999. 35879, 2002. Bravo, S.B., Pampin, S., Cameselle-Teijeiro, J., Carneiro, C., 55 Iijima, M., Huang, Y. E., and Devreotes, P. Temporal and Dominguez, F., Barreiro, F., and Alvarez, C. V. TGF-beta spatial regulation of chemotaxis. Dev Cell, 3: 469-478, induced apoptosis in human thyrocytes is mediated by 2002, p27kip1 reduction and is overridden in neoplastic thyro Jolly, C. and Morimoto, R. I. Role of the heat shock response cytes by NF-kappaB activation. Oncogene, 22:7819-7830, and molecular chaperones in oncogenesis and cell death. J 2003. 60 Natl Cancer Inst, 92: 1564-1572, 2000. Chambers, A. F., Groom, A. C., and MacDonald, I. C. Dis Kang, Y., Siegel, P. M., Shu, W., Drobnjak, M., Kakonen, S. semination and growth of cancer cells in metastatic sites. M. Cordon-Cardo, C., Guise, T. A., and Massague, J. A Nat Rev Cancer, 2:563-572, 2002. multigenic program mediating breast cancer metastasis to Chan, A.Y., Bailly, M., Zebda, N., Segall, J. E., and Condee bone. Cancer Cell, 3: 537-549, 2003. lis, J. S. Role of cofilin in epidermal growth factor-stimu 65 Larsen, M., Tremblay, M. L., and Yamada, K. M. Phos lated actin polymerization and lamellipod protrusion. J phatases in cell-matrix adhesion and migration. Nat Rev Cell Biol, 148: 531-542, 2000. Mol Cell Biol, 4: 700-711, 2003. US 8,298,756 B2 3 4 LeBedis, C., Chen, K., Fallavolita, L., Boutros, T., and Brodt, lamellipod extension in metastatic mammary adenocarci P. Peripheral lymph nodestromal cells can promote growth noma cells by an actin-dependent mechanism. Clin Exp and tumorigenicity of breast carcinoma cells through the Metastasis, 14:61-72, 1996. release of IGF-I and EGF. Int J Cancer, 100: 2-8, 2002. Shestakova, E. A., Wyckoff, J., Jones, J., Singer, R. H., and Lin, M. and Van Golen, K. L. Rho-regulatory proteins in 5 Condeelis, J. Correlation of beta-actin messenger RNA breast cancer cell motility and invasion. Breast Cancer Res localization with metastatic potential in rat adenocarci Treat, 84: 49-60, 2004. noma cell lines. Cancer Res, 59: 1202-1205, 1999. Lin, E. Y., Nguyen, A. V., Russell, R. G., and Pollard, J. W. Shestakova, E. A. Singer, R. H., and Condeelis, J.The physi Colony-stimulating factor 1 promotes progression of ological significance of beta-actin mRNA localization in mammary tumors to malignancy. J Exp Med., 193: 727 10 determining cell polarity and directional motility. Proc 740, 2001. Natl Acad Sci USA, 98: 7045-7050, 2001. Lin, E.Y., Gouon-Evans, V., Nguyen, A.V., and Pollard, J. W. Tomasovic, S. P. Rosenblatt, P. L., Johnston, D. A., Tang, K., The macrophage growth factor CSF-1 in mammary gland and Lee, P. S. Heterogeneity in induced heat resistance and development and tumor progression. J Mammary Gland its relation to synthesis of stress proteins in rat tumor cell Biol Neoplasia, 7: 147-162, 2002. 15 clones. Cancer Res, 44: 5850-5856, 1984. Liotta, L.A. and Kohn, E. C. The microenvironment of the Tusher, V.G., Tibshirani, R., and Chu, G. Significance analy tumour-host interface. Nature, 411:375-379, 2001. sis of microarrays applied to the ionizing radiation Loisel, T. P. Boujemaa, R., Pantaloni, D., and Carlier, M. F. response. Proc Natl AcadSci USA, 98: 5116-5121, 2001. Reconstitution of actin-based motility of Listeria and Shi Van Waes, C., Surh, D. M., Chen, Z. Kirby, M., Rhim, J. S., gella using pure proteins. Nature, 401: 613-616, 1999. Brager, R., Sessions, R. B., Poore, J., Wolf, G. T., and Mariadason, J. M., Arango, D., Corner, G. A., Aranes, M.J., Carey, T. E. Increase in Suprabasilar integrin adhesion mol Hotchkiss, K. A., Yang, W., and Augenlicht, L. H. A gene ecule expression in human epidermal neoplasms accom expression profile that defines colon cell maturation in panies increased proliferation occurring with immortaliza vitro. Cancer Res, 62: 4791-4804, 2002. tion and tumor progression. Cancer Res, 55: 5434-5444, Mogilner, A. and Edelstein-Keshet, L. Regulation of actin 25 1995. dynamics in rapidly moving cells: a quantitative analysis. Wang, W., Wyckoff, J. B., Frohlich, V. C., Oleynikov, Y., Biophys J, 83: 1237-1258, 2002. Huttelmaier, S., Zavadil, J., Cennak, L. Bottinger, E. P. Nicholson, R.I., Gee, J. M., and Harper, M. E. EGFR and Singer, R. H. White, J. G., Segall, J. E., and Condeelis, J. cancer prognosis. Eur J Cancer, 37 Suppl 4: S9-15, 2001. S. Single Cell Behavior in Metastatic Primary Mammary Nishitani, H. and Lygerou, Z. Control of DNA replication 30 Tumors Correlated with Gene Expression Patterns licensing in a cell cycle. Genes Cells, 7: 523-534, 2002. Revealed by Molecular Profiling Cancer Res, 62: 6278 Ohashi, K., Nagata, K., Maekawa, M., Ishizaki, T., Narua 6288, 2002. miya, S., and Mizuno, K. Rho-associated kinase ROCK Wang, W., Wyckoff, J. B. Wang, Y. Bottinger, E. P. Segall, J. activates LIM-kinase 1 by phosphorylation at threonine E., and Condeelis, J. S. Gene expression analysis on Small 508 within the activation loop. J Biol Chem, 275: 3577 35 numbers of invasive cells collected by chemotaxis from 3582, 2000. primary mammary tumors of the mouse. BMC Biotechnol, O'Sullivan, C., Lewis, C. E., Harris, A. L., and McGee, J. O. 3:13, 2003. Secretion of epidermal growth factor by macrophages Wyckoff, J. B., Jones, J. G., Condeelis, J. S., and Segall, J. E. associated with breast carcinoma. Lancet, 342: 148-149, A critical step in metastasis: in vivo analysis of intravasa 1993. 40 tion at the primary tumor. Cancer Res, 60: 2504-251 1, Parent, C. A. and DeVreotes, P.N. A cell's sense of direction. 2OOOa. Science, 284: 765-770, 1999. Wyckoff, J. B., Segall, J. E., and Condeelis, J. S. The collec Ramaswamy, S. Ross, K. N. Lander, E. S., and Golub, T. R. tion of the motile population of cells from a living tumor. A molecular signature of metastasis in primary Solid Cancer Res, 60: 5401-5404, 2000b. tumors. Nat Genet, 33: 49-54, 2003. 45 Yoshioka, K., Foletta, V., Bernard, O., and Itoh, K. A role for Real, P.J., Sierra, A., DeJuan, A., Segovia, J.C., Lopez-Vega, LIM kinase in cancer invasion. Proc Natl Acad Sci USA, J. M., and Fernandez-Luna, J. L. Resistance to chemo 100: 7247-7252, 2003. therapy via Stat3-dependent overexpression of Bcl-2 in Zebda, N., Bernard, O., Bailly, M., Welti, S. Lawrence, D.S., metastatic breast cancer cells. Oncogene, 21: 7611-7618, and Condeelis, J. S. Phosphorylation of ADF/cofilin abol 2002. 50 ishes EGF-induced actin nucleation at the leading edge and Reed, J. C. Apoptosis-targeted therapies for cancer. Cancer subsequent lamellipod extension. J Cell Biol. 151: 1119 Cell, 3:17-22, 2003. 1128, 2000. Ree, A. H., Engebraaten, O., Hovig, E., and Fodstad, O. Zhao, H., Hastie, T., Whitfield, M. L., Borresen-Dale, A. L., Differential display analysis of breast carcinoma cells and Jeffrey, S. S. Optimization and evaluation of T7 based enriched by immunomagnetic target cell selection: gene 55 RNA linear amplification protocols for cDNA microarray expression profiles in bone marrow target cells. IntJ Can analysis. BMC Genomics, 3:31, 2002. cer, 97: 28-33, 2002. Zhu, Y.Y., Machleder, E. M., Chenchik, A., Li, R., and Sie Sahai, E. and Marshall, C. J. Differing modes of tumour cell bert, P. D. Reverse transcriptase template switching: a invasion have distinct requirements for Rho/ROCK signal SMART approach for full-length cDNA library construc ling and extracellular proteolysis. Nat Cell Biol. 5: 711 60 tion. Biotechniques, 30: 892-897, 2001. 719, 2003. Zigeuner, R. Ratschek, M., Rehak, P. Schips, L., and Lang Sahai, E., Olson, M. F., and Marshall, C. J. Cross-talk ner, C. Value of p53 as a prognostic marker in histologic between Ras and Rho signalling pathways in transforma Subtypes of renal cell carcinoma: a systematic analysis of tion favours proliferation and increased motility. EMBOJ, primary and metastatic tumor tissue. Urology, 63: 651 20: 755-766, 2001. 65 655, 2004. Segall, J. E., Tyerech, S., Boselli, L., Masseling, S., Helft, J., Understanding how cancer cells spread from the primary Chan, A., Jones, J., and Condeelis, J. EGF stimulates tumor is important for improving diagnostic, prognostic and US 8,298,756 B2 5 6 therapeutic approaches that allow control of cancer metasta tissue making uncertain the identity of the collected cells and sis. Alterations in gene expression along with protein activa their behavior within the tumor before fixation. Alternative tion by cancer cells leads to transformation, proliferation, approaches involve the collection of cells from metastatic invasion, intravasation, dissemination in blood or lymphatic tumors and their expansion in culture (Clark et al., 2000; vessels and eventually growth of distant metastases. In order Kang et al., 2003; Ree et al., 2002). The pitfall of these for a tumor cell to become metastatic, it must be able to approaches is that during culturing, the gene expression pat Survive in the circulation and respond appropriately to new terns may change to represent the in vitro culture conditions environments. This includes being able to migrate both within which are likely to be irrelevant to invasion in vivo. and beyond the primary tumor, in and out of blood and lymph vessels, and to utilize growth factors available at the site of 10 SUMMARY OF THE INVENTION metastasis for attachment and growth (Lin and Van Golen, 2004). Accordingly, the inventor has developed methods of iso We have studied the motility-associated behavior of meta lating motile cells from animal tissues, and the use of those static and non-metastatic mammary tumor cell lines by intra methods to isolate metastatic cells from cancerous tissue and vital imaging within primary tumors (Farina et al., 1998a; 15 quantify expression of various genes in those cells. Wang et al., 2002; Wyckoffet al., 2000a). These studies have Thus, in some embodiments, the invention is directed to shown that the metastatic cells migrate to blood vessels and methods of isolating motile cells of interest from an animal intravasate in a series of steps that involve active cell motility tissue, where the animal tissue comprises the motile cells of and may involve chemotaxis (Wang et al., 2002; Wyckoffet interest and other motile cells. The methods comprise obtain al., 2000a: Condeelis and Segall, 2003). ing a microneedle or capillary filled with a porous matrix Many of the formative steps that determine the invasive and comprising a chemotactic factor; inserting the microneedle or metastatic potential of carcinoma cells occur within the pri capillary into the tissue for a time sufficient for the motile mary tumor. Much evidence Suggests that the progress of cells of interest to migrate into the porous matrix; expelling cells from normal to invasive and then to metastatic involves the porous matrix with motile cells from the microneedle or progressive transformation through multiple genetic alter 25 capillary; combining the porous matrix with microbeads, ations selected by the tumor microenvironment (Hanahanand where the microbeads comprise a binding partner to a Surface Weinberg, 2000). To identify the steps in progression and the marker present on the other motile cells but not the motile genes involved in metastasis, recent emphasis has been on the cells of interest; and removing the microbeads. use of molecular arrays to identify expression signatures in In other embodiments, the invention is directed to methods whole tumors with differing metastatic potential (Liotta and 30 of determining mRNA or protein expression of a gene in Kohn, 2001). A well recognized problem here is that primary motile cells of interest from an animal tissue. The methods tumors show extensive variation in properties with different comprise isolating the motile cells of interest by the method regions of the tumor having different growth, histology, and described above, then extracting the mRNA or protein from metastatic potential and where only a small Subset of cells the cells of interest, then determining mRNA or protein within the parental tumor population may be capable of 35 expression in the extraction of the cells of interest. metastasizing (Fidler and Kripke, 1977). The array data The invention is also directed to methods of determining derived from whole tumors results inevitably in averaging of whether a cancer in a tissue of a mammal is likely to metas the expression of different cell types from all of these diverse tasize. The methods comprise obtaining a microneedle or regions. The expression signature of invasive tumor cells, capillary filled with a porous matrix comprising a chemotac arguably the population essential for metastasis, may be 40 tic factor; inserting the microneedle into the cancer for a time masked or even lost because of the contribution of surround Sufficient for motile cells to migrate into the porous matrix: ing cells which represent the bulk of the tumor mass. Even so, expelling the porous matrix with motile cells from the recent studies of expression profiling of primary tumors Sug microneedle; combining the porous matrix with microbeads, gest that the metastatic potential of tumors is encoded in the where the microbeads comprise a binding partner to a Surface bulk of a primary tumor, thus challenging the notion that 45 marker present on macrophages from the tissue; removing the metastases arise from rare cells within a primary tumor microbeads; and quantifying the motile cells, where the pres acquired late during tumor progression (Ramaswamy et al., ence of more motile cells than from the tissue when noncan 2003). cerous or when comprising a non-metastatic cancer indicates This leaves us with a conundrum concerning the contribu that the cancer in the tissue of the mammal is likely to metas tion of rare cells to the metastatic phenotype. The relative 50 tasize. contribution of subpopulations of cells to the invasive and In further embodiments, the invention is directed to meth metastatic phenotype of primary tumors has not been ods of inhibiting metastasis of a cancer in a tissue of a mam assessed due to the difficulty in isolating phenotypically dis mal. The methods comprise enhancing ZBP-1 activity in the tinct cell populations from whole tumors. In addition, the tissue. metastatic cascade has been studied most heavily at the level 55 The invention is additionally directed to methods of inhib of extravasation and beyond using experimental metastasis iting metastasis of a cancer in a tissue of a mammal. The models removing the primary tumor from scrutiny. Thus, the methods comprise reducing the presence or activity of a pro microenvironment of the primary tumor that contributes to tein in the tissue, where the protein is selected from the group invasion and intravasation, and the process of selection of consisting of Arp2/3 p 16 subunit, Arp2/3 p21 subunit, alpha metastatic cells, has not been studied directly (Chambers et 60 Subunit of capping protein, beta Subunit of capping protein, al., 2002). cofilin, WAVE3, ROCK1, ROCK2, LIMK 1, PKC, LIM In this context it has become important to develop tech kinase, PAK, type II alpha isoform of PI4, 5 kinase, mena, nologies to separate pure populations of invasive cancer cells tropomyosin, calpain, gelsolin-like protein (CAPG), ZyXin, for gene expression studies. To this end, the development of Vinculin, and integrin 1. Laser Capture Microdissection (LCM) has been an important 65 The invention is further directed to methods of determining advance (Bonner et al., 1997). However, the identification of resistance of a motile cancer cell population in an animal cells within the tumor relies on morphology within fixed tissue to a chemotherapeutic agent. The methods comprise US 8,298,756 B2 7 8 obtaining the motile cancer cell population by the method Arrows indicate the final location of invading cells in both described above; contacting the motile cancer cell population frames over the time lapse interval. Scale bar=25um. Panel B with the chemotherapeutic agent at a concentration and for a shows a schematic representation of the chemotaxis based time sufficient to cause apoptosis in cancer cells Susceptible to the chemotherapeutic agent; and determining apoptosis in selection process. MTLn3-derived mammary tumors in rats the motile cancer cell population. In these embodiments, less and the microneedle collection method were used to study the apoptosis in the motile cancer cell population indicates that gene expression pattern of invasive Subpopulation of carci the motile cancer cell population is resistant to the chemo noma cells within live primary tumors. FACS sorting based therapeutic agent. on GFP expression in tumor cells was performed to isolate the general population of carcinoma cells from primary tumor, BRIEF DESCRIPTION OF THE DRAWINGS 10 RNA extraction, probe labeling and microarray analysis were carried out. Carcinoma cells from primary tumor were FACS FIG. 1, top, is an illustration of a strategy for identification sorted as described above. The resulting cells were split and of gene expression patterns in invasive cells and their func plated on Mettek dish covered with matrigel (1:5) in the tional categories. MTLn3-derived mammary tumors in rats and the microneedle collection method were used to study the 15 presence (iv) or absence of 1 nM EGF (iii) for 4 hr at 37° C. gene expression pattern of invasive subpopulation of carci The cells were then lysed directly on the dish for total RNA noma cells within live primary tumors. FACS sorting based extraction, probe labeling and microarray analysis. Genes on GFP expression in tumor cells was performed to isolate the that were up- or downregulated on control experiments (com general population of carcinoma cells from primary tumor, parison: iii vs. ii and iv vs. ii) were removed from the list of RNA extraction, probe labeling and microarray analysis were differentially expressed genes obtained when comparing i carried out as described in the Example 1 Materials and and ii. The resulting final list of 1366 genes is shown in Methods. The resulting genelist from the SAM analysis is Supplementary Table 4. presented in Supplementary Table 1. The diagram at the bot FIG. 6 is Summary diagrams showing functional categories tom is a Summary showing functional categories of the genes of the genes regulated in the invasive cells. The pie charts regulated in the invasive cells. The pie charts represent the 25 represent the relative proportion of genes in 11 categories relative proportion of genes (selected by SAM) in 6 catego based on their function using Gene-ontology Consortium ries based on their function using Gene-ontology Consortium classification. Chart A represents the relative proportion of classification. annotated spots compared to ESTs on the array. Chart B FIG. 2, Panel A is a chart indicating the relative overex shows the proportional representation of the functional pression and underexpression of pro-apoptotic and anti-apo 30 groups into which the genes annotated in A fall. Panel C ptotic genes respectively. N/F shows the relative ratios of the shows the proportional representation of the functional gene expression of invasive cells over the general population. groups into which the genes regulated in the invasive cells Panel B is a graph showing validation of microarray results fall. for selected genes by quantitative real time PCR (QRT-PCR). FIG.7, Panel A is a graph showing validation of microarray Real time PCR was performed by using the ABI 7700 and 35 results for selected genes by quantitative real time PCR (QRT SYBR Green PCR Core Reagents system (Applied Biosys PCR). Comparison of expression analyses in needle collected tems Foster City, Calif.) along with sequence-specific primer tumor cells gives similar results for cDNA microarrays and pairs for all genes tested. Results were evaluated with the ABI QRT-PCR. Panel B is a diagram summarizing results showing Prism SDS 2.0 software. Comparison of expression analyses that the minimum motility machine pathways in the invasive in needle collected invasive tumor cells gives similar results 40 cells are upregulated. Genes involved in these pathways are for cDNA microarrays and QRT-PCR. upregulated in the invasive cells as shown by microarray and FIG.3 is micrographs and a graph showing drug resistance QRT-PCR. The extent of upregulated expression is indicated in invasive cells compared to the general population of the next to each component of the pathway as NX. primary tumor measured by an apoptosis assay. The cells FIG. 8 is a diagram and photographs of ZBP-1 construct collected by the needle collection procedure were subjected 45 and overexpression in MTLn3. Panel A is a diagram of the full to drug challenge using doxorobucin (17 uM), cisplatin (50 length ZBP-1 gene was subcloned in a pMCSV neo vector and uM) or etoposide (50 uM). The apoptotic status and viability transfected into parental MTLn3 cells. The control plasmid of these cells was assessed by staining with propedium iodide used in the experiments was the pGreenLantern-1. Panel B is (PI) and Annexin V-Cy5. Micrograph. A shows the GFP chan western blots showing stable MTLn3-ZBP-1 clones 1 and nel with all the carcinoma cells. Micrograph B shows the dead 50 11B selected in the presence of neomycin. The western blots cells with PI staining, and micrograph C is the Cy5 channel on the left show the increased ZBP-1 protein expression in showing the apoptotic cells. The graph represents viability these 2 separate clones. The western blot on the right shows a status and apoptotic index of the cells after being challenged longer exposure time so that the endogenous ZBP-1 expres by the anticancer drugs. sion in wild type MTLn3 cells can be seen relative to the FIG. 4 is a schematic diagram of an apoptotic pathway 55 overexpression. indicating the pathways in which the anti- and pro-apoptotic FIG. 9 is graphs showing the effect of ZBP-1 overexpres genes are co-coordinately up- or downregulated respectively. sion. Panel A shows that ZBP-1 over expression inhibits cell The numbers in parenthesis indicate fold change in gene motility. Chemotaxis was measured in a Boyden chamber. expression in the invasive cells compared to the general popu ZBP-1 over expressing cells migrated through the filter in lation. 60 response to EGF poorly compared to the parental MTLn3 FIG. 5 is micrographs and a diagram showing in vivo cells. Panel B shows that ZBP-1 over expression inhibits selection and gene expression analysis of the highly invasive invasion as confirmed by the needle collection assay. The Subpopulation of breast cancer cells collected by chemotaxis. ability of carcinoma cells to invade microneedles placed into Panel A shows multi-photon images of a live cell collection primary tumors derived from MTLn3 cells over expressing from an MTLn3 derived tumor. GFP-expressing carcinoma 65 ZBP-1 was greatly reduced in ZBP-1 over expressing cells. cells are seen moving toward the bevel (dashed line delineates FIG. 10 is graphs showing ZBP-1 over expression inhibits edge) of a microneedle filled with matrigel and 25 nM EGF. tumor invasion and metastasis. ZBP-1 over expressing cells US 8,298,756 B2 10 show lower metastatic potential. The number of tumor cells formulate a binding partner for any particular motile cell of present in circulating blood (Panel A), and the number of lung interest/other motile cell combination without undue experi metastatic tumors (Panel B) were greatly reduced in animals mentation. with tumors prepared with cells over expressing ZBP-1 As used herein, “antibody' includes the well-known natu (p<0.05, by Mann-Whitney Test). However, as shown in 5 rally occurring immunoglobulin molecules as well as frag Panel C, tumor growth was not affected by increasing the ments thereof that comprise a typical immunoglobulin anti expression of ZBP-1. gen binding site (e.g., Fab or Fab2). The antibodies can be from a polyclonal, monoclonal, or recombinant source, and DETAILED DESCRIPTION OF THE INVENTION can be of any vertebrate (e.g., mouse, chicken, rabbit, goat or 10 human), or of a mixture of vertebrates (e.g., humanized The present invention is based on the development of meth mouse). ods of isolating motile cells, especially motile (metastatic) These methods are also not narrowly limited to any par cancer cells from animal tissues, and the use of those methods ticular microbeads for binding the other motile cells. For to quantify expression of various genes in those motile cells. example, the microbeads can be heavy particles that are pel 15 leted under centrifugal conditions that do not pellet the motile Thus, in some embodiments, the invention is directed to cells of interest. Alternatively, the microbeads can be buoyant methods of isolating motile cells of interest from an animal particles that are not pelleted under centrifugal conditions tissue, where the animal tissue comprises the motile cells of that pellet the motile cells of interest. In preferred embodi interest and other motile cells. The methods comprise obtain ments, the microbeads are colloidal Super-paramagnetic ing a microneedle or capillary filled with a porous matrix beads as described in Wang et al., 2003. comprising a chemotactic factor; inserting the microneedle or The chemotactic factor can be any factor capable of attract capillary into the tissue for a time sufficient for the motile ing the motile cells of interest. Where the motile cells of cells of interest to migrate into the porous matrix; expelling interest are cancer cells, a preferred chemotactic factor is an the porous matrix with motile cells from the microneedle or epidermal growth factor. capillary; combining the porous matrix with microbeads, 25 Although the other motile cells in the examples herein and where the microbeads comprise a binding partner to a Surface in Wang et al., 2003 are Substantially macrophages, it is marker present on the other motile cells but not the motile anticipated that other normal stromal cells such as fibroblasts cells of interest; and removing the microbeads. Some pre or eosinophils may be predominant in other applications, e.g., ferred embodiments of these methods are described in Wang where the cancer is in tissues other than mammary tissue. It is et al., 2003. 30 believed that the skilled artisan could easily identify binding These methods can be used with tissue from any animal. partners that are effective for removal of any other motile cells Preferably, the animal is a vertebrate, more preferably amam without undue experimentation. mal, for example a rodent or a human. The motile cells of interest for these methods are not lim Any tissue in the animal can be utilized in these methods, ited to cancer cells, and can be normal Stromal cells such as 35 macrophages. Additionally, the other motile cells (such as where the tissue has motile cells that are directed toward a macrophages where the motile cells of interest are cancer chemotactic factor. Preferably, the issue is cancerous, since cells) can be retained and further analyzed, since they are the isolation of motile cells from cancerous tissue is particu generally isolated in essentially pure form on the microbeads. larly useful, e.g., for determining the metastatic potential of The further analysis can include, e.g., quantitation of the the cancer. A non-limiting example of a tissue useful for these 40 cells, or analysis of mRNA or protein expression. methods is mammary tissue. See examples. These methods are generally useful for isolating live motile The methods can be used with tissue in culture, tissue taken cells of interest in highly enriched form, such that culture of from a biopsy, or directly on tissue in a living mammal. the cells, and/or further analysis, can be performed. For These methods are not narrowly limited to the use of any example, the cells can be quantified, in order to approximate particular porous matrix. The matrix must only allow motile 45 the number of motile cells of interest present in a given cells in the tissue to move through the matrix in response to amount of tissue, or to compare the amount of motile cells of the chemotactic factor. In preferred embodiments, the matrix interest to the amount of the other motile cells. is matrigel, since that matrix is similar chemically to verte In some preferred embodiments, mRNA or protein expres brate extracellular matrix. sion of at least one gene is determined in the motile cells of The methods are also not limited to any particular micron 50 interest. See Example 2, where mRNA expression of various eedle or capillary; the microneedle or capillary must only be genes is quantified in the motile cells of interest (carcinoma of sufficient bore to be capable of being filled with the porous cells) and compared with expression of the same genes in matrix and to allow the motile cells to move into the matrix in other carcinoma cells in the same tissue. response to the chemotactic factor. In some preferred embodi As shown in Example 2, motile breast carcinoma cells have ments, a microneedle is used; a preferred bore is 33-gauge. 55 significantly higher mRNA expression of Arp2/3 p 16 subunit, Any binding partner capable of binding to the other motile Arp2/3 p21 subunit, alpha Subunit of capping protein, beta cells but not the motile cells of interest, and capable of being subunit of capping protein, cofilin, WAVE3, ROCK1, bound (either covalently or noncovalently) to a microbead ROCK2, LIMK1, PKC., LIM-kinase, PAK, type II alpha can be used. Nonlimiting examples include aptamers or, pref isoform of PI4, 5 kinase, mena, tropomyosin, calpain, gelso erably, antibodies or antibody fragments, where the binding 60 lin-like protein (CAPG), ZyXin, Vinculin, integrin B1, tight site is preferably specific for a cell surface marker present on junction protein 2, member Ras oncogene family, and epider the surface of the other motile cells but not the motile cells of mal growth factor receptor than nonmotile carcinoma cells interest. For example, where the motile cells of interest are from the same tissue, indicating involvement of these genes in carcinoma cells and the other motile cells are macrophages, a the metastatic phenotype. Additionally, mRNA expression of preferred microbead has antibodies specific for CD11b, 65 ZBP-1, collagen type III C1, G-protein coupled receptor 26, which is present on the Surface of macrophages but not car and fibroblast growth factor receptor 1 is significantly cinoma cells. See Wang et al., 2003. The skilled artisan could reduced in motile breast carcinoma cells when compared to US 8,298,756 B2 11 12 the nonmotile carcinoma cells, indicating a role of these mRNA expression of the group collagen type III C.1, G-pro proteins in regulation of metastasis. Additionally, when tein coupled receptor 26, ZBP-1, fibroblast growth factor ZBP-1 is overexpressed in a carcinoma cell line, motility of receptor 1, Arp2/3 p16 Subunit, tightjunction protein 2, mem the cells is greatly reduced (Example 2), further establishing ber Ras oncogene family, and epidermal growth factor recep the role of ZBP-1 in metastasis regulation. Thus, determina 5 tor is desirable to identify a characteristic signature of tion of protein, or, preferably, mRNA expression of any of metastasis. those genes, especially ZBP-1 is particularly desirable. The present invention is also directed to methods of deter As shown in Table 2 and the accompanying discussion in mining whether a cancer in a tissue of a mammal is likely to Example 2, motile cancer cells have a characteristic pattern of metastasize. The method comprises obtaining a microneedle downregulation of collagen type III C.1, G-protein coupled 10 or capillary filled with a porous matrix comprising a chemo receptor 26, ZBP-1, and fibroblast growth factor receptor 1, tactic factor; inserting the microneedle into the cancer for a and upregulation of Arp2/3 p16 subunit, tightjunction protein time sufficient for motile cells to migrate into the porous 2, member Ras oncogene family, and epidermal growth factor matrix: expelling the porous matrix with motile cells from the receptor. Thus, it is also preferred that protein or, especially, microneedle or capillary; combining the porous matrix with mRNA expression is determined in at least two, and prefer 15 microbeads, where the microbeads comprise a binding part ably all, of those genes. ner to a Surface marker present on macrophages from the When analysis of mRNA or protein expression of more tissue; removing the microbeads; and quantifying the motile than one gene is desired, microarray technology can be cells, where the presence of more motile cells than from the employed. This well-established technology can analyze tissue when noncancerous or when comprising a non-meta mRNA or protein expression of many thousands of genes at static cancer indicates that the cancer in the tissue of the once, allowing comparison of expression of, e.g., an entire mammal is likely to metastasize. Since the motile cell isola genome between motile and non-motile cells. tion method isolates metastatic cells from cancerous tissue, These methods are capable of isolating a few hundred the presence of more motile cells from a cancerous tissue than motile cells from a tissue. This typically provides 20-50 ng of from a normal tissue establishes that the cancerous tissue as total RNA, which is insufficient for array analysis. Therefore, 25 metastatic potential. These methods are useful for analyzing the mRNA from these cells is preferably amplified prior to the potentially metastatic cancer in any tissue. In some preferred determination of expression of the genes. Preferably, the embodiments, the tissue is mammary tissue, since breast car amplification is by reverse transcription and cDNA amplifi cinoma is often metastatic. cation. A preferred method is the SMART PCR cDNA ampli These methods can be used with any animal. Preferably, fication method (ClonTech Laboratories). See Wang et al., 30 the animal is a mammal, such as a rodent or a human. 2003. As established in Wang et al., 2003, and Example 2, where The motile cells of interest can also be tested for resistance the cancer is a carcinoma, and in particular a breast cancer, to chemotherapeutic agents. See Example 1. common other motile cells in these methods are macroph In other embodiments, the invention is directed to methods ages. In those cases, a preferred binding partnerisan antibody of determining mRNA or protein expression of a gene in 35 is specific for CD11b. Additionally, where the cancer is a motile cells of interest from an animal tissue. The methods carcinoma, a preferred chemotactic factor is an epidermal comprise isolating the motile cells of interest by the method growth factor. described above, then extracting the mRNA or protein from The motile cells resulting from these methods can be quan the cells of interest, then determining mRNA or protein tified by any known method. Preferred methods include the expression in the extraction of the cells of interest. Preferably, 40 use of a fluorescence-activated cell sorter, after labeling the mRNA or protein expression of more than one gene is deter cells with a fluorescent marker by known methods. Alterna mined, for example using a microarray by known methods. tively, the motile cells may be quantified by simple micro When mRNA expression is determined using these meth scopic observation, e.g., with a hemocytometer. ods, the mRNA is preferably extracted and amplified in the As described above, the microneedle or capillary is a pref motile cells of interest, then mRNA expression of the gene(s) 45 erably a microneedle, and the porous matrix preferably com are determined from the amplified mRNA. As described prises matrigel. above, the mRNA in these methods is preferably amplified by As established in Example 2, enhancing ZBP-1 activity in reverse transcription and cDNA amplification. a cancerous tissue decreases the metastatic potential in that In these methods, the animal is preferably a vertebrate; tissue. Also, since collagen type III C.1, G-protein coupled more preferably the animal is a mammal. Such as a rodent or 50 receptor 26, and fibroblast growth factor receptor 1 are char a human. acteristically decreased in metastatic cells, decreasing the These methods are particularly useful for analysis of expression or activity of those proteins would also be motile cells of interest in cancerous tissue, for example car expected to decrease the metastatic potential of cancer cells. cinoma tissue. Such as breast cancer in mammary tissue. See Thus, the present invention is further directed to methods of Example 2. As with the methods described above, these meth 55 inhibiting metastasis of a cancer in a tissue of a mammal. The ods can be used with tissue in culture, tissue taken from a methods comprise enhancing collagen type III C.1, G-protein biopsy, or directly on tissue in a living mammal. coupled receptor 26, fibroblast growth factor receptor 1, or As discussed above, preferred genes for determination of especially ZBP-1 activity in the tissue. It is anticipated that protein or mRNA expression are Arp2/3 p 16 subunit, Arp2/3 these methods are particularly useful for treatment of breast p21 subunit, alpha Subunit of capping protein, beta subunit of 60 CaCC. capping protein, cofilin, WAVE3, ROCK1, ROCK2, LIMK1, In some embodiments of these methods, the collagen type PKC, LIM-kinase PAK, type II alpha isoform of PI4, 5 III C1, G-protein coupled receptor 26, ZBP-1, or fibroblast kinase, mena, tropomyosin, calpain, gelsolin-like protein growth factor receptor 1 activity is enhanced by transfecting (CAPG), ZyXin, Vinculin, integrin B1, collagen type III C.1. the tissue with a vector comprising a collagen type III C.1. G-protein coupled receptor 26, ZBP-1, fibroblast growth fac 65 G-protein coupled receptor 26, ZBP-1, or fibroblast growth tor receptor 1, tightjunction protein 2, member Ras oncogene factor receptor 1 transgene, where the collagen type III C.1. family, and epidermal growth factor receptor. In particular, G-protein coupled receptor 26, ZBP-1, or fibroblast growth US 8,298,756 B2 13 14 factor receptor 1 transgene is translated from the vector in the dependent on the secondary structure formed by the aptamer tissue. Such methods, and vectors for executing those meth oligonucleotide. Both RNA and single stranded DNA (or ods, are well known in the art, and can be established by a analog), aptamers are known. skilled artisan without undue experimentation. Aptamers that bind to virtually any particular target can be In other embodiments, the collagen type III C.1, G-protein 5 selected by using an iterative process called SELEX, which coupled receptor 26, ZBP-1, or fibroblast growth factor stands for Systematic Evolution of Ligands by EXponential receptor 1 activity is enhanced by adding a pharmaceutical enrichment. Several variations of SELEX have been devel composition of collagen type III C.1, G-protein coupled oped which improve the process and allow its use under receptor 26, ZBP-1, or fibroblast growth factor receptor 1 particular circumstances. See the references cited in PCT/ protein to the tissue. Preferably, the pharmaceutical compo 10 US04/15752, all of which are incorporated by reference. sition comprises an agent to enhance penetration of the col The invention is further directed to methods of determining resistance of a motile cancer cell population in an animal lagen type III C.1, G-protein coupled receptor 26, ZBP-1, or tissue to a chemotherapeutic agent. The methods comprise fibroblast growth factor receptor 1 protein into the cell, such obtaining the motile cancer cell population by the methods as liposomes, etc., the use of which are well known in the art. 15 described above; contacting the motile cancer cell population Example 2 also establishes that several genes are upregu with the chemotherapeutic agent at a concentration and for a lated in metastatic tissue. It is therefore anticipated that time sufficient to cause apoptosis in cancer cells Susceptible metastasis can be inhibited by reducing the activity of these to the chemotherapeutic agent; and determining apoptosis in genes in a cancer having metastatic potential. Thus, the inven the motile cancer cell population. In these embodiments, less tion is additionally directed to methods of inhibiting metasta apoptosis in the motile cancer cell population indicates that sis of a cancerina tissue of a mammal. The methods comprise the motile cancer cell population is resistant to the chemo reducing the presence or activity of a protein in the tissue, therapeutic agent. See Example 1 for some preferred embodi where the protein is a protein whose expressionisupregulated ments of these methods. in metastatic cells. Examples of such proteins are Arp2/3 p16 Examples of chemotherapeutic agents that can be utilized Subunit, Arp2/3 p21 Subunit, alpha Subunit of capping protein, 25 in these embodiments are doxorobucin, cisplatin, or etopo beta subunit of capping protein, cofilin, WAVE3, ROCK1, side. ROCK2, LIMK1, PKC., LIM-kinase, PAK, type II alpha Preferred embodiments of the invention are described in isoform of PI4, 5 kinase, mena, tropomyosin, calpain, gelso the following examples. Other embodiments within the scope lin-like protein (CAPG), ZyXin, Vinculin, integrin B1, tight of the claims herein will be apparent to one skilled in the art junction protein 2, member Ras oncogene family, and epider 30 from consideration of the specification or practice of the mal growth factor receptor. invention as disclosed herein. It is intended that the specifi cation, together with the examples, be considered exemplary The presence of any of these proteins can be reduced with only, with the scope and spirit of the invention being indicated out undue experimentation by addition of an antisense mol by the claims, which follow the examples. ecule, a ribozyme, or an RNAi molecule to the tissue, where 35 the antisense molecule, ribozyme or RNAi molecule specifi Example 1 cally inhibits expression of the protein. In these embodi ments, the antisense molecule, ribozyme, or RNAi molecule Breast Cancer Cells Isolated by Chemotaxis from can be comprised of nucleic acid (e.g., DNA or RNA) or Primary Tumors Show Increased Survival and nucleic acid mimetics (e.g., phosphorothionate mimetics) as 40 Resistance to Chemotherapy are known in the art. Methods for treating tissue with these compositions are also known in the art. In some embodi Example Summary ments, the antisense molecule, ribozyme or RNAi molecule A novel observation resulting from intravital imaging of can be added directly to the cancerous tissue in a pharmaceu these tumors is the dramatic fragmentation of carcinoma cells tical composition that preferably comprises an excipient that 45 when in contact with blood vessels in non-metastatic tumors enhances penetration of the antisense molecule, ribozyme or (Wyckoff et al., 2000a) compared with the ability of carci RNAi molecule into the cells of the tissue. In other embodi noma cells in metastatic tumors to enter blood vessels as ments, the antisense molecule, ribozyme or RNAi is intact whole cells. This suggests a Survival advantage for expressed from a vector that is transfected into the cancerous metastatic cells during migration and intravasation. tissue. Such vectors are known in the art, and these embodi 50 In the current study we have collected a migratory popu ments can be developed for any of the subject proteins with lation of carcinoma cells by chemotaxis to EGF containing out undue experimentation. microneedles held in the primary tumor. The collected cells In other embodiments, the presence or activity of the pro were Subjected to microarray analysis for differential gene tein is reduced by addition of an antibody or aptamer to the expression. The results show that anti-apoptotic genes are up tissue, wherein the antibody oraptamer specifically binds and 55 regulated and pro-apoptotic genes are down regulated coor reduces the activity of the protein in the tissue. The antibody dinately in the migratory Subpopulation. Induction of apop oraptamer can be added directly to the tissue, preferably in a tosis by doxorubicin, cisplatin and etoposide in these cells pharmaceutical composition comprising an agent that demonstrates that they exhibit a lower drug induced apoptotic enhances penetration of the antibody or aptamer into the index and lower cell death as compared to carcinoma cells of tissue. Alternatively, the antibody oraptamer can be encoded 60 the whole tumor. Our study indicates, for the first time, the on a vector that is used to transfect the cancerous tissue. capability of using a rat allograft model for evaluating the Aptamers are single stranded oligonucleotides or oligo apoptotic status of a migratory Subpopulation of tumor cells nucleotide analogs that bind to a particular target molecule, and the ability to study their resistance to chemotherapeutic Such as a protein or a small molecule (e.g., a steroid or a drug, agents directly. In addition, these results indicate that tumor etc.). Thus, aptamers are the oligonucleotide analogy to anti 65 cells that are chemotactic and migratory in response to EGF in bodies. However, aptamers are Smaller than antibodies, gen the primary tumor have a survival advantage over stationary erally in the range of 50-100 nt. Their binding is highly tumor cells. US 8,298,756 B2 15 16 Introduction Quality control and data analysis for microarrays. The Recently we have shown that microarray based gene scanned images were analyzed using the Software Genepix expression studies can be successfully performed on cells (AXon Instruments, Inc. CA) and an absolute intensity value collected by chemotaxis into microneedles held in the pri was obtained for both the channels. The entire raw data set mary tumor (Wang et al., 2003). In the current example we was filtered to accommodate a requirement of at least 2 good have combined this method with the analysis of pro- and quality measurements for each triplicate experiment. Values anti-apoptosis gene expression to determine if migratory cells from only the good quality measurements (where the signal in the primary tumor have a Survival advantage over that of strength was more than twice the standard deviation of the sedentary carcinoma cells within the same tumor. In addition, background plus the background) were considered for further anticancer drugs designed against the proliferative property 10 analysis. Two types of normalization were performed rou of cancer cells were used to investigate if the migratory cells tinely in tandem on all the experiments using the GeneSpring respond equally to the antiproliferative drugs compared to software package (Silicon Genetics, Redwood City, Calif.). their non-migratory counterparts. First, intensity-based-normalization was performed to take Materials and Methods into consideration the overall signal strength of both channels 15 and normalize the signal strength between all the different Needle collection and FACS sorting of primary tumor chips, reducing the chance of chip-to-chip variability. Sec cells. We used MTLn3-derived mammary tumors in rats (Fa ond, a reference channel-based normalization was performed rina et al., 1998a), and the microneedle collection method which takes into consideration the reference channel (which described previously (Wyckoff et al., 2000b, Wang et al., in this case is pooled reference RNA) and normalizes the 2003), to study the gene expression pattern of invasive sub values in all the spots. This reduces the chance of spot to spot population of carcinoma cells within live primary tumors. variability. The final data was a result of both these types of Briefly, the invasive cells were collected from MTLn3 tumor normalization. using microneedles containing EGF. Macrophages were Significance analysis of microarrays. In order to determine removed from this population by using MACSCD11b Micro the significance of up-regulated and down-regulated genes, beads (Miltenyi Biotec) as described before (Wang et al., 25 we performed significance analysis using the Software Sig 2003). The residual carcinoma cells were lysed for RNA nificance Analysis of Microarrays (SAM) (8). Briefly after extraction. To isolate the general population of carcinoma normalizing the data as mentioned above the data was log cells from primary tumor, a small piece tumor was minced, transformed to Log 2 and subjected to SAM analysis. The and filtered twice through a nylon-filter to obtain a single cell algorithm performs a significance analysis by comparing the Suspension. FACS sorting was performed on the resulting 30 relative variance of the replicates between the samples. The single cell suspensions based on their GFP expression in result were determined at 5% False Discovery Rate (FDR). tumor cells using a Becton Dickinson (San Jose, Calif.) Real time PCR confirmation. To verify the data obtained FACSVantage cell sorter. GFP-positive tumor cells were col from microarrays, QRT-PCR analysis of selected over lected and lysed directly for RNA extraction. All the proce expressed and under expressed genes was performed by using dures were done on ice or 4°C. 35 the ABI 7900 (Applied Biosystems, Foster City, Calif.) with RNA extraction and amplification. RNA extraction was sequence-specific primer pairs for all genes tested (see performed using the RNeasy kit (QIAGEN), as per manufac Supplement Table 2 for primer sequences, amplicon size and turer's protocol and eluted with 30 ul RNase-free water. The annealing temperature) as described previously (Wang et al., total RNA was reverse-transcribed and amplified directly 2002). SYBR Green was used for real-time monitoring of using the SMART PCR cDNA synthesis kit (Clontech, Palo 40 amplification. Results were evaluated with the ABI Prism Alto, Calif.) as described previously (Wang et al., 2003). SDS 2.0 software. All the genes tested for regulation were Use of pooled reference RNA as control. An equal quantity compared to at least two housekeeping genes (Beta actin and of reference RNA (pooled RNA from rat liver, spleen, brain GAPDH). and kidney, 4:2:1:1, Ambion Tex.) was used as a control in all Cell culture and apoptosis assay. The cells extruded from our microarray experiments, which allowed us to use one of 45 the needles and tumor cells FACS sorted were cultured in the channels as a hybridization control for all the spots on the DMEM20% FCS along with streptomycin and penicillin, for microarray. The use of pooled reference RNA from the same 16 hrs. Subsequently, the cells were challenged with either species as the MTLn3 cells allowed the same interspecies doxorobucin (17 uM) or cisplatin (50 uM) or etoposide (50 cross hybridization as the background, allowing us to use uM) for 1 hr., washed and allowed to recover for 24 hrs. The Mouse cDNA microarrays for our experiments. The pooled 50 cells were then subjected to an apoptosis assay kit containing reference RNA covers a very broad range of gene expression Annexin V Cy5 for staining the apoptotic cells and Prope and is routinely used as controls in cDNA microarray studies dium Iodide (PI) for staining the dead cells (BD Biosciences (Zhao et al., 2002). San Jose, Calif.). After staining the cells using the manufac Probe labeling and microarray hybridization. After ampli turer's protocol, the cells were observed under a fluorescent fication, cDNAs were purified using the QIAquick PCRPuri 55 microscope in the green, red and high red channel for GFP, PI fication Kit (Qiagen) and eluted with TE buffer. Labeling was and Cy5 respectively. The total number of GFP cells counted performed using Label ITR (Mirus) following the manufac was compared to the number of PI positive and Annexin turer's instructions. Briefly, labeling reactions were prepared V-Cy5 positive cells. by mixing 10x Mirus Labeling Buffer A, purified cDNA and Results and Discussion Cy5 (or Cy3) dye. After incubating the reaction mix at 37°C. 60 GFP-labeled tumor cells were injected into rat mammary for 1 hour, the two resulting probes were purified by passing fat pads, and primary tumors were allowed to grow for 2-2.5 through gel filteration columns. The purified probes were weeks. To provide insight into the pattern of gene expression then combined and concentrated using Microcon columns. associated with chemotactic and migratory carcinoma cells in The concentrated cDNA probes were denatured at 94°C., and Vivo, we compared the gene expression profile of a Subpopu hybridized to an arrayed slide overnight at 50° C. Details of 65 lation of tumor cells collected from the primary tumor by slide washing and image collection were described in previ chemotaxis into a microneedle, called the invasive cells, with ous studies (Wang et al., 2002; Wang et al., 2003). that of the general population of GFP-expressing tumor cells US 8,298,756 B2 17 18 sorted from the whole primary tumor by FACS sorting (FIG. In addition, the anti-apoptotic and pro-apoptotic genes are 1). Differential gene expression analysis comparing the inva inversely regulated in the chemotactic and migratory popula sive and general populations of tumor cells was performed tion of cells in the primary tumor (FIG. 2A). The ratio of using SAM analysis at 5% FDR level revealing 679 genes that expression of each gene in the invasive cells, when compared were differentially expressed significantly relative to all to the general population indicates that a significant number genes on the array (Supplementary Table 1). The genes that of the anti-apoptotic genes were up regulated while the pro are previously known to be associated with the EGF response apoptotic genes were unregulated or down regulated. This is (28 genes) were removed from this population. As shown in consistent with a previous study where the apoptosis Suppres FIG. 1, genes with known functions whose regulation was sor genes were up regulated in a cell line (MTLn3), which changed in the chemotactic and migratory population of cells 10 causes metastasis in vivo when compared to another cell line in the primary tumor were divided into six different func from the same lineage (MTC), which does not (Wang et al., tional categories based on the definitions provided by the 2002). In the current study we show a similar difference gene-ontology consortium (http://www.geneontology.org/). between the invasive and general populations of the primary It was evident that amongst the functional categories men 15 tumor even though the tumor is derived from the same paren tioned here the largest change in the number of regulated tal cells (MTLn3). This is important because it means that the genes was observed in the genes associated with the cell cycle microenvironment that induces the chemotactic and migra indicating a large change in the cell proliferation pattern of tory behavior of tumor cells induces the survival expression migratory cells. A detailed scrutiny of these cells showed that pattern in cells with a previously identical genetic back the genes associated with increasing cell proliferation were ground. We verified the array results using real time PCR for downregulated and those genes associated with a reduction in selected genes belonging to the functional category of apop cell proliferation were upregulated. tosis. As shown in FIG. 2B, the same pattern of expression Another category of genes found to be significantly regu was observed in the invasive cells with both microarray and lated in the chemotactic and migratory population of cells in real time PCR analysis using gene specific primers (see the primary tumor is that of cell motility. These genes have 25 Supplementary Table 2). been explained in detail in an accompanying paper. Since Drug resistance in invasive cells measured by apoptosis there are 5 steps of the motility cycle which are coordinated to assay. The finding that the anti-apoptotic genes are up regu assure efficient cell motility, the up regulation of genes for lated in the invasive cells prompted us to study the functional major effectors in the pathways of each step predicts that the importance of this finding and whether these cells indeed invasive cells will have a heightened migratory activity com 30 have a survival advantage over the resident population. We pared to carcinoma cells of the general tumor population and challenged the invasive cells with three most commonly used this is consistent with the high velocities of migration seen in anticancer drugs, doxorobucin, cisplatin and etoposide. Pre tumors (Condeelis and Segall, 2003). vious studies have shown that these drugs to induce apoptosis Regulation of pro and anti-apoptotic genes along with in the MTLn3 cells (Huigsloot et al., 2002). We performed mechanical stability genes. Of particular relevance to Sur 35 these studies on the invasive and general populations of cells vival, stress and apoptosis associated genes showed large from MTLn3-derived tumors. After treatment with the drugs changes in regulation (FIG. 2). The up regulation of the heat the cells were allowed to recover for 24hr. Subsequently, the shock proteins indicates a Survival phenotype (Jolly and apoptotic index and cell viability was measured as described Morimoto, 2000). This is particularly interesting here as the in the Methods section. The results, shown in FIG. 3, dem MTLn3 cells used to generate the primary tumors in this study 40 onstrate that as a percentage of all the carcinoma cells the have been shown to over express heat shock proteins as com invasive cells are able to tolerate all three drugs better than the pared to non-metastatic cell lines (MTC) derived from the general population of tumor cells. The process of FACS sort same tumor (10). This indicates that in the chemotactic and ing by itself did not cause any change in the apoptotic index of migratory population of cells in the primary tumor there is a the tumor cells (data not shown). further up regulation of the heat shock gene expression over 45 Most of the anticancer drugs like doxorobucin, cisplatin that in the MTLn3 cells used to generate the primary tumor. and etoposide are designed against the proliferative cells A potential explanation for mechanical stability and Sur (Awada et al., 2003) making them cytotoxic. Recently, there vival advantage observed in invasive cells (Jolly and is an increasing effort to make cytostatic drugs, which prevent Morimoto, 2000; Condeelis et al., 2003) is the large relative the proliferation and invasion as opposed to killing the cells. over expression of cytokeratins by carcinoma cells and the 50 There has been a demand in the field to have a method to Suppression of apoptosis gene expression in metastatic isolate these invasive cells and look for the effect of cytostatic tumors and cell lines (Wang et al., 2002). Keratins form the drugs specifically on invasive cells. We believe that in our largest Subfamily of intermediate filament proteins that play studies we have demonstrated a method that makes possible critical roles in the mechanical stability of epithelial cells this analysis on migratory cells of the primary tumor. subjected to shear forces (Coulombe and Omary, 2002). In 55 Coordinate regulation of Survival genes in the invasive addition, it was found that carcinoma cells in metastatic cells. Previous studies have shown that the anti-apoptotic tumors and in culture express laminins and cadherins and pathways are overexpressed in the metastatic cell lines (Real apoptosis Suppressor genes at high levels, all of which might et al., 2002), and these cells have a survival advantage via contribute to Survival during intravasation and in the circula Stat3 dependent over expression of BCL-2. In our study we tion (Wang et al., 2002). In contrast, carcinoma cells in non 60 find that a number of anti-apoptotic genes are upregulated. metastatic tumors and in culture express genes involved in These genes belong to all three pathways, rendering a survival programmed cell death at higher levels. The combination of advantage to the cells. On one hand upregulation of the these factors may contribute to the increased numbers of defender against death 1 (DAD1) gene indicates that the viable carcinoma cells in the circulation of metastatic tumors extrinsic pathway is blocked in these invasive cells. On the and to fragmentation during intravasation and cell death seen 65 other hand there are signs of down regulation of the intrinsic in non metastatic tumors (Wyckoffet al., 2000a: Condeelis et pathway as well by the over expression of ornithine decar al., 2003). boxylase 1 (ODC1). Upregulation of the expression of apo US 8,298,756 B2 19 20 ptosis inhibitor 1, 4 and 5 (Apil, Api4 and Apiš) genes indi metastatic cell lines. We identified genes important for the cate an involvement of the convergence pathway as well. invasion of tumor cells in this study. We demonstrate that the Finally there is the robust over expression of the genes like identification of these genes provides new insight for the immediate early response gene 3 (IER3) which is a multi invasion process and the regulation of invasion and demon pathway regulator involving the NFkB family of transcription strate the importance of these pathways in invasion and factors (Reed, 2003). Simultaneously a number of the pro metastasis by altering the expression of a master gene, ZBP-1. apoptotic were down regulated, significantly a key regulator Introduction of the intrinsic pathway APAF-1 was down-regulated in the A potential approach to determine the cellular mechanisms invasive cells. FIG. 4 Summarizes these findings and indicates that contribute to invasion is to collect live cells from the the extent of change that occurs in the transcriptome of inva 10 primary tumor based on their ability to invade, and profile sive cells. their gene expression patterns. One of the properties corre In the current study we have attempted to investigate the pathways leading to metastasis, which provides this Survival lated with metastasis is chemotaxis to blood vessels (Wyckoff advantage to these cells. In previous studies, authors have et al., 2000a). This cell behavior allows cells to orient and used cell lines derived from an established secondary tumor 15 move toward blood vessels facilitating their intravasation. (Real et al., 2002). We on the other hand have performed a Based on these observations, we have developed a comple dynamic assessment of the process of metastasis and have mentary approach to directly select for live, invasive cells captured the cells prior to the entry into the blood. from live primary tumors in intact rats using a microneedle In our studies we have identified pathways, which get containing a chemoattractant to mimic chemotactic signals regulated in the invasive cells, which are not proliferative from blood vessels and/or surrounding tissue (Wyckoffetal. (FIG. 1). The majority of the genes indicated in the functional 2000b). Overexpression of the EGF receptor and other family category of "cell cycle' are genes that cause a reduction in cell members has been correlated with poor prognosis (Nicholson proliferation and prevent the progression of the cell cycle. et al., 2001), and therefore we have developed methods for Recent studies have shown that the overexpression of Bcl2 in collecting invasive tumor cells that use gradients of EGF to MTLn3 cells causes the cells to become resistant to dox 25 direct tumor cell invasion into microneedles. Gradients of orobucin (Huigsloot et al., 2002) as observed by a reduction EGF receptor ligands can be generated by diffusion from the in drug-induced DNA fragmentation. Previous studies using blood as well as stromal cells in the tumor microenvironment cell lines derived from metastatic and resident cells from (O'Sullivan et al., 1993; LeBedis et al., 2002). Thus we are human breast adenocarcinoma have shown that the metastatic using a physiologically relevant stimulus to mimic tumor cell cell line was more resistant to anti-cancer drug treatment than 30 invasion induced at the borders of tumors near blood vessels the cell line from the primary tumor. However, it remains and other elements of connective tissue. We have used this unknown at which stage of cancer progression (i.e. transfor method to test the hypothesis that chemotaxis to blood vessels mation, proliferation, invasion, intravasation, dissemination is an important form of egress of carcinoma cells from the of metastases) the selection of the cells that have a survival primary tumor. Cells have been collected from live rats with advantage occurs. In this paper we show for the first time that 35 tumors that have been generated by the injection of carcinoma this selection of cells with a survival advantage probably cells with different metastatic potential (Wyckoff et al., takes place at the very initial stage of invasion, as evident by 2000b), and from live mice with mammary tumors derived the overexpression of anti-apoptotic genes and resistance to from the expression of the PyMT oncogene (Lin et al., 2002: anticancer drugs by the invasive cells. The gene expression Lin et al., 2001; Wang et al., 2003). pattern observed here is associated with an invasive signature 40 In order to perform gene expression profiling using high unique to these cells. Hence we have identified an expression density arrays on the few hundred cells commonly collected pattern of Survival genes that offer a Survival advantage to in microneedles, it is necessary to amplify mRNA by about non-proliferating invasive cells. 1000 fold to the amounts required for arrays. It is also neces sary to have a pure cell population. Both of these conditions Example 2 45 have been met using recently developed methods (Wang et al., 2003). RNA obtained from as few as 400 cells collected in Identification and Testing of a Gene Expression a single microneedle from the primary tumor, when amplified Signature of Invasive Carcinoma Cells Within as cDNA using the PCR based cDNA amplification technique Primary Mammary Tumors (18), can be used for microarray expression analysis. We have 50 validated this amplification method and demonstrated that it Example Summary retains the original mRNA's copy abundance and complexity We combined chemotaxis-based cell collection and cDNA in the amplified product (Wang et al., 2003). microarray technology to identify the gene expression profile In the current study, the collection of invasive cells from the of invasive carcinoma cells from primary mammary tumors in primary tumor using chemotaxis is combined with gene experimental animals. Expression of genes involved in cell 55 expression profiling using the above-described PCR based division and Survival, metabolism, signal transduction at the cDNA amplification techniques. This technology has allowed membrane, and cell motility were most dramatically the characterization of gene expression patterns of invasive increased in invasive cells, indicating a population that is not carcinoma cells from the primary tumor without potential dividing but intensely metabolically active and motile. In artifacts that arise from the culturing of Small populations of particular, the genes coding for the minimum motility 60 cells. We identified a group of genes that define motility machine that regulates B-actin polymerization, and therefore pathways that are coordinately up regulated in invasive cells. the motility of carcinoma cells, were dramatically up regu These pathways may account for the enhanced migratory lated, while ZBP-1, which regulates the localization of B-ac behavior of the collected cells. Furthermore, we tested the tin, was downregulated. This pattern of expression Suggested contribution of these pathways to invasion and metastasis by ZBP-1 is a suppressor of invasion. Overexpression of ZBP-1 65 altering the expression of a master gene that regulates the Suppressed chemotaxis and invasion in primary tumors and expression of the common molecule on which these pathways inhibited metastasis from tumors generated using intensely converge. US 8,298,756 B2 21 22 Materials and Methods ray hardware and procedures are available from http:// Needle collection and FACS sorting of primary tumor 129.98.70.229/. Microarray analysis was performed in three cells. We used MTLn3-derived mammary tumors in rats (Fa independent repeats. Details of slide hybridization, washing rina et al., 1998b), and the microneedle collection method and image collection were described in previous studies described previously (Wyckoff et al., 2000b, Wang et al., (Wang et al., 2003; Wang et al., 2002). 2003), to study the gene expression pattern of invasive sub Quality control and data analysis for microarrays. The population of carcinoma cells within live primary tumors. scanned images were analyzed using the Software Genepix Briefly, the invasive cells were collected from MTLn3 tumor (AXon Instruments, Inc. CA) and an absolute intensity value using microneedles containing EGF. Cell collection was was obtained for each of the channels for the reference RNA imaged using a multi-photon microscope as described previ 10 ously (Wang et al., 2002) by inserting the bevel of a matrigel and the RNA derived from the cells. The entire raw data set and EGF containing needle into the field of view. A 50 mm was filtered to accommodate a requirement of at least two Z-Series consisting of 5 mm steps allows for the imaging of a good quality measurements for each triplicate experiment. large number of cells around the needle. /10th of the volume Values from only the good quality measurements (where the from each needle was used to determine the number of cells 15 signal strength was more than twice the standard deviation of collected. From the remaining 9/10 volume from the micron the background plus the background) were considered for eedle, macrophages were removed by magnetic separation, further analysis. Two types of normalization were performed and RNA extraction was done as previously described (Wang routinely in tandem on all the experiments using the Gene et al., 2003). Spring software package (Silicon Genetics, Redwood City, To isolate the general population of carcinoma cells from Calif.). First, intensity-based-normalization was performed primary tumor, a small piece tumor was separated from the which takes into consideration the overall signal strength of whole tumor, minced, and filtered twice through a nylon-filter both channels and normalizes the signal strength between all to obtain a single cell Suspension. FACS sorting was per the different chips, reducing the chance of chip-to-chip vari formed on the resulting single cell Suspensions based on their ability due to the experiment being performed on different GFP expression in tumor cells. GFP-positive tumor cells were 25 days. Second, a reference-channel-based normalization was collected into a tube and lysed directly for RNA extraction. performed which takes into consideration the reference chan All the procedures were done on ice or 4°C. nel (which in this case is pooled reference RNA) and normal Because EGF and Matrigel are present in the needle, as a izes the values in all the spots. This reduces the chance of spot control experiment, we identified genes whose expression is to spot variability. The final data was a result of both these altered by EGF or Matrigel application. Carcinoma cells from 30 types of normalization. the primary tumor were FACS-sorted as described above. The In order to determine the significance of upregulated and resulting cells were split and plated on Mettek dishes covered downregulated genes, we calculated the standard deviation of with Matrigel (1:5) in the presence or absence of EGF (1 nM) the reference channel in all of the chips and found it to be 0.18 for 4 hr at 37°C. The cells were then lysed directly on the dish and used 5x standard deviation as the cutoff, indicating a high for total RNA extraction. 35 level offidelity in our data above 2-fold. Genes that were up An equal quantity of reference RNA (pooled RNA from rat or down-regulated in the arrays performed on control samples liver, spleen, brain and kidney, 4:2:1:1, Ambion Tex.) was (FACS sorted cells which were treated with Matrigel and used to generate probes as a control in all our microarray EGF) were removed from the final list of genes specific to the experiments, which allowed us to use one of the channels as invasive subpopulation of tumor cells. a hybridization control for all the spots on the microarray. The 40 Real time PCR confirmation. To verify the data obtained use of pooled reference RNA from the same species as the from microarrays, QRT-PCR analysis of selected overex MTLn3 cells allowed the same interspecies cross hybridiza pressed and underexpressed genes was performed by using tion as the background, allowing us to use mouse cDNA the iCycler Apparatus (Bio-Rad) with sequence-specific microarrays for our experiments. The pooled reference RNA primer pairs for all genes tested (see Supplementary Table 3 covers a very broad range of gene expression and is routinely 45 for primer sequences, amplicon size and Tm) as described used as controls in cDNA microarray studies (Zhao et al., previously (Wang et al., 2002). The SYBR Green PCR Core 2002). Reagents system (Perkin-Elmer Applied Biosystems) was RNA amplification, probe labeling and microarray hybrid used for real-time monitoring of amplification. ization. The RNA was then concentrated by ethanol precipi Plasmid construction, cell culture transfection, infection tation and re-dissolved in 3.5ul DEPC water. The total RNA 50 and generation of ZBP-1 stable expression cell lines. FLAG was reverse-transcribed directly using the SMART PCR ZBP-1 (Farina et al., 2003) was digested with BamHI/Xbal cDNA synthesis kit (Clontech, Palo Alto, Calif.) according to and inserted into the BamHI/Xbal sites of EGFP-C1 (Clon the manufacturer's protocol. After amplification, cDNAs tech). The EGFP-FLAG-ZBP-1, which encodes a fusion pro were purified using the QIAquick PCR Purification Kit tein, was then isolated as Eco47III/Xbal restriction fragment, (Qiagen) and eluted with TE buffer. Labeling was performed 55 bluntended and inserted into a filled XhoI site of pMCSV neo using Label ITR (Mirus) following the manufacturers (Clontech). This vector contains a viral packaging signal, instructions. Briefly, labeling reactions were prepared by neomycin resistance gene, and the 5' and 3' long terminal mixing 10x Mirus Labeling Buffer A (10 uL), purified cDNA repeats from the murine PCMV virus. As a result, the LTR (3.5ug), Cy5 (or Cy3) dye (5uL) in a total volume of 100LL. drives high-level constitutive expression of the EGFP-FLAG After incubating the reaction mix at 37° C. for 1 hr., the two 60 ZBP-1 gene. PHOENIX cells were cultured under standard resulting probes were purified by passing through SigmaSpin conditions (Dal Canto et al., 1999) and were transfected with columns followed by Qiaquick columns. The purified Cy-3 EGFP-FLAG-ZBP-1 using FUGENE (Roche). Retroviral and Cy-5 DNA probes were then combined and concentrated supernatant was harvested and used to infect MTLn3 cells as using micron YM 50 columns. Microarray analysis was per previously described (Dal Canto et al., 1999). Stable MTLn3 formed by using cDNA microarrays made at AECOM. About 65 cells were selected in the presence of neomycin. 27,000 mouse genes (Incyte Genomics) were precisely spot Microchemotaxis chamber assay. A 48-well microchemo ted onto a single glass slide. Detailed descriptions of microar taxis chamber (Neuroprobe) was used to study the chemot US 8,298,756 B2 23 24 actic response to EGF, following the manufacturers instruc regulation indicating that the pattern was not observed by tions and as described previously (SEGALLET AL., 1996). chance (P<0.05). Similarly, clustering the results from all Blood burden, single cells in the lung, and metastases. genes of the general population in the same space of all genes MTLn3-ZBP-1 or MTLn3-GFP cells were injected into the on the microarray did not yield an outcome similar to the mammary fat pads of female Fischer 344 rats. Tumor cell invasion signature (P-0.05). A detailed table indicating each bloodburden was determined as described previously (Wyck of the functional categories and the significant analysis is offet al., 2000a). After blood removal and euthanization of given as a Supplementary table (Supplementary Table 5) indi the rat, the lungs were removed and the visible metastatic cating the number of genes printed on the microarray and the tumors near the Surface of the lungs were counted. For mea number regulated in invasive cells. Surement of metastases, excised lungs were placed in 3.7% 10 It is interesting to note that the number of genes whose formaldehyde, mounted in paraffin, sectioned, and stained expression is regulated up or down in the functional category with H&E. Slices were viewed using a 20x objective, and all called cell cycle (FIG. 6, #1) is reduced in the invasive cells metastases in a section containing more than five cells were compared to the general population. In addition, there is a counted (Wyckoffet al., 2000a). reduction in the number of regulated genes of the Nucleic Results 15 Acid Chemistry category (FIG. 6, #10), which includes genes Gene expression patterns unique to invasive tumor cells. necessary for DNA synthesis. These may indicate that the cell GFP-labeled tumor cells were injected into rat mammary fat proliferation activity of invasive cells is repressed (Bravo et pads, and primary tumors were allowed to grow for 2-2.5 al., 2003) and the cell cycle is arrested (Nishitani and weeks. To provide insight into the pattern of gene expression Lygerou, 2002). The increase in the number of genes regu associated with chemotactic and invasive carcinoma cells in lated in both the General Metabolism and the protein metabo Vivo, we compared the gene expression profile of the Sub lism categories (FIG. 6, #5 and 6, respectively) may indicate population of invasive tumor cells collected from the primary that invasive cells are very active metabolically, probably tumor by chemotaxis into a microneedle with that of the utilizing more energy and having a fast turnover of proteins general population of GFP-expressing tumor cells Sorted (Larsen et al., 2003). The number of genes regulated in the from the whole primary tumor by FACS (FIG.5B). Hereafter, 25 Apoptosis category (FIG. 6, #2) is significantly higher in the the former population of cells will be called the invasive cells, invasive cells. A closer inspection of the genes involved and the latter the general population, respectively. The inva shows that the pro-apoptotic genes are downregulated and the sive subpopulation of tumor cells was collected into micron anti-apoptotic genes are upregulated. This may indicates that eedles filled with EGF and Matrigel that were held in the these cells have a Survival advantage over the general popu primary tumor for up to 4 hours as described previously 30 lation. Conversely, the genes involved in the Growth Factors (Wyckoffet al., 2000b; Wang et al., 2003). The collection of and Signal Transduction group (FIG. 6, #9) is markedly the invasive cells was monitored by imaging the GFP-ex reduced. These, taken together with the Cell Cycle genes pressing cells with a multiphoton microscope as they (FIG. 6, #1), jointly indicate a significant reduction in the migrated to the EGF containing microneedles (FIG.5A). This proliferative nature of these cells (Supplementary Table 5). allowed direct confirmation that collection was due to cell 35 Finally, there is an increase in the number of regulated migration and not a passive process. genes in the Cytoskeleton and Extracellular Matrix category The collected cells were a mixture of carcinoma cells (FIG. 6, #7). This is of particular relevance to the migratory (75%) and macrophages (25%) as shown previously (Wang et behavior of the tumor cells that is important in their invasion al., 2003). Macrophages were removed by binding to mag (discussed next). netic beads conjugated with anti-MAC-1, giving a greater 40 Genes involved in invasion. In order to be collected by the than 96% pure population of carcinoma cells for analysis microneedle, the carcinoma cells must be capable of moving (Wang et al., 2003). The general population of primary tumor toward and crawling into the extracellular matrix of the cells was collected by FACS sorting and plated either on microneedle within the 4 hr. collection interval. If a cell matrigel or matrigel and EGF for 4 hours, the interval of time moves 2 cell diameters during this interval to gain entry to the required for microneedle collection, to mimic the collection 45 microneedle it would have a minimum speed of 0.2 Lum/min, conditions prior to purification of the RNA. These controls similar to the velocity of carcinoma cells in vitro. However, were done to subtract patterns of gene expression resulting carcinoma cells move in the primary tumor at speeds up to from stimulating cells with matrigel and EGF, and allowed 10x this minimum value (Condeelis and Segall, 2003) indi identification of the gene expression signature of the invasive cating that cells from hundreds of microns away from the cells (FIG. 5B). 50 microneedle can be recruited for collection and that the cells Differential gene expression analysis comparing the inva may penetrate the extracellular matrix in the collecting sive and general populations of tumor cells revealed 1366 microneedle. Consistent with this prediction is the observa genes that were differentially expressed (Supplementary tion that carcinoma cells are found within the matrix of the Table 4). As shown in FIG. 6, genes with known functions collecting microneedle, indicating that cells have traveled were divided into eleven different functional categories based 55 hundreds of microns during the collection interval. This indi on definitions provided by the gene-ontology consortium cates speeds much greater than 0.2 um/min in vivo. (Mariadason et al., 2002), (http://www.geneontology.org). The motility cycle of chemotactic crawling cells is com In order to determine the significance of changes in gene posed of 5 steps; signal sensing, protrusion toward the signal expression in each of the functional categories of the genes Source, adhesion, contraction and tail retraction (Bailly and represented in our arrays, Chi-square or SAM analysis were 60 Condeelis, 2002). As shown in Table 1 and FIG. 7, based on performed. The functional categories of Cell Cycle, Apopto the microarray analysis, many genes associated with motility sis, Metabolism, Protein Metabolism, Cytoskeleton & ECM, are upregulated in the invasive cells compared to the general Growth Factor & Signal Transduction and Nucleic Acid population of cells. We verified the array results using real Chemistry were found to be statistically significant in the time PCR for selected genes representing the 5 steps of the invasive cells by Chi-square (Zigeuner et al., 2004) or SAM 65 motility cycle. As shown in FIG. 7A, the same pattern of analysis (Tusher et al., 2001). Random sets of equal numbers expression was observed in the invasive cells with both of genes did not generate the same pattern of up and down microarray and real time PCR analysis. US 8,298,756 B2 25 26 List of motility related genes differentially expressed in the can phosphorylate LIM-kinase thereby activating it to invasive Sub-population of tumor cells. Genes associated with increase cofilin phosphorylation. Inhibition of LIM-kinase motility are displayed in this table and the ratios on the right activity is PKC dependent and this involves one of the uncon indicated the level of expression in the invasive compared to ventional PKC isoforms (Edwards et al., 1999). As shown in the general population of cells of the primary tumor. FIG. 7B, PKC gene expression, the inhibitory branch of the LIM-kinase inhibitory pathway, is elevated along with that of TABLE 1. the activating branch of the pathway involving ROCK and PAK Gene Description NeedlefEACS Similar increases in both the stimulatory and inhibitory Capping protein alpha 1 4.34 10 parts of the capping protein pathway are upregulated in inva Cell division cycle 42 3.96 sive carcinoma cells (FIG. 7B). The expression of both the Capping Protein alpha 2 3.89 alpha and beta Subunits of capping protein is increased. In Moesin 3.67 addition, genes that antagonize capping protein function Such Rho interactin protein 3 3.33 LIM-kinase 1 3.24 as the type II alpha isoform of PI4, 5 kinase and Mena are Palladin 3.12 15 upregulated (Cooper and Schafer, 2000; Bear et al., 2002). Zyxin 2.93 Genes coding for proteins involved in myosin mediated Tropomyosin alpha chain 2.86 contraction and tail retraction (tropomyosin, ROCK1, and Rho-associated coiled-coil forming kinase 1 2.71 Testis expressed gene 9 2.67 calpain), gelsolin-like protein (CAPG) and adhesion mol Phosphatidylinositol-4-phosphate 5-kinase type II alpha 2.60 ecules (ZyXin, Vinculin, and integrin B1) are up regulated, as Epidermal growth factor receptor 2.59 well (Table 1). ROCK plays a crucial role in cell adhesion and Capping protein (actin filament), gelsolin-like 2.53 motility and is linked to pathogenesis and progression of Annexin A5 2.47 CRIPT protein 2.32 several human tumors (Sahai and Marshall, 2003). Integrin Protein kinase C, Zeta 2.30 B1 has previously been implicated in the ability of an experi Arp 2/3 complex subunit p21 2.22 mentally transformed fibroblast cell line to metastasize RAB25, member RAS oncogene family 2.19 25 Vinculin 2.16 (Brakebusch et al., 1999), and its expression is increased in Kinesin family member 5B 2.13 upper aerodigestive tract and cervical squamous cell carcino Catenin beta 2.08 mas (Van Waes et al., 1995). Chaperonin subunit 4 (delta) 2.06 ZBP-1 as a master gene regulating cell polarity. A gene that Chaperonin Subunit 3 (gamma) 2.06 is strongly downregulated in invasive cells is Zip-code bind Tubulin Alpha-4 chain 2.05 Integrin beta 1 (fibronectin receptor beta) 2.OO 30 ing protein (ZBP-1) (Table 1 and FIG. 7). ZBP-1 is a 68kD Cofilin 1, non-muscle 1.98 RNA-binding protein that binds to the mRNA zipcode of Arp 2/3 complex subunit p16 1.93 B-actin mRNA and functions to localize the mRNA to the Kinectin 1 1.91 leading edge of crawling cells. B-actin is the preferred iso Downstream of Tyrosine Kinase 1 1.91 Burkitt lymphoma receptor 1 1.90 form of actin for the polymerization of filaments at the lead Wave 3 1.89 35 ing edge of cells and, therefore, is acted on by the cofilin, Rho-associated coiled-coil forming kinase 2 1.63 capping protein and Arp2/3 pathways (Shestakova et al., Cadherin 1 1.51 Fibroblast growth factor receptor 1 O.S4 2001). B-actin mRNA localization is required for the genera Zip code binding protein 1 O.25 tion of intrinsic cell polarity that is characteristic of normal Alpha-Actinin, Smooth muscle isoform O.21 fibroblasts and epithelial cells. Disruption of ZBP-1-medi 40 ated p-actin mRNA targeting leads to cells without stable cell polarity (Shestakova et al., 2001), and loss of B-actin mRNA The protrusion of a pseudopod toward the chemotactic targeting is correlated with the polarity of carcinoma cell lines signal initiating the motility cycle is the key step in defining in vitro and in vivo (Shestakova et al., 1999; 2001). Therefore, the leading edge of the cell and therefore its direction during ZBP-1 is a candidate invasion Suppressor gene required for migration (Bailly and Condeelis). Protrusion is driven by 45 normal cell polarity by determining the sites in cells where the actin polymerization-based pushing against the cell mem Arp2/3 complex, capping protein and cofilin pathways con brane and this requires the minimum motility machine com Verge by controlling the sites of targeting of B-actin mRNA posed of cofilin, Arp2/3 complex and capping protein acting and the location off-actin protein that is the common down on their common downstream effector, B-actin (Mogilner and stream effector of these pathways (FIG. 7B). Edelstein-Keshet, 2002). The elevated expression of any one 50 To test the hypothesis that ZBP-1 expression can suppress of these three effectors is expected to significantly enhance invasion, the full length ZBP-1 gene was subcloned in a the speed of migration of cells since doubling the amount of pMCSVneo vector (FIG. 8A) and transfected into the paren either Arp2/3 complex, capping protein or cofilin in the tal MTLn3 cells. Data from Western blot analysis (FIG. 8B) reconstituted minimum motility machine can increase protru confirmed that stable clones transfected with pEGFP-FLAG sion rate by 10x (Loisel et al., 1999). Therefore, it is signifi 55 ZBP-1 expressed higher levels of ZBP-1 compared to cant, as shown in FIG. 7B, that the genes coding for all three untransfected cells. To account for any effects that might arise end-stage effectors, the Arp2/3 complex (the p16 and p21 from the introduction of EGFP into cells, MTLn3 cells trans Subunits), capping protein and cofilin, are up regulated by at fected with pGreenLantern-1 vector (Life Technologies, Inc.) least two-fold each. Furthermore, the genes coding for the were used as control. pathways regulating the activities of Arp2/3 complex 60 To investigate the chemotactic properties of the ZBP-1 (WAVE3), capping protein and cofilin are coordinately overexpressing cells, two independent clones of ZBP-1 over upregulated in the invasive cell population. In the cofilin expressing cell lines were characterized. Chemotaxis was pathway, genes for ROCK1 and ROCK2, LIMK1 and PKC. measured in a Boyden chamber. ZBP-1 overexpressing cells are upregulated along with cofilin. LIM-kinase is activated migrated through the filter in response to EGF poorly com either by PAK which is regulated by Cdc42-GTP and Rac 65 pared to the parental MTLn3 cells (FIG.9A), indicating that GTP or by ROCK which is regulated by Rho-GTP. Either chemotaxis was inhibited. This was true for both ZBP-1 PAK (Edwards et al., 1999) or ROCK (Ohashi et al., 2000) clones and is consistent with previous data showing the US 8,298,756 B2 27 28 enhanced intrinsic cell polarity of ZBP-1 expressing cells population of the same tumor defined here, we have found (Shestakova et al., 1999; 2001). Furthermore, the ability of that a Subset of genes (Table 2), maintain the same patterns of carcinoma cells to invade microneedles placed into primary regulation in both studies. This Suggests that the invasive tumors derived from MTLn3 cells over expressing ZBP-1 subpopulation of cells collected from primary tumors with microneedles has enhanced an expression pattern of a Subset was greatly reduced (FIG. 9B) further indicating a reduction of genes that is characteristic of the differences between in chemotaxis. metastatic and non-metastatic cell lines and tumors. This is Injection of the ZBP-1 over expressing cells into the mam emphasized by the fact that the invasive subpopulation of mary fat pads of rats resulted in tumors that were less meta cells collected by chemotaxis into microneedles is from static. The metastatic potential of these tumors was charac tumors derived from a single cell line, the MTLn3 cell line. terized as the number of tumor cells present in circulating 10 This indicates that as the tumor progresses, highly invasive blood (FIG. 10A), and the number of lung metastatic tumors cells are selected in which a pattern of gene expression (FIG. 10B). However, as shown in FIG. 10C, tumor growth present in metastatic cells and tumors is enhanced over the was not affected by increasing the expression of ZBP-1. In pattern of expression of the cells that remain behind in the addition, primary tumors derived from control and ZBP-1 primary tumor. overexpressing cell lines were indistinguishable as judged by 15 Differentially expressed genes common to invasive cells their histology upon multiphoton imaging of GFP-expressing identified in this study and to metastatic tumors and cell lines tumor cells (data not shown). identified in a previous study. Common genes regulated in a Discussion similar way in all the three samples are displayed here. Dark Signature of invasive carcinoma cells. By comparing gene shading indicates overexpression and light shading repre expression patterns of invasive cells to those of the general sents repression. Taken together these genes outline a signa population of carcinoma cells in the same primary tumor, we ture of invasion and indicate that a number of interacting were able to find patterns in the regulation of gene expression pathways are involved in invasion. TABLE 2 Met? non met, Met non met, Needle? Gene name Cell line Tumors: FACS*** Gene function Collagen, type III, alpha 1 1. 1S 19 ECM Composition G-protein coupled receptor 26 OZ O2 0.46 Signal transduction Zip code binding protein 1 O35 Cell polarity

Fibroblast growth factor receptor 1 :53 Signal transduction ARP 2, 3 COMPLEX16 KD SUBUNIT. Minimum motility machine Tightjunction protein 2 : Adhesion Molecules Member Ras oncogene family Signal transduction Epidermal growth factor receptor Signal transduction

Metastatic cell line = MTLn3, non-metastatic cell line = MTC: **Tumor derived from injection of MTLn3 or MTC; ***Needle = cells collected into needleby chemotaxis = invasive; FACS = cells obtained from whole tumor by FACS = general population. unique to the invasive subpopulation of cells. Our results Cell motility genes and their roles in cancer invasion. indicate that the regulation of genes involved in cell division, 40 Chemotaxis to EGF is required for collection of cells into the metabolism, signal transduction at the membrane, cell Sur microneedle because significant numbers of cells are not vival and cell motility was most dramatically changed in collected in the absence of EGF (Wyckoffet al., 2000b), and invasive cells predicting a population that is neither prolifer EGF-R activity is required for the collection of carcinoma ating nor apoptotic but intensely metabolically active and cells. Therefore, the motility related genes that are differen motile. While increased cell proliferation during tumor devel 45 tially expressed in the invasive population may also contrib opment has been associated with poor prognosis in patients ute to EGF-dependent chemotaxis and enhanced migration in (Evan and Vousden, 2001), the results reported both here and the primary tumor. A major result of this study is the finding in previous studies (Wyckoffet al., 2000a) indicate that tumor that genes from the pathways associated with the minimum size is neither correlated with invasion nor the ability of cells 50 motility machine are greatly up regulated, predicting that to metastasize to distant organs. In addition, invasive cells protrusion velocity will be increased. Since protrusion sets show down regulation of genes associated with apoptosis and cell direction and, therefore, defines chemotaxis, this step in up regulation of genes for cell Survival. This is consistent with the motility cycle may be key in determining invasive poten previous work where it was shown that cell survival genes tial. Furthermore, as seen in FIG. 7B, genes coding for key were up regulated in metastatic tumors as compared to non 55 components of the pathways regulating the end stage effec metastatic tumors (Wang et al., 2002) and Suggests that the tors of the minimum motility machine are up regulated invasive Subpopulation may contribute disproportionally to together, from the receptor through the key kinases and finally this expression profile in whole metastatic tumors. the end stage effectors themselves. By upregulating these In a previous study, the genes differentially expressed entire pathways, receptor-ligand stimulated motility would between metastatic and non-metastatic cells in culture and the 60 be greatly enhanced leading to increased invasiveness. These tumors derived from them by orthotopic injection of the cells results are consistent with the 10-fold higher velocity of cell into the mammary gland were compared. We found that those migration toward blood vessels and EGF filled microneedles, coding for molecules involved in cell adhesion, motility, cell both sources of chemoattractant, observed in primary tumors polarity, and signal transduction were most different. Com of un-dissected live rats and mice compared to their cultured paring the gene expression patterns in non-metastatic tumors 65 cell counterparts (Wyckoffet al., 2000a: 2000b; Farina et al., to metastatic tumors from the previous study (20), with the 1998b; Wang et al., 2002: Condeelis and Segall, 2003). Con differences between the invasive cell population and general sistent with these results are the finding that inhibition of the US 8,298,756 B2 29 30 nucleation activity of Arp2/3 complex in carcinoma cells in polarity (Shestakova et al., 1999). The mechanism relating culture inhibits chemotaxis to EGF (Bailly et al., 2001) and B-actin mRNA targeting to the leading edge and intrinsic cell that cofilin activity is required for cell motility in carcinoma polarity involves the localization of B-actin nucleation to the cells (Chanet al., 2000). leading edge during motility. Disruption of mRNA targeting Our results show that cofilin, LIM-kinase 1, ROCK1, 2 and to the leading edge using oligonucleotides that disrupt the PKC are all over expressed in highly invasive carcinoma interaction between ZBP-1 and the targeting sequence in the cells. In previous studies, LIM-kinase 1 was shown to be over mRNA, the zip-code, results in delocalization of mRNA and expressed in metastatic breast and prostate tumors (Davila et B-actin nucleation sites, and the disruption of cell polarity al., 2003: Yoshioka et al., 2003). Over expression of LIM (Shestakova et al., 2001). Highly metastatic cells have lost the Kinase 1 in tumor cell lines increased their motility and 10 ability to target mRNA for B-actin, which may be required to invasiveness in vitro (Davila et al., 2003) and in vivo maintain a localized Supply of B-actin protein to Support a (Yoshioka et al., 2003). Reduction in the expression of LIM stable leading edge in response to the activity of the minimum kinase 1 in metastatic prostate cell lines deceased invasive motility machine. Without a stable leading edge, the intrinsic ness in matrigel invasion assays (Davila et al., 2003). These polarity of the metastatic cell is lost and cell direction is results are consistent with ours shown here that LIM-kinase 1 15 determined by signals from blood vessels, resulting in is more highly expressed in the invasive cell population. chemotaxis toward blood vessels and intravasation (Wyckoff In contrast, it has been reported that increased expression et al., 2000a: Condeelis and Segall, 2003). Molecular profil of LIM-kinase 1 in carcinoma cells significantly reduces their ing of MTLn3 and MTC cells and tumors using both cDNA cell motility as the phosphorylation of cofilin by LIM-kinase arrays and QRT-PCR demonstrates that non-metastatic MTC 1 abolishes EGF induced actin nucleation and polymerization cells and tumors express much higher levels of ZBP-1 than (Zebda et al., 2000). Our study may resolve this paradox by the metastatic MTLn3 cells and tumors (Wang et al., 2002). demonstrating that in invasive cells collected from primary Furthermore, in the present study, invasive tumor cells iso tumors both the stimulatory and inhibitory pathways to LIM lated from primary mammary tumors using chemotaxis kinase 1 and cofilin are over expressed together thereby express much lower levels of ZBP-1 than cells that remain increasing the steady state rate of cofilin activation in invasive 25 behind in the primary tumor even though both cell popula carcinoma cells resulting in enhanced cell motility as pre tions were derived from the same progenitor MTLn3 cells dicted previously (Davila et al., 2003; Yoshioka et al., 2003: (Table 2). Furthermore, as shown in the current study, inva Zebda et al., 2000; Sahai et al., 2001). sive carcinoma cells expressing experimentally increased ZBP-1 in metastasis. In general, cells that lack a fixed levels of ZBP-1 after transfection with ZBP-1 expression intrinsic polarity are more chemotactic to exogenous gradi 30 vectors exhibit decreased chemotaxis, and invasion into ents presumably because there is no intrinsic polarity to be microneedles, and the tumors made from cell grafts of these overcome by the exogenous chemotactic signal and the cell ZBP-1 expressing cells are much less metastatic by several can turn in any direction to respond to a gradient (Parent and criteria. Devreotes, 1999; Iijima et al., 2002). The presence of intrinsic The results reported here indicate that ZBP-1 is a metasta polarity in carcinoma cells in tumors is correlated with the 35 sis repressor and, together with mRNA targeting status and stable polarization of actin polymerization at one end of the analysis of tumor cell polarity around blood vessels discussed cell only, resulting in polarized locomotion. In contrast, car above, might be used in prognosis and therapy. cinoma cells in metastatic MTLn3 tumors are unpolarized In view of the above, it will be seen that the several advan except when they are near blood vessels where they become tages of the invention are achieved and other advantages polarized toward the blood space (Shestakova et al 1999; 40 attained. Wyckoff et al., 2000a). These results suggest that cells that As various changes could be made in the above methods have proceeded through the epithelial mesenchymal transi and compositions without departing from the scope of the tion (EMT) to the point where all remnants of the intrinsic cell invention, it is intended that all matter contained in the above polarity of the original epithelium are lost, such as MTLn3 description and shown in the accompanying drawings shall be cells, are more efficient at responding to external chemotactic 45 interpreted as illustrative and not in a limiting sense. signals and more attracted to blood vessels in the primary All references cited in this specification are hereby incor tumor. porated by reference. The discussion of the references herein A key difference between metastatic and non-metastatic is intended merely to Summarize the assertions made by the cells that may explain the inverse correlation between intrin authors and no admission is made that any reference consti sic cell polarity and metastasis is loss of the ability by meta 50 tutes prior art. Applicants reserve the right to challenge the static cells to localize mRNA and proteins that define cell accuracy and pertinence of the cited references. SUPPLEMENTAL TABLE 1.

D AccNo Gene Description NF ratio , 13, 7 AW554270 Hinrpu heterogeneous nuclear ribonucleoprotein U 6.96244-6985 15, 6 AW557056 ESTs 9.8276436O1 20, 17 AW536795 CIk CDC-like kinase 2.522978124 , 8, 19 AA404094 C11orf17 C11orf7 2.898.634353 0, 10, 16 AW537281 ESTs 2.OSO2S3842 0, 11, 8 AW550681 ESTs 1.671987O76 0, 12, 23 AAO60863 Mus musculus TSC22-related inducible leucine zipper 1b (Tilz1b) mRNA, 2.567SO62O1 complete cols 0, 14, 14 C87169 1.742.126569 0, 14, 9 AW546455 ESTs, Moderately similar to nuclear factor of activated T-cells, cytoplasmic 3.70859768 3 H. sapiens 0, 18, 7 AW553938 ESTs 1.784945891 0, 19, 13 AUO23882 Brca2 breast cancer 2 2.117866OSS US 8,298,756 B2 31 32 SUPPLEMENTAL TABLE 1-continued

AccNo Gene Description NF ratio AWSS1966 ESTs 1.693995246 AUO15358 Ub1a2 ubiquitin-like 1 (Sentrin) activating enzyme subunit 2 5.36S11445S pending AWSS2108 ESTs, Highly Similar to SUCCINATE DEHYDROGENASE CYTOCHROME 2.657O65897 B560 SUBUNIT PRECURSOR Bos taurus ESTs, Weakly similar to N-methyl-D-aspartate receptor glutamate-binding 3.272488788 chain R. norvegicus AW554.737 Cs, Weakly similar to KIAAO512 protein H. sapiens 2.51486,7936 AWS47900 S 1.702197367 s AWS47928 SSTS 4.426096507 AUO4O764 2.305827433 AWS43960 19838S959 AWSS4947 ST Ts, Highly similar to translation initiation factor IF2H. Sapiens 3.62S64426S O AUO40830 ST Cs, Weakly similar to 60S RIBOSOMAL PROTEIN L30A 4.091843934 S accharomyces cerevisiae 6 AWS37188 2.91355.4588 AWS49332 ESTs 2.023735431 AW537237 ADP-ribosylation-like factor 6 interacting protein 3.42711SO27 AA24OSO6 ESTs 1.7238926.14 AA38668O Kifsb kinesin family member 5B 2.13O805311 AWS38432 Rhoip3 Rho interacting protein 3 3.33021601S pending 5 C80446 ESTs 6.5977321.93 AW55.1715 2.6.1895.42O2 AWS471.89 ESTs, Weakly similar to membrane glycoprotein M. musculus 1872805389 8 AWS43115 3.OOS219811 AWS.55297 2.16749597 AWSS2496 2.877924.191 AUO42851 2.235921475 AUO1895S ESTs 2.195691464 AA138394 ESTs 2.169177669 AUO43242 ESTs, Weakly similar to ORFYKRO81c (S. cerevisiae) 2.34OSO1043 AWS38403 Mus musculus formin binding protein 11 (FBP11) mRNA, complete cols 3.048.88214 AUO43911 ESTs, Weakly similar to UBIQUITIN-CONJUGATING ENZYME 2.769S4032S E2-17 KD 2 (Mus musculus AW555759 Phb prohibitin 2.76.1699761 8 AW538517 ESTs 4.507048384 A448261 Mits musculus serine-threonine kinase receptor-associated protein mRNA, 1.962139SS4 complete cols ESTs, Highly similar to HPBRII-7 protein H. sapiens 5.426224824 3 AWS45323 5.843973O21 AWS46487 Mns1 meiosis-specific nuclear structural protein 1 1.788.191829 AW556673 Anxa7 annexin A7 2.03695.2459 AWS47603 ESTs 3.8O8619679 AW5567O6 ESTs 3.094.896437 AUO15298 E Ts, Moderately similar to dJ30M3.3 H. sapiens 1998.24.4621 AWS47693 3.SS440963 8 AW539791 Cs, Weakly similar to coded for by C. elegans cDNAs GenBank: 6.21796016 elegans AWSS47O6 Ts, Highly similar to hypothetical protein H. Sapiens 2.357478513 8 AWS39811 Cdc10 division cycle 10 homolog (S. cerevisiae) 3.902125311 AWSS4761 S 2.541961009 AWSS4784 Cs, Weakly similar to Cxorf5 H. sapiens 2.14798O173 AUO24765 s 4.02111663

S 2.027161144 STs, Highly similar to VACUOLAR ASSEMBLY PROTEIN VPS41 1.76686O604 HOMOLOG H. sapiens A427886 ESTs, Highly similar to RAS-RELATED PROTEIN RAB-28 R. norvegicus) 2.6941OO196 AW537132 Gdap2 ganglioside-induced differentiation-associated-protein 2 3.002468515 s AA285584 Mus musculus strain Swiss Webster/NIH actin-associated protein palladin 3.124624.175 mRNA, partial cols AW554567 Fkbp1a FK506 binding protein 1a (12 kDa) 2.653957746 AWSS46O7 Ptk9r related protein 2.08852.5057 pending 8, 12 AUO1504.8 ESTs 3.334654393 O AUO43380 ESTs, Highly similar to RER1 PROTEIN Saccharomyces cerevisiae 1922629478 C85794 ESTs, Weakly similar to myelin transcription factor 1-like M. musculus 2142786048 AW537070 ESTs 1932.096917 AWS48914 Mits musculius receptor activity modifying protein 2 mRNA, complete cols 3.22.9667371 AWSS2636 1.651243516 6 C78511 Bikk Bcl2-interacting killer-like 2.2SO3145 AW552679 ESTs 2.1621.11394 AUO43443 ESTs, Highly similar to TRAM PROTEIN Canis familiaris 4.O11298,228 AW55.3519 ESTs, Highly similar to DNA-DIRECTED RNA POLYMERASE II 19 KD 1.727583809 POLYPEPTIDE (Glycinemax 1 AUO16361 EST 2.107962.946 i A429145 ESTs 4.812765403 1 2 AUO2O132 Odc ornithine decarboxylase, structural 2.890092488 US 8,298,756 B2 33 34 SUPPLEMENTAL TABLE 1-continued

D AccNo Gene Description NF ratio 1 8 AW538715 ASS1 arginosuccinate synthetase 1 4.609205297 : 2 AUO2O218 Zrf2 Zuotin related factor 2 2.62741.3283 4 AUO 17036 STs, Highly similar to UBIQUITIN-CONJUGATING ENZYME 2.0788242 17 KD 3 Homo sapiens: Rattus norvegicus C76660 ESTs, Moderately similar to KIAA0663 protein H. sapiens 2.172287352 C87551 eukaryotic translation initiation factor 4E 1966.834.915 AAO3O786 ESTs 2240373072 AWS41471 Tfg Trk-fused gene 1.678.687844 AUO46294 Magoh mago-nashi homolog, proliferation-associated (Drosophila) 2.353138844 AWS482O3 3.090924081 2 AUO1843O ESTs 3.818903275 AA22O617 Bak Bc12 homologous antagonist/killer 2.461291028 AWS374S4 ESTs 2.21447486 2.OOO189626 ESTs, Weakly similar to SEX-LETHAL PROTEIN, FEMALE-SPECIFIC 2.569 110342 Drosophila melanogaster AWS39416 ESTs 2.348876157 4 AAO31056 Mcmd5 mini chromosome maintenance deficient 5 (S. cerevisiae) 2.391689429 326287 ESTs, Highly similar to TUBULINALPHA-4 CHAIN Gallus gallus 2.054481753 W539519 ESTs 2.341527.019 W539538 ESTs 2.611916S6S W536987 Snta1 syntrophin, acidic 1 2.464853599 UO22589 18244-62022 UO19284 S 2.059174381 79S48 S 1.690129068 AA415370 S 2.25790O982 AWS39347 ESTs 4.447072022 AI32362O House-keeping protein 1 1.640331493 AW555997 16306744OS AWS387OO 2.617538557 AAO27451 2.614310944 7 AW553990 4.108.364998 2 AAO3OO61 2.621208402 AUO 1701S 3.5O27973.18 C76678 Mus musculus mRNA for Sidó061p, complete cds 3.720O28548 C87531 ESTs 2.9914SOO1 AUO46O28 ESTs, Moderately similar to RNA polymerase II transcription factor SIII p18 2.46786OO62 Subunit R. norvegicus 5 C80210 ESTs 7.29568.7026 7 AWS45676 ESTs 2.591383664 9 AWS48061 ESTs, Weakly similar to unknown C. elegans 3.032513,144 1 AUO18045 3.2198.5786S 1 2 AUO18486 Ssb Sjogren syndrome antigen B 3.979536441 AWS41494 Surfa. Surfeit gene 4 3.591874393 AUO41374 1.7844771.97 AW536576 Tex9 testis expressed gene 9 2.671SSO442 : AUO18409 Arha Rho family GTpase 3.530268774 AUO15646 Rex3 reduced expression 3 2.0716444O6 AUO42578 2.01S4O7334 C86226 5.44261442 C863O1 ESTs 2.1792.947S1 C79036 EST 3.875693403 C86367 ESTs, Weakly similar to BAT2 M. musculus 2.375988234 AW557130 Xist inactive X specific transcripts 1.697891896 AW551743 ESTs, Moderately similar to WD-REPEAT PROTEIN SAZD H. sapiens 1807778O23 C88038 1.8O890O72S 6 AWSS8021 ESTs 2.219679067 AWS434.47 3.028866O15 AUO16133 ESTs, Weakly similar to MSSP M. musculus 2.213OO9807 AW557547 2.432430534 AW537221 fibroblast growth factor regulated protein 2.648SS8726 AWS36849 cyclin B1, related sequence 1 3.255.108.538 2 AUO2O382 6.5893O3975 AUO2O575 ESTs, Moderately similar to HYPOTHETICAL 27.1 KD PROTEIN CCE1 2.037569931 CAP1 INTERGENIC REGION Saccharomyces cerevisiae) AWS36101 Mus musculus mRNA for phosphorylated adaptor for RNA export (PHAX 3.313622909 gene) AAO3O810 ESTs, Highly similar to AF161432 1 HSPC314 H. sapiens 2.043627079 AWS36142 S, Weakly similar to unknown R. norvegicus 1.98.1339461 AW557108 ESTs 1.98.1762S36 AWS42930 ESTs 1953.216474 AWSS2398 ESTs, Moderately similar to TRANSCRIPTION INITIATION 4.263787S23 FACTORTFIID 28 KD SUBUNIT H. sapiens AA276O43 ructose bisphosphatase 1 18152O7277 AWSS2461 ESTs, Weakly similar to SKD1 PROTEIN Mus musculus 1629936,776 C85347 S.69154099 AWS48671 ESTs 1881.136659 AA388122 Mem3 Maternal embryonic message 3 2.374556107 US 8,298,756 B2 35 36 SUPPLEMENTAL TABLE 1-continued

AccNo Gene Description NF ratio C791.84 Kpna2 karyopherin (importin) alpha 2 4.483193OO7 AW537587 4.458135946 AWS4998O ESTs, Highly similar to UBIQUITIN-CONJUGATING ENZYME E2-17 KD 3.30468O342 Drospohila melanogaster 2 5 W82690 ESTs 2.09784.8007 1 AUO16110 Mus musculus heat shock protein (HSPC030) mRNA, complete cols 3.031383324 C86564 1.733344896 AW553398 EST 4.024687885 AUO15271 ESTs 2.714478478 6 AW537279 Macs myristoylated alanine rich protein kinase C Substrate S47S95949 1 AUO16670 2.480538118 9 AWS46453 ESTs 2.73290518.5 7 AWSS3809 Rinaseli ribonuclease L. (2',5'-oligoisoadenylate synthetase-dependent) inhibitor 3.127019793 AUO21072 ESTs, Weakly similar to unknown R. norvegicus 3.691, 19996S AUO23815 ESTs, Weakly similar to (defline not available 5901816) D. melanogaster 2.318446678 C81194 Hsp105 heat shock protein, 105 kDa 2.79345821 AUO17931 ESTs, Highly similar to ALPHA-1,6-MANNOSYL-GLYCOPROTEIN BETA 2.050617842 2-N-ACETYLGLUCOSAMINYLTRANSFERASE Rattus norvegicus) ESTs, Highly similar to CYTOCHROME COXIDASE POLYPEPTIDE VIB 2.115484663 Homo sapiens AW552O25 ESTs 1863596817 AUO21850 Semcap2 SemaF cytoplasmic domain associated protein 2 1835494.893 AAO34561 Fen1 Flap structure specific endonuclease 1 2.5874.17174 AUO15537 ESTs, Highly similar to H-BETA>58 PROTEIN Mus musculus 1.73OO63182 AUO21834 ESTs 2.8O2694822 AWS384O7 Slc20a1 solute carrier family 20, member 1 2.767681717 C87110 ESTs 3.327762139 C872O5 ESTs, Weakly similar to C44-B9.1 C. elegans 3.70199.0317 20, 17, 13 AUO23806 Rock1 Rho-associated coiled-coil forming kinase 1 2.714535436 20, 17, 17 AWS45339 Ate1 arginine-tRNA-protein transferase 1 2.0166931.99 20, 17, 25 W87153 ESTs, Moderately similar to HYPOTHETICAL 21.5 KD PROTEIN 1928.120788 C08B11.9 IN CHROMOSOME II Caenorhabditis elegans 20, 18, 12 AUO21126 ESTs 4.O3O388791 20, 18, 17 AWS3632O Orc4 origin recognition complex, Subunit 4 2.55331517 20, 18, 8 AWSSO920 ESTs 3.1643.7003 20, 18, 9 AWS476O4 ESTs, Weakly similar to ORF YOLO71w S. cerevisiae 2.7049388O1 20, 19, 19 AAO662SO ESTs, Weakly similar to BC-2 protein H. sapiens 3.43.01.16366 20, 19, 8 AWSS1944 ESTs, Highly similar to Similar to D. melanogaster parallel sister chromatids 2.767267.283 protein H. Sapiens 20, 2, 26 AA413090 ESTs, Moderately similar to unknown protein IT12 H. sapiens 2.08408988 20, 20, 8 AW551959 Cul1 cullin 1 3.04.08.2811S 20, 21, 19 AAO68436 s, Highly similar to unknown R. norvegicus 5.647684222 20, 22, 7 AW554765 STs, Moderately similar to tpr protein H. sapiens 2.2312O2975 20, 23, 14 AUO21819 Top1 opoisomerase (DNA) I 3.5484OO292 20, 3,3 A427786 EST 2.OSSS46444 20, 3, 5 AW557661 Taldo1 transaldolase 1 3.573769539 20, 6, 22 AA154465 ESTs, Highly similar to similar to human DNA-binding protein 5. H. sapiens 3.125092795 20, 6, 8 AWS49269 ESTs 2.555555862 20, 7, 13 AUO22791 3.776946978 20, 7, 15 C78755 ESTs 3.382SSOOO1 20, 7, 16 AW5372O2 Difr dihydrofolate reductase 2.653.293OO4 20, 9, 11 AUO1648O ESTs, Highly similar to 40S RIBOSOMAL PROTEIN S25 Homo sapiens 2.434O92714 Rattus norvegicus AWS44140 DNA segment, Chr 10, Wayne State University 52, expressed 4.683O18189 AUO42440 ESTs, Weakly similar to BRAIN SPECIFIC POLYPEPTIDE PEP-19 3.114535048 Rattus norvegicus. Mits musculius AUO42135 ESTs, Moderately similar to protocadherin-3 R. norvegicus 2.539044703 AWS36295 1819211222 AWS48397 ESTs, Weakly similar to cDNA EST EMBL: TO1421 comes from this gene 2.636437S64 C. elegans C86478 7.93O960547 AWS46813 1.54OS2O248 AAO73695 Mea1 e enhanced antigen 1 3.681.248673 AWS42425 3.1122.SS862 AWS44437 2.28118451 AW555565 2.929O15914 2 3 AW552671 1.8OO668SOS AWS491.19 RIE2 RIE2 protein 2.108802 AWSS3643 ESTs, Highly similar to LZIP-1 and LZIP-2 (M. musculus 1.7276O2S28 AUO4S213 ESTs 1.57541576 C80749 ESTs 2.O2S627OOS AWS361.94 ESTs, Highly similar to CGI-35 protein H. sapiens S.O45862O39 AW556475 2.718743SO2 AUO24490 ESTs, Highly similar to PROTEIN TRANSLATION FACTORSUI1 6.646581,144 HOMOLOG Anonpheles gambiae AAOS2404 CRIPT CRIPT protein 2.31831O231 C80954 2.OS1583281 W97837 DNA segment, Chr 10, ERATO Doi 322, expressed 2.494826439 US 8,298,756 B2 37 38 SUPPLEMENTAL TABLE 1-continued

ID AccNo Gene Description NF ratio 23, 18, 22 AA1838O3 ESTs, Weakly similar to envelope polyprotein M. musculus 1.732688.267 23, 2, 12 AUO19219 EST 2.10823O415 23, 2, 16 AWS37048 EtS2 E26 avian leukemia oncogena 2,3' domain 3.325078728 23, 2, 7 AW552709 Mus musculus brain protein 44-like protein (Brp441) mRNA, complete cols 2.521723313 23, 20, 14 C88330 ESTs, Weakly similar to weak similarity to the yeast SSM4 protein 2.282437195 C. elegans 23, 20, 17 AWS36945 ESTs, Weakly similar to female sterile homeotic-related protein Frg-1 3.37311499 M. musculus 23, 21, 10 ESTs 3.02452904 23, 22, 16 Eif eukaryotic translation initiation factor 3 5.424426041 23, 23, 17 AWS37OO6 S 1.696593O42 23, 4, 6 AW555631 STs, Highly similar to PUTATIVE RECEPTOR PROTEIN Homo sapiens 24.88892742 23, 5, 15 C795.06 2.42O211405 23, 5, 9 AWS45976 Cops7a COP9 (constitutive photomorphogenic), Subunit 7a (Arabidopsis) 2.297823068 23, 6, 16 AWS37694 ESTs, Highly similar to HYPOTHETICAL 109.5 KD PROTEIN IN 4.23891808S PPA1-DAP2 INTERGENIC REGION Saccharomyces cerevisiae) 23, 7,3 A426,727 ESTs, Weakly similar to 5'-AMP-ACTIVATED PROTEIN KINASE, 2.61712O238 GAMMA-1 SUBUNIT M. musculus 23, 7, 6 AWSS6339 ESTs, Highly similar to RN protein R. norvegicus 2.311016095 23, 8, 11 AUO17390 ESTs 1.8O2786179 23, 8, 14 C86919 4.0168894.22 23, 8, 24 AAO17991 2.483412396 24, 1, 14 C85101 1.52794O385 24, 1, 7 AW552230 2.376.848943 24, 12, 7 AW55.3979 STs, Highly similar to TYROSINE-PROTEIN KINASE JAK1 2.112422O1 Homo sapiens 24, 14, 7 AWSS4059 ESTs, Weakly similar to HYPOTHETICAL 15.9 KD PROTEIN IN 2.945086458 GLNA-FDHE INTERGENIC REGION Escherichia coli 24, 17, 11 AUO17987 ESTs, Weakly similar to NADH-CYTOCHROME B5 REDUCTASE 2.016928.064 R. norvegicus 24, 18, 11 AUO18O29 ESTs, Highly similar to cbp146 M. musculus 3.428O43O44 24, 18, 19 AAO8O156 Kap kidney androgen regulated protein 3.15890 1378 24, 22, 25 AAOOOO38 Usp23 ubiquitin specific protease 23 3.1374O7556 24, 3, 13 AUO22218 Ptp4a.1 protein tyrosine phosphatase 4a1 2.459877.353 24, 5, 14 C86208 ESTs 4.6O3S1847 24, 5, 16 AW537358 ESTs, Weakly similar to cDNA ESTyk338g10.5 comes from this gene 4.424107656 C. elegans 24, 7, 24 AAO13832 Clpx caseinolytic protease X (E. coii) 3.18328.7717 24, 8, 16 AWS37419 ESTs 2.2968SO796 24, 9, 21 AA209964 DNA segment, Chr 11, KL Mohlke 34 7.590.178566 25, 18, 17 AW536755 ESTs, Highly similar to similar to nuclear domain 10 protein NDP52 7.509323804 H. Sapiens 25, 19, 8 AWSS2431 Scp2 sterol carrier protein 2, liver 4.8182021.9S 25, 22, 7 AW555335 2.161464496 26, 10, 9 AWS46296 ESTs 2.764721009 26, 19,91 16 C77513 ESTs, Highly similar to GUANINE NUCLEOTIDE-BINDING PROTEIN 1935966462 G(I)?G(S)/G(O) GAMMA-5 SUBUNIT Bos taurus. Rattus norvegicus 26, 19, 8 AWSS1969 Prtb proline rich protein expressed in brain 3.399624829 26, 20, 9 AWS47818 Fmr1 ragile X mental retardation syndrome 1 homolog 3.184148.074 26, 21, 24 AAO31120 Psma1 proteasome (prosome, macropain) subunit, alpha type 1 2.663765326 26, 8, 17 AWS44153 ESTs 1877SO2862 27, 1, 17 AWS43439 FK506 binding protein 4 (59 kDa) 3.254740967 27, 10, 15 C794.09 1.66090225 27, 10, 16 AWS37744 Mus musculus protein inhibitor of activated STAT protein PIAS1 mRNA, 2.15944O423 complete cols 27, 10, 17 AWS45798 DNA segment, Chr 13, Abbott 1 expressed 1.779679579 27, 11, 12 AUO2O432 ESTs 2.383.793282 27, 11, 20 AA265845 Mus musculus mRNA for heterogeneous nuclear ribonucleoprotein H 2.185702249 27, 12, 14 C86757 ESTs 1.7O6875968 27, 12, 26 W36917 D17WS155e DNA segment, Chr 17, Wayne State University 155, expressed 1.967356236 27, 13, 17 AWS36O71 2.574O43367 27, 15, 14 C87823 ESTs, Weakly similar to cDNA EST EMBL:TO1156 comes from this gene 2.4467OS774 C. elegans 27, 15, 7 AWSS4328 ESTs, Highly similar to RSP5 PROTEIN Saccharomyces cerevisiae 3.913617092 27, 17, 9 AWS471.93 2.2221574.41 27, 18, 19 AA403949 Capn12 calpain 12 2.38344367 27, 18, 6 AW557115 3.25273O213 27, 2, 8 AWS48748 ESTs, Weakly similar to proline-rich protein M. musculus 2.84O416615 27, 20, 16 C78065 ESTs 1.707168.222 27, 20, 18 AWS42945 ESTs 1832348729 27, 21, 18 AWS43112 1.910260O87 27, 23,4 A426498 Mits musculius radio-resistance, chemo-resistance cell cycle checkpoint 4.OO7328711 control protein (Rad9) mRNA, complete cols 27, 4, 15 C79174 ESTs 4.OS893.6269 27, 6, 12 AUO19031 Hist4 histone 4 protein 2.341178338 27, 6, 26 AA415519 ESTs, Weakly similar to HYPOTHETICAL 40.4 KD PROTEIN R06F6.5 IN 2.1013494.22 CHROMOSOME II Caenorhabditis elegans US 8,298,756 B2 39 40 SUPPLEMENTAL TABLE 1-continued

AccNo Gene Description NF ratio AA189879 ESTs, Weakly similar to similar to Zinc finger, C2H2 type C. elegans 18784O7963 AAOS7995 ESTs, Moderately similar to AF151892 1 CGI-134 protein H. sapiens 2.147568646 W81857 ESTs, Highly similar to HYPOTHETICAL 39.7 KD PROTEIN C34E10.2 IN 2.4583.20944 CHROMOSOME III Caenorhabditis elegans 27, 9, 16 AW537685 ESTs, Highly similar to HYPOTHETICAL 83.2 KD PROTEIN IN 2.342999287 CHA1-APA1/DTP INTERGENIC REGION Saccharomyces cerevisiae) 27, 9, 17 AWS44704 ESTs, Weakly similar to CGI-90 protein H. sapiens 1864913487 27, 9, 26 W14928 Smpd1 Sphingomyelin phosphodiesterase 1, acid lysosomal 2.035892.157 28, 11, 23 AAOS1256 CbxS chromobox homolog 5 (Drosophila HP1a) 1994358091 28, 12, 18 AWS3848O ESTs, Moderately similar to serine proteinase inhibitor 6 M. musculus 4.924,57718 28, 17, 14 C87270 ESTs 2.5838.12733 28, 17, 5 AI327.096 Mus musculus neuronal calcium sensor-1 (NCS-1) mRNA, complete cols 4.676318103 28, 18, 17 AWS36321 ESTs 167994SS48 28, 19, 6 AW556708 ESTs 1.426373OS4 28, 19, 7 AW553932 EST 1637328157 28, 21, 12 AUO21314 Mits musculius KOI-4 gene, partial cols 3.06495230S 28, 22, 19 AAO68665 ESTs, Weakly similar to AF152841 1 polymyositis scleroderma overlap 3.05957507 syndrome M. musculus 28, 23, 12 AUO15222 ESTs 2.795922775 28, 23,9 AWS4788O 3.239.702305 28, 4, 17 AWS43978 S S 3.969831883 28, 6, 10 AUO40813 S Ts, Weakly similar to T23G 11.9 C. elegans 2.309549.316 28, 6, 2 A449074 TS 4497O49697 28, 7, 7 AW552851 S S 2.139124061 28, 9, 18 AWS38390 1.833998.742 29, 10, 18 AWS39386 ESTs 7.008050386 29, 10, 9 AWS47284 ESTs, Weakly similar to PYRROLINE-5-CARBOXYLATE REDUCTASE 2.0491.818O2 Glycine max 29, 11, 13 AUO23662 20.598.40816 29, 14, 17 AWS36258 Tpp2 tripeptidyl peptidase II 1835SO6405 29, 15, 4 A427491 ESTs, Highly similar to PROBABLE UBIQUITIN CARBOXYL-TERMINAL 2.394177647 HYDROLASE Homo sapiens 29, 18, 10 AUO41939 Mus musculus TBX1 protein mRNA, complete cols 2.221932S11 29, 19, 15 C81124 Hsp60 heat shock protein, 60 kDa 1.968544873 29, 20, 10 AUO42003 2.4410246O7 29, 3, 10 AUO43450 Msh? mutS homolog 2 (E. coli) 2.659901068 3, , 10 AUO41246 ESTs, Highly similar to 26S PROTEASE REGULATORY SUBUNIT 4 7.5759.91278 HOMOLOG Schizasaccharomyces pombe 17 AWS4341S Mits musculius Secretory carrier membrane protein 4 mRNA, complete cols 3.643663528 1, 17 AWS45809 Mdu1 antigen identified by monoclonal antibodies 4-F2 1791428539 3, 16 C76908 6.2O3526972 3, 17 AWS36067 Aop2 anti-oxidant protein 2 2.42S678079 AWSS4240 ESTs, Highly similar to OLIGOSACCHARYL TRANSFERASE STT3 2.752467221 SUBUNIT HOMOLOG Caenorhabditis elegans AUO44892 ESTs 1.705319286 AAO3O271 ESTs 2.483.517776 AWSS6999 ESTs, Moderately similar to hypothetical protein H. sapiens 2.84O617772 C80485 Zinc finger RNA binding protein 4.20498.1315 Mus musculus cerebellar postnatal development protein-1 (Cpd1) mRNA, 3.268033947 partial cols 3 AWS48431 ESTs, Highly similar to CYTOCHROME COXIDASE POLYPEPTIDE VIIB 4.OO9096,262 PRECURSOR Homo sapiens AWS42927 Bcap31 B-cell receptor-associated protein 31 5.066787673 AW557152 ESTs, Highly similar to spliceosomal protein SAP 155 H. sapiens 2.706136493 AWS48470 ESTs 12.88458118 AUO15947 ESTs 1.788247928 AWSS2411 Ech1 enoyl coenzyme A hydratase 1, peroxisomal 2.31SO44879 AUO15879 Mus musculus LIM-kinase1 (Limk1) gene, complete cols:Wbscr1 (Wbscr1) 3.239108652 gene, alternative splice products, complete cols; and replication factor C, 40kDa subunit (Rfc2) gene, complete cols ESTs, Highly similar to TRAF4-associated factor 2 H. sapiens S.S1OO48.96S Anxa4 annexin A4 3.44.828O131 3.272O69232 LOCS6463 p100 co-activator 7.850930684 ESTs 1841319116 D16WSu83e DNA segment, Chr 16, Wayne State University 83, expressed 7.71686883 LOCS6046 hypothetical protein 3.596271768 : ESTs, Highly similar to KIAA0368 H. sapiens 4.173186SO3 ESTs S.478942934 RIBOSOMAL PROTEINS6 KINASE IIALPHA1 2.01602961.2 o 1 1 ESTs, Weakly similar to cDNA ESTyk338.f6.5 comes from this gene C. el 2.330288731 C. elegans 30, 1, 14 C851.43 2.94O279646 30, 1, 16 AW536713 ESTs 2.28356006 30, 10, 5 AI893564 Anx5 Annexin V 2.032674O21 30, 11, 7 AWSS328O Itgb1 integrin beta 1 (fibronectin receptor beta) 2.OO3708956 30, 12, 14 C864.80 Plp proteolipid protein (myelin) 2.746O27119 30, 14, 12 AUO2O233 Arf1 ADP-ribosylation factor 1 3.991S26009 US 8,298,756 B2 41 42 SUPPLEMENTAL TABLE 1-continued

ID AccNo Gene Description NF ratio 30, 16, 12 AUO21489 Omd Osteomodulin 2.593848954 30, 16, 16 C76750 Hinrpal heterogeneous nuclear ribonucleoprotein A1 4.582363217 30, 19, 14 C87694 EST Ts, Weakly similar to acid ceramidase M. musculus 1879731613 30, 2, 15 C78024 19737O6153 30, 2, 19 AA472933 EST Ts, Highly similar to unknown H. Sapiens 2.6O2S36474 30, 20, 8 AW5521.59 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 2.409551934 30, 21, 11 AUO18151 EST 1.913900772 30, 21, 19 AAO68842 ubiquitin conjugating enzyme 2e 2.435798.543 30, 22, 15 C85070 EST S 2.1776.09374 30, 22, 8 AW552205 Zinc finger protein 101 1.845671095 30, 23,9 AWS48330 EST Cs, Moderately similar to NADH-UBIQUINONE OXIDOREDUCTASE 2.6468,92785 CHAIN 2 Mus musculus 30, 3, 14 C85216 48.971961.72 30, 3, 16 AWS37334 EST Ts, Weakly similar to signal recognition particle 54K protein M. musculus 2.6474123SS 30, 5, 7 AW55.3103 EST Cs, Weakly similar to es 64 M. musculus 2.470432.192 30, 7, 16 AWS37446 Tcea1 transcription elongation factor A (SII), 1 3.353756593 30, 9, 13 AUO23128 EST Cs, Highly similar to CAMP-DEPENDENT PROTEIN KINASE TYPE I 2.971627.282 AL PHA REGULATORY CHAIN Homo sapiens AWSS8291 EST s 2.31484213 AW552672 bio inidase 18736O7374 AWS491.21 high mobility group protein 14 5.305166988 AWSS3645 solute carrier family 12, member 2 S.20922S843 AWSS4493 2.1083931O1 AWS47310 EST 2.7248.27548 AW551817 Madha. MAD homolog 4 (Drosophila) 2.757229361 C8O862 EST Cs, Moderately similar to (defline not available 5931553) M. musculus 3.09.0776,963 AWS39487 Pabpc1 poly Abinding protein, cytoplasmic 1 3.2298.131 AAO3O846 Coq7 demethyl-Q 7 2.013748.884 UO41887 EST Cs, Highly similar to HYPOTHETICAL 30.3 KD PROTEIN IN 5.573.324729 AP E1/LAP4-CWP1 INTERGENIC REGION Saccharomyces cerevisiae) Ube?i ubiquitin-conjugating enzyme E2I 3.SOO959948 3.416858729 UO22550 S 2.059326983 UO16270 Ts, Highly similar to CYCLIN-DEPENDENT KINASES REGULATORY 3.3958.12648 BUNIT 2 Homo sapiens AA414612 Cappal cap ping protein alpha 1 4.335956318 AUO2O667 Uch3 ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) 3.22S2OOO79 AUO23SSO Fin14 fibroblast growth factor inducible 14 2.195941O34 AA272115 EST S 2.39274.1899 AWSS36O2 EST Cs, Weakly similar to (defline not available 6016842) M. musculus 2.285573594 AUO23139 EST Ts, Weakly similar to natural killer cell tumor-recognition protein 2.061470989

miscuits AWS36519 Cs, Weakly similar to lens epithelium-derived growth factor H. sapiens 2.62322S239 AUO18130 Cs, Weakly similar to cholesterol 25-hydroxylase M. musculus 6.335735765 AW557836 S 8.74O904908 AWS37469 Cs, Moderately similar to BB1 2.05226.7636 AA423209 PSme3 O easeome (prosome, macropain) 28 Subunit, 3 2.222939666 AWS36140 Hsp86-1 (8. shock protein, 86 kDa 1 3.22OO69536 AWSS4376 Dlghl discs, large homolog 1 (Drosophila) 3.049574352 C80708 EST Cs, Weakly similar to 62D9.a D. melanogaster 2.1.19484585 AWS42919 EST Cs, Highly similar to KIAA0398 H. sapiens 2.049586337 C88028 EST Ts, Highly similar to Small membrane protein 1 H. Sapiens 3.665.66524 AWS48794 EST S 1861249227 AI327246 EST Cs, Weakly similar to tiltin M. musculus 3.SO7243434 AWS499.37 Hodac2 histone deacetylase 2 2.2928.64895 AUO16137 Fth e itin heavy chain 2.4649594SS AW550050 4.2779.12854 C79363 Mus musculus hsp40 mRNA for heat shock protein 40, complete cds 1623760717 AWS38992 Mus musculus mRNA for 26S proteasome non-ATPase subunit 4.76789816 C861 O7 Actin3 actinin alpha 3 2.520902204 AWS45272 1.6477SO981 AWS39649 ESTs, Highly similar to DEKPROTEIN Homo sapiens 2.54249SO91 AA266868 ESTs, Highly similar to RIBOSOMAL PROTEINS6 KINASE Homo sapiens 2.364627315 C81381 ESTs, Weakly similar to BcDNA.GHO3108 (D. melanogaster 2.2321414 C77692 EST 2.OO4659901 AAS43829 ESTs, Weakly similar to CG17593 gene product D. melanogaster 1.770333636 34, 21, 8 AWSS2O22 Nudit5 nudix (nucleoside diphosphate linked moiety X)-type motif 5 2.155260382 34, 23, 21 AA213017 Fmo3 flaw in containing monooxygenase 3 1940O84944 34, 6, 9 AUO42383 ESTs 2.9220975.99 35, 11, 17 AWS45818 ESTs, Weakly similar to prediction 3.339835947 35, 13, 14 C877.26 Mits musculus mitotic checkpoint component Mad2 mRNA, complete cols 2.391344308 35, 4, 15 C791.76 ESTs, Weakly similar to TYROSINE-PROTEIN KINASE JAK3 M. musculus 2.82666O13S 35, 8, 9 AUO43040 2.289264614 36, 12, 7 AW55.3719 ESTs 2.3836S4235 36, 12, 9 AWS46,347 Mits musculus geminin mRNA, complete cols 2.181899423 36, 15, 12 AUO21009 Mits musculus cleavage and polyadenylation specificity factor 73 kDa 1.73127O685 subunit mRNA, complete cols US 8,298,756 B2 43 44 SUPPLEMENTAL TABLE 1-continued

AccNo Gene Description NF ratio AI451984 Prim1 DNA primase, p49 subunit 2.2SO302092 AWS48009 ESTs, Highly similar to PTD014 H. sapiens 2.346432008 AW537083 s, Highly similar to cellular apoptosis susceptibility protein H. sapiens 2.766532496 AWS49140 s, Weakly similar to Peter Pan D. melanogaster 2.379.705926 AUO15435 2.654766001 AUO408O1 ESTs, Highly similar to rer M. musculus 3.236,111635 W62229 Ube1.c ubiquitin-activating enzyme E1C 5.477163155 AWS394.43 4.636199091 AW5565.11 ESTs 184141389 AUO20998 Pat plasminogen activator, tissue 2.599921486 AI4S1597 EST 2.740582S23 AW557336 Vti.1b-pending vesicle transport through interaction with t-SNAREs 1b homolog 1877835.528 AWS43524 Ghrh growth hormone releasing hormone 3.7312984O1 AUO16461 SSfa1 sperm specific antigen 1 2.512128647 C86958 ESTs 2.444945562 AA161815 4.123898.045 AW55.7863 2.491298OO2 C87642 STs, Weakly similar to coded for by C. elegans cDNAs GenBank: M88869 1869067234 and TO1933 C. elegans AUO21687 ESTs 1.8O3O38147 AI464450 ESTs 2.2042O2O38 AW557915 Ezh1 enhancer of Zeste homolog 1 (Drosophila) 2.4168558O1 AWSS2394 2.487914695 AUO42629 2.392O)6O2O7 AUO18693 1983728331 AW557968 3.S14174584 39, 12, 20 AA265633 3.087599296 39, 14, 25 W97741 18672O6344 39, 15, 18 AWS39S28 DNA segment, Chr 13, Wayne State University 177, expressed 1.97.046O782 39, 19, 17 AWS36910 ESTs, Moderately similar to chromosome-associated protein-E H. sapiens 2.365185976 39, 19, 18 AWS436.36 Anxas annexin A5 2.471-442908 39, 21, 3 A4478.15 ESTs, Moderately similar to LUTHERAN BLOOD GROUP 2.2O379027 GLYCOPROTEIN PRECURSOR H. sapiens) AWS44818 Rab18 RAB18, member RAS oncogene family 3.109347054 AAO141.96 Glud Glutamate dehydrogenase 3.238249096 AAO2O034 ESTs, Weakly similar to cleft lip and palate transmembrane protein 1 2.376903716 H. Sapiens 6.851 119345 AW557574. Lirpap1 ow density lipoprotein receptor related protein, associated protein 1 3.789636371 7 AWS4SOO6 PSmb1 proteasome (prosome, macropain) subunit, beta type 1 4.277781412 8 AWS49474 STs, Moderately similar to unknown H. sapiens 3.314824736 AWS4S119 7.994.504577 8 AWS38456 18O3.82642 6 AW555755 2.5 62143842 87 AWS38474 ESTs, Highly similar to PUTATIVE SERINE THREONINE-PROTEIN 2.2478.26338 KINASE A Trypanosoma bruceii brucei 7 AW55.3714 TIk Tousled-like kinase (Arabidopsis) 2.510671023 7 AWS4SO33 ESTs, Moderately similar to KIAAO007 H. sapiens S.424290287 s AWS46427 ESTs, Highly similar to RAS-LIKE PROTEIN TC21 Homo sapiens 2.783O813S 2 5 W83959 ESTs 3.01450973 AUO4S568 ESTs, Weakly similar to IgGFc binding protein M. musculus 3.3625O1582 AWS396O7 ESTs, Weakly similar to All-1 protein +GTE form M. musculus 3.099324211 69 AAS456O7 Mtf2 metal response element binding transcription factor 2 3.777112474 AUO17822 ESTs, Weakly similar to NSP-like 1 M. musculus 3.226784472 : AUO21740 ESTs, Weakly similar to POSSIBLE GLOBAL TRANSCRIPTION 4.128979953 ACTIVATORSNF2L Caenorhabditis elegans 3 1 AUO17911 ESTs, Weakly similar to implantation-associated protein R. norvegicus 1976753477 AW557657 socitrate dehydrogenase 1 (NADP+), soluble 8.1065632O2 3 AAO41834 Thymidine kinase 8.48OO42707 AWSS4926 ESTs, Highly similar to PTB-ASSOCIATED SPLICING FACTOR 4.181277703 Homo sapiens 4, 6, 17 AWS44040 ESTs 5.628414012 4, 6, 21 AA2O8818 ragile X mental retardation gene, autosomal homolog 2.57488.2839 AW538705 3.202681524

40, 12, 18 40, 13, 8 AW551167 S 2.085037733 40, 14, 18 AWS38766 ESTs, Weakly similar to HYPOTHETICAL UOG-1 PROTEIN M. musculus 2.62S140435 40, 17, 11 AUO17992 kinectin 1 1.910629157 40, 2, 16 AWS36696 NADH dehydrogenase flavoprotein 1 3.16947838 40, 22, 12 AUO14587 ESTs, Highly similar to POLYADENYLATE-BINDING PROTEIN Xenopu 2.98.3364731 Xenopus laevis 40, 23, 18 AWS424O1 ESTs 4.6227O7745 40, 4, 26 AA473234 ESTs 1879559343 40, 5, 13 AUO22276 Ask-pending activator of S phase kinase 1.8O1825864 40, 7, 22 AA154888 2.045741456 41, 10, 13 AUO234.17 Xnp X-linked nuclear protein 2.3051S632 41, 10, 17 AWS458.35 Mus musculus Smt3A protein mRNA, complete cols 4.782.6417 41, 13, 10 AUO44944 Rab11a RAB11a, member RAS oncogene family 3.257027215 41, 14, 10 AUO44964 2.56.1072945 US 8,298,756 B2 45 46 SUPPLEMENTAL TABLE 1-continued

ID AccNo Gene Description NF ratio 41, 15, 7 AW55.4377 ESTs 3.210449861 41, 18, 1 8 AWS42924 ESTs, Highly similar to hSgt1p H. sapiens 1.661318391 41, 19, 8 AWSS2438 ESTs, Moderately similar to (defline not available 5714400) M. musculus 2.084900792 41, 23, 1 7 AWS36843 Cct4 chaperonin Subunit 4 (delta) 2.06085563S 41, 3, 16 AW537566 ESTs, Highly similar to HYPOTHETICAL PROTEIN C22G7.01C IN 4.12S279614 CHROMOSOME I Schizosaccaharomyces pombe 41, 6, 17 AWS44660 ESTs 1.666988225 41, 6, 26 AA422973 ESTs, Moderately similar to AF 161556. 1 HSPCO71 H. sapiens 2.652S81493 41, 7, 26 AA46598O ESTs, Highly similar to HYPOTHETICAL 51.6 KD PROTEIN F59B2.5 IN 4.083961131 CHROMOSOME III Caenorhabditis elegans 41, 8, 26 AA413694 Rab7 RAB7, member RAS oncogene family 2.94.841S605 41, 9, 1 AUO17162 Rpl5 ribosomal protein L5 1.694246937 42, 1, 1 AUO15293 ESTs 2.490.522603 42, 11, 8 AWS38SOO 2.1991 O9471 42, 11, 9 AWS46,328 1838459869 42, 14, 7 AWSS38O8 ESTs, Weakly similar to (defline not available 5579011) M. musculus 1.766S284S1 42, 16, C76345 1894584674 42, 18, AWS36342 ESTs, Weakly similar to RSP-1 PROTEIN Mus musculus 2.542866132 42, 18, AA105717 Ddx20 DEAD H (Asp-Glu-Ala-Asp/His) box polypeptide 20 1909088139 42, 19, i AWS36359 ESTs, Highly similar to UNR PROTEIN Rattus norvegicus 4.798453644 42, 2.8 AWS48051 s 2.8741373.72 42, 21, 2 A465270 S 1931439.126 42, 22, 7 AWS364SO S 2.60324142 42, 22, 6 AW557553 S 4.4237 63724 8 AWS410O3 2.28301633S 42, 23, 42, 23,9 AWS47945 Cs, Weakly similar to ZIP-kinase M. musculus 3.2348.69937 42, 5, 1 AUO15486 Cappa2 ping protein alpha 2 3.8944O1118 42, 6, 17 AWS44098 1.80O2851.86 42, 6, 25 W67062 Ts, Weakly similar to CST1 HUMAN CLEAVAGE STIMULATION 3.272S11033 FACTOR, 50 KD SUBUNIT H. sapiens 42, 6, 26 AA467238 ESTs, Moderately similar to AF155107 1 NY-REN-37 antigen H. sapiens 2.O2S843113 43, 14, 24 AAO24255 Slc22a5 Solute carrier family 22 (organic cation transporter), member 5 1.88O231831 43, 15, AA396.298 Mus musculus mRNA for RNase 4, complete cols 3.470957341 43, 15, 9 AWS47111 Myhca myosin heavy chain, cardiac muscle, adult 3.155653539 43, 16, 4 A431019 ESTs 3.158363336 43, 18, 6 AW557123 Dok1 downstream of tyrosine kinase 1 1906960586 43, 19, C87993 Mtf1 metal response element binding transcription factor 1 1998.123193 43, 20, C88019 EST 2.320518989 43, 22, C85340 ESTs 2.94.188799 43, 22, AWS36816 ESTs, Weakly similar to ZW10 interactor Zwint H. sapiens 3.211073,781 43, 23, AWS43413 ESTs 2.826341304 43, 23, 8 AW552337 ESTs, Highly similar to RAS-RELATED PROTEIN RAB-6 Homo sapiens 2.64.1220499 43, 5, 22 AA162800 Cul3 cullin 3 4.18974O174 44, 14, 3 AUO23746 Tacc3 transforming, acidic coiled-coil containing protein 3 4.176773893 44, 2, 16 AWS36480 ESTs 2.671.38219 44, 22, AWS36428 ESTs, Moderately similar to BLEOMYCIN HYDROLASE Oryctolagus cliniculus 44, 6, 16 AWS37169 ESTs, Weakly similar to misato D. melanogaster 3.14O606246 45, 1,8 AWS49019 ESTs 2.22O328696 45, 10, 7 AWS361.83 Cct3 chaperonin Subunit 3 (gamma) 2.OSS.41031 45, 13, 1 AUO17619 Ak3 adenylate kinase 3 3.186508,194 45, 18, 7 AWS36926 ESTs, Highly similar to KIAA0601 protein H. sapiens 2.282.157312 45, 4, 10 AUO43481 ESTs 3.30981-1859 45, 4, 1 AUO16359 ESTs, Weakly similar to GPROTEIN PATHWAY SUPPRESSOR1 1949742SO2 R. norvegicus 4 C86941 15.31639347 AW556373 ESTs, Highly similar to HAM1 PROTEIN Saccharomyces cerevisiae 2.228965982 AWS46.162 ESTs, Weakly similar to CARG-BINDING FACTOR-AM. musculus 2.18948.2216 8 AW539377 2.065750725 4 AWS46244 ESTs, Weakly similar to G protein-coupled receptor kinase 6, splice variant 1.671 S15989 AM. musculus 46, 10, 5 AIS73427 Catnb Catenin beta 2.08164667 46, 10, 6 AWSS6036 ESTs, Weakly similar to Weak similarity in middle of protein to HIV-1 TAT 1.693,522,568 protein S. cerevisiae 46, 14, 1 O AUO44566 ESTs, Highly similar to VACUOLARATP SYNTHASE SUBUNIT D 2.897417571 Bos tattrits 46, 16, 1 1 AUO18O11 Mus musculus truncated SON protein (Son) mRNA, complete cols 2.729861304 46, 16, 1 8 AWS38862 ESTs, Weakly similar to P9513.2 gene product S. cerevisiae 3.0549.27766 46, 17, 1 8 AWS41468 ESTs, Highly similar to HYPOTHETICAL 64.5 KD PROTEIN ZK652.9 IN 2.98SO37992 CHROMOSOME III Caenorhabditis elegans AUO18547 EST, Weakly similar to NaPi-2 beta R. norvegicus 2.58O324249 AW536727 ESTs, Highly similar to HYPOTHETICAL 18.5 KD PROTEIN C12G12.05 2.254.945336 NCHROMOSOME I Schizosaccaromyces pombe AW555047 Mus musculus major histocompatibility complex region NG27, NG28, 3.29O2S8007 RPS28, NADH oxireductase, NG29, KIFC1, Fas-binding protein, BING1, apasin, RalGDS-like, KE2, BING4, beta1,3-galactosyltransferase, and RPS18 genes, complete cols: Sacm21 gene, partial cod US 8,298,756 B2 47 48 SUPPLEMENTAL TABLE 1-continued

ID AccNo Gene Description NF ratio 46, 22, 3 A4471SO Mits musculus insulin-like growth factor I receptor mRNA, complete cols 1805486723 46, 22,9 AWS48322 Pctk1 PCTAIRE-motif protein kinase 1 12.057525 47, 1, 13 AUO22611 2.776415523 47, 1, 16 AWS37042 ESTs 1.729832182 47, 1,3 A426.662 EST 4.156422912 47, 10, 17 AW536175 Adhs alcohol dehydrogenase 5 2.65O134514 47, 11, 9 AW547270 ESTs, Weakly similar to Smarcel-related protein M. musculus 16249.51679 47, 12, 17 AWS361.97 Mus musculus Tera (Tera) mRNA, complete cols 8.192347763 47, 12, 6 AWSS6482 ESTs, Moderately similar to hypothetical protein H. sapiens 2.303394618 47, 13, 18 AWS39474 ESTs 2.191349291 47, 13, 8 AWSS1820 ESTs, Highly similar to HYPOTHETICAL 37.2 KD PROTEIN C12C2.09C 2.736097382 NCHROMOSOME I Schizosaccaromyces pombe 47, 14, 14 C88094 ESTs, Weakly similar to teg292 protein M. musculus 14.3.1878982 47, 15, 18 AW539.529 ESTs 2.64445063 47, 15, 2 AI451613 ESTs, Highly similar to CYP4B1 M. musculus 2.318913225 47, 15, 8 AWSS1863 2.647171891 47, 19, 26 W592O2 Stat3ip1 signal transducer and activator of transcription 3 interacting protein 1 5.10228.177 pending 47, 2, 15 C78609 ESTs, Highly similar to EUKARYOTIC INITIATION FACTOR4 GAMMA 2.621287161 Oryctolagus cliniculus 47, 22, 18 AWS43722 ESTs, Highly similar to ARGINYL-TRNASYNTHETASE 7.643773902 Cricetitius longicatidatus 47, 3, 10 AUO434O7 ESTs, Highly similar to elongation factor SIII p15 subunit R. norvegicus 3.0792624 47, 3,9 AWS45936 Cks1 cyclin-dependent kinase regulatory subunit 1 3.2O2S32356 47, 4, 11 AUO16321 ESTs 19433 16321 47, 6, 7 AW553551 ESTs, Highly similar to calcium-independent alpha-latrotoxin receptor 2.23S17OO69 homolog 2 R. norvegicus 47, 7, 15 C79581 MSn moesin 3.670385369 47, 8, 8 AWSSO493 Db diazepam binding inhibitor 2.SSS4928.23 47, 8, 9 AWS46174 Tgfbli4 transforming growth factor beta 1 induced transcript 4 S.66898.8417 48, 12, 7 AW553985 ESTs 1839.71483S 48, 14, 15 C8O147 Hdgf hepatoma-derived growth factor 2.5796.184S5 48, 15, 7 AWSS4081 Adnp activity-dependent neuroprotective protein 3.05598.9327 5, 14, 12 AUO20992 S 2.568169261 5, 14, 5 AI894.273 ESTs, Moderately similar to HIGH MOBILITY GROUP-LIKE NUCLEAR 13.46949084 PROTEIN 2 Saccharomyces cerevisiae 5, 15, 14 C881.81 ESTs, Moderately similar to CCR4-ASSOCIATED FACTOR 1 M. musculus 2.0491.63.559 5, 15, 18 AW53.9545 ESTs 1.8042O6411 5, 16, 24 AAO3O995 Ppib peptidylprolyl isomerase B 5.335704428 5, 17, 12 AUO15031 ESTs 1870335095 5, 17, 18 AWS43515 ESTs, Highly similar to TRNA-PROCESSING PROTEINSEN3 2.600612477 Saccharomyces cerevisiae 1 2 AUO19262 ESTs, Weakly similar to DNAJ PROTEIN HOMOLOGMTJ1 M. musculus 4.084659.729 2. 1 8 AW543.750 M. musculus mRNA for glutamyl-tRNA synthetase 3.038O631.68 1 6 AW537799 Mus musculus SIK similar protein mRNA, complete cds 2.636695362 AUO19331 ESTs 2.O92198567 AAO16759 Mcmd.6 mini chromosome maintenance deficient 6 (S. cerevisiae) 3.94.2228729 AAS47SSS Cks1 CDC28 protein kinase 1 2.8421638SS AA475488 ESTs, Highly similar to KIAA1008 protein H. sapiens 1907 792508 1 AUO16865 Zipper (leucine) protein kinase 187496068 AWSS606S 5.780334277 AWSS6081 ESTs 2.22898364 3 AUO23995 Mits musculus chromosome segregation protein SmcE (SmcEB) mRNA, 2.53O486227 complete cols 8 AWS4145S ESTs, Weakly similar to anillin D. melanogaster 1.75224982S AWS46860 S 2.576O70438 8 AWS415O1 STs, Highly similar to CLATHRIN HEAVY CHAIN Rattus norvegicus 2.117485424 AWSS2139 Adcy6 adenylate cyclase 6 3.7312O1924 O AUO41439 Gnai2 guanine nucleotide binding protein, alpha inhibiting 2 2.87168OOS AWS48297 Gitsel G two S phase expressed protein 1 1.95946572 AW557901 ESTs, Weakly similar to C54G7.4 gene product C. elegans 2.5223.77919 AWS497O6 Nedd4 neural precursor cell expressed, developmentally down-regulated gene 4 2.327084972 AWSS3142 2.O86689668

s AWS49721 Hspa9a heat shock protein, 74 kDa, A 2.53S48O124 AWS49786 ATP synthase, H+ transporting mitochondrial F1 complex, alpha Subunit 3.883486,547 AWS498.17 Burkitt lymphoma receptor 1 190463473S AUO44286 ESTs 2.426995221 AUO16189 ESTs 2.013455.426 AW555561 Mybl2 myeloblastosis oncogene-like 2 2.467492726 o, 7 AWSS3629 ESTs, Moderately similar to LEYDIG CELLTUMOR 10 KD PROTEIN 1.7886.1896 Rattus norvegicus AWSS4486 Unp ubiquitous nuclear protein 1967446342 AW551867 CSrp2 cysteine-rich protein 2 164296,7264 AWS47491 ESTs, Highly similar to nuclear pore complex glycoprotein pé2 M. musculus 1.751627931 AWS36943 ESTs 5.96.5587283 AAOO3258 ESTs 3.0341SOS89 AUO16261 ESTs 2.130579.346 US 8,298,756 B2 49 50 SUPPLEMENTAL TABLE 1-continued

ID AccNo Gene Description NF ratio

7, 6, 16 AW537692 ESTs, Highly similar to AUXIN-RESISTANCE PROTEIN AXR1 4.828573O83 Arabidopsis thaliana 7, 6, 26 AA437614 ESTs, Highly similar to S1-1 protein R. norvegicus 2.58O768885 7, 7, 16 AW537731 ESTs 3.0261222O2 7, 8, 10 AUO43672 ESTs, Highly similar to PUTATIVE ATP-DEPENDENT RNA HELICASE 2.123346276 C22F3.08C Schizosaccaromyces pombe 7, 8, 12 Mus musculus dUB-type TGT mRNA for deubiquitinating enzyme, complete 3.722164894 cols 7, 8, 22 AA168656 DSErt363e DNA segment, Chr 5, ERATO Doi 363, expressed 3.199043745 7, 9, 10 AUO45064 ESTs, Highly similar to SOH1 PROTEIN Saccharomyces cerevisiae 2.O35291187 8, 1, 20 AA24.1756 sid2057p Small acidic protein sid2057p 3.15579.1289 8, 10, 7 W55.3223 ESTs 242843.1066 8, 12, 17 W545455 ESTs 2.121493764 8, 12, 5 573460 Chd1 Chromodomain helicase DNA binding protein 1 2.SSO88O804 8, 14, 8 551176 3.98.4110864 8, 16, 18 WS3882O adenylate kinase 4 S.S90412241 8, 2, 5 W557865 RadSO RAD50 homolog (S. cerevisiae) 2.71088834 8, 21, 11 UO18118 Nap111 nucleosome assembly protein 1-like 1 4.5776698.91 8, 21, 7 AW555020 ESTs, Highly similar to UBIQUINOL-CYTOCHROME CREDUCTASE 3.1340O887 COMPLEXCORE PROTEIN 2 PRECURSOR Bos taurus) 8, 22, 18 AWS42335 E STs, Highly similar to MICROSOMAL SIGNAL PEPTIDASE 21 KD 2.43673.4688 SUBUNIT Canis familiaris 8, 23, 3 A452358 ST 2.78SS39438 8, 5, 26 AA474386 3472579152 8, 6, 17 AWS44320 arto G10 PROTEIN Xenopus laevis 3.666082859 8, 6, 6 AW555813 2.358368809 8, 8, 24 AAO14445 F10 L O 3.94.046682S 8,9, 6 AW555985 Rpa2 replication protein A2 2.490514775 9, 1, 15 C7828O 2.916669069 9, 1,5 AW558079 ESTs, Weakly similar to PPARgamma coactivator M. musculus 2.596900062 9, 11, 16 C76867 ESTs, Moderately similar to TROPOMYOSINALPHACHAIN, SKELETAL 2.862563996 AND CARDIAC MUSCLE IM. musculus 9, 12, 11 AUO17259 eed embryonic ectoderm development 3.34.3130988 9, 13, 11 AUO17276 Ntan1 N-terminal ASn amidase 2.571512897 9, 13, 7 AW554273 ESTs, Weakly similar to VRK2 H. sapiens 1.647320818 9, 14, 23 AAO86829 Missk1 muscle-specific serine kinase 1 2.1OOO87115 9, 16, 11 AUO18261 ESTs 4.232824.804 9, 17, 11 AUO4O108 2.163537648 9, 17, 8 AW551726 WW domain binding protein 5 2496644567 9, 2, 6 AWSSS464 S, Weakly similar to neuronal-specific septin 3 M. musculus 2.8576.49535 9, 20, 17 AWS36798 2.0452O7463 9, 21, 10 AUO41740 2.01868O23 9, 22, 10 AUO41756 2.554725916 9, 22, 8 AWSS2312 1.978.37746 9, 3,9 AUO42878 proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein 2.0698.63O24 9, 4, 16 AW537568 ESTs, Weakly similar to similar to yeast heat shock protein STI1 C. elegans 2.212O10488 9, 5, 25 W821.94 LOCS7423 hypothetical protein, clone: 2-31 3.004332364 9, 6, 22 AA144221 HicS3 hydrogen peroxide inducible protein 53 1.613906386 9, 7, 17 AWS44666 ESTs 1.S73680622 24, 13, 17 AW545557 O.289781915 11, 23, 13 UO18762 gMCK2 Mits miscuit is casein kinase 2 beta Subunit O.213188567 37, 21, 16 7 8 5 O3 Ask-pending activator of S phase kinase O.193218524 2, 18, 12 UO21170 Abca1 Macrophage specific gene O.390 186712 8, 10, 15 791.13 weakly similar to casein kinase 2 beta Subunit 0.195588578 38, 15, 18 5 1 ESTs O.18O13489 39, 5, 15 . ESTs O.28888SO71 37, 7, 13 0.1677353.54 12, 10, 7 ESTs, Highly similar to ATP-DEPENDENT PROTEASE LA 2 Myxococcus O.297372968 canthus 11, 2, 12 AUO18863 KIfA. Kruppel-like factor 4 (gut) O403065274 24, 17, 15 C80212 ESTs O.338.126518 17, 20, 15 C85300 unp Mits miscuit is ubiquitin-specific protease O.323OO4358 43, 13, 2 AI4S1378 ESTs O4S4721961 31, 7, 13 AUO23508 Mits musculus uroporphyrinogen III synthase gene, promoter, O.168448.583 24, 22, 13 AUO18397 Nek7 Mus musculus NIMA (never in mitosis genea)-related expressed kinase 7 O.35983928S US 8,298,756 B2 51 52 SUPPLEMENTAL TABLE 2

Primers used in uantitative RT-PCR RT-PCR) . Annealing Product Primer Temperature Size Gene Name type Primer sequence 5'-3' (o C.) (bp) Apoptosis Forward acctt caagaactggc cctt 6 O 117 Inhibitor 4 Rewerse aaaac actgggccalaatcag

Breast Forward ttggacaacccc caattaaa 6 O 1OO Cancer Rewerse Ctggagtgctttittgaaggc Associated Protein 2

Defender Forward ttgctggatgccitat citc ct 6 O 147 Against Rewerse gcaaaccgctaagatgaagc Death 1

Heat Shock Forward acacaaatgaagaggctggg 6 O 106 Protein 60 Rewerse actggattagcc cctittgct

Integrin Forward Cagtgaacagcaagggitgaa 6 O 115 Beta 1 Rewerse taagaacaattic cqgcaacc

Macrophage Forward ttcatcgtgaacaccalatgt 6 O 147 Migration Rewerse aaaagt catgagctggtc.cg Inhibitory Factor 1.

Ornithine Forward catcCaaaggcaaagttggit 6 O 104 Decarboxy Rewerse agcctgctggittitt cagtgt lase 1

Beta Forward gatctggcaccacaccittct 6 O 144 actin Rewerse ggggtgttgaaggt ct caaa

GAPDH Forward gaagggct catgaccacagt 6 O 125 Rewerse ggatgcagggatgatgttct

SUPPLEMENTAL TABL 3 Primers used in Quantitative Real Time PCR (QRT-PCR). Product Annealing size temperature Primer name Sequence 5'-3' (bp) (o C.)

ZBP1 Forward t caagattgctic caccagaa 91 60 Rewerse citt coctdagcc ttgaactg

Arp2/3, Forward ttcaaggccaacgt.ctitctt 2O 60 p21 Rewerse tctggagttgcacttittgga

Actin Forward actgggacga catggagaag 14 60 gamma Rewerse tgttagctttggggttcagg

IIMK 1. Forward t catcaagagcatgga cagc 13 60 Rewerse gaggtotcggtggatgatgt

Actin3 Forward gCaggagcagaa catcatca 12 60 Rewerse Catgctgtag accgtgtgct

CFL1 Forward gtcaagatgctgccagacaa O2 60 Rewerse ggcc.ca.gaaaatgaatacca

TMOD Forward cgagggittalaaggggaaaag O2 60 Rewerse gacaggcatcgttct c ccta

MNS1 Forward ctg.ccgat ct ct catcct ct OO 60 Rewerse gag cacaa.gc.cactctgaca

Cap 1 Forward gaaag.ccaccagtttcaacc OS 60 Rewerse cittgagcact coaaccacct

Rock 1 Forward ttcaa.gc.cgactaacgg tatg 14 60 Rewerse gct caggaattctggaaga US 8,298,756 B2 53 54 SUPPLEMENTAL TABLE 3 - continued

Primers used in Ouantitative Real Time PCR RT-PCR) .

Product Annealing size temperature Primer name Sequence 5'-3' (bp) (o C.)

Arp2/3, Forward gctaggct cqctgaagaaga 117 60 p16 Reverse tatt cqtccacgt.ccaccitt

Beta- Forward gatctggcaccacaccittct 144 60 actin Reverse ggggtgttgaaggit ct caaa

GAPDH Forward gaagggct catgaccacagt 125 60 Reverse ggatgcagggatgatgttct

SUPPLEMENTAL TABLE 4 AccNo Gene Description NF ratio AW536875 ESTs, Highly similar to 60S RIBOSOMAL PROTEIN L15 Rattus norvegicus) 28.07042798 C88094 ESTs, Weakly similar to teg292 protein M. musculus 14.3.1878982 AI894273 ESTs, Moderately similar to HIGH MOBILITY GROUP-LIKE NUCLEAR PROTEIN 2 13.46949084 Saccharomyces cerevisiae AW555.456 Mits musculus centrin (Cetn2) gene, complete cols 12.388SSS12 AWS48322 Pctk1 PCTAIRE-motif protein kinase 1 12.057525 C86468 Kcnna. potassium intermediate small conductance calcium-activated channel, Subfamily N, 11.025301S2 member 4 AUO19118 ESTs, Moderately similar to unknown H. sapiens 9.3278.88895 AAO41834 Tk1 Thymidine kinase 1 8.48OO42707 AWS36197 Mus musculus Tera (Tera) mRNA, complete cols 8.192347763 AW557657 Idh1 isocitrate dehydrogenase 1 (NADP+), soluble 8.106,5632O2 AW537075 ESTs, Weakly similar to SIG41 M. musculus 7.942.96S646 AA172774 D16Wsu83e DNA segment, Chr 16, Wayne State University 83, expressed 7.71686883 AWS43722 ESTs, Highly similar to ARGINYL-TRNASYNTHETASE Cricetulus longicaudatus 7.6.43773902 AA209964 D11 Moh34 DNA segment, Chr 11, KL Mohlke 34 7.590178566 AUO41246 ESTs, Highly similar to 26S PROTEASE REGULATORY SUBUNIT 4 HOMOLOG 7.5759.91278 Schizosaccaromyces pombe AW536755 ESTs, Highly similar to similar to nuclear domain 10 protein NDP52 H. sapiens 7.509323804 AUO19152 Zfr Zinc finger RNA binding protein 7.1878.04716 AW554270 Hinrpu heterogeneous nuclear ribonucleoprotein U 6.962446985 AUO24490 ESTs, Highly similar to PROTEIN TRANSLATION FACTORSUI1 HOMOLOG 6.646581,144 Anopheles gambiae AUO18130 ESTs, Weakly similar to cholesterol 25-hydroxylase M. musculus 6.335735765 AW539791 ESTs, Weakly similar to coded for by C. elegans cDNAs GenBank: C. elegans 6.21796016 AUO1718O ESTs, Highly similar to HETEROGENEOUS NUCLEARRIBONUCLEOPROTEINK 6.088798225 Homo sapiens; Ratti is norvegicus AI464376 M. musculus mRNA for ribosomal protein S5 6.08735.8987 AW5442O4 Cct8 chaperonin subunit 8 (theta) 6.O14885,062 AW546174 Tgfb114 transforming growth factor beta 1 induced transcript 4 S.66898.8417 AAO68436 ESTs, Highly similar to unknown R. norvegicus 5.647684222 AWS38820 AkA adenylate kinase 4 S.S90412241 AWS492SS ESTs, Weakly similar to unknown R. norvegicus S.S76813364 AUO41887 ESTs, Highly similar to HYPOTHETICAL 30.3 KD PROTEIN IN APE1/LAP4-CWP1 5.5733.24729 NTERGENIC REGION Saccharomyces cerevisiae) AW547924 Rbbp7 retinoblastoma binding protein 7 S.S60647246 AUO18928 ESTs, Highly similar to TRAF4-associated factor 2 H. sapiens S.S1 OO48.96S W62229 Ube1.c ubiquitin-activating enzyme E1C 5.477163155 AWS37279 Macs myristoylated alanine rich protein kinase C Substrate S.47S95949 C78877 PSmc5 protease (prosome, macropain) 26S subunit, ATPase 5 5.462141323 AWS48O86 Ptna prothymosin alpha S.460385354 AUO23751 ESTs, Highly similar to HPBRII-7 protein H. sapiens 5.426224824 C784.81 Ef3 eukaryotic translation initiation factor 3 5.424426041 AWS4SO33 ESTs, Moderately similar to KIAAO007 H. sapiens S.424290287 AUO41313 Et1 enhancer trap locus 1 5.38413569 AUO15358 Obl1a2- ubiquitin-like 1 (Sentrin) activating enzyme subunit 2 5.36S11445S pending AW543409 DXWsu72e DNA segment, ChrX, Wayne State University 72, expressed 5.35O172937 AAO3O995 Ppib peptidylprolyl isomerase B 5.335704428 AW549121 Hmg14 high mobility group protein 14 5.305166988 AWSS3645 Sc12a2 solute carrier family 12, member 2 S.20922S843 AWS3646O Sfirs3 splicing factor, arginine?serine-rich 3 (SRp20) 5.140661094 W592O2 Statisipl- signal transducer and activator of transcription 3 interacting protein 1 5.10228.177 pending AW542927 Bcap31 B-cell receptor-associated protein 31 5.066787673 AWS36.194 ESTs, Highly similar to CGI-35 protein H. sapiens S.O45862O39 AWS3848O ESTs, Moderately similar to serine proteinase inhibitor 6 M. musculus 4.924.57718 US 8,298,756 B2 55 56 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio AWS394.67 eukaryotic translation initiation factor 3 4.892O17699 AWS44515 ADP-ribosylation-like factor 6 interacting protein 4.837717593 AW537692 ESTs, Highly similar to AUXIN-RESISTANCE PROTEIN AXR1 Arabidopsis thaliana 4.828573O83 AWSS2431 Scp2 sterol carrier protein 2, liver 4.8182O2.195 AWS36911 C97 CD97 antigen 4.810474487 AWS36359 ESTs, Highly similar to UNR PROTEIN Rattus norvegicus 4.798453644 AWS445O2 ATPase, Na+/K+ transporting, beta 1 polypeptide 4.787962787 AWS4S835 Mus musculus Smt3A protein mRNA, complete cols 4.78.26417 AWS38992 Mus musculus mRNA for 26S proteasome non-ATPase subunit 4.76789816 AWS4S393 ESTs, Highly similar to TRANSLATION INITIATION FACTOREIF-2B GAMMA 4.68467O69 SUBUNIT R. norvegicus AW544140 D1OWSuS2e DNA segment, Chr 10, Wayne State University 52, expressed 4.683O1818.9 AI327.096 Mus musculus neuronal calcium sensor-1 (NCS-1) mRNA, complete cols 4.676318103 AWS41474 Nc nucleolin 4.6577OOSO4 AW537584 Kirt2-8 keratin complex 2, basic, gene 8 4.6321245 AW557.019 ESTs, Moderately similar to TRANSCRIPTION INITIATION FACTORIA SMALL 4.631.52 CHAIN Saccharomyces cerevisiae AW538715 ASS1 arginosuccinate synthetase 1 4.609205297 AWS44376 ESTs, Weakly similar to predicted using Genefinder C. elegans 4.5964544S5 C76750 Hinrpal heterogeneous nuclear ribonucleoprotein A1 4.582363217 AUO18118 Nap111 nucleosome assembly protein 1-like 1 4.577669891 AA166336 ESTs, Moderately similar to DRIM protein H. sapiens 4S1584.1853 C791.84 Kpna2 karyopherin (importin) alpha 2 4.483193 007 AWS38863 Mus musculus mRNA for mitochondrial acyl-CoA thioesterase, clone 1 4.48O3O1436 AWS47148 ESTs, Highly similar to LL5 protein R. norvegicus 4473954.317 AW536137 Ccts chaperonin Subunit 5 (epsilon) 4.46932O692 AUO44379 Arléip ADP-ribosylation-like factor 6 interacting protein 4456690776 AA2723.63 ESTs, Highly similar to KINESIN-II 85 KD SUBUNIT Strongylocentrotus purpuratus 4.451371.032 AW537358 ESTs, Weakly similar to cDNA ESTyk338g10.5 comes from this gene C. elegans 4.4241O7656 AUO4O277 Rpms7 ribosomal protein, mitochondrial, S7 4.42173964 AUO15699 ESTs, Highly similar to SPLICING FACTOR U2AF 35 KD SUBUNIT Homo sapiens 4.3967873O4 AUO4.3252 Mits musculus succinyl-CoA synthetase (Sucla.1) mRNA, complete cols 4.389.7454.09 AU043400 Suptah Suppressor of Ty 4 homolog (S. cerevisiae) 4346211791 AA414612 Cappal capping protein alpha 1 4.335956318 AW558053 Ugt1a1 UDP-glucuronosyltransferase 1 family, member 1 4.324788648 AW53978O H3f.3b H3 histone, family 3B 4.312364694 AWS4SOO6 PSmb1 proteasome (prosome, macropain) subunit, beta type 1 4.277781412 AW555779 Mapk3 mitogen activated protein kinase 3 4.2659890S AWSS2398 ESTs, Moderately similar to TRANSCRIPTION INITIATION FACTORTFIID 28 KD 4.263787523 SUBUNIT H. sapiens AWS37694 ESTs, Highly similar to HYPOTHETICAL 109.5 KD PROTEIN IN PPA1-DAP2 4.23891808S NTERGENIC REGION Saccharomyces cerevisiae) C80485 Zinc finger RNA binding protein 4.20498.1315 AWS391O2 ESTs, Weakly similar to EUKARYOTIC TRANSLATION INITIATION FACTOR 3 4.20O8823O2 BETA SUBUNIT H. sapiens W75853 ESTs, Moderately similar to SIGNAL RECOGNITION PARTICLE 19 KD PROTEIN 4. 98.748472 Homo sapiens AWS42909 Hmg14 high mobility group protein 14 95667397 AA1628OO Cul3 cullin 3 8974O174 AWSS4926 ESTs, Highly similar to PTB-ASSOCIATED SPLICING FACTOR Homo sapiens 81277703 AWS458.39 Nap111 nucleosome assembly protein 1-like 1 79882367 AUO23746 Tacc3 transforming, acidic coiled-coil containing protein 3 76773893 AA422.809 ESTs, Highly similar to KIAA0368 H. sapiens 73186503 AW537017 Odc ornithine decarboxylase, structural 44399442 AW553.526 Npm1 nucleophosmin 1 4O3S2223 AWS38686 Ubce.7 ubiquitin-conjugating enzyme 7 384.51568 AUO21740 ESTs, Weakly similar to POSSIBLE GLOBAL TRANSCRIPTION ACTIVATOR 28979953 SNF2L Caenorhabditis elegans AW537566 ESTs, Highly similar to HYPOTHETICAL PROTEIN C22G7.01C IN CHROMOSOME 4. 2S279614 Schizosaccaromyces pombe procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 4.107549035 polypeptide AUO40830 ESTs, Weakly similar to 60S RIBOSOMAL PROTEIN L30A Saccharomyces cerevisiae) 4.091843934 AAO33344 Sc12a2 solute carrier family 12, member 2 4.088397442 AUO19262 ESTs, Weakly similar to DNAJ PROTEIN HOMOLOGMTJ1 M. musculus 4.084659.729 AA46598O ESTs, Highly similar to HYPOTHETICAL 51.6 KD PROTEIN F59B2.5 IN 4.083961131 CHROMOSOME Caenorhabditis elegans AWS49711 Mus musculus fallotein mRNA, complete cols 4.0677901 C80966 Timm8b. translocase of inner mitochondrial membrane 8 homolog b (yeast) 4.044729993 AWSS62O6 Hsp84-1 heat shock protein, 84 kDa 1 4.022387626 AUO43443 ESTs, Highly similar to TRAM PROTEIN Canis familiaris 4.01.1298,228 AWS45939 Rps12 ribosomal protein S12 4.OO9116425 AWS48431 ESTs, Highly similar to CYTOCHROME COXIDASE POLYPEPTIDE VIIB 4.OO9096,262 PRECURSOR Homo sapiens A426498 Mits musculus radio-resistance chemo-resistance cell cycle checkpoint control protein 4.OO7328711 (Rad9) mRNA, complete cols AI4291.36 ESTs, Highly similar to transforming acidic coiled-coil containing protein 3 4.00493O38 M. musculus US 8,298,756 B2 57 58 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio Arf1 ADP-ribosylation factor 1 3.991S26009 AUO41628 ESTs, Weakly similar to ORF2 M. musculus 3.9838S943 AUO18486 Ssb Sjogren syndrome antigen B 3.979536441 AWS36140 Hsp86-1 heat shock protein, 86 kDa 1 3.972.152303 AI323926 Fau Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed (fox 3.97.0764464 derived) C86592 Fin1 fibronectin 1 3.964340966 AWSS6230 Codc42 cell division cycle 42 homolog (S. cerevisiae) 3.958.094748 AI324227 Mits musculus 14-3-3 protein gamma mRNA, complete cols 3.9468994.17 AAO16759 Mcmd.6 mini chromosome maintenance deficient 6 (S. cerevisiae) 3.94.2228729 AAO14445 F10 FL10 3.940466825 C78998 Rp127 ribosomal protein L27 3.935127734 AAOO818.9 ESTs, Highly similar to KINESIN-II 85 KD SUBUNIT Strongylocentrotus purpuratus 3.92101OOS6 AWSS4328 ESTs, Highly similar to RSP5 PROTEIN Saccharomyces cerevisiae 3.913617092 AUO42788 ESTs, Moderately similar to phosphoenolpyruvate carboxykinase M. musculus 3.912S11036 AWS39228 Fasl Faa antigen ligand 3.910933775 AWSS6588 Tpi triosephosphate isomerase 3.903S381.84 AUO4S251 Ranbp1 RAN binding protein 1 3.90334OO68 AWS39811 Coc10 cell division cycle 10 homolog (S. cerevisiae) 3.902125311 AW555157 ESTs, Highly similar to C-1-TETRAHYDROFOLATE SYNTHASE, CYTOPLASMIC 3.896907728 Homo sapiens AUO15486 Cappa2 capping protein alpha 2 3.8944O1118 C87887 Et1 enhancer trap locus 1 3.89073106 AWS424.08 Pea15 phosphoprotein enriched in astrocytes 15 3.887.421434 AWS49786 Atp5b ATP synthase, H+ transporting mitochondrial F1 complex, alpha Subunit 3.883486,547 AWS3748O Atp5a1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1 3.8798O1077 AW555675 ESTs, Highly similar to ALCOHOL DEHYDROGENASE Homo sapiens 3873714959 AA423312 Ga17 dendritic cell protein GA17 3.84.8176993 pending AWS44122 Nap111 nucleosome assembly protein 1-like 1 3.8461. 61333 AWS483S4 Mits musculus elongation factor 1-beta homolog mRNA, complete cols 3.7990O7315 C79212 ESTs, Weakly similar to R32611 2 H. sapiens 3.7976083 AW558177 ESTs, Weakly similar to head-elevated expression in 0.9 kb D. melanogaster 3.796955936 AW556.707 ESTs, Moderately similar to PTB-ASSOCIATED SPLICING FACTOR Homo sapiens 3.794530279 AW557574. Lirpap1 low density lipoprotein receptor related protein, associated protein 1 3.789636371 AAS456O7 Mtf2 metal response element binding transcription factor 2 3.777112474 AWS453S4 Mus musculus mRNA for sid2057p, complete cols 3.771481148 AWSS34OS ubiquitin-activating enzyme E1, ChrX 3.74334.7278 AWS43524 growth hormone releasing hormone 3.7312984O1 AUO2O664 Mus musculus dUB-type TGT mRNA for deubiquitinating enzyme, complete cols 3.722164894 C76678 Mus musculus mRNA for Sido061p, complete cols 3.720O28548 ESTs, Moderately similar to nuclear factor of activated T-cells, cytoplasmic 3 H. sapi 3.70859768 &S C872O5 ESTs, Weakly similar to C44-B9.1 C. elegans 3.70 1990.317 AUO21072 ESTs, Weakly similar to unknown R. norvegicus 3.6911.9996S AAO73695 Mea1 male enhanced antigen 1 3.68.1248673 C87164 Ier3 immediate early response 3 3.6753.00717 AWS47244 Rpl10a ribosomal protein L10A 3.671527312 C79581 MSn moesin 3.670385369 AWS46184 ATPase, H+ transporting, lysosomal (vacuolar proton pump), 42 kDa 3.669772578 AWS44320 ESTs, Highly similar to G10 PROTEIN Xenopus laevis 3.666082859 C88O28 ESTs, Highly similar to small membrane protein 1 H. sapiens 3.665.66524 AW55.3254 Zip207 Zinc finger protein 207 3.651732585 AW539757 Zfp36 Zinc finger protein 36 3.64942S16S AUO2O890 ESTs, Weakly similar to CARG-BINDING FACTOR-A (Mus musculus 3.6451 12149 AWS4341S Mits musculus secretory carrier membrane protein 4 mRNA, complete cols 3.643663528 C87445 ESTs, Highly similar to PROBABLE 3-OXOADIPATE COA-TRANSFERASE 3.635344195 SUBUNIT B Bacillus subtilis) AWSS4947 ESTs, Highly similar to translation initiation factor IF2 H. sapiens 3.62564426S AWS4S835 Mus musculus Smt3A protein mRNA, complete cols 3.606723.188 AW554157 Nsmaf neutral sphingomyelinase (N-SMase) activation associated factor 3.602107632 C77976 ESTs, Weakly similar to retinoblastoma-associated protein HEC H. sapiens 3.599674605 AWS43839 ESTs, Moderately similar to AKAP450 protein H. sapiens 3.5963 13894 AAO15136 LOCS6046 hypothetical protein 3.596271768 AI324640 Amd3 S-adenosylmethionine decarboxylase 3 3.595274519 AWS41494 Surfa. Surfeit gene 4 3.591874393 AI4SO158 SIGNAL RECOGNITION PARTICLES4KD PROTEIN 3.578261.456 AW557661 Taldo1 transaldolase 1 3.573769539 AAS37161 ESTs, Highly similar to A55058 retinoic acid-regulated protein pH 34 - mouse 3.573741952 M. musculus AUO43213 Ewsh Ewing sarcoma homolog 3.565251777 AUO21819 Top1 opoisomerase (DNA) I 3.5484.00292 AW5372O7 ESTs, Highly similar to transcription factor NF-AT 45K chain H. sapiens 3.537224.57 C86331 H3 histone, family 3B 3.533490685 AWSS2131 ESTs, Highly similar to HYPOTHETICAL 109.5 KD PROTEIN IN PPA1-DAP2 3.53.0658429 NTERGENIC REGION Saccharomyces cerevisiae) AUO18409 ArhA Rho family GTPase 3.530268774 AI323675 Pctk3 PCTAIRE-motif protein kinase 3 3.52168,5781 US 8,298,756 B2 59 60 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio AWS36904 Ppia peptidylprolyl isomerase A 3.SO7621SO4 AI327246 ESTs, Weakly similar to tiltin M. musculus 3.SO7243434 AWS44281 Mus musculus ASC-1 mRNA, complete cols 3.50215121 AWSS1918 Ube?i ubiquitin-conjugating enzyme E2I 3.SOO959948 W481.68 Hprt Hypoxanthine guanine phosphoribosyltransferase 34957381.68 AUO16813 ESTs, Highly similar to ubiquitin specific protease H. Sapiens 3.494717718 AA396.298 Mus musculus mRNA for RNase 4, complete cols 3.470957341 AWS39445 Homer2 homer, neuronal immediate early gene, 2 3.468546,701 pending AWS36666 Hmg1 high mobility group protein 1 3.462175648 AWS491.14 Dncic2 dynein, cytoplasmic, intermediate chain 2 3.461903637 AWS448O1 Nap111 nucleosome assembly protein 1-like 1 3.45766SO96 AWS43791 Tbrg1 transforming growth factor beta regulated gene 1 3.456539482 AWS38438 Rp127a ribosomal protein L27a 3.45.1778704 AUO16O22 AnXa4 annexin A4 3.44.828O131 C79628 PSme1 protease (prosome, macropain) 28 subunit, alpha 3.442541693 AAO662SO ESTs, Weakly similar to BC-2 protein H. sapiens 3.43.01.16366 AWS42410 PSmc5 protease (prosome, macropain) 26S subunit, ATPase 5 3.429494.424 AUO18O29 ESTs, Highly similar to cbp146 M. musculus 3.428043044 C851.15 ESTs, Highly similar to NADH-CYTOCHROME B5 REDUCTASE Rattus norvegicus 3.427306351 AW556395 ornithine decarboxylase antizyme 3.4183O2938 AW536137 chaperonin Subunit 5 (epsilon) 3.417978.956 AAS17043 ring finger protein 4 3.4O9788494 AWSS1969 proline rich protein expressed in brain 3.399624829 AUO16270 ESTs, Highly similar to CYCLIN-DEPENDENT KINASES REGULATORY SUBUNIT 3.3958.12648 2 Homo sapiens AWS49909 Surfa. Surfeit gene 4 3.393471.399 AUO44024 Tip2 ightjunction protein 2 3.39.238.3317 AWS46168 Rps5 ribosomal protein S5 3.39.1993.373 AWS38671 ColSa3 procollagen, type V, alpha 3 3.383446584 AI894263 Tuba2 Tubulin alpha 2 3.37781933 AWS43832 ESTs, Highly similar to eukaryotic translation initiation factor elF3, p35 subunit 3.3748.34929 H. sapiens AWS36945 ESTs, Weakly similar to female sterile homeotic-related protein Frg-1 M. musculus 3.37311499 AWS36361 ESTs, Highly similar to KIAAO697 protein H. sapiens 3.364917242 AUO4S568 ESTs, Weakly similar to IgGFc binding protein M. musculus 3.3625O1582 AWS37446 Tcea1 transcription elongation factor A (SII), 1 3.353756593 AI666653 Mits miscuit is ubiquitin conjugating enzyme UBC9 mRNA, complete cols 3.347460034 AUO17259 eed embryonic ectoderm development 3.34.3130988 AI324671 Rp130 Ribosomal protein L30 3.343001828 WO9723 ESTs, Moderately similar to HAT1 HUMAN HISTONE ACETYLTRANSFERASE 3.34242.9405 TYPE B CATALYTIC SUBUNIT H. sapiens) AWS45818 ESTs, Weakly similar to prediction 3.339835947 AA278878 H2-T23 histocompatibility 2, Tregion locus 23 3.334974918 AUO14886 Gnb2-rs1 guanine nucleotide binding protein, beta-2, related sequence 1 3.3336.92828 AWS38432 Rhoip3 Rho interacting protein 3 3.330216O15 pending AW537357 Sdcbp Syndecan binding protein 3.329064.842 AWS37048 EtS2 E26 avian leukemia oncogene 2,3' domain 3.325078728 AWS49474 ESTs, Moderately similar to unknown H. sapiens 3.3148.24736 AWS36101 Mus musculus mRNA for phosphorylated adaptor for RNA export (PHAX gene) 3.313622909 AW557102 ESTs, Moderately similar to INSULIN-DEGRADING ENZYME R. norvegicus) 3.304747476 AWS4998O ESTs, Highly similar to UBIQUITIN-CONJUGATING ENZYME E2-17 KD 3.3O468O342 Drosophila melanogaster A413942 ESTs, Highly similar to UBIQUITIN-CONJUGATING ENZYME E2-17 KD 3.295674825 Drosophila melanogaster AW555047 Mus musculus major histocompatibility complex region NG27, NG28, RPS28, NADH 3.29O2S8007 oxidoreductase, NG29, KIFC1, Fas-binding protein, BING1, tapasin, RaIGDS-like, KE2, BING4, beta1,3-galactosyl transferase, and RPS18 genes, complete cols; Sacm21 gene, partial cod AA265636 ESTs, Highly similar to CALDESMON, SMOOTH MUSCLE Gallus gallus 3.2864.88615 AW557310 Kap kidney androgen regulated protein 3.275864713 W67062 ESTs, Weakly similar to CST1 HUMAN CLEAVAGE STIMULATION FACTOR, 50 3.272S11033 KDSUBUNIT H. sapiens C80438 Gart phosphoribosylglycinamide formyltransferase 3.26910O882 AA26O352 Mus musculus cerebellar postnatal development protein-1 (Cpd1) mRNA, partial cds 3.268033947 AWS36682 Impnb importin beta 3.263591322 AUO44944 Rab11a RAB11a, member RAS oncogene family 3.257027215 AW555762 Tkt transketolase 3.255445846 AWS36849 Ccnb1-rs1 cyclin B1, related sequence 1 3.2SS108.538 AWS43439 Fkbp4 FK506 binding protein 4 (59 kDa) 3.254740967 AUO42923 ESTs, Highly similar to dJ483K16.1 H. sapiens 3.2SO491765 AUO45845 Ywhaq tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta 3.24.9673818 polypeptide AWS44115 ESTs, Weakly similar to NSP-like 1 M. musculus 3.245183948 AWS392.62 Et1 enhancer trap locus 1 3.240855617 AWS4S4S1 ESTs, Moderately similar to ribonuclease P protein subunit p14 H. sapiens 3.24O611299 US 8,298,756 B2 61 62 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio AUO15879 Mus musculus LIM-kinase1 (Limk1) gene, complete cols; Wbscr1 (Wbscr1) gene, 3.239108652 alternative splice products, complete cols; and replication factor C, 40 kDa subunit (Rfc2) gene, complete cols AAO14196 Glud Glutamate dehydrogenase 3.238249.096 AUO408O1 ESTs, Highly similar to rer M. musculus 3.236,111635 AWS47945 ESTs, Weakly similar to ZIP-kinase M. musculus 3.2348.69937 AWS394.87 Pabpc1 poly Abinding protein, cytoplasmic 1 3.2298.131 AWS48914 Mits musculus receptor activity modifying protein 2 mRNA, complete cols 3.22.9667371 AUO17822 ESTs, Weakly similar to NSP-like 1 M. musculus 3.226784.472 AUO2O667 Uchl3 ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) 3.22S2OOO79 AWS36140 Hsp86-1 heat shock protein, 86 kDa 1 3.22OO69536 AA289001 ESTs, Weakly similar to DDX8 HUMAN PROBABLE ATP-DEPENDENT RNA 3.213217918 HELICASE HRH1 H. sapiens AW5375O1 ESTs, Weakly similar to hypothetical 43.2 kDa protein H. sapiens 3.21294.6254 AWS36816 ESTs, Weakly similar to ZW10 interactor Zwint H. sapiens 3.211073,781 AWS36688 Tra1 tumor rejection antigen gp96 3.2O7785549 AWS45936 Cks1 cyclin-dependent kinase regulatory Subunit 1 3.2O2S32356 AA168656 DSErt363e DNA segment, Chr 5, ERATO Doi 363, expressed 3.199043745 AWSSO88O Txn hioredoxin 94.798752 AW557260 ESTs, Highly similar to testicular antigen M. musciitis 94.109779 AUO17619 Ak3 adenylate kinase 3 86508.194 AUO22272 Rnaseli ribonuclease L. (2',5'-oligoisoadenylate synthetase-dependent) inhibitor 845593O3 AWS47818 Fmr1 ragile X mental retardation syndrome 1 homolog 84148.074 AAO13832 Clipx caseinolytic protease X (E. coli) 832877.17 C86748 Tgfb2 transforming growth factor, beta 2 81199624 AWS46704 ESTs, Highly similar to 40S RIBOSOMAL PROTEIN S13 79558602 Homo sapiens; Ratti is norvegicus M. musculus mRNA for gas.S growth arrest specific protein 71264611 AWS36696 NADH dehydrogenase flavoprotein 1 6947838 AW552833 Mus musculus LNR42 mRNA, complete cols 6O749904 AAO8O156 kidney androgen regulated protein S890 1378 AA24.1756 small acidic protein sid2057p 55791.289 AWS47111 myosin heavy chain, cardiac muscle, adult 55653539 AWS36212 ESTs, Weakly similar to moesin R. norvegicus SO862O62 AI32.7319 ESTs, Highly similar to CYTOCHROME B5 Rattus norvegicus SO293218 AWSSO836 enhancer trap locus 1 48741977 AWS37169 ESTs, Weakly similar to misato D. melanogaster 40606246 AAOOOO38 ubiquitin specific protease 23 374O7556 AWS39360 ESTs, Weakly similar to matrin cyclophilin R. norvegicus 35475267 AWS36967 Et1 enhancer trap locus 1 3S171966 AW555020 ESTs, Highly similar to UBIQUINOL-CYTOCHROME CREDUCTASE COMPLEX 340O887 CORE PROTEIN 2 PRECURSOR Bos taurus) AWSS3809 Rnaseli ribonuclease L. (2',5'-oligoisoadenylate synthetase-dependent) inhibitor 3. 27O19793 AA154.465 ESTs, Highly similar to similar to human DNA-binding protein 5. H. sapiens 25092795 AA285584 Mus musculus strain Swiss Webster/NIH actin-associated protein palladin mRNA, 3. 24624.175 partial cols Krt2-1 keratin complex 2, basic, gene 1 24299.027 endoplasmic reticulum protein 238.23806 Mus musculus mkf-1 mRNA, complete cols 16870544 M. musculus mRNA for Pr22 protein 146672 ESTs, Weakly similar to BRAIN SPECIFIC POLYPEPTIDE PEP-19 14535048 Raitt is norvegicus; M. musculius AWS44818 Rab18 RAB18, member RAS oncogene family O9347054 AA237184 Ddx5 D-E-A-D (aspartate-glutamate-alanine-aspartate) box polypeptide 5 O8934627 W85513 ESTs, Highly similar to KIAAO925 protein H. sapiens O43914 C87631 Zinc finger protein 68 O3182346 AUO42346 ESTs, Moderately similar to serine/threonine protein kinase M. musculus O2909947 C81324 ESTs, Highly similar to ISOCITRATE DEHYDROGENASE Bos taurus O2708564 A413150 HETEROGENEOUS NUCLEARRIBONUCLEOPROTEINA1 O1332766 AWS44358 ESTs, Highly similar to PROTEIN DISULFIDE ISOMERASE PRECURSOR O0578685 Medicago Saiiva AWS396O7 ESTs, Weakly similar to All-1 protein +GTE form M. musculus 3.099324211 AWS46793 Actg actin, gamma, cytoplasmic 3.094036051 C8O862 ESTs, Moderately similar to (defline not available 5931553) M. musculus 3.09.0776,963 AWS362S6 Silg81 silica-induced gene 81 3.089849843 AWS39609 Jup junction plakoglobin 3.08822389 W98547 Bad Bcl-associated death promoter 3.088183956 AWS41488 B2m beta-2 microglobulin 3.0691 OO689 AWS45318 Pcna proliferating cell nuclear antigen 3.067845966 AWS36215 Stip1 stress-induced phosphoprotein 1 3.065752133 AUO21314 Mits musculus KOI-4 gene, partial cols 3.06495230S AA17S386 Mus musculus mRNA for partial Laxp180 protein 3.063948171 AAO68665 ESTs, Weakly similar to AF152841 1 polymyositis scleroderma overlap syndrome 3.05957507 M. musculus AWSS4081 Adnp activity-dependent neuroprotective protein 3.05.5989.327 AWS38862 ESTs, Weakly similar to P9513.2 gene product S. cerevisiae 3.0549.27766 AWSS4376 discs, large homolog 1 (Drosophila) 3.049S74352 AWS38403 Mus musculus formin binding protein 11 (FBP11) mRNA, complete cols 3.04888,214 US 8,298,756 B2 63 64 SUPPLEMENTAL TABLE 4-continued

A.cc No Gene Description NF ratio AW541446 DNA segment, Chr 6, Wayne State University 137, expressed 3.0446117SS AW551959 cullin 1 3.04.08.2811S AWS48092 Mus musculus 14-3-3 protein beta mRNA, complete cols 3.039487463 AW543.750 M. musculus mRNA for glutamyl-tRNA synthetase 3.0380631.68 AWS38568 Rp144 ribosomal protein L44 3.033122817 AWS48061 ESTs, Weakly similar to unknown C. elegans 3.032S13144 AUO16110 Mus musculus heat shock protein (HSPC030) mRNA, complete cols 3.03.1383324 C81083 Hinrnpc heterogeneous nuclear ribonucleoprotein C2 3.03.01.35958 AWSS4393 ESTs, Weakly similar to RNA binding motif protein 7 H. sapiens 3.O2S632148 W13785 ribosomal protein S27 3.O2S322982 AWS42456 Limnb1 amin B1 3.02.1908.529 AW537278 Fmos flavin containing monooxygenase 5 3.015653O1 AI326367 Mus musculus TCR beta locus from bases 250554 to 501917 (section 2 of 3) of the 3.01.0492026 complete sequence AUO44431 Mus musculus DEBT-91 mRNA, complete cols 3.OO9214891 W821.94 LOCS7423 hypothetical protein, clone: 2-31 3.004332364 AW537132 Gdap2 ganglioside-induced differentiation-associated-protein 2 3.002468515 A4652S1 ESTs, Moderately similar to CALPONIN, ACIDIC ISOFORM Rattus norvegicus) 2.9985O8138 AUO15421 ESTs, Highly similar to unknown H. Sapiens 2.98827.5793 AWS41468 ESTs, Highly similar to HYPOTHETICAL 64.5 KD PROTEINZK652.9 IN 2.98SO37992 CHROMOSOME III Caenorhabditis elegans AUO14587 ESTs, Highly similar to POLYADENYLATE-BINDING PROTEIN Xenopus laevis 2.98.3364731 AWS36274 Mus musculus mRNA for Sido061p, complete cols 2.97.5961818 AW554565 Aop1 anti-oxidant protein 1 2.975547979 AUO16907 Supl15h Suppressor of Lec15 homolog (C. grisetis) 2.97343761 AW557067 Dad1 defender against cell death 1 2.97.1833.739 AUO23128 ESTs, Highly similar to CAMP-DEPENDENT PROTEIN KINASETYPE I-ALPHA 2.971627.282 REGULATORY CHAIN Homo sapiens AAO36347 KIf Kruppel-like factor 9 2.96.88.2996S AWS36151 Hsp60 heat shock protein, 60 kDa 2.95.5737367 AWS36963 ESTs, Highly similar to PUTATIVE ADENOSINE KINASE Saccharomyces cerevisiae 2.95O322741 AA413694 Rab7 RAB7, member RAS oncogene family 2.94.841S605 AWSS4059 ESTs, Weakly similar to HYPOTHETICAL 15.9 KD PROTEIN IN GLNA-FDHE 2.9450864.58 NTERGENIC REGION Escherichia coli AWSS8048 Co24.a. CD24a antigen 2.94.3485748 AW538.527 ESTs, Moderately similar to R313411 H. sapiens 2.94O115.188 AWS45662 ESTs, Highly similar to 26S PROTEASE REGULATORY SUBUNIT 7 Homo sapiens 2.934174O7 AW555565 ZyX Zyxin 2.929O15914 W294.92 ASns asparagine synthetase 2.926212129 AA416435 ESTs, Highly similar to KIAAO095 gene is related to S. cerevisiae NIC96 gene. 2.91.604107 H. sapiens A. 323814 Mouse mRNA for ARF4, complete cols 2.915172345 A. 427441 M. musculus mRNA for neuronal protein 15.6 2.91.4821665 AWS38481 ESTs, Highly similar to TRANSLATIONAL INITIATION FACTOR2 BETA 2.90578241S SUBUNIT Oryctolagus cuniculus AWSS2361 ESTs, Weakly similar to Similarity to Yeast YIP1 protein C. elegans 2.905297661 A UO46228 ESTs, Highly similar to translation initiation factor IF2 H. sapiens 2.904375747 A UO44.835 Ppp1cc protein phosphatase 1, catalytic Subunit, gamma isoform 2.90.16443.09 AA404094 C11orf17 C11orf17 2.898.6343S3 W85166 Tacc3 transforming, acidic coiled-coil containing protein 3 2.89.7486.584 A ESTs, Highly similar to VACUOLARATP SYNTHASE SUBUNIT D Bos taurus 2.89.7417571 A Odc ornithine decarboxylase, structural 2.890092488 AW550627 Mus musculus drebrin E2 mRNA, complete cols 2.888.730948 A UO15096 ESTs, Weakly similar to nucleolin R. norvegicus 2.88.3466921 W10O23 Catnb catenin beta 2.88293O209 C80267 Hinrnpc heterogeneous nuclear ribonucleoprotein C2 2.882107319 C854.71 Polcd8 programmed cell death 8 (apoptosis inducing factor) 2.88.1879732 A UO24091 Sucla2 Succinate-Coenzyme Aligase, ADP-forming, beta subunit 2.881062765 AAO44475 Nfe22 Nuclear, factor, erythroid derived 2, like 2 2.876121329 W538967 Mus musculus mRNA for mD3, complete cols 2.874346371 UO41439 Gnai2 guanine nucleotide binding protein, alpha inhibiting 2 2.87168OOS WS44616 ESTs, Weakly similar to ZW10 interactor Zwint H. sapiens 2.87O858.344 41.4590 Srpk2 Serinefarginine-rich protein specific kinase 2 2.864730663 76867 ESTs, Moderately similar to TROPOMYOSIN ALPHACHAIN, SKELETAL AND 2.862563996 CARDIAC MUSCLE IM. musculus 325958 ESTs, Highly similar to REPLICATION PROTEIN A 14 KD SUBUNIT Homo sapiens 2.862S34762 WSSS464 ESTs, Weakly similar to neuronal-specific septin 3 M. musculus 2.8576495.35 W536856 Mouse testis abundant mRNA sequence 2.857368.245 78.835 ActX melanoma X-actin 2.85448914 k UO21567 Hip2 huntingtin interacting protein 2 2.85.0054551 AWSS4115 Crcp calcitonin gene-related peptide-receptor component protein 2.84790964.8 AW556509 ESTs, Highly similar to similar to human DNA-binding protein 5. H. sapiens 2.847314257 AWSS802O ESTs, Highly similar to CELL GROWTH REGULATING NUCLEOLAR PROTEIN 2.84.3396.393 M. musculus AWS48709 ESTs, Moderately similar to EUKARYOTIC INITIATION FACTOR4A 2.843274.915 Caenorhabditis elegans AAS47SSS Cks1 CDC28 protein kinase 1 2.8421638SS AWSS6999 ESTs, Moderately similar to hypothetical protein H. sapiens 2.84O617772 US 8,298,756 B2 65 66 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio AWS46,373 ESTs, Highly similar to 54Karginine-rich nuclear protein H. Sapiens 2.84OS74103 AWS48748 ESTs, Weakly similar to proline-rich protein M. musculus 2.84O416615 AWS36817 ESTs, Highly similar to ALPHAENOLASE Mus musculus 2.84O261891 AWS394.87 Pabpc1 poly Abinding protein, cytoplasmic 1 2.84O11637 AW537045 Mus musculus mRNA for initiation factor 2-associated 67 kDa protein, complete cols 2.83718519 AWS446O1 ESTs, Weakly similar to cDNA EST EMBL:T00542 comes from this gene C. elegans 2.83.318307 C791.76 ESTs, Weakly similar to TYROSINE-PROTEIN KINASE JAK3 M. musculus 2.82666O13S AA185258 ESTs, Highly similar to IDN3 H. sapiens 2.82427546S AWS43973 ESTs, Highly similar to thyroid hormone receptor-associated protein complex 2.82.307595 component TRAP150 H. sapiens AW555383 ESTs, Highly similar to NADH-UBIOUINONE OXIDOREDUCTASE B22 SUBUNIT 2.82OS75628 Bos taurus AWS491.45 Fkbp3 FK506-binding protein 3 (25 kD) 2.81.2895276 AWS45658 Catns catenin Src 2.812160453 AW 556635 ESTs, Weakly similar to splicing factor SC35 M. musculus 2.8O8058439 AWS468SS M. musculus (C57 Black? 6X CBA) LAL mRNA for lysosomal acid lipase 2.8027941.38 AWSS3068 ESTs, Weakly similar to KIAA0344 H. sapiens 2.79951 2259 W97442 Map3k12 mitogen activated protein kinase kinase kinase 12 2.798.312097 AWS36734 ESTs, Highly similar to EUKARYOTIC INITIATION FACTOR-4B Homo sapiens 2.79472633 C81194 Hap105 heat shock protein, 105 kDa 2.79345821 AAS37566 Histocompatibility 2, class II antigen Aalpha 2.7923.18423 AW557878 M. musculus GAS 6 mRNA associated with growth-arrest 2.79157O157 AWS48139 Mus musculus mRNA, complete cols, clone: 2-31 2.79079344 AW555.176 DNA segment, Chr 15, Wayne State University 59, expressed 2.7841584.57 AWS46427 ESTs, Highly similar to RAS-LIKE PROTEIN TC21 Homo sapiens 2.783O813S AW537671 ESTs, Highly similar to similar to human DNA-binding protein 5. H. sapiens 2.779263.429 C77223 Rpo2-1 RNA polymerase II 1 2.776921055 AAOOO318 ESTs, Highly similar to REPLICATION PROTEIN A 14 KD SUBUNIT Homo sapiens 2.773773419 AWS43985 ESTs, Weakly similar to MYELOID DIFFERENTIATION PRIMARY RESPONSE 2.77132421 PROTEIN MYD116 M. musculus AWSS2638 Mouse mRNA for dbpA murine homologue, complete cds 2.7696.26773 AUO43911 ESTs, Weakly similar to UBIQUITIN-CONJUGATING ENZYME E2-17 KD 2 2.769S4O325 M. musculus AWS4381.1 ESTs, Weakly similar to HYPOTHETICAL 86.9 KD PROTEINZK94.5.3 IN 2.767962O67 CHROMOSOME II Caenorhabditis elegans AWS384O7 Slc20a1 solute carrier family 20, member 1 2.76768.1717 AWSS1944 ESTs, Highly similar to Similar to D. melanogaster parallel sister chromatids protein 2.767267283 Homo sapiens AW537083 ESTs, Highly similar to cellular apoptosis Susceptibility protein H. sapiens 2.766S32496 AWS44737 Atpl ATPase-like vacuolar proton channel 2.763759005 AW556977 Zpk Zipper (leucine) protein kinase 2.763133879 AW555759 Phb prohibitin 2.76.1699761 AWS36246 ESTs, Highly similar to PUTATIVE METHIONINE AMINOPEPTIDASE 1 H. sapiens 2.76O259754 AW551817 Madha. MAD homolog 4 (Drosophila) 2.757229361 AA146O20 Mits musculus chromosome X contigB: X-linked lymphocyte regulated 5 gene, Zinc 2.756223.603 finger protein 28, Zinc finger protein 92, mmxq28orf AWSS4240 ESTs, Highly similar to OLIGOSACCHARYL TRANSFERASE STT3 SUBUNIT 2.752467221 HOMOLOG Caenorhabditis elegans AUO43122 CoxSb cytochrome c oxidase, subunit Vb 2.7513964.87 AA265396 Lag eukemia-associated gene 2.750567 219 AWSSO641 Frg1 FSHD region gene 1 2.74.7989143 C8648O Plp proteolipid protein (myelin) 2.746O27119 AA3998.54 ESTs, Highly similar to PUTATIVE ASPARAGINYL-TRNASYNTHETASE DED81 2.743198399 Saccharomyces cerevisiae C76349 Sclip Scgn10 like-protein 2.742268,969 AASO985S ESTs, Highly similar to TROPOMYOSIN4, EMBRYONICFIBROBLAST ISOFORM 2.74O953S45 Raitt is norvegicus AIS2876O Mouse mRNA for dbpA murine homologue, complete cds 2.7392571.65 AWSS1820 ESTs, Highly similar to HYPOTHETICAL 37.2 KD PROTEIN C12C2.09C IN 2.736097382 CHROMOSOME I Schizosaccharomyces pombe AWSS3OO1 Islr immunoglobulin Superfamily containing leucine-rich repeat 2.73527515.2 AI324702 60S RIBOSOMAL PROTEINL19 2.7338O3.162 AUO18O11 Mus musculus truncated SON protein (Son) mRNA, complete cols 2.729861304 C87907 Mor malate dehydrogenase, Soluble 2.728657,356 AWSS6389 Cappb 1 capping protein beta 1 2.72783.6531 AI661905 ESTs, Highly similar to similar to nuclear domain 10 protein NDP52 H. sapiens 2.72394245 AW537825 ESTs, Moderately similar to unknown protein IT12 H. sapiens 2.723239257 AA122891 Gapd Glyceraldehyde-3-phosphate dehydrogenase 2.72255977 AW550518 Mus musculus acidic ribosomal phosphoprotein P1 mRNA, complete cols 2.7225242S6 AWS46168 Rps5 ribosomal protein S5 2.722225631 AWS498SS Scp2 sterol carrier protein 2, liver 2.72161746 AWSSS634 Dld dihydrolipoamide dehydrogenase 2.72129 AW537250 ESTs, Weakly similar to damage-specific DNA binding protein 1 M. musculus 2.72O679787 AW55332O Mus musculus mRNA for ribosomal protein L35a 2.72O548.204 AAS47684 ESTs, Highly similar to translation initiation factor IF2 H. sapiens 2.719806487 AWS45347 ESTs, Highly similar to HYPOTHETICAL 47.4KD PROTEIN IN PAS1-MST1 2.719059223 INTERGENIC REGION Saccharomyces cerevisiae US 8,298,756 B2 67 68 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio AA276O3O Atpl ATPase-like vacuolar proton channel 2.715993.411 AW555415 Gitfi general transcription factor III 2.714548958 AUO23806 Rock1 Rho-associated coiled-coil forming kinase 1 2.714535436 AW557865 RadSO RAD50 homolog (S. cerevisiae) 2.71088834 C77773 ESTs, Weakly similar to (define not available 5453421) M. musculus 2.7O6432587 AW557152 ESTs, Highly similar to spliceosomal protein SAP 155 H. sapiens 2.706136493 AWS476O4 ESTs, Weakly similar to ORF YOLO71w S. cerevisiae 2.7049388O1 AW555995 Lirpap1 ow density lipoprotein receptor related protein, associated protein 1 2.70479.575 AWSS6062 Tex10 estis expressed gene 10 2.70424.9677 AWS36817 ESTs, Highly similar to ALPHAENOLASE Mus musculus 2.700717507 AAOSOO86 ubiquitin-conjugating enzyme E2I 2.699647334 AI427886 ESTs, Highly similar to RAS-RELATED PROTEIN RAB-28 R. norvegicus) 2.6941 OO196 AAO32437 ESTs, Moderately similar to DUAL SPECIFICITY PROTEIN PHOSPHATASE PAC-1 2.68.8124354 Homo sapiens AWSS1468 ESTs, Weakly similar to sorting nexin 1 M. musculus 2.684.742798 AI451433 Abc2 ATP-binding cassette 2 2.67945398 AWS38472 Bikk Bcl2-interacting killer-like 2.677929061 AWS46,384 Psma3 proteasome (prosome, macropain) subunit, alpha type 3 2.675.903592 AWSSO900 Emd emerin 2.67432O907 AUO19004 Cd63 Cd63 antigen 2.6739.391.97 AI326913 ESTs, Highly similar to CYCLIN-DEPENDENT KINASES REGULATORY SUBUNIT 2.672753295 Homo sapiens AW536576 Tex9 estis expressed gene 9 2.671SSO442 AAO3112O Psma1 proteasome (prosome, macropain) subunit, alpha type 1 2.66376,5326 AWS44996 M6pr mannose-6-phosphate receptor, cation dependent 2.66 1867728 AI4S1372 ESTs, Weakly similar to similar to kinensin-like protein C. elegans 2.6612949.57 AUO22S47 ESTs, Highly similar to ACTIVATOR 1 38 KD SUBUNIT Homo sapiens 2.66O297025 AUO43450 Msh? mutS homolog 2 (E. coli) 2.659901068 AWS36,154 Ctps CTP synthase 2.65952.6849 C76763 ESTs, Moderately similar to GOLIATH PROTEIN Drosophila melanogaster 2.657128663 AW554567 Fkbp1a FK506 binding protein 1a (12 kDa) 2.653957746 AUO18277 ESTs, Highly similar to OLIGOSACCHARYL TRANSFERASE STT3 SUBUNIT 2.653900272 HOMOLOG Caenorhabditis elegans AW5372O2 Difr dihydrofolate reductase 2.653293OO4 AW552167 II1rak interleukin 1 receptor-associated kinase 2.652630575 AA422973 ESTs, Moderately similar to AF161556 1 HSPCO71 H. sapiens 2.65258.1493 AW536175 Adhs alcohol dehydrogenase 5 2.65O134514 AWS49687 Mits musculus ribosomal protein L23 (Rp123) gene, complete cols 2.649942368 AW537221 Fgfrp fibroblast growth factor regulated protein 2.648SS8726 AWS37334 ESTs, Weakly similar to signal recognition particle 54K protein M. musculus 2.6474123SS AWS48330 ESTs, Moderately similar to NADH-UBIQUINONE OXIDOREDUCTASE CHAIN 2 2.6468,92785 Mits musculus AUO19197 Bet Bet3 homolog (S. cerevisiae) 2.644793591 pending AW552337 ESTs, Highly similar to RAS-RELATED PROTEIN RAB-6 Homo sapiens 2.641220499 AW537799 Mus musculus SIK similar protein mRNA, complete cols 2.636695362 AWS48397 ESTs, Weakly similar to cDNA EST EMBL:TO1421 comes from this gene C. elegans 2.636437S64 C85373 ESTs, Highly similar to ARGINYL-TRNASYNTHETASE, MITOCHONDRIAL 2.63S279.092 PRECURSOR Saccharomyces cerevisiae W641.96 ESTs, Weakly similar to HG17 MOUSE NONHISTONE CHROMOSOMAL PROTEIN 2.63462814 HMG-17 M. musculus W12375 Hinrpa2b1 heterogeneous nuclear ribonucleoprotein A2, B1 2.6338O84.09 AWS39363 Nsbp1 nucleosome binding protein 1 2.63O394701 AUO2O218 Zrf2 Zuotin related factor 2 2.62741.3283 AW537655 Gapd glyceraldehyde-3-phosphate dehydrogenase 2.625964554 AW552715 ESTs, Weakly similar to DnaJ-like protein M. musculus 2.625449507 AWS38766 ESTs, Weakly similar to HYPOTHETICAL UOG-1 PROTEIN M. musculus 2.62S140435 AI3261.46 ESTs, Highly similar to HYPOTHETICAL 23.3 KD PROTEINZK688.3 IN 2.62464727 CHROMOSOME III Caenorhabditis elegans AU040819 ESTs, Highly similar to VESICULARINTEGRAL-MEMBRANE PROTEIN VIP36 2.6246,15038 PRECURSOR Canis familiaris AWS36519 ESTs, Weakly similar to lens epithelium-derived growth factor H. sapiens 2.62322S239 C78609 ESTs, Highly similar to EUKARYOTIC INITIATION FACTOR4 GAMMA 2.621287161 Oryctolagus clinicitlis AI662104 Mus musculus CYP2C40 (Cyp2c40) mRNA, complete cds 2.61983.3394 AW537395 Ube3a ubiquitin conjugating enzyme E3A 2.61974.8772 AWSS4398 Tcea1 transcription elongation factor A (SII), 1 2.619234745 WO9453 proton pump polypeptide R. rattus 2.618453637 AWS44762 Fbln1 fibulin 1 2.6178,61014 A426727 ESTs, Weakly similar to 5'-AMP-ACTIVATED PROTEIN KINASE, GAMMA-1 2.61712O238 SUBUNIT M. musculus AW53.7625 ESTs, Highly similar to TRNA-PROCESSING PROTEINSEN3 2.615208114 Saccharomyces cerevisiae AW537195 M. musculus mRNA for e1 protein 2.61OSO2282 AWS374O1 pyruvate kinase 3 2.609416814 AWS49044 Mus musculus SPARC-related protein (SRG) mRNA, complete cols 2.609089766 AA274739 Pnn pinin 2.60493O495 AWSS6049 Aco2 aconitase 2, mitochondrial 2.602835974 US 8,298,756 B2 69 70 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio AA472933 ESTs, Highly similar to unknown H. Sapiens 2.6O2S36474 AWS43515 ESTs, Highly similar to TRNA-PROCESSING PROTEINSEN3 2.600612477 Saccharomyces cerevisiae AUO20998 Pat plasminogen activator, tissue 2.599921486 AWS45301 Dnipep aspartyl aminopeptidase 2.5987,35375 AI324089 EST, Highly similar to PHOSPHATIDYLINOSITOL-4-PHOSPHATE 5-KINASE 2.598.540553 TYPE II ALPHA. M. musculus AW558079 ESTs, Weakly similar to PPARgamma coactivator M. musculus 2.5969OOO62 AUO21489 Omd osteomodulin 2.593848954 AI32.7309 Mus musculus clone TA-9 ATP synthase b chain homolog mRNA, partial cds 2.591834166 AI427644 Egfr Epidermal growth factor receptor 2.59.1598589 AWS44372 ESTs, Highly similar to pEachy R. norvegicus 2.59.1522355 AW537730 ESTs, Highly similar to PRE-MRNA SPLICING FACTOR PRP9 2.5899.14483 Saccharomyces cerevisiae Fen1 Flap structure specific endonuclease 1 2.587417174 Sema3a sema domain, immunoglobulin domain (Ig), short basic domain, secreted, 2.586.437483 (semaphorin) 3A AIS288SO Fasn Fatty acid synthase 2.585878.999 AWS481.98 Gpx3 glutathione peroxidase 3 2.584222275 C86630 ESTs, Highly similar to similar to nuclear domain 10 protein NDP52 H. sapiens 2.5825.73765 C87669 Mod1 malic enzyme, Supernatant 2.581027133 AA437614 ESTs, Highly similar to S1-1 protein R. norvegicus 2.58O768885 AUO18547 EST, Weakly similar to NaPi-2 beta R. norvegicus 2.58O324249 C8O147 hepatoma-derived growth factor 2.5796.184S5 AI322431 ESTs, Highly similar to MICROSOMAL SIGNAL PEPTIDASE 18 KD SUBUNIT 2.579173299 Canis familiaris AWS48906 ESTs, Highly similar to PROBABLE 60S RIBOSOMAL PROTEIN L14EB 2.5791.31557 Saccharomyces cerevisiae AWS46,306 high mobility group protein 2 2.57498711 AA2O8818 ragile X mental retardation gene, autosomal homolog 2.57488.2839 AUO17276 N-terminal ASn amidase 2.571512897 AWS36.609 eukaryotic translation initiation factor 3 2.57O65592 AWS48091 ESTs, Moderately similar to LAR PROTEIN PRECURSOR Homo sapiens 2.57.0578867 AUO23604 ESTs, Weakly similar to SEX-LETHAL PROTEIN, FEMALE-SPECIFICDrosophila 2.5691 10342 melanogaster C81388 Sc16a1 solute carrier family 16 (monocarboxylic acid transporters), member 1 2.568588458 AAO60863 Mus musculus TSC22-related inducible leucine zipper 1b (Tilz1b) mRNA, complete cols 2.567SO6201 AW555706 Ppia peptidylprolyl isomerase A 2564464822 AWSS1564 Mus musculus mRNA for sid2057p, complete cols 2.SS9018224 AWS.48086 Ptma prothymosin alpha 2.558161157 AWSSO493 Db diazepam binding inhibitor 2.SSS4928.23 AWS44081 Rbbp7 retinoblastoma binding protein 7 2.SS4967829 AAOO3408 3-Sep septin 3 2.5533.31559 AWS3632O Orc4 origin recognition complex, Subunit 4 2.55331517 AI324242 ESTs, Highly similar to HOMEOBOX PROTEIN OTX1 M. musculus 2.5529O3418 AIST3460 Chd1 Chromodomain helicase DNA binding protein 1 2.SSO88O804 AAO61763 ESTs, Highly similar to HYPOTHETICAL 70.2 KD PROTEIN IN GSH1-CHS6 2.SSO22S644 NTERGENIC REGION Saccharomyces cerevisiae) AWS49809 Abcd4 ATP-binding cassette, Sub-family D (ALD), member 4 2.54887OO42 AWS38647 Rps11 ribosomal protein S11 2.545085369 AW539270 ESTs, Highly similar to TUBULINGAMMACHAIN Homo sapiens 2.543404596 AWS36342 ESTs, Weakly similar to RSP-1 PROTEIN Mus musculus 2.542866132 AWS36182 Sec61a. SEC61, alpha subunit (S. cerevisiae) 2.542719816 AWS39649 ESTs, Highly similar to DEK PROTEIN Homo sapiens 2.54249SO91 AA426845 Sox15 SRY-box containing gene 15 2.54230538 AI427918 ESTs, Moderately similar to dJ206D15.3 H. sapiens 2.541668093 Pmp20 peroxisomal membrane protein 20 2.54.05OO727 pending AA266.975 Codc42 Cell division cycle 42 2.53971S246 AW557331 ESTs, Weakly similar to F15D4.3 (C. elegans 2.53958994 AU042135 ESTs, Moderately similar to protocadherin-3 R. norvegicus 2.539044703 AWSSS666 ESTs, Highly similar to CAMP-DEPENDENT PROTEIN KINASETYPE I-ALPHA 2.538O2316S REGULATORY CHAIN Homo sapiens AWS49721 heat shock protein, 74 kDa, A 2.53S48O124 AUO23995 Mits musculus chromosome segregation protein SmcE (SmcEB) mRNA, complete cols 2.53O486227 AWS41453 Capg capping protein (actin filament), gelsolin-like 2.530408.897 AA222216 Tubb4 tubulin, beta 4 2.528905535 AW536795 CIk CDC-like kinase 2.522978124 AW557901 ESTs, Weakly similar to C54G7.4 gene product C. elegans 2.5223.77919 AW552709 Mus musculus brain protein 44-like protein (Brp44I) mRNA, complete cols 2.521723313 AWS36179 ESTs, Weakly similar to CGI-59 protein H. sapiens 2.5212SS841 C861O7 Actin3 actinin alpha 3 2.52O902204 AUO44498 Bcap37 B-cell receptor-associated protein 37 2.518818666 AWS47403 Adcyap1r1 adenylate cyclase activating polypeptide 1 receptor 1 2.51824O435 AW554.737 ESTs, Weakly similar to KIAA0512 protein H. sapiens 2.514867936 AA445435 ESTs, Moderately similar to PTD017 H. sapiens 2.512197233 AUO16461 SSfa1 sperm specific antigen 1 2.512128647 US 8,298,756 B2 71 72 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio Ywhae Tyrosine 3-monooxygenase? tryptophan 5-monooxygenase activatioprotein, epsilon 2.51,1644859 polypeptide AUO22118 Pnn pinin 2.51.1460674 AWS39549 ESTs, Highly similar to KIAAO095 gene is related to S. cerevisiae NIC96 gene. 2.51099.1932 H. sapiens AW553,714 TIk Tousled-like kinase (Arabidopsis) 2.510671 O23 C864S4 ESTs, Weakly similar to SOX13 M. musculus 2.5101.41101 AA474681 ESTs, Moderately similar to A53770 growth factor-responsive protein, vascular 2.50.9526639 Smooth muscle-rat R. norvegicus AWSS2886 Vcp valosin containing protein 2.508O1841 AUO21911 ESTs, Moderately similar to ERYTHROID KRUEPPEL-LIKE TRANSCRIPTION 2.507198715 FACTORMus musculus AWS3912O ESTs, Weakly similar to BETA-MANNOSIDASE PRECURSOR H. sapiens 2.505882O42 AUO42815 LOC53325 putative transcription factor 2.505471313 AWS44SOS Soat1 sterol O-acyltransferase 1 2.498.84.7559 AWS46,367 Mus musculus CRIPT protein mRNA, complete cols 2.4976SO335 AW551726 WW domain binding protein 5 2.496644567 W97837 DNA segment, Chr 10, ERATO Doi 322, expressed 2.494826439 AUO16534 ESTs, Weakly similar to PARATHYMOSIN Rattus norvegicus) 2.493713568 AWS46141 Macs myristoylated alanine rich protein kinase C Substrate 2.492O12377 AWS47469 Ywhae tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activatioprotein, epsilon 2.491814894 polypeptide AWS3932O P1 placental lactogen 2.49087931.3 AW555985 Rpa2 replication protein A2 2.490S14775 AAOSO 684 Silg81 silica-induced gene 8 2.490476063 AWS44374 Fin14 fibroblast growth factor inducible 14 2.490464918 AAO16827 ESTs, Weakly similar to RING CANAL PROTEIN Drosophila melanogaster 2.48932S106 AUO15783 ESTs, Highly similar to unknown H. Sapiens 2.4890O3752 AW555631 ESTs, Highly similar to PUTATIVE RECEPTOR PROTEIN Homo sapiens 2.488892742 C8007O ESTs, Moderately similar to hypothetical protein H. sapiens 2.488351328 AAO1681O DNA segment, Chr 15, Wayne State University 77, expressed 2.487746.386 AAOOO223 Mus musculus SPARC-related protein (SRG) mRNA, complete cols 2.484.495842 AUO458SO ESTs, Highly similar to PUTATIVE ATP-DEPENDENT RNA HELICASET26G10.1 2.4809SO679 NCHROMOSOME III Caenorhabditis elegans AI326091 Mus musculus antioxidant enzyme AOE372 mRNA, complete cols 2.48O362721 AAO14915 Hsp74 Heat shock protein, 74 kDa 2.4795.01024 AWS44689 ESTs, Weakly similar to KIAAO869 protein H. sapiens 2.478.3396.67 AWS42349 ESTs, Highly similar to SIGNAL RECOGNITION PARTICLE 72 KD PROTEIN 2.474356861 Canis familiaris ESTs, Highly similar to leucine-rich-domain inter-acting protein 1 M. musculus 2.4724.94776 AWS436.36 Anxas annexin A5 2.47 1442908 AW55.3103 ESTs, Weakly similar to es 64 M. musculus 2.470432.192 AI448428 ESTs, Weakly similar to Rigui M. musculus 2.470113702 AWS46519 Trt translationally regulated transcript (21 kDa) 2.46972O709 AWS3982O Lw delta-aminolevulinate dehydratase 2.468434243 AUO46O28 ESTs, Moderately similar to RNA polymerase II transcription factor SIII p18 subunit 2.46786OO62 R. norvegicus AW555561 Myb|2 myeloblastosis oncogene-like 2 2.467492726 AWS43683 Nc nucleolin 2.4668.32971 W13561 Jag2 jagged 2 2.4652OO657 AUO16137 Fth erritin heavy chain 2.4649594SS AWS36987 Snta1 syntrophin, acidic 1 2.464853599 AWS36435 ESTs, Moderately similar to KIAA0755 protein H. sapiens 2.463881083 AI327112 Mus musculus NADP-dependentisocitrate dehydrogenase (Idh) mRNA, complete cols 2.463800442 AA268327 ESTs, Highly similar to FIBRILLIN 1 PRECURSOR Homo sapiens 2.4624.47346 AIS287OO Rab1 RAB1, member RAS oncogene family 2.46222SO9 AA22O617 Bak Bc12 homologous antagonist/killer 2.461291.028 AWS42307 GTP binding protein 2.460990263 AUO22218 protein tyrosine phosphatase 4a1 2.459877 353 W81857 ESTs, Highly similar to HYPOTHETICAL 39.7 KD PROTEIN C34E10.2 IN 2.4583.20944 CHROMOSOME III Caenorhabditis elegans C78257 ESTs, Highly similar to (defline not available 6012071) R. norvegicus 2.45776456 AWS39362 ESTs, Highly similar to KIAA0515 protein H. sapiens 2.45SS66909 AA274.915 U2 small nuclear ribonucleoprotein auxiliary factor (U2AF), 35 kDa, related sequence 1 2.454199936 AW536155 DEAD (aspartate-glutamate-alanine-aspartate) box polypeptide 5 2.45O3990O8 AI4S1115 Treacher Collins Franceschetti Syndrome 1, homolog 2.4491.14592 AI415181 ESTs, Highly similar to adaptor protein H. sapiens 2.447784219 C87823 ESTs, Weakly similar to cDNA EST EMBL:TO1156 comes from this gene C. elegans 2.4467OS774 AUO4S477 M. musculus ASF mRNA 2.44424645 C87175 ESTs, Highly similar to TUBULIN BETA CHAIN Lytechinus pictus 2.44.4103591 AW555877 guanosine diphosphate (GDP) dissociation inhibitor 3 2.443313285 AUO23429 ESTs, Moderately similar to heat shock factor binding protein 1 HSBP1 H. sapiens 2.443174621 AWSS1.192 PSme1 protease (prosome, macropain) 28 subunit, alpha 2.442839637 AWS45938 Sap18 Sin3-associated polypeptide 18 2.441113O88 AUO16SO1 Ltbp3 atent transforming growth factor beta binding protein 3 2.439347726 AWSS1042 Mits miscuius X chromosome: L1 cam locus 2.4387.10922 AW552195 ESTs, Highly similar to MITOCHONDRIAL IMPORT RECEPTORSUBUNIT TOM20 2.4386.961 HOMOLOG R. norvegicus US 8,298,756 B2 73 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio AWS42335 ESTs, Highly similar to MICROSOMAL SIGNAL PEPTIDASE 21 KDSUBUNIT 2.436734688 Canis familiaris AWS47166 ESTs, Highly similar to UBIQUINOL-CYTOCHROME CREDUCTASE COMPLEX 2.43621.9154 4KD PROTEIN Bos taurus AAO 68842 ubiquitin conjugating enzyme 2e 2.435798.543 AUO1648O ESTs, Highly similar to 40S RIBOSOMAL PROTEINS25 Homo sapiens; 2.434O92714 Ratti is norvegicus AUO23232 Pigf phosphatidylinositol glycan, class F 2.43393S408 AA266531 AA93O106 ESTAA93O106 2.432691.59 AWS48819 ESTs, Moderately similar to acidic 82 kDa protein H. sapiens 2.432596.162 AAS17431 ESTs, Moderately similar to GLYCOPROTEIN 25L PRECURSOR Canis familiaris 2.431952116 AAOOO842 ESTs, Highly similar to KINESIN-II 85 KD SUBUNIT Strongylocentrotus purpuratus 2.4312.569 AUO2O424 Sc12a2 solute carrier family 12, member 2 2.42972381 WO8137 ESTs, Weakly similar to HYPOTHETICAL 86.9 KD PROTEINZK94.5.3 IN 2.4291.86971 CHROMOSOME II Caenorhabditis elegans AWS36067 Aop2 anti-oxidant protein 2 2.425678079 AW555OO1 Mus musculus RW1 protein mRNA, complete cols 2.42260O237 AA274946 Eifla. eukaryotic translation initiation factor 1A 2.42OO39228 AW557915 Ezh1 enhancer of Zeste homolog 1 (Drosophila) 2.4168558O1 AA168538 Orc4 origin recognition complex, Subunit 4 2.413722611 AW537427 Tstap91a tissue specific transplantation antigen P91A 2.41341.0871 AI429159 ESTs, Weakly similar to ultra-high-sulfur keratin 1 M. musculus 2.413170232 AWS36433 Hsp70-4 heat shock protein, 70 kDa 4 2.413114212 AWS41013 ESTs, Moderately similar to HYPOTHETICAL PROTEIN HIO376 Haemophilus 2.412854SSS influenzae AA272821 ESTs, Highly similar to PUTATIVE ADENOSINE KINASE Saccharomyces cerevisiae) 2.412651 495 AW5521.59 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 2.409551934 AW55.5351 Mits musculus domesticits mitochondrial carrier homolog 1 isoform a mRNA, 2.408853343 complete cols; nuclear gene for mitochondrial product AI323543 Mus musculus (clone: pMAT1) mRNA, complete cods 2.4O628791 AWS36140 Hsp86-1 heat shock protein, 86 kDa 1 2.4OSSOO262 C76941 Tfb transcriptional intermediary factor 1, beta 2.40299958 AA414211 ESTs, Highly similar to RSP5 PROTEIN Saccharomyces cerevisiae 2.4O1776272 WO8937 FAN protein 2.4O1104291 AWS49671 ESTs, Weakly similar to SOX13 M. musculus 2.398OS1225 AA416246 Pmp22 Peripheral myelin protein, 22 kDa 2.394,587625 AI427491 ESTs, Highly similar to PROBABLE UBIQUITIN CARBOXYL-TERMINAL 2.394177647 HYDROLASE Homo sapiens AUO151.83 Ptpre protein tyrosine phosphatase, receptor type, C 2.393.5291.37 AAO31056 Mcmd5 mini chromosome maintenance deficient 5 (S. cerevisiae) 2.391689429 C877.26 Mits musculus mitotic checkpoint component Mad2 mRNA, complete cols 2.391344308 AW552558 eukaryotic translation initiation factor 2, Subunit 3, structural gene X-linked 2.390411491 AWS47239 ESTs, Highly similar to TRANSLOCON-ASSOCIATED PROTEIN, ALPHA SUBUNIT 2.3884O4892 PRECURSOR Canis familiaris AWSS2412 ESTs, Highly similar to TRANSLOCON-ASSOCIATED PROTEIN, BETA SUBUNIT 2.385307516 PRECURSOR Homo sapiens AUO18839 Hmg14 high mobility group protein 14 2.3849082S6 AA403949 Capn12 calpain 12 2.38344367 C86052 Cnn1 calponin 1 2.38OS862S1 AWS49140 ESTs, Weakly similar to Peter Pan D. melanogaster 2.3797.05926 AA245492 ESTs, Moderately similar to AF151064. 1 HSPC230 H. sapiens 2.379149074 AA466838 ESTs, Highly similar to Cdc5-like protein R. norvegicus 2.377796.701 AW552727 Fasn atty acid synthase 2.377306081 AAO2OO34 ESTs, Weakly similar to cleft lip and palate transmembrane protein 1 H. sapiens 2.376903716 AAO23641 Madh3 MAD homolog 3 (Drosophila) 2.376148136 C86367 ESTs, Weakly similar to BAT2 M. musculus 2.375988234 AA388,122 Mem3 Maternal embryonic message 3 2.374556107 AAOO4149 ESTs, Weakly similar to PROBABLE PEPTIDYL-TRNA HYDROLASE 2.373057115 Bacillus subtilis AW55.32O3 Mits musculus mRNA, complete cols, clone: 2-24 2.37.1518772 AWS362O6 Hsp86-1 heat shock protein, 86 kDa 1 2.370643703 W91463 Ddef1 development and differentiation enhancing 2.369S12617 AWS4854O Mus musculus SIK similar protein mRNA, complete cols 2.368814949 AA288977 ESTs, Moderately similar to GOLIATH PROTEIN Drosophila melanogaster 2.368498766 AAO33138 Ant2 Adenine nucleotide translocator 2, fibroblast 2.36746577 AWS36910 ESTs, Moderately similar to chromosome-associated protein-E H. sapiens 2.365185976 AW556217 Ash2 ash2 (absent, Small, or homeotic)-like (Drosophila) 2.364972967 AA266868 ESTs, Highly similar to RIBOSOMAL PROTEIN S6 KINASE Homo sapiens 2.364627315 C81301 Rbpsuh recombining binding protein Suppressor of hairless (Drosophila) 2.364326.297 AA274539 Mus musculus mRNA for 26S proteasome non-ATPase subunit 2.3627O6461 AI325930 ESTs, Highly similar to CELL DIVISION CONTROL PROTEIN 23 2.36109588S Saccharomyces cerevisiae AW555373 Mus musculus short coiled coil protein SCOCO (Scoc) mRNA, complete cols AWSS47O6 ESTs, Highly similar to hypothetical protein H. sapiens 2.357478513 AWSS1989 Eef2 eukaryotic translation elongation factor 2 2.357184652 AA2O3922 Tmod3 tropomodulin 3 2.3552.90717 AUO41196 ESTs, Highly similar to 60S RIBOSOMAL PROTEIN L22 Tripneustes gratilla 2.3551696O4 US 8,298,756 B2 75 76 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio AA290484 ESTs, Weakly similar to SPORULATION-SPECIFIC PROTEIN 1 2.354693252 Saccharomyces cerevisiae AUO46294 Magoh mago-nashi homolog, proliferation-associated (Drosophila) 2.353138844 AAOSO900 Egr1 Early growth response 1 2.352134769 AWS48009 ESTs, Highly similar to PTD014 H. sapiens 2.346432008 AUO23893 ESTs, Highly similar to choline ethanolaminephosphotransferase H. sapiens 2.343732092 AW537685 ESTs, Highly similar to HYPOTHETICAL 83.2 KD PROTEIN IN CHA1-APA1/DTP 2.342999287 NTERGENIC REGION Saccharomyces cerevisiae) AWS4O984 Api4 apoptosis inhibitor 4 2.342898.046 C77892 Hba-al hemoglobin alpha, adult chain 1 2.342638.604 UO19031 Hist4 histone 4 protein 2.341178338 41.4575 ESTs, Moderately similar to HISTONE ACETYLTRANSFERASE TYPE B 2.340858.323 CATALYTIC SUBUNIT H. sapiens UO43242 ESTs, Weakly similar to ORFYKRO81c (S. cerevisiae) 2.34OSO1043 Mus musculus Cope1 mRNA for nonclathrin coat protein epsilon-COP, complete cols 2.339239681 W : : : ESTs, Weakly similar to ORFYGR200c S. cerevisiae) 2.339173959 M. musculus mRNA for neuronal protein 15.6 2.339134449 W5 3 6 64 1 ESTs, Highly similar to CLATHRIN HEAVY CHAIN Rattus norvegicus 2.33898O841 ESTs, Weakly similar to ORFYNLO61w S. cerevisiae) 2.3378.16604 W5 5 8 1 9 8 Emap2 endothelial monocyte activating polypeptide 2 2.33546S842 UO43578 Tacc3 transforming, acidic coiled-coil containing protein 3 2.3329.24372 W5 47 3 6 3 FmoS flavin containing monooxygenase 5 2.3306836SS W44.162 ESTs, Moderately similar to N153 RAT NUCLEARPORE COMPLEX PROTEIN 2.33O3O962S NUP153 R. norvegicus AUO15616 ESTs, Weakly similar to cDNA ESTyk338fö.5 comes from this gene C. elegans 2.330288731 AI322439 ESTs, Moderately similar to SIGNAL RECOGNITION PARTICLE 19 KD PROTEIN 2.329157971 Homo sapiens AWS44876 ESTs, Highly similar to TRANSCRIPTION FACTOR BTF3 Homo sapiens 2.327613924 AWS36151 Hsp60 heat shock protein, 60 kDa 2.327256.569 AWS497O6 Nedd4 neural precursor cell expressed, developmentally down-regulated gene 4 2.327084972 AW555062 ESTs, Weakly similar to SnRNP protein B D. melanogaster 2.32273OO91 AWSS6238 ESTs, Moderately similar to striatin M. musculus 2.3214668O1 AA444533 ESTs, Highly similar to G10 PROTEIN Xenopus laevis 2.319746228 AI45 1613 ESTs, Highly similar to CYP4B1 M. musculus 2.318913225 AUO23815 ESTs, Weakly similar to (defline not available 5901816) D. melanogaster 2.318446678 AAOS2404 CRIPT CRIPT protein 2.31831O231 AW547917 ESTs, Highly similar to SINGLE-STRANDED DNA-BINDING PROTEIN, 2.317172841 MITOCHONDRIAL PRECURSOR Rattus norvegicus) AWS36.738 KIf Kruppel-like factor 9 2.316449053 AWS37.096 ESTs, Highly similar to GLUTAMINYL-TRNASYNTHETASE Homo sapiens 2.316069284 AWSS2222 H19 H19 fetal liver mRNA 2.315271509 AWSS2411 Ech1 enoyl coenzyme A hydratase 1, peroxisomal 2.31SO44879 AWSS6441 ESTs, Moderately similar to NY-REN-45 antigen H. sapiens 2.314566,763 AW537615 Orc1 origin recognition complex, Subunit 1 homolog (S. cerevisiae) 2.313OO1263 AWSS4187 G2an alpha glucosidase 2, alpha neutral subunit 2.312O88278 AWSS6339 ESTs, Highly similar to RN protein R. norvegicus 2.311016095 AW536573 ESTs, Weakly similar to similar to leucyl-tRNA synthetase C. elegans 2.31.10092S8 AUO44452 Nit nitrilase 1 2.31 O27286 AU040813 ESTs, Weakly similar to T23G 11.9 C. elegans 2.309549.316 AUO21615 ESTs, Highly similar to SET PROTEIN Homo sapiens 2.307O3954 AA444224 ESTs, Highly similar to UBP7 HUMANUBIQUITIN CARBOXYL-TERMINAL 2.305871297 HYDROLASE 7 (H. sapiens AUO234.17 X-linked nuclear protein 2.3051,5632 AWSS6482 ESTs, Moderately similar to hypothetical protein H. sapiens 2.303394618 AWS46518 enhancer of rudimentary homolog (Drosophila) 2.30306S378 AA268423 retinol dehydrogenase type 5 2.301.249007 AAO14771 protein kinase C, Zeta 2.29878.2934 AWS45976 COP9 (constitutive photomorphogenic), Subunit 7a (Arabidopsis) 2.297823068 AUO15592 Y box protein 1 2.296828893 AWSS2368 ESTs, Weakly similar to F42A6.6 C. elegans 2.296,724442 AUO16947 retinoblastoma binding protein 6 2.293981468 AW539367 Mits musculus ribosomal protein L23 (Rp123) gene, complete cols 2.293923928 AWS49937 Holac2 histone deacetylase 2 2.2928.64895 AW55.3303 ESTs, Highly similar to NADH-UBIQUINONE OXIDOREDUCTASE 19 KD 2.292305877 SUBUNIT Bos taurus AW557882 Anxa7 annexin A7 2.291896.987 W34474 ESTs, Highly similar to HAM1 PROTEIN Saccharomyces cerevisiae 2.290024001 AWS44089 ESTs, Highly similar to unknown H. Sapiens 2.2890294.66 AW553.526 Npm1 nucleophosmin 1 2.288099461 AA444943 ESTs, Highly similar to GLYCOPROTEIN 25L PRECURSOR Canis familiaris) 2.286326O1 AWSS3602 ESTs, Weakly similar to (define not available 6016842) M. musculus 2.285573594 AWSS4909 Rp18 ribosomal protein L8 2.28536O197 AUO2O790 Mus musculus BAF53a (Baf53a) mRNA, complete cols 2.284270468 AUO24674 ESTs, Highly similar to CITRATE SYNTHASE, MITOCHONDRIAL PRECURSOR 2.2832.3685 SiS scrofa C88330 ESTs, Weakly similar to weak similarity to the yeast SSM4 protein C. elegans 2.282437195 AWS36926 ESTs, Highly similar to KIAA0601 protein H. sapiens 2.282157312 W48O17 ESTs, Highly similar to AF151859 1 CGI-101 protein H. sapiens 2.28097946 US 8,298,756 B2 77 78 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio W13152 ESTs, Highly similar to CYCLIN-DEPENDENT KINASES REGULATORY SUBUNIT 2.28091.6964 2 Homo sapiens AA388377 DSErt363e DNA segment, Chr 5, ERATO Doi 363, expressed 2.28.0662428 AWS364.90 Usp5 ubiquitin specific protease 5 (isopeptidase T) 2.27846OO1 AWS46788 Tgfbi transforming growth factor, beta induced, 68 kDa 2.275899.113 C80729 Catna.1 catenin alpha 1 2.275074652 A426,199 ESTs, Weakly similar to stromal cell-derived factor 2 M. musculus 2.273575265 AWSS4921 ESTs, Weakly similar to KIAAO690 protein H. sapiens 2.270891671 AAS41870 ESTs, Highly similar to arsenate resistance protein ARS2 H. sapiens 2.264516126 AWS48.210 ESTs, Highly similar to 40S RIBOSOMAL PROTEINS25 Homo sapiens; Rattus 2.2626O4986 norvegicus A427473 ESTs, Moderately similar to COP9 PROTEIN Arabidopsis thaliana 2.262114744 AWS38852 Hmg14 high mobility group protein 14 2.25996.1047 AAO3O447 Prph1 Peripherin 2.25921575 AW536727 ESTs, Highly similar to HYPOTHETICAL 18.5 KD PROTEIN C12G12.05C IN 2.254.945336 CHROMOSOME IN Schizosaccharomyces pombe AWSS24O6 Mits misciitis ATP synthase gamma-Subunit gene, nuclear gene encoding a 2.252S2829 mitochondrial protein, partial cols C78511 Bikk Bcl2-interacting killer-like 2.2SO3145 AI451984 Prim1 DNA primase, p49 subunit 2.2SO302092 AWS44726 YwhaZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, Zeta 2.2489.14858 polypeptide AWS38474 ESTs, Highly similar to PUTATIVE SERINE THREONINE-PROTEIN KINASEA 2.2478.26338 Trypanosoma bruceii brucei AWSS1451 Spnb2 beta-spectrin 2, non-erythrocytic 2.245979336 AWSS6933 ESTs, Weakly similar to PUTATIVE PRE-MRNA SPLICING FACTOR RNA 2.245882244 HELICASE H. sapiens AAO49766 ESTs, Highly similar to KIAA0560 protein H. sapiens 2.2440O3O84 AW552799 ESTs, Weakly similar to predicted using Genefinder C. elegans 2.243647865 AW536273 Mcmd5 mini chromosome maintenance deficient 5 (S. cerevisiae) 2.243O88262 AAOO3951 Alas2 Aminolevulinic acid synthase 2, erythroid 2.2418558.39 AWS44857 ESTs, Highly similar to ISOCITRATE DEHYDROGENASE Bos taurus 2.2417483.63 AAO14456 Atp6k ATPase, H+ transporting lysosomal (vacuolar proton pump), 9.2 kDa 2.23872792 AA2545.28 Magoh mago-nashi homolog, proliferation-associated (Drosophila) 2.236,163487 AUO15485 ESTs, Weakly similar to PROBABLE PEROXISOMAL ENOYL-COA HYDRATASE 2.23.5591843 M. musculus AW553551 ESTs, Highly similar to calcium-independent alpha-latrotoxin receptor homolog 2 R. norvegicus AUO24141 ESTs, Highly similar to UBIQUITIN Homo sapiens; Bos taurus; Sus scrofa; Cavia 2.232630685 porcelius; Cricetitius grisetts; Cricetitius longicatidatus: Rattus norvegicus; Mits miscuits; Oryctiagiis clinicatius; Gaius gaits: Xenopus laevis; Drosophia melanogaster; Cerati C81381 ESTs, Weakly similar to BcDNA.GHO3108 (D. melanogaster 2.2321414 AW554765 ESTs, Moderately similar to tpr protein H. sapiens 2.2312O2975 AI323810 Mouse nucleolar protein NO38 mRNA, complete cols 2.23056495 AW537485 Pla2g6 85 kDa calcium-independent phospholipase A2 2.230310343 AW556373 ESTs, Highly similar to HAM1 PROTEIN Saccharomyces cerevisiae 2.228965982 AUO24437 ESTs, Weakly similar to rit M. musculus 2.228.758058 AUO2368O ESTs, Highly similar to SET PROTEIN Homo sapiens 2.228390926 W53962 Transforming growth factor, beta 2 2.228071514 AW544.412 ESTs, Highly similar to TUBULIN BETA CHAIN Lytechinus pictus 2.226024845 AA423209 PSme3 Proteaseome (prosome, macropain) 28 Subunit, 3 2.222939666 AU042116 ESTs, Highly similar to 40S RIBOSOMAL PROTEIN S10 Homo sapiens 2.222175184 AUO41939 Mus musculus TBX1 protein mRNA, complete cols 2.221932S11 W83O38 CSnk casein kappa 2.22O674318 AUO1681O EST, Weakly similar to coxsackie and adenovirus receptor homologue M. musculus 2.22O6285.18 AA272O67 erritin heavy chain 2.2196.6855 AWSSO222 melanocortin 2 receptor 2.219421336 AWS46733 Mus musculus mRNA for Arp2/3 complex subunit p21-Arc, complete cols 2.219371653 AWS49040 Rbmxrt RNA binding motif protein, X chromosome retrogene 2.21822.2838 AWS41.478 ESTs, Highly similar to signal peptidase:SUBUNIT 2.2.17423992 AI447392 DiGeorge syndrome chromosome region 6 2.216472345 AWS49381 ral guanine nucleotide dissociation stimulator 2.21318416 AUO16133 ESTs, Weakly similar to MSSP M. musculus 2.213OO9807 AW537792 glucose regulated protein, 78 kDa 2.21276O746 AW551233 protein tyrosine phosphatase 4a2 2.212302179 AW537568 ESTs, Weakly similar to similar to yeast heat shock protein STI1 C. elegans 2.212O10488 AW550650 Tctex1. -complex testis expressed 1 2.210463986 AAO16SO7 Eif2aka. eukaryotic translation initiation factor 2 alpha kinase 4 2.2099.06084 AAS10877 LOCS6043 aldo-keto reductase 2.209674103 AWSS6SO6 ESTs, Weakly similar to contains similarity to human cyclin A/CDK2-associated 2.207942373 protein p19, an RNA polymerase II elongation factor-like protein C. elegans AAO334.17 Shd Src homology 2 domain-containing transforming protein D 2.207103949 AA27O607 HIRIP5 HIRA-interacting protein 5 2.205698224 AI4478.15 ESTs, Moderately similar to LUTHERAN BLOOD GROUP GLYCOPROTEIN 2.2O379027 PRECURSOR H. sapiens AW536587 muskelin 1, intracellular mediator containing kelch motifs 2.20286SO2S AA427166 ESTs, Weakly similar to BAZFM. musculus 2.202843.556 US 8,298,756 B2 79 80 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio C80427 ESTs, Weakly similar to HYPOTHETICAL 32.0 KD PROTEIN IN SAP190-SPO14 2.2024.16221 NTERGENIC REGION Saccharomyces cerevisiae) AW537746 Atp6k ATPase, H+ transporting lysosomal (vacuolar proton pump), 9.2 kDa 2.2O2O77047 AWSS4292 Req requiem 2.199587912 C76488 Ubce.7 ubiquitin-conjugating enzyme 7 2.19958.3639 W11665 ESTs, Highly similar to LEUCYL-TRNASYNTHETASE, CYTOPLASMIC 2.199309009 Saccharomyces cerevisiae AW557.050 ESTs, Highly similar to RADIAL SPOKE PROTEIN 3 Chlamydomonas reinhardtii) 98522495 AIS28531 Poha1 Pyruvate dehydrogenase E1alpha subunit 984836O1 AUO23SSO Fin14 fibroblast growth factor inducible 14 9594.1034 W62248 CS cadherin 5 938O8943 AWS36168 Rangap1 RAN GTPase activating protein 1 9351605 AW554767 CIk4 CDC like kinase 4 9099.1173 AAS38228 Rab25 RAB25, member RAS oncogene family 89.550785 AWS46.162 ESTs, Weakly similar to CARG-BINDING FACTOR-AM. musculus 8948.2216 AWS39323 ESTs, Weakly similar to (defline not available 5852158) M. musculus 8924S581 AUO43933 Gapd glyceraldehyde-3-phosphate dehydrogenase 89078854 C77.465 ESTs, Moderately similar to ZINC FINGER PROTEIN MLZ-4 (Mus musculus 88892377 AWS36852 Fadk ocal adhesion kinase 88786.742 AWS362O7 ESTs, Highly similar to TUBULIN BETA CHAIN Sus scrofa) 885,17011 W871.97 ESTs, Highly similar to GLUTATHIONES-TRANSFERASEP Homo sapiens 8847O627 C799.25 Cox5a cytochrome c oxidase, subunit Va. 87784867 AI325926 Pigf Phosphatidylinositol glycan, class F 8771481 AW536O73 ESTs, Weakly similar to cDNA ESTyk338g10.5 comes from this gene C. elegans 87551.361 AW555238 ESTs, Weakly similar to ORFYNLO91w S. cerevisiae) 87097387 AWS46840 ESTs, Moderately similar to ubiquitin protein ligase M. musculus 866982S AWS442O7 Ubce4 ubiquitin-conjugating enzyme 4 863995.75 W11957 Sm protein FH. sapiens 85884275 AA265845 Mus musculus mRNA for heterogeneous nuclear ribonucleoprotein H 85702249 C87751 Mus musculus sodium bicarbonate cotransporter isoform 3 kNBC-3 mRNA, complete 8554.5754 AWS36982 Syn1 synapsin I 852.1333 AA108797 ESTs, Highly similar to AF125100 1 HSPCO39 protein H. sapiens 85O13011 AUO441.69 ESTs, Weakly similar to TYROSINE-PROTEIN KINASE JAK3 M. musculus 8489266S AA105546 ESTs, Highly similar to CHROMOSOME REGION MAINTENANCE PROTEIN 1 84752938 Schizosaccharomyces pombe AWS36.192 Mits musculus mRNA similar to human Sua1, complete cols 8417813S AW55678O chaperonin Subunit 3 (gamma) 83O29578 AW5525O2 ESTs, Weakly similar to RHO GDP-DISSOCIATION INHIBITOR2 (M. musculus 82648O38 AAS17533 Est2 repressor factor 81963644 AWS46,347 Mits musculus geminin mRNA, complete cols 81899423 A4145O1 ESTs, Highly similar to citrin H. sapiens 8O84O196 AAS21888 Neo1 neogenin 80793589 AWS44.317 Psma.6 proteasome (prosome, macropain) subunit, alpha type 6 79852629 AUO19946 Mus musculus E2F-like transcriptional repressor protein mRNA, complete cols 794-18995 AAOSO169 protein phosphatase X 778164.79 AA111722 Ccnd 1 cyclin D1 778.05783 W83655 Prip PPAR interacting protein PRIP 77488O26 AA285673 Rbmx RNA binding motif protein, X chromosome 7686901 AAO36275 Gata1 GATA-binding protein 1 76573242 AWSS6431 Krt2-1 keratin complex 2, basic, gene 1 75571901 AWS3681.1 H2afz histone H2A.Z 73945.499 C8OO66 Hn1 hematological and neurological expressed sequence 1 72659356 WO8432 Brp441 brain protein 44-like protein 7256098 C76660 ESTs, Moderately similar to KIAA0663 protein H. sapiens 72287352 C87299 CSnkle casein kinase 1, epsilon 67517796 AW55.3712 kbkb inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta 66514209 AUO17536 Cox6a1 cytochrome c oxidase, subunit VI a polypeptide 1 66O7638 AWS44371 Fin14 fibroblast growth factor inducible 14 65438344 W11746 Tuba4 tubulin alpha 4 64642273 AUO2O791 Mouse mRNA for TI-225, complete cols 64606896 C77.018 G3bp2 ras-GTPase-activating protein (GAPK120>) SH3-domain-binding protein 2 64476129 pendin AUO4O132 Shfig1 split hand foot deleted gene 1 2. 64347S35 AA275.245 Mus musculus mRNA for vinculin, partial cds 2. 64119226 AWS47479 ESTs, Weakly similar to PERIPLASMIC DIVALENT CATION TOLERANCE 2.164045819 PROTEIN CUTA (Escherichia coli AW537551 Abcf3 ATP-binding cassette, Sub-family F (GCN20), member 3 2. 63970346 AI32.7284 ESTs, Highly similar to NADH-UBIQUINONE OXIDOREDUCTASE B15 SUBUNIT 2. 610.72251 Bos taurus ESTs, Weakly similar to DEOXYRIBOSE-PHOSPHATE ALDOLASE Escherichia coli 6O741463 ribosomal protein S4, X-linked 6O12O787 AW557678 ESTs, Moderately similar to CGI-147 protein H. sapiens 594.7136 AWS37744 Mus musculus protein inhibitor of activated STAT protein PIAS1 mRNA, complete cols S944O423 AWS45312 M. musculus mRNA for GTP-binding protein 593 18938 AW551617 ESTs, Weakly similar to HC1 ORF (M. musculus 57995.583 AWSS1441 Mus musculus carboxy terminus of Hsp70-interacting protein (Chip) mRNA, complete 57761101 cols US 8,298,756 B2 81 82 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio AWSS2O22 Nudit5 nudix (nucleoside diphosphate linked moiety X)-type motif 5 SS260382 AWS49360 SfSS splicing factor, arginine?serine-rich 5 (SRp40, HRS) S46OO128 AWSS2668 LXn atexin 54541717 AA204262 ESTs, Highly similar to ALPHAENOLASE Mus musculus 536,53659 AUO21450 ESTs, Highly similar to step II splicing factor SLU7 H. sapiens 53638703 AI8934.42 Cox6a1 Cytochrome C oxidase, subunit VI a, polypeptide 1 S25966O2 AW537050 ESTs, Moderately similar to HYPOTHETICAL 49.7 KD PROTEIN INGIN2-STE3 S2451 S61 NTERGENIC REGION Saccharomyces cerevisiae) W77190 ESTs, Weakly similar to 60S RIBOSOMAL PROTEIN L30A 2. S1613671 Saccharomyces cerevisiae AA435101 ESTs, Highly similar to MDC-3.13 isoform 1 H. sapiens 49988.061 AWSS6946 ESTs, Highly similar to TRANSCRIPTION INITIATION FACTOR IIF, ALPHA 3. 48.9721.13 SUBUNIT Homo sapiens AW554745 ESTs, Weakly similar to LA PROTEIN HOMOLOG Drosophila melanogaster 48,511594 AWSS4784 ESTs, Weakly similar to Cxorf5 H. sapiens 4798O173 AAOS7995 ESTs, Moderately similar to AF151892 1 CGI-134 protein H. sapiens 47568646 C85330 Mus musculus mRNA for aldolase C, partial 46314267 AW55.3718 Mus musculus CRIPT protein mRNA, complete cols 46238796 W98278 ESTs, Highly similar to AF161434. 1 HSPC316 H. sapiens 461624O1 C85794 ESTs, Weakly similar to myelin transcription factor 1-like M. musculus 42786048 AW55.3739 Ttk protein kinase 42S8919 AAS12757 ESTs, Weakly similar to cDNA EST EMBL: CO8125 comes from this gene C. elegans 39749244 AW550795 ESTs, Highly similar to GUANINE NUCLEOTIDE-BINDING PROTEING(K), 37941679 ALPHA SUBUNIT Rattus norvegicus AUO18994 ATP synthase, H+ transporting, mitochondrial FO complex, Subunitg 37180545 AUO4OS33 Mus musculus mRNA for mD8, complete cols 361.224.53 AUO43470 ESTs, Moderately similar to ubiquitin/60S ribosomal fusion protein M. musculus 3S4O2S69 AUO41751 Wbp2 WW domain binding protein 2 3445.614 AUO4O781 Mus musculus ring-box protein 1 (Rbx1) mRNA, complete cols 3360888 AUO40559 Rpl3 ribosomal protein L3 33597012 AWS46128 Gli2 GLI-Kruppel family member GLI2 33528553 AUO4O711 ESTs, Weakly similar to All-1 protein + GTE form M. musculus 3298.2988 AW545.556 Rinps1 ribonucleic acid binding protein S1 31229452 AA38668O Kifsb kinesin family member 5B 3O805311 AA276752 ESTs, Weakly similar to AF104033 1 MUEL protein M. musculus 30751988 AWS3642O phosphofructokinase, liver, B-type 3O381062 AW537576 USf2 upstream transcription factor 2 3O169878 AI324141 Klc1 Kinesin light chain 1 2996.8869 AUO23963 ESTs, Weakly similar to SIG41 M. musculus 27150277 W36959 ESTs, Weakly similar to AAKG MOUSE 5'-AMP-ACTIVATED PROTEIN KINASE, 263336O7 GAMMA-1 SUBUNIT M. musculus AAOSO13S ESTs, Highly similar to ISOCITRATE DEHYDROGENASE Bos taurus 26317392 AWS37218 Mits miscuit is p53 apoptosis-associated target (Perp) mRNA, complete cols 24913489 AWSS4484 heterogenous nuclear ribonucleoprotein A2, B1 23621.382 AWSS1889 ring finger protein 4 234.89733 AUO43672 ESTs, Highly similar to PUTATIVE ATP-DEPENDENT RNA HELICASE C22F3.08C 23346276 Schizosaccharomyces pombe AA183061 ESTs, Highly similar to RNA splicing-related protein R. norvegicus 953S349 C80708 ESTs, Weakly similar to 62D9.a D. melanogaster 948.4585 W65230 Cldn13 claudin-13 gene 901S4S4 AA122896 Slc22a1 solute carrier family 22 (organic cation transporter), member 1-like 84.41117 AUO23882 Brca2 breast cancer 2 7866055 AUO19334 ESTs, Moderately similar to ACTIN-LIKE PROTEIN 14D Drosophila melanogaster 7797328 AWS415O1 ESTs, Highly similar to CLATHRIN HEAVY CHAIN Rattus norvegicus 748S424 AW557038 ESTs, Highly similar to TRANSCRIPTION INITIATION FACTORTFIID 20/15 KD 6385548 SUBUNIT H. sapiens AWS48472 Rps8 ribosomal protein S8 610450S AWS4O941 ESTs, Highly similar to CYTOCHROME COXIDASE POLYPEPTIDE VIB 3. 54.64663 Homo sapiens AW545587 ESTs, Moderately similar to BIOTIN CARBOXYLASE Anabaena pcc7120 2747687 AW55.3979 ESTs, Highly similar to TYROSINE-PROTEIN KINASE JAK1 Homo sapiens 2422O1 AWS57096 Nfix nuclear factor IX 19444 AUO44022 ESTs, Weakly similar to predicted using Genefinder C. elegans 1675482 AWSSO624 Mouse mRNA for TI-225, complete cols O955467 AI415O12 ESTs, Weakly similar to F25H9.7 C. elegans O875235 AAO03927 chaperonin Subunit 2 (beta) O8233.15 W89599 eukaryotic translation initiation factor 2, Subunit 3, structural gene X-linked O9036647 AWS491.19 RIE2 protein O8802 AAO27675 T-box 15 O7485233 AWSSS686 ESTs, Moderately similar to FAD SYNTHETASE Saccharomyces cerevisiae O7160343 AWS36333 transcription factor-like 1 OS768299 AUO152O3 pituitary tumor-transforming 1 O557106 W34455 ESTs, Highly similar to NADH-UBIQUINONE OXIDOREDUCTASE B12 SUBUNIT 05042587 Bos taurus AUO41434 Uk1 Unc-51 like kinase 1 (C. elegans) O3857568 AUO17038 ESTs, Highly similar to REPLICATION PROTEIN A 14 KD SUBUNIT Homo sapiens O2934707 W14837 PrSc1 protease, cysteine, 1 O2744346 AA1634.32 ESTs, Weakly similar to ANX7 MOUSE ANNEXIN VII (M. musculus O2354444 US 8,298,756 B2 83 84 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio AWS443SO ESTs, Highly similar to ESS1 PROTEIN Saccharomyces cerevisiae 2.101933004 AUO18835 Mus musculus claudin-10 mRNA, complete cols 2.101785421 AA415519 ESTs, Weakly similar to HYPOTHETICAL 40.4KD PROTEIN R06F6.5 IN 2.101349422 CHROMOSOME II Caenorhabditis elegans AWS38436 Mus musculus protein inhibitor of nitric oxide synthase (PIN) mRNA, complete cols 2.1 OO6949S4 AAO86829 Missk1 muscle-specific serine kinase 1 2.1OOO87115 AA212445 Statsa Signal transducer and activator of transcription 5A 2.099472632 AW555798 Nicor1 nuclear receptor co-repressor 1 2.098583834 AUO41141 ESTs, Moderately similar to (defline not available 6118541) M. musculus 2.097.62O163 AA272878 ESTs, Highly similar to atypical PKC specific binding protein R. norvegicus 2.09748684 AAO14127 DNA segment, Chr 15, Wayne State University 77, expressed 2.094.998.947 AWS44533 hymidine kinase 1 2.0936964OS AIS28532 Mus musculus protein kinase C inhibitor (mPKCI) mRNA, complete cols 2.093394.542 AUO40509 ESTs, Weakly similar to Ring3 M. musculus 2.092999984 AAO49416 His1a histone H1 2.092964O75 AA268862 Saps SKAP55 homologue 2.092899653 pending C88157 Mus musculus RING finger protein AO7 mRNA, complete cols 2.092SOSS96 AWS36.16.1 erritin light chain 1 2.092408097 AAO32709 DNA segment, Chr 7, ERATO Doi 462, expressed 2.091456089 AW538753 ESTs, Highly similar to SORCINCricetulus longicaudatus 2.090595934 AWSS46O7 Ptk9r protein tyrosine kinase 9 related protein 2.08852.5057 pending AI325946 TESTIN 2 PRECURSOR 2.O88224301 AWSSO148 Spint2 serine protease inhibitor, Kunitz type 2 2.088199037 AW555109 Chd1 chromodomain helicase DNA binding protein 1 2.088170924 AW557266 ESTs, Highly similar to MITOCHONDRIAL IMPORT RECEPTORSUBUNIT TOM20 2.08S963.328 HOMOLOG R. norvegicus AWS38548 ESTs, Highly similar to PHOSPHATIDYLSERINE DECARBOXYLASE PROENZYME 2.0858.27569 Cricetitius grisetts AWSS2438 ESTs, Moderately similar to (define not available 5714400) M. musculus 2.084900792 AA413090 ESTs, Moderately similar to unknown protein IT12 H. sapiens 2.O8408988 AIST3427 Catnb Catenin beta 2.08164667 AWSS1843 ESTs, Highly similar to (defline not available 5901572) R. norvegicus 2.08.1031756 AWS49786 ATP synthase, H+ transporting mitochondrial F1 complex, alpha Subunit 2.080499984 AW555377 S-adenosylhomocysteine hydrolase 2.080387755 AWS45836 ESTs, Highly similar to GLUCOSE-6-PHOSPHATASE Homo sapiens 2.0794.6168 AWSS44.08 Usp9x ubiquitin specific protease 9, X chromosome 2.0794.1020S AUO17036 ESTs, Highly similar to UBIQUITIN-CONJUGATING ENZYME E2-17 KD 3 Homo 2.0788242 Sapiens; Ratti is norvegicus AUO23.795 ESTs, Weakly similar to formin binding protein 11 M. musculus 2.078771795 AUO21910 ESTs, Highly similar to C-1 H. sapiens 2.078299566 AAO66209 M. musculus mRNA for glutamyl-tRNA synthetase 2.07822O839 AAO28539 Pdgfc platelet-derived growth factor, C polypeptide 2.078O34358 AWS45810 ESTs, Highly similar to P53-BINDING PROTEIN 53BP2 M. musculus 2.077868917 AWS439S4 Ub1 ubiquitin-like 1 2.077687,345 A UO15235 Mits musculus pre-B-cell colony-enhancing factor mRNA, complete cols 2.077221503 A. 4SO292 ESTs, Highly similar to signal peptidase:SUBUNIT 2.077147229 A UO21030 Mus musculus mACS4 mRNA for Acyl-CoA synthetase 4, complete cols 2.076973921 AWS488.33 ESTs, Weakly similar to coronin-3 M. musculus 2.076920O83 AA24178O Atp6s1 ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1 2.0741.SS421 A UO15646 Rex3 reduced expression 3 2.O.716444.06 W34672 Sh3d2a SH3 domain protein 2A 2.071075.902 ESTs, Weakly similar to cDNA EST EMBL:CO8125 comes from this gene C. elegans 2.07070659 W5 5 6 2 5 6 Tcfcp2 transcription factor CP2 2.070422069 465224 ESTs, Highly similar to 60S RIBOSOMAL PROTEIN L15 Rattus norvegicus) 2.06998SO1 W5 5 5 3 2 6 Smoh Smoothened homolog (Drosophila) 2.069871303 PSmc3Ip proteasome (prosome, macropain) 26S Subunit, ATPase 3, interacting protein 2.0698.63O24 78.336 Cnn2 calponin 2 2.068042O36 WS45.645 Tpm5 tropomyosin 5 2.06794.7872 W5 5 1 3 1 5 Rps29 ribosomal protein S29 2.067794525 428885 ESTs, Weakly similar to prediction 2.06641.6765 W5 3 6 O 6 8 Rrm1 ribonucleotide reductase M1 2.06622O888 323,636 Mits miscuit is eosinophil Secondary granule protein (mEAR-2) mRNA, complete cols 2.065726689 UO42101 Plp proteolipid protein (myelin) 2.06543O884 77213 ESTs, Moderately similar to PUTATIVE ORAL CANCER SUPPRESSOR 2.065210238 Mesocricetus at traits A UO23139 ESTs, Weakly similar to natural killer cell tumor-recognition protein M. musculus 2.061470989 A.WS36843 Cct4 chaperonin Subunit 4 (delta) 2.06085563S AA221877 STs, Highly similar to GUAA HUMAN GMP SYNTHASE H. sapiens 2.06O478391 A UO19894 STs, Highly similar to brain and reproductive organ-expressed protein H. Sapiens 2.0596.14762 W59026 KIAAO857 2.05813772 A UO425.18 Hdc histidine decarboxylase cluster 2.056638675 AWS46468 ESTs, Highly similar to RIBONUCLEASE INHIBITOR Rattus norvegicus) 2.OSS993.345 AWS361.83 Cct3 chaperonin Subunit 3 (gamma) 2.OSS41031 A. 326287 ESTs, Highly similar to TUBULIN ALPHA-4 CHAIN Gallus gallus 2.054481753 AWSS1916 Mus musculus putative deubiquitinating enzyme UBPY (Ubpy) mRNA, complete cds 2.OS4332813 US 8,298,756 B2 85 86 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio AWS36647 ESTs, Highly similar to HYPOTHETICAL 25.7 KD PROTEIN IN MSH1-EPT1 2.OS3538.694 NTERGENIC REGION Saccharomyces cerevisiae) AWSS6964 Silga-1 silica-induced gene 41 2.053.13114 AWS37469 ESTs, Moderately similar to BB1 2.05226.7636 AUO17931 ESTs, Highly similar to ALPHA-1,6-MANNOSYL-GLYCOPROTEIN BETA-1,2-N- 2.050617842 ACETYLGLUCOSAMINYLTRANSFERASE Rattus norvegicus AWS42919 ESTs, Highly similar to KIAA0398 H. sapiens 2.049586337 AWS47284 ESTs, Weakly similar to PYRROLINE-5-CARBOXYLATE REDUCTASE 2.0491.818O2 Glycine max C881.81 ESTs, Moderately similar to CCR4-ASSOCIATED FACTOR 1 M. musculus 2.0491.63.559 C8S992 troponin I, skeletal, fast 2 2.04659.0193 AA124929 ESTs, Moderately similar to unnamed protein product H. sapiens 2.04601.4815 AAO31105 ESTs, Weakly similar to nuclear protein ZAP M. musculus 2.0462411 AWS47298 ESTs, Weakly similar to NG38 M. musculus 2.045099916 AW544241 ESTs, Highly similar to eukaryotic translation initiation factor eIF3, p35 subunit 2.043937442 H. sapiens AAS42348 ESTs, Weakly similar to SIK similar protein M. musculus 2.043764446 AAO3O810 ESTs, Highly similar to AF161432 1 HSPC314 H. sapiens 2.043627079 AA273.426 ESTs, Moderately similar to nebulette H. sapiens 2.0433.66784 AI447370 ESTs, Highly similar to CAAX prenyl protein protease RCE1 H. sapiens 2.04179856 AAO871.93 Lipocalin 2 2.04O902926 AWSS2O69 ATP synthase, H+ transporting, mitochondrial FO complex, Subunit b, isoform 1 2.04O618398 AWSS4249 ESTs, Weakly similar to microtubule-actin crosslinking factor M. musculus 2.040394297 AWSS2221 Hdgf hepatoma-derived growth factor 2.0396.26815 AWS4718S Arg1 arginase 1, liver 2.037574.557 AUO2O575 ESTs, Moderately similar to HYPOTHETICAL 27.1 KD PROTEIN CCE1-CAP1 2.037569931 NTERGENIC REGION Saccharomyces cerevisiae) AWS45291 Calm calmodulin 2.037S14948 AUO2O225 Mus musculus mRNA for Sid393p, complete cols 2.037396367 AW 556673 Anxa7 annexin A7 2.03695.2459 W14928 Smpd1 Sphingomyelin phosphodiesterase 1, acid lysosomal 2.035892.157 AUO45064 ESTs, Highly similar to SOH1 PROTEIN Saccharomyces cerevisiae 2.O35291187 AUO15736 ESTs, Moderately similar to KIAAO873 protein H. sapiens 2.035101764 AW554127 Ly841 ymphocyte antigen 84 ligand 2.033282.134 AI893564 Anx5 Annexin V 2.032674O21 A414985 ESTs, Highly similar to HYPOTHETICAL 109.5 KD PROTEIN IN PPA1-DAP2 2.032638418 NTERGENIC REGION Saccharomyces cerevisiae) AWS36.16.1 Ft.1 erritin light chain 1 2.031483O82 AW557154 ESTs, Highly similar to HYPOTHETICAL 64.5 KD PROTEINZK652.9 IN 2.O3O895392 CHROMOSOME III Caenorhabditis elegans AWS444O2 ESTs, Moderately similar to PROBABLE UBIQUITIN CARBOXYL-TERMINAL 2.028946.654 HYDROLASE Mus musculus AAO58,194 Ephb1 Eph receptor B1 2.028898148 AWS38460 SfS3 splicing factor, arginine?serine-rich 3 (SRp20) 2.027993079 AUO18866 Abcd3 ATP-binding cassette, Sub-family D (ALD), member 3 2.027886.388 W894.91 Fus2 usion 2 (human) 2.027721 104 AW556539 Mus musculus mRNA for eIF3 p66, complete cols 2.0263O2738 W63009 DNA segment, Chr 6, Wayne State University 137, expressed 2.026028375 AA467238 ESTs, Moderately similar to AF155107 1 NY-REN-37 antigen H. sapiens 2.O2S843113 W79958 X-linked nuclear protein 2.O2S191.263 AUO19848 LIM domain binding 1 2.024274.047 AA22O582 Cytochrome P450, 2f2 2.023391931 C76118 Mus musculus carboxy terminus of Hsp70-interacting protein (Chip) mRNA, 2.0226,131.59 complete cols AAO16824 Cck cholecystokinin 2.022490481 AI326325 ESTs, Weakly similar to CCAAT-BINDING TRANSCRIPTION FACTOR 2.02O679018 SUBUNITA Petromyzon marinus AA253928 S100a11 S100 calcium binding protein A11 2.O 9696914 AWS41485 Ldr ow density lipoprotein receptor 2.O 9565667 AWS36904 Ppia peptidylprolyl isomerase A 2.O 9439841 AWSS2486 Ube?i ubiquitin-conjugating enzyme E2I 2.O 888.3876 AUO41740 M. musculus mRNA for fibromodulin 2.O 868O23 AI448352 ESTs, Highly similar to KIAA0670 protein H. sapiens 2.O 8648182 AW557886 ESTs, Highly similar to dJ3OM3.2 H. sapiens 2.O 8168,191 AWS46615 ESTs, Highly similar to TRANSLATIONAL INITIATION FACTOR2 ALPHA 2.O 7143269 SUBUNIT Rattus norvegicus; Bos taurus AWS36942 Mus musculus mRNA for MSSP, complete cds 2.O 70881.83 AUO17987 ESTs, Weakly similar to NADH-CYTOCHROME B5 REDUCTASE R. norvegicus 2.O 6928.064 C85531 Mus musculus TBX1 protein mRNA, complete cols 2.O 6803084 AWS45339 Ate1 arginine-tRNA-protein transferase 1 2.O 66931.99 AWS46437 Rab6kif Rab6, kinesin-like 2.O 6652O63 AI666581 RIBOSOMAL PROTEINS6 KINASE II ALPHA1 2.O 602961.2 AI447773 Mus musculus BAF53a (Baf53a) mRNA, complete cols 2.O S349198 AAS37763 matrin cyclophilin (matrin-cyp) R. rattus 2.O 4990SOS AAO3O846 Coq7 demethyl-Q 7 2.O 3748.884 AW5376.79 ESTs, Highly similar to transcriptional co-activator CRSP77 H. sapiens 2.O 244S473 AWS4S196 Suppressor of initiator codon mutations, related sequence 1 (S. cerevisise) 2.O 2217503 C78825 ESTs, Weakly similar to protein co-factor M. musculus 2.O 1284548 US 8,298,756 B2 87 88 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio AWSS1014 ESTs, Highly similar to KIAA0594 protein H. sapiens 2.01.105.3628 AW550287 Map2k7 mitogen activated protein kinase kinase 7 2.01 OOO86.79 C79872 PSmd7 proteasome (prosome, macropain) 26S Subunit, non-ATPase, 7 2.009904416 AW538975 ESTs, Weakly similar to ladinin H. sapiens 2.OO94O1476 AI666784 ESTs, Weakly similar to protein kinase C-binding protein RACK7 H. sapiens 2.OO819018 C79697 3-phosphoglycerate dehydrogenase 2.OO734278 AWS36784 ESTs, Highly similar to HYPOTHETICAL PROTEIN KIAAO174 H. sapiens 2.OOS216822 AWSS2691 ESTs, Highly similar to KINESIN-II 85 KD SUBUNIT Strongylocentrotus purpuratus 2.004947.093 W66889 ESTs, Highly similar to RABPHILIN-3A Rattus norvegicus 2.004938O2S AWSS328O tgb1 integrin beta 1 (fibronectin receptor beta) 2.OO3708956 A413372 ESTs, Highly similar to Rer1 protein H. sapiens 2.OO3211999 C77965 fibroblast growth factor regulated protein 2.00177749 AA15390S ESTs, Weakly similar to CG17019 gene product D. melanogaster 2.OOO439106 AWS445O1 Hmox1 heme oxygenase (decycling) 1 O.498585892 W62969 Fyn Fyn protooncogene O.498473008 AWS47534 Snrp116 U5 Small nuclear ribonucleoprotein 116 kDa 0.497942009 pending AWSS6002 ESTs, Weakly similar to open reading frame M. musculus 0.497906318 AWS38495 ESTs, Moderately similar to GLYCOPROTEIN 25L PRECURSOR Canis familiaris 0.497505758 AUO18809 ESTs, Weakly similar to cDNA EST EMBL:D70762 comes from this gene C. elegans 0.4973.60848 W34685 Rora RAR-related orphan receptor alpha O.496667567 A426288 ESTs, Weakly similar to ultra-high-sulfur keratin M. musculus O496141712 AI324.866 Mus musculus PEST phosphatase interacting protein mRNA, complete cols O.495826245 AI893650 USf2 Upstream transcription factor 2 0.4955,7731 A426736 Mits musculus timeless homolog mRNA, complete cols 0.494-513325 AA184214 Gabpb1 GA repeat binding protein, beta 1 0.494-022907 AAO17867 ESTs, Highly similar to CARCINOEMBRYONIC ANTIGENCGM6 PRECURSOR 0.49312595S Homo sapiens AA268219 Mpeg1 macrophage expressed gene 1 O.492S80225 AA239856 Omi serine protease OMI O.492467109 W163S4 ESTs, Moderately similar to LAR PROTEIN PRECURSOR Homo sapiens O.491968272 C87660 ESTs, Weakly similar to melastatin M. musculus O.491744995 AW555781 complement component 1, q. Subcomponent, beta polypeptide O.490941625 A428004 ESTs, Moderately similar to transporter protein H. sapiens O.48948.1805 C77865 ESTs, Highly similar to major vault protein R. norvegicus O488832841 AI449541 ESTs, Highly similar to myc far upstream element-binding protein H. sapiens O.4882O1357 W64937 Arp2 angiopoietin related protein 2 O.486616378 pending AI327367 C28 CD28 antigen O.486573305 AA413761 Epn2 epsin2 O.48638791 AAS11061 ESTs, Weakly similar to similar to kinensin-like protein C. elegans O.485798.066 AA462869 Complement component 2 (within H-2S) O.48577O605 W301.78 Platelet derived growth factoralpha O.485512789 AW536657 ESTs, Highly similar to PHOSPHOENOLPYRUVATE CARBOXYKINASE, O484491052 CYTOSOLIC Rattus norvegicus C81284 ESTs, Moderately similar to TYROSINE-PROTEIN KINASE JAK2 M. musculus O.484285289 AI661,346 ESTs, Moderately similar to estradiol 17beta-dehydrogenase M. musculus O.4842S3534 AAO641.83 Pex16 peroxisome biogenesis factor 16 O.48391.9369 AI3856OO Mus musculus cyclic nucleotide phosphodiesterase (PDE1A2) mRNA, complete cols O.483.35782 AI447349 ESTs, Moderately similar to hypothetical protein H. sapiens O.48314.7225 AUO45766 ESTs, Weakly similar to KIAA0926 protein H. sapiens O.48294.7335 AA174729 D13Etc27 Se DNA segment, Chr 13, ERATO Doi 275, expressed O.482851894 W82220 Rab3a RAB3A, member RAS oncogene family O.482386856 AI447993 H2-Aa Histocompatibility 2, class II antigen A, alpha O.48129597 AI327389 Stata Signal transducer and activator of transcription 4 O481241844 A42771S ESTs, Weakly similar to Rab8-interacting protein M. musculus O481160908 AI4494.08 RADIXIN O481OO611 AAO14942 ESTs, Weakly similar to RAS-like protein expressed in many tissues M. musculus 0.48O372777 AAOOO726 Vipr2 Vasoactive intestinal peptide receptor 2 O48O224921 81.465 Taut aurine/beta-alanine transporter O.479566248 42592O ESTs, Weakly similar to HSPC010 H. sapiens O.479378243 77369 ESTs, Weakly similar to cDNA EST EMBL:C11678 comes from this gene C. elegans O.4792.2836 8832O ESTs, Weakly similar to RING1B protein M. musculus O.4782O664 UO4O2S3 ESTs, Weakly similar to LR8 LM. musculus O.47742886 AA260747 Birc6 baculoviral IAP repeat-containing 6 O.476766539 AWS44351 Kifap3 kinesin-associated protein 3 O.476,693 SOS AUO412O2 Mus musculus mRNA, complete cols, clone: 2-68 O.47S319304 AUO20O28 Iers immediate early response 5 O.475163983 A413118 Gng31g G protein gamma 3 linked gene O.473S43339 AAO61278 ESTs, Weakly similar to KIAA0308 H. sapiens O.473431725 AUO14897 Apc adenomatosis polyposis coli O.47295.6452 AA426926 D14Ertd817e DNA segment, Chr 14, ERATO Doi 817, expressed O.47258OOO7 AA108640 Gdc1 Glycerolphosphate dehydrogenase 1, cytoplasmic adult O.4722O26 AA261368 YwhaZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, Zeta O.471958974 polypeptide AA435123 ESTs, Weakly similar to ZK1058.5 C. elegans O.471909449 AU043840 Cora. carbon catabolite repression 4 homolog (S. cerevisiae) O.471612261 AI4SO156 ESTs, Weakly similar to RING1B protein M. musculus O.47O6O2473 US 8,298,756 B2 89 90 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio AWS36,169 Sparc secreted acidic cysteine rich glycoprotein O.468881114 AWSS2818 M. musculus mRNA for GTP-binding protein O.466979012 C77414 Gpcr26 G-protein coupled receptor 26 O.46635312S AI449065 ESTs, Highly similar to SUSHI REPEAT-CONTAINING PROTEIN SRPX O4658412 PRECURSORR. norvegicus) AA260521 Ucp2 uncoupling protein 2, mitochondrial O.46SO29569 AA2OOO91 ESTs, Moderately similar to AFO96286 1 pecanex 1 M. musculus O46491171 AI326894 ESTs, Moderately similar to HYPOTHETICAL 20.8 KD PROTEIN TO9A5.6 IN O-46346233 CHROMOSOME III Caenorhabditis elegans AA118392 Staf Selenocysteine tRNA gene transcription activating factor O.4609788OS AA2O0942 Slfn4 schlafen 4 O.4605942O2 AA275985 Rieske iron-sulfur protein R. Rattus O.4599.11898 AI325.975 ESTs, Highly similar to 65 KDYES-ASSOCIATED PROTEIN Mus musculus O.459243061 AI323966 ESTs, Weakly similar to GOLIATH PROTEIN Drosophila melanogaster O458644321 W12425 ESTs, Highly similar to KIAA1533 protein H. sapiens 0.457391.655 W81912 Crabp2 Cellular retinoic acid binding protein II O.45721 1976 AA178121 Ctss cathepsin S O.457173OO1 W70924 PK-120 precursor (itih-4) O.45658.7824 AA123853 Cast calpastatin O.456342311 AA23O451 S1OOa8 S100 calcium binding protein A8 (calgranulin A) O.456297242 AI430926 ESTs, Highly similar to KIAA1002 protein H. sapiens O.455164376 W973O3 Meg3 maternally expressed gene 3 O4S4711379 A426SSS Mus musculus histone deacetylase mHDA1 mRNA, complete cols O.454390478 AAO61732 shrm shroom O.4539.0698 AUO2OSS1 ESTs, Moderately similar to NOF1 H. sapiens O.45336961 AI429678 Capni5 Calpain 5 O.452911351 AA213015 Tstap35b issue specific transplantation antigen P35B O452689264 AUO18982 C1s complement component 1, SSubcomponent O.451660309 AA268592 Tgfbi Transforming growth factor, beta induced, 68 kDa 0.451233977 C79673 ESTs, Weakly similar to TALIN M. musculus O451086496 AUO19876 ESTs, Moderately similar to POLLEN SPECIFIC PROTEINSF3 Helianthus annuus O.45O242321 W29855 ep Pale ear O.45O183821 AI32551.6 ESTs, Highly similar to ASPARTOACYLASE Homo sapiens O.4498.31,178 AUO16285 UNC-5 homolog (C. elegans) 3 O.4491,07031 C81338 procollagen, type V, alpha 1 O4484605 AA12O639 DNA segment, Chr 13, ERATO Doi 372, expressed O.447735968 AI452234 ESTs, Weakly similar to Similar to aldehyde dehydrogenase C. elegans O.447.667176 AAO73843 ESTs, Weakly similar to HYPOTHETICAL 29.5 KD PROTEIN COSB5.7 IN O446317848 CHROMOSOME III Caenorhabditis elegans AA1891.96 ESTs, Highly similar to T00325 hypothetical protein KIAA0546 - human H. sapiens O.446285677 AA118626 ESTs, Highly similar to unnamed protein product H. Sapiens O.445541417 AIS287O6 Mus musculus MPS1 gene and mRNA, 3'end O.443511276 AI324761 Mus musculus short-chain dehydrogenase CRAD2 mRNA, complete cols O4428398.84 W999.68 Kcnna. potassium intermediate small conductance calcium-activated channel, Subfamily N, O.441371.237 member 4 AA435060 List1 eucocyte specific transcript 1 O441296.333 AA178076 Cd53 CD53 antigen O.44059 1878 AUO418O1 Dr.3 developmentally regulated repeat element-containing transcript 3 O439266461 AUO19411 ESTs, Highly similar to ARGININOSUCCINATELYASE Homo sapiens O.43891OSS6 AI326924 ESTs, Highly similar to MYO-INOSITOL-1 (OR4)-MONOPHOSPHATASE O.437951O6 Xenopus laevis ESTs, Highly similar to 0-44 PROTEIN Rattus norvegicus O.43692673 AA120432 Mus musculus prostaglandin transporter PGT mRNA, complete cols 0.436751727 AA110278 ESTs, Weakly similar to unknown R. norvegicus O.43638582 AUO42856 ESTs, Weakly similar to contains similarity to Saccharomyces cerevisiae MAF1 O.43622857 protein C. elegans AAOO3252 Myhca myosin heavy chain, cardiac muscle, adult O.434973S45 AWS46079 ESTs, Highly similar to HYPOTHETICAL 70.2 KD PROTEIN IN GSH1-CHS6 O434243151 NTERGENIC REGION Saccharomyces cerevisiae) C79931 jm jumonji O.43O266963 AI4S1309 Px3 Plexin 3 O.43OO74817 A426259 ESTs, Weakly similar to high affinity immunoglobulin gamma Fc receptor I O.429035689 M. musculus AA474849 ESTs, Highly similar to KIAA1461 protein H. sapiens O.42741177 W82668 Spry1 Sprouty homolog 1 (Drosophila) O.426418.559 AA161816 Api5 apoptosis inhibitory protein 5 O.425689953 AI323807 Mus musculus GDP-dissociation inhibitor mRNA, preferentially expressed in O4238O3111 hematopoietic cells, complete cols AA118878 ESTs, Highly similar to NEDD-4 PROTEIN Homo sapiens O.423726623 AA212838 PSnb7 Proteasome (prosome, macropain) subunit, beta type 7 O.42279869 W4612S ESTs, Weakly similar to D29149 proline-rich protein - mouse M. musculus O.422389477 AA144383 Clpx caseinolytic protease X (E. coli) O.42231.1709 AI3.85657 Ext1 Exostoses (multiple) 1 O.4172O6887 C86591 Sdfr2 stromal cell derived factor receptor 2 O41567.4914 AUO421.51 ESTs, Highly similar to laminin B1 M. musculus O.412353937 AI324O11 ESTs, Weakly similar to BRAIN SPECIFIC POLYPEPTIDE PEP-19 O.41 1873664 Raitt is norvegicus; Mits musculus US 8,298,756 B2 91 92 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio AI451431 ESTs, Highly similar to RAS-RELATED PROTEINRAL-B Rattus norvegicus AA175990 ESTs, Highly similar to P300 HUMAN E1A-ASSOCIATED PROTEIN P300 H. sapiens AA2SOO39 Lgals9 lectin, galactose binding, soluble 9 O.4095.11422 AI32.6849 TRANSCRIPTIONAL REGULATOR PROTEIN HCNGP O.4O6388099 C79775 Hba-al hemoglobin alpha, adult chain 1 O.405986OS C77913 Gdf3 growth differentiation factor 3 O.4042O3495 C77459 ESTs, Weakly similar to HYPOTHETICAL PROTEIN KIAAO008 H. sapiens O404184,781 AW557391 Nedd5 neural precursor cell expressed, developmentally down-regulated gene 5 O.403827774 AUO18863 KIfA. Kruppel-like factor 4 (gut) O.403065274 AUO42260 Cf complement component factor I O.402491799 W34157 Secreted acidic cysteine rich glycoprotein SPARC O401851,169 AA178132 Mus musculus PGES mRNA for prostaglandin E synthase, complete cols O.4O1791.284 WO8086 Gba Acid beta glucosidase O401380464 AA25O238 Usp18 ubiquitin specific protease 18 O.401098,929 AAO48539 ESTs, Highly similar to INOSITOL 14,5-TRISPHOSPHATE-BINDING PROTEIN O.396S2O3S3 TYPE 1 RECEPTOR Rattus norvegicus) AAO3O377 ESTs, Highly similar to PDGF receptor beta-like tumor suppressor H. sapiens O.3958.14313 C88171 ESTs, Weakly similar to KIAA0601 protein H. sapiens O.395639563 AWS49905 Hba-al hemoglobin alpha, adult chain 1 O.39S434605 AUO15378 Pole7a phosphodiesterase 7A 0.3953.71322 AI429264 ESTs, Moderately similar to KIAA0948 protein H. sapiens O.39532O909 W87077 Cell cycle progression 2 protein (CPR2) H. sapiens O.393842569 AI4S1393 ESTs, Weakly similar to HYPOTHETICAL PROTEIN HI1130 O.392399983 Haemophilus influenzae AI3234.71 Zfp147 Zinc finger protein 147 O.391742O59 C79534 CStf3 cleavage stimulation factor, 3' pre-RNA, subunit 3 O.389435064 AI5733.76 Fcer1g Fc receptor, IgE, high affinity I, gamma polypeptide O.385223.818 AWS49905 Hba-al hemoglobin alpha, adult chain 1 O.3847O3759 AU045698 Mus musculus SOCS box-containing WD protein SWiP-2 (Swip2) mRNA, complete cols O.38469230S W17967 Pon1 Paraoxonase 1 O.381300142 AA118886 Histocompatibility 2, Oregion alpha locus O.379646356 AA183698 Sell selectin, lymphocyte 0.378737.018 AAO284.11 D7Ertf6Oe DNA segment, Chr 7, ERATO Doi 760, expressed 0.377683276 W33982 HDAC7 histone deacetylase 7 O.375622229 AWS44285 Gnai2 guanine nucleotide binding protein, alpha inhibiting 2 0.37553O863 AWS4458O Ero11-pendin ERO1-like (S. cerevisiae) O.373S17048 AI327378 ESTs, Highly similar to putative E1-E2 ATPase M. musculus O.3726928.78 C79918 Mus musculus serine protease OMI (Omi) mRNA, complete cols O.371971496 AA423584 Expi extracellular proteinase inhibitor O.371842492 C81309 Gata GATA-binding protein 3 O.371089436 AWSS3343 LgalsT ectin, galactose binding, soluble 7 O.368788049 AAO17742 Hdac5 histone deacetylase 5 O.368222326 AUO21.695 ESTs, Weakly similar to cDNA ESTyk325c7.5 comes from this gene C. elegans O.362313766 AI324651 Csk C-src tyrosine kinase O.361784019 AI32391.6 Hbb-bl3 Hemoglobin beta, pseudogene bh3 O.35939.0956 AA140511 Coro1a. coronin, actin binding protein 1A O.348942089 AW55O250 ESTs, Moderately similar to P53-BINDING PROTEIN 53BP2 M. musculus O.348279234 WS94O2 Solute carrier family 2 (facilitated glucose transporter) member 1 O.34726.6069 AI323455 Mits musculus peptidylglycine alpha-amidating monooxygenase (PAM) mRNA, O.3422S2509 complete cols AI324019 ESTs, Highly similar to PANCREATIC LIPASE RELATED PROTEIN 1 O.342094.96S PRECURSOR Canis familiaris AI323613 nositol polyphosphate-5-phosphatase, 145 kDa O.34.1842445 W48.074 ESTs, Weakly similar to U82695 2 expressed-Xq28STS protein H. sapiens O.341.545463 AI449289 ESTs, Weakly similar to regulator of G protein signaling 12 H. sapiens O.34052S506 AWSS4421 C1qa complement component 1, q. Subcomponent, alpha polypeptide O.337939883 AA286654 LOCS4129 hypothetical protein 0.337264557 AWS49905 Hba-all hemoglobin alpha, adult chain O.3301.45717 AAO08051 Mits musculus Dkc1 gene for dyskerin, exon 1 and join CDS O.33OO43228 W41258 GT12 protein O.325468276 AWS49905 Hba-all hemoglobin alpha, adult chain O.324.856566 AA245O29 Dlk1-like homolog (Drosophila) O.321318.128 C88O87 pre B-cell leukemia transcription factor 3 0.32O595592 AUO41875 apolipoprotein B editing complex 1 O.315363153 AI4S1067 ESTs, Weakly similar to LIGATIN M. musculus O.314S53028 AA2O8883 alin O.310653211 AI3268.39 Mits musculus high mobility group protein homolog HMG4 (Hmg4) mRNA, complete O.310482414 cols C791.79 EST, Weakly similar to organic anion transporter OATP-C H. sapiens O.302074885 AW552972 ESTs, Highly similar to ATP-DEPENDENT PROTEASE LA 2 Myxococcus xanthus O.297372968 AA145212 caseinolytic protease X (E. coli) O.29513184 AI605734 O.295081875 AWS46106 Tyms hymidylate synthase O.295071229 C77182 ESTs, Weakly similar to glycogen debranching enzyme isoform 6 H. Sapiens O.294297238 AW55.6657 ESTs, Weakly similar to NY-REN-45 antigen H. sapiens O.293288SO2 AA276OO3 Prlr-rS1 prolactin receptor related sequence 1 O.286620436 AUO23S28 Mits musculus tescalcin mRNA, complete cols O.280S 11647 US 8,298,756 B2 93 94 SUPPLEMENTAL TABLE 4-continued

AccNo Gene Description NF ratio

AIS28713 Mus musculus predicted GTP binding protein (IRG-47) mRNA, complete cols O.277481051 AWS44018 Sc23a2 solute carrier family 23, (nucleobase transporters) member 2 O.274O741SS AAO98166 Pgf Placental growth factor O.265680649 AWSS1388 Mus musculus E2F-like transcriptional repressor protein mRNA, complete cols O.258,361.27 AU045552 Lrp low density lipoprotein receptor related protein O.249.126285 C78643 ESTs, Moderately similar to H-REV 107 PROTEIN R. norvegicus O.2466,08761 AI32.3599 H-2 CLASS II HISTOCOMPATIBILITY ANTIGEN, I-A BETA CHAIN PRECURSOR O.245441986 AW549905 Hba-al hemoglobin alpha, adult chain 1 O.2438OOO73 AA413508 Serk1 SAPK, Erkkinase 1 O.242356002 AA120574 Sod1 Superoxide dismutase 1, Soluble 0.235.267761 AIS285.47 C2 Complement component 2 (within H-2S) O.229074.483 AWS48291 Hbb-b2 hemoglobin, beta adult minor chain 0.227852807 AW552978 ESTs, Highly similar to ALPHA-ACTININ, SMOOTH MUSCLE ISOFORM O.2131936.15 Gaius gallus AWS4S280 TS translin O.21028048 AA260985 ESTs, Weakly similar to ANX7 MOUSE ANNEXIN VII (M. musculus O.204873897 W89883 Col3a1 Procollagen, type III, alpha 1 O.196376754 C78503 Ask-pending activator of S phase kinase 93218524 AUO22963 Selp selectin, platelet 92.932242 C866O7 Mat8 mammary tumor 8 kDa 90339.745 AA434863 ESTs, Moderately similar to no similarities to reported gene products H. sapiens 895O3955 AI46448O ESTs, Moderately similar to KIAA1014 protein H. sapiens 88621 63 AA272807 H2-Aa Histocompatibility 2, class II antigen Aalpha 67760814 AA413764 ESTs, Weakly similar to P24 RAT COP-COATED VESICLE MEMBRANE PROTEIN 43346174 P24 PRECURSORR. norvegicus AI4S1475 ESTs, Highly similar to nucleolar protein Nopp140, hepatic R. norvegicus O. 2142S101 AWSS3502 Coa2 procollagen, type I, alpha 2 O.121045883

SUPPLEMENTARY TABLE 5

Details of the number of genes up or down regulated in functional group and a comparison of their relative abundance compared to the spots printed on the microarrays.

Apop- Suppressors Development Cyto- Signal Nucleic Functional Cell tosis and and Protein skeletan Membrane Trans- acid Groups Cycle Tumor Oncogenes Differentiation Metabolism Metabolism and ECM Associated duction chemistry Others Printed on 263 252 77 440 1102 698 468 15O1 846 1134 1893 microarrays % of Sum of 3.0 2.9 O.9 5.1 12.7 8.0 5.4 17.3 9.8 13.1 21.8 annotated Regulated in the hyper invasive cells Total 14 46 10 70 205 163 93 252 98 145 270 upregulated 11 39 8 59 172 137 78 211 82 121 225 down 3 7 2 11 33 26 15 41 16 24 45 regulated % of Sum of 32 373 i:7 10.6 regulated Difference between printed and regulated Decrease Increase US 8,298,756 B2 95 SUPPLEMENTARY TABLE 5-continued Details of the number of genes up or down regulated in functional group and a comparison of their relative abundance compared to the spots printed on the microarrays.

3B: Details of the functional category called "Cell Cycle" Gene description Fold ion of cell prolif

Enhancement of cell proliferation CGMC Carcinoembryonicantigen CGM6 precursor CPR2 Ce:cycle progression:2 protein (CFR2) Ask activator of Sphase kinase

SEQUENCE LISTING

< 16 Os NUMBER OF SEO ID NOS: 40 SEQ ID NO 1 LENGTH: 2O TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Forward primer for Apoptosis Inhibitor 4

SEQUENCE: 1 acct tcaaga actggc cctt 2O

SEQ ID NO 2 LENGTH: 2O TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Reverse primer for Apoptosis Inhibitor 4

SEQUENCE: 2 aaaacactgg gccaaatcag 2O

SEQ ID NO 3 LENGTH: 2O TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Forward primer for Breast Cancer Associated Protein 2

SEQUENCE: 3 ttggacaa.cc cccaattaaa 2O

SEQ ID NO 4 LENGTH: 2O TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Reverse primer for Breast Cancer Associated Protein 2 US 8,298,756 B2 97 98 - Continued

< 4 OOs SEQUENCE: 4 Ctggagtgct ttittgaaggc 2O

SEO ID NO 5 LENGTH: 2O TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Forward primer for Defender Against Death 1 SEQUENCE: 5 ttgctggatg cct atctoct 2O

SEQ ID NO 6 LENGTH: 2O TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Reverse primer for Defender Against Death 1 SEQUENCE: 6 gcaaaccgct aagatgaagc 2O

SEO ID NO 7 LENGTH: 2O TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Forward primer for Heat Shock Protein 60 SEQUENCE: 7 acacaaatga agaggctggg 2O

SEQ ID NO 8 LENGTH: 2O TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Reverse primer for Heat Shock Protein 60 SEQUENCE: 8 actggattag ccc ctittgct 2O

SEO ID NO 9 LENGTH: 2O TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Forward primer for Integrin Beta 1 SEQUENCE: 9 Cagtgaacag caagggtgaa 2O

SEQ ID NO 10 LENGTH: 2O TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Reverse primer for Integrin Beta 1 SEQUENCE: 1.O taagaacaat tcc.ggcaacc 2O

SEQ ID NO 11 LENGTH: 2O US 8,298,756 B2 99 100 - Continued

&212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Forward primer for Macrophage Migration Inhibitory Factor 1

<4 OOs, SEQUENCE: 11 ttcatcgtga acaccalatgt 2O

<210s, SEQ ID NO 12 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Reverse primer for Macrophage Migration Inhibitory Factor 1

<4 OOs, SEQUENCE: 12 aaaagt catg agctggtc.cg 2O

<210s, SEQ ID NO 13 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Forward primer for Ornithine Decarboxylase 1

<4 OOs, SEQUENCE: 13 catccalaagg caaagttggit 2O

<210s, SEQ ID NO 14 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Reverse primer for Ornithine Decarboxylase 1

<4 OOs, SEQUENCE: 14 agcctgctgg tttitcagtgt 2O

<210s, SEQ ID NO 15 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Forward primer for Beta-actin <4 OOs, SEQUENCE: 15 gatctggcac cacaccittct 2O

<210s, SEQ ID NO 16 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Reverse primer for Beta-actin <4 OOs, SEQUENCE: 16 ggggtgttga aggtotcaaa 2O

<210s, SEQ ID NO 17 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Forward primer for GAPDH

<4 OOs, SEQUENCE: 17 US 8,298,756 B2 101 102 - Continued gaagggctica taccacagt

<210s, SEQ ID NO 18 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Reverse primer for GAPDH <4 OOs, SEQUENCE: 18 ggatgcaggg atgatgttct

<210s, SEQ ID NO 19 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Foward primer for ZBP1 <4 OOs, SEQUENCE: 19 t caagattgc ticcaccagaa

<210s, SEQ ID NO 2 O &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Reverse primer for ZBP1 <4 OOs, SEQUENCE: 2O citt.ccctgag ccttgaactg

<210s, SEQ ID NO 21 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Forward primer for Arp2/3, p.21 <4 OOs, SEQUENCE: 21 ttcaaggcca acgt.cttctt

<210s, SEQ ID NO 22 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Reverse primer for Arp2/3, p.21 <4 OOs, SEQUENCE: 22 tctggagttg cacttittgga

<210s, SEQ ID NO 23 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Forward primer Actin gamma <4 OOs, SEQUENCE: 23 actgggacga catggagaag

<210s, SEQ ID NO 24 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial US 8,298,756 B2 103 104 - Continued

22 Os. FEATURE: <223> OTHER INFORMATION: Reverse primer Actin gamma <4 OOs, SEQUENCE: 24 tgttagctitt ggggttcagg

<210s, SEQ ID NO 25 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Forward primer for LIMK 1 <4 OOs, SEQUENCE: 25 t cat Caagag catggacagc

<210s, SEQ ID NO 26 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Reverse primer for LIMK 1 <4 OOs, SEQUENCE: 26 gaggtotcgg tatgatgt

<210s, SEQ ID NO 27 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Forward primer for Actn3 <4 OOs, SEQUENCE: 27 gCaggagcag aac atcatca

<210s, SEQ ID NO 28 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Reverse primer for Actn3

<4 OOs, SEQUENCE: 28 Catgctgtag accgtgtgct

<210s, SEQ ID NO 29 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Forward primer for CFL1

<4 OOs, SEQUENCE: 29 gtcaagatgc tigc.ca.gacala

<210s, SEQ ID NO 3 O &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Reverse primer for CFL1

<4 OOs, SEQUENCE: 30 ggcc.ca.gaaa atgaatacca US 8,298,756 B2 105 106 - Continued

<210s, SEQ ID NO 31 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Forward primer for TMOD <4 OOs, SEQUENCE: 31 cgagggittaa aggggaaaag

<210s, SEQ ID NO 32 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Reverse primer for TMOD <4 OOs, SEQUENCE: 32 gacaggcatc gttct c ccta

<210s, SEQ ID NO 33 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Forward primer for MNS1 <4 OOs, SEQUENCE: 33 ctg.ccgat ct ct catcct ct

<210s, SEQ ID NO 34 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Reverse primer for MNS1 <4 OOs, SEQUENCE: 34 gagg acaa.gc cactctgaca

<210s, SEQ ID NO 35 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Forward primer for Cap 1 <4 OOs, SEQUENCE: 35 gaaag.ccacc agtttcaacc

<210s, SEQ ID NO 36 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Reverse primer for Cap 1 <4 OOs, SEQUENCE: 36 cittgagcact c caaccacct

<210s, SEQ ID NO 37 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Forward primer for Rock 1 US 8,298,756 B2 107 108 - Continued

<4 OO > SEQUENCE: 37 ttcaa.gc.cga Ctalacggt at g 21

SEQ ID NO 38 LENGTH: 2O TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Reverse primer for Rock 1

< 4 OOs SEQUENCE: 38 gct Caggaa ttctggalaga

SEO ID NO 39 LENGTH: 2O TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Forward primer for Arp2/3, p16

<4 OOs, SEQUENCE: 39 gctaggctic ctgaagaaga

SEQ ID NO 4 O LENGTH: 2O TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Reverse primer for Arp2/3, p16

<4 OOs, SEQUENCE: 4 O tatt cqtcca cqtccaccitt

What is claimed is: cells indicates that the profiled tumor cells are metastatic 1. A method of determining whether a cancer in a tissue of tumor cells and that the cancer is likely to metastasize. a mammal is likely to metastasize, the method comprising 2. The method of claim 1, wherein the tissue is mammary obtaining a microneedle or capillary filled with a porous 40 tissue. matrix comprising a chemotactic factor; 3. The method of claim 1, wherein the porous matrix com inserting the microneedle or capillary into the tissue for a prises matrigel. time sufficient for motile cells to migrate into the porous 4. The method of claim 1, wherein the microneedle or matrix; capillary is a microneedle. expelling the porous matrix with motile cells from the 45 5. The method of claim 1, wherein the binding partner is an microneedle or capillary; antibody. combining the porous matrix with microbeads, where the 6. The method of claim 1, wherein the chemotactic factoris microbeads comprise a binding partner to a Surface an epidermal growth factor. marker present on macrophages from the tissue; 50 7. The method of claim 1, wherein the binding partner is an removing the microbeads and bound macrophages; and antibody is specific for CD11b. obtaining a gene expression profile of motile tumor cells 8. The method of claim 1, wherein the gene expression remaining after removal of the microbeads, profile is determined using mRNA expression. wherein the gene that is profiled includes one or more of 9. The method of claim 1, wherein the gene expression collagen type III C.1, G-protein coupled receptor 26, Zip 55 profile is determined using protein expression. code binding protein 1, fibroblast growth factor receptor 10. The method of claim 1, wherein the genes that are 1, Arp2/3 p16 Subunit, tight junction protein 2, member profiled include all of collagen type III C1, G-protein coupled Ras oncogene family, and epidermal growth factor receptor 26, Zip code binding protein 1, fibroblast growth receptor, and factor receptor 1, Arp2/3 p16 subunit, tightjunction protein2, wherein downregulation of expression of one or more of 60 member Ras oncogene family, and epidermal growth factor collagen type III C.1, G-protein coupled receptor 26, Zip receptor. code binding protein 1, or fibroblast growth factor recep 11. A method of identifying metastatic tumor cells from a tor 1 compared to expression in non-metastatic tumor tumor, the method comprising: cells, and/or upregulation of expression of one or more isolating motile tumor cells from the tumor; of Arp2/3 p 16 subunit, tight junction protein 2, member 65 obtaining a gene expression profile of the motile tumor Ras oncogene family or epidermal growth factor recep cells, wherein the genes that are profiled include all of tor compared to expression in non-metastatic tumor collagen type III C.1, G-protein coupled receptor 26, Zip US 8,298,756 B2 109 110 code binding protein 1, fibroblast growth factor receptor one or more of Arp2/3 p16 subunit, tightjunction protein 1, Arp2/3 p16 Subunit, tight junction protein 2, member 2, member Ras oncogene family or epidermal growth Ras oncogene family, and epidermal growth factor factor receptor compared to expression in non-meta receptor, and static tumor cells indicates that the profiled tumor cells comparing the expression of collagen type III C1, G-pro- 5 are metastatic tumor cells, thereby identifying said pro tein coupled receptor 26, Zip code binding protein 1, filed tumor cells as metastatic tumor cells. fibroblast growth factor receptor 1, Arp2/3 p16 subunit, 12. The method of claim 11, wherein the metastatic tumor tight junction protein 2, member Ras oncogene family cells are breast tumor cells. and epidermal growth factor receptor in the profiled 13. The method of claim 11, wherein the gene expression tumor cells to their expression in non-metastatic tumor 10 profile is determined using mRNA expression. cells, wherein downregulation of expression of one or 14. The method of claim 11, wherein the gene expression more of collagen type III C.1, G-protein coupled receptor profile is determined using protein expression. 26, Zip code binding protein 1, or fibroblast growth factor receptor 1 compared to expression in non-meta static tumor cells, and/or upregulation of expression of k . . . . UNITED STATES PATENT AND TRADEMARK OFFICE CERTIFICATE OF CORRECTION PATENT NO. : 8,298,756 B2 Page 1 of 1 APPLICATIONNO. : 1 1/659514 DATED : October 30, 2012 INVENTOR(S) : Condeelis et al. It is certified that error appears in the above-identified patent and that said Letters Patent is hereby corrected as shown below:

On the Title Page:

The first or Sole Notice should read --

Subject to any disclaimer, the term of this patent is extended or adjusted under 35 U.S.C. 154(b) by 476 days.

Signed and Sealed this Twenty-sixth Day of August, 2014 74-4-04- 2% 4 Michelle K. Lee Deputy Director of the United States Patent and Trademark Office