Proc. Natl. Acad. Sci. USA Vol. 93, pp. 6129-6134, June 1996 Medical Sciences Deregulation of PAX-5 by translocation of the E,t enhancer of the IgH locus adjacent to two alternative PAX-5 promoters in a diffuse large-cell lymphoma MEINRAD BUSSLINGER*, NORMAN KLIXt, PETER PFEFFER, PAULA G. GRANINGER, AND ZBYNEK KOZMIK Research Institute of Molecular Pathology, Dr. Bohr-Gasse 7, A-1030 Vienna, Austria Communicated by Max L. Birnstiel, Research Institute of Molecular Pathology, Vienna, Austria, February 22, 1996 (received for review January 26, 1996) ABSTRACT Analyses ofthe human PAX-5 locus and ofthe (KIS-1) that was established from a patient with diffuse 5' region of the mouse Pax-5 gene revealed that transcription large-cell lymphoma (5). Molecular cloning of the KIS-1 from two distinct promoters results in splicing of two alter- translocation breakpoint demonstrated that the IgH locus on native 5' exons to the common coding sequences ofexons 2-10. 14q32 was translocated next to 9pl3 sequences of unknown Transcription from the upstream promoter initiates down- function (5). stream of a TATA box and occurs predominantly in B- We have previously mapped the human PAX-5 gene to lymphocytes, whereas the TATA-less downstream promoter is chromosome 9p13 (6). PAX-5 codes for the transcription factor active in all Pax-5-expressing tissues. The human PAX-5 gene BSAP that is expressed at all stages of B cell development is located on chromosome 9 in region p13, which is involved except in terminally differentiated plasma cells and that is in t(9;14)(p13;q32) translocations recurring in small lympho- known to regulate the CD19 gene as well as the Is promoter cytic lymphomas of the plasmacytoid subtype and in derived and 3'a enhancer of the IgH locus (for review, see ref. 7). In large-cell lymphomas. A previous molecular analysis of a addition to all B-lymphoid tissues, the Pax-5 gene is also t(9;14) breakpoint from a diffuse large-cell lymphoma (KIS-1) expressed in the embryonic midbrain and adult testis of the demonstrated that the immunoglobulin heavy-chain (IgH) mouse (8). Consistent with this expression pattern, gene locus on 14q32 wasjuxtaposed to chromosome 9pl3 sequences inactivation in the mouse germ line demonstrated that Pax-5 of unknown function [Ohno, H., Furukawa, T., Fukuhara, S., plays an essential role in B-lymphopoiesis and midbrain de- Zong, S. Q., Kamesaki, H., Shows, T. B., Le Beau, M. M., velopment (9). McKeithan, T. W., Kawakami, T. & Honjo, T. (1990) Proc. Here we report the cloning and characterization of the Natl. Acad. Sci. USA 87, 628-632]. Here we show that the KIS-1 entire human PAX-5 locus and of the 5' region of the mouse translocation breakpoint is located 1807 base pairs upstream Pax-5 gene, indicating that both genes are transcribed from two of exon 1A ofPAX-5, thus bringing the potent E,i enhancer of distinct promoters that are differentially regulated during the IgH gene into close proximity of the PAX-5 promoters. development. Southern blot analysis and direct sequence These data suggest that deregulation ofPAX-5 gene transcrip- comparison mapped the KIS-1 translocation breakpoint 1807 tion by the t(9;14)(p13;q32) translocation contributes to the base pairs upstream of exon 1A of PAX-5. As a consequence, pathogenesis of small lymphocytic lymphomas with plasma- the IgH and PAX-5 genes are arranged in a head-to-head cytoid differentiation. configuration, resulting in the juxtaposition of the potent E,L enhancer next to thePAX-5 promoters. These data suggest that Hematologic malignancies are often associated with specific deregulation of PAX-5 transcription through enhancer inser- chromosomal translocations that result in the oncogenic con- tion by the t(9;14)(p13;q32) translocation contributes to the version of regulatory genes controlling differentiation, prolif- pathogenesis of small lymphocytic lymphoma with plasmacy- eration, or cell survival. In B cell neoplasms, chromosomal toid differentiation. translocations frequently involve the immunoglobulin heavy- chain (IgH) gene locus on chromosome 14q32. Molecular MATERIALS AND METHODS studies of these abnormalities have led to the isolation of novel oncogenes located at the translocation breakpoint and pro- Oligonucleotides. The following oligonucleotides were used vided insight into their role in lymphomagenesis. Prominent in this study: 1, 5'-GATCATGTCCTGTTCTCGCCAACAT- examples are the c-myc gene (8q24) implicated in Burkitt CACAAGATGT-3'; 2, 5'-CGGCTGCAGAGGTGTTTTCT- lymphoma, the bcl-1 gene (11q13) involved in mantle cell GATCT-3'; 3, 5'-TTGAGGCACTGCAGCA(T)17-3'; 4, 5'- lymphoma, the bcl-2 gene (18q21) activated in follicular lym- TTGAGGCACTGCAGCA-3'; 5, 5'-TCCTTTGGCGGACT- phoma, and the bcl-6 gene (3q27) implicated in diffuse large- ACATCTGG-3'; 6, 5'-GCGGGATCCTGTCCTGATGGTC- cell lymphoma (for reviews, see refs. 1 and 2). 3'; 7, 5'-AGCAAGTTCAGCCTGGTTAAGTCC-3'; 8, 5'- A new recurring translocation, t(9;14)(p13;q32), has cyto- GCCAAGCTTCCCCAAGCTGATTCACTCCTCC-3' genetically been identified in 52% of non-Hodgkin lympho- Subcloning and DNA Sequencing of PAX-5 Cosmid, Yeast mas (3). This characteristic translocation is highly correlated Artificial Chromosome (YAC), and P1 Clones. The isolation of with small lymphocytic lymphomas of the plasmacytoid sub- mouse and human PAX-5 cosmids has been described (6, 9). A type (3) that are referred to as lymphoplasmacytoid immuno- 2.2-kb EcoRI, a 7.2-kb SacI, and a 3-kb HindIII fragment were cytomas in the Kiel classification (4). This B cell neoplasm is subcloned from cos-mPax5-14 into pSP64 or pBluescript initially of low grade, but may slowly progress toward trans- (Stratagene) to generate p5.14-E2.2, p5.14-S7.2, and p5.14- formation into a more aggressive large-cell lymphoma (3). The same t(9;14) translocation has been identified in a cell line Abbreviation: YAC, yeast artificial chromosome. Data deposition: The sequences reported in this paper have been deposited in the GenBank data base (accession nos. U56835-U56838). The publication costs of this article were defrayed in part by page charge *To whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" in tPresent address: Medical Research Council Laboratory of Molecular accordance with 18 U.S.C. §1734 solely to indicate this fact. Biology, Hills Road, Cambridge CB2 2QH, England. 6129 Downloaded by guest on September 27, 2021 6130 Medical Sciences: Busslinger et al. Proc. Natl. Acad. Sci. USA 93 (1996) H3.0. The probes p5.1-E3.0 and p5.3-E3.6 were obtained by probes pSP6-ExlA and pSP6-ExlA/2 were generated by clon- subcloning a 3-kb EcoRI fragment from cos-hPAX5-1 and a ing a 1038-bp TaqI fragment from p5.14-E2.2 and a 261-bp 3.6-kb EcoRI fragment from cos-hPAX5-3, respectively. A TaqI-BamHI fragment from mBSAP-1 cDNA (8) into theAccI 8.7-kb BamHI, a 1.8-kb PstI, and a 2.3-kb NheI fragment were site of pSP64, respectively. A 220-bp cDNA fragment was subcloned from the YAC 37G-D10 into pSP64 to generate amplified by reverse transcription-PCR with primers 2 and 8 pD10-B8.7, pD10-P1.8, and pD10-N2.3, respectively. All sub- from RNA of mouse embryos at day 12.5 and cloned into cloned DNA fragments were sequenced on an automated pSP64 to generate the probe pSP6-ExlB/2. sequencer (Applied Biosystems) by primer walking. 5' End Determination of PAX-5 Transcripts. A 274-bp Determination of the Exon-Intron Structure of the PAX-5 Sau3AI-SmaI fragment isolated from clone pD10-B8.7 was 5' Gene. The junctional sequences of exons 2-6 and 9-10 were end-labeled at the Sau3AI site in exon 1A and used for S1 directly determined on cos-hPAX5-1, -2 and -3 with exon- nuclease analysis as described (14). For primer extension assay, specific primers. Exon 7 was subcloned as a 4.5-kb EcoRI the 5' end-labeled oligonucleotide 1 was hybridized with 5 tug fragment from YAC 16D9 and exon 8 as a 3.4-kb PstI fragment of poly(A)+ RNA from BJA-B and RPMI 8226 cells followed from P1 clone 355 before DNA sequencing. by reverse transcription as described (15). Isolation and Characterization of PAX-5 YAC and P1 Clones. A human YAC library, cloned in pYAC4 (10) and RESULTS obtained from the Human Genome Mapping Project Resource Centre (Harrow, U.K.), was screened with the labeled EcoRI Cloning and Characterization of the Human PAX-5 Locus. inserts of p5.1-E3.0 and p5.3-E3.6, resulting in the isolation of Eight different cosmids containing PAX-5 coding sequences YAC 37G-D10. A second YAC, 16D9, cloned in pJS97 and were previously isolated (6), and individual exons were as- pJS98 and isolated from a flow-sorted chromosome 9 library signed to these clones by direct DNA sequencing. The map of (11), was kindly provided to us by M. K. McCormick (Mas- three representative cosmids that cover 100 kb of the PAX-5 sachusetts General Hospital, Harvard Medical School, Bos- gene is shown in Fig. 1. To clone the missing 5' region as well ton). A human P1 library, generated in pADlOsacBII (12) and as exons 7 and 8, we next screened human YAC and P1 libraries distributed by the Imperial Cancer Research Fund Reference (10, 16) with two unique DNA probes originating from the 5' Library Database (London), was screened with the same DNA and 3' regions of the PAX-5 locus (p5.1-E3.0 and p5.3-E3.6). probes, resulting in the identification of clone ICRFP700H0355 The YAC clone 37G-D10 and P1 clone 355 were identified in (abbreviated as P1 355). The sizes of 37G-D10, 16D9, and P1 355 this manner, whereas a second 9pl3-specific YAC, 16D9, was were estimated by pulsed field gel electrophoresis to be -250, isolated from a flow-sorted chromosome 9 library (11). Exons -220, and "100 kb, respectively. The presence of individual were assigned to these clones by hybridization and PCR assays, PAX-5 exons on these clones was determined either by PCR demonstrating that clone 37G-D10 contains the 5' end, clone analysis or Southern blot hybridization with exon-specific oligo- 16D9 the entire structural gene and clone 355 the 3' region of nucleotides. PAX-5. Sequence analysis of all exon-intron junctions (Fig. 1) Rapid Amplification of cDNA Ends Analysis. Rapid ampli- demonstrated that intron positions have been strictly con- fication of cDNA ends was performed as described (13). served between PAX-5 and the two other members, PAX-2 (6) Mouse Pax-5 exon 1A sequences were isolated by priming the and PAX-8 (17), of this PAX subfamily. reverse transcription of poly(A)+ RNA (5 jug) from 70Z/3 Identification of Two Alternative Promoters of the PAX-5 cells with oligonucleotide 5. Following tailing and second- Gene. Cloning of the PAX-5 promoter region was facilitated by strand synthesis with primer 3, the Pax-5 sequences were the availability ofpartial sequence information for exon 1 from amplified by PCR with oligonucleotides 4 and 6 and cloned cloned BSAP cDNA (8). However, RNase protection analysis into the BamHI and PstI sites of pBluescript. Mouse Pax-5 with a 5' cDNA probe suggested the existence of a second, exon 1B sequences were amplified by PCR with primers 5 and alternatively transcribed exon 1 (see below). Both exon 1 7 from phage DNA of a 11.5-day mouse embryo cDNA library sequences were first isolated by rapid amplification of cDNA (Clontech) before cloning into pBluescript. ends (see Materials and Methods) and then used for subcloning RNA Preparation and RNase Protection Assay. Total RNA of the corresponding exon and intervening intron sequences of was prepared, poly(A)+ RNA was isolated, and RNase pro- PAX-5 from cos-mPax5-14 (9) and YAC 37G-D10, respectively tection assays were performed as described (8). The ribo- (Fig. 2A). DNA sequence analysis indicated that exons 1A and

PD PD PD OP HDH TA TA IDSTOP

2 3 4 5 6 7 8 9 10 I cos-hPAX5-1 - ---- cos-hPAX5-3 ------I p5.1-E3.0 I- cos-hPAX5-2 -I I-- p5.3-E3.6 --- 4- YAC 37G-D10 -- i P1 355 - >

4--AYAC 16D9 -

.C--a _. i... ( --) .E- .- a :T'.--a _iAA . (1-_26 ) .Ex .. ((3; 3 . 'SACA'c aa. ._ .SA- _. -_).Ex-(L 3 ) .GC_Gtaac.

- -- auS iC . (S3 r) , . :- - L z . _0(S) (-(_ L 'R)i . r " aAT)CA ' .ECx. (I21.iAiA2saaa.).) rr _ a, \< >Q Tts -t .caaagA ( -23).2 _.. c ASa

FIG. 1. Structure of the PAX-5 gene. The extent ofPAX-5 sequences that were isolated on different YAC, P1, and cosmid clones is shown below a map of the exon-intron structure of PAX-5. Exon and intron sequences are shown in uppercase and lowercase letters, respectively. The invariant GT and AG dinucleotides at the 5' and 3' splice junctions are underlined. The amino acids encoded by the first and last codon of each exon are indicated together with their positions in the BSAP sequences (8). PD, paired domain; OP, conserved octapeptide; HDH, homeodomain homology region; TA, transactivation domain; ID, inhibitory domain; 3' UR, 3' untranslated region. Downloaded by guest on September 27, 2021 Medical Sciences: Busslinger et al. Proc. Natl. Acad. Sci. USA 93 (1996) 6131

A o ------30- - - --L------human0PAX---PBPo-

i------YAC 16D9 YAC 37G-D10 |i ~~pD10-B8.7 H- pD10-N2.3- pD10-P1.8 --

PD ES,,- mouse Pax-5 l ES E H S, H -m- cos-mPax5-14 410. i-- p5.14-E2.2 ---- p5.14-H3.0 -

|I --- ~ ~p5.14-S7.2 -

MDLM E K NY PT PR T S R T exon 1A hPAX-5 AAGTCCTGAAAAATCAAAATGGATTTAGAGAAAAATTATCCGACTCCTCGGACCAGCAGGACAGgtagg mPax-5 T- G C T ME I H C K H D P F A SM H exon 1B hPAX-5 CCTGCAGTCTGGAGCGCCCCGATGGAAATACACTGTAAGCACGACCCGTTTGCATCCATGCATAgtaag mPax-5 -A FIG. 2. Transcription of PAX-5 from two distinct promoters. (A) 5' Region of the human and mouse PAX-5 genes. The relative positions of exons 1A and 1B were determined by DNA sequencing of the indicated subclones, and the distance between the mouse exons 1B and 2 was estimated by PCR analysis to be 5.3 kb. The endpoint of YAC 16D9 was mapped by cloning and sequencing of the end fragments. Only the restriction enzyme sites relevant for subcloning are indicated. B, BamHI; E, EcoRI; H,HindIII; N, NheI P, PstI; S, SacI. (B) Sequence ofthe 3' part of the two alternative exons 1. Only those nucleotides of the mouse Pax-5 gene that differ from the human PAX-5 sequence are shown together with the deduced amino acid sequence. Intron sequences are shown by lowercase letters, and the invariant GT dinucleotide of the 5' splice site is underlined. Note that the Pax-5B transcript codes for an arginine (instead of a glycine) at the first amino acid position of the paired domain (exon 2) due to the presence of an adenosine residue at the 3' end of exon 1B instead of the guanosine residue in exon 1A. 1B are separated by 6.7 and 7.1 kb in mouse and human, a conserved TATA sequence, as determined by S1 nuclease respectively. Moreover, the 5' end of YAC 16D9 was mapped and primer extension analyses (Fig. 3). The sequences of exon within the first intron of PAX-5 (Fig. 2A). 1B contain only one start codon with an optimal sequence Exon 1A of the PAX-5 gene codes for the N-terminal 15 context for translation initiation (18). Translation from this amino acid residues of the previously characterized BSAP site results in a N-terminal sequence of 14 amino acids that protein (ref. 8; Fig. 2B). Transcription of this exon (PAX-SA differs entirely from that encoded by exon 1A (Fig. 2B). RNase mRNA) initiates at a single site 21 nucleotides downstream of protection and primer extension analyses indicated that the Pax-SB transcripts are heterogeneously initiated in agreement A RT S1 with the absence of any TATA-like sequence in the vicinity of co Ic exon 1B (data not shown). In conclusion, the PAX-5 gene is ;aG G A T C 3a: transcribed from two distinct promoters, resulting in alterna- tive splicing of different 5' end exons to the common coding sequences of exons 2-10. Differential Regulation of the Two Pax-5 Promoters. The 5' activity of the two Pax-5 promoters was next studied during -5 mouse ontogeny by RNase protection assay with exon 1-spe- * cific riboprobes (Fig. 4B). The probe ExlA detected correctly initiated Pax-SA mRNA in B-lymphoid tissues and cell lines representing the pro-B (HAFTL-1), pre-B (PD31), or mature B (WEHI-231) cell stages, but not in terminally differentiated plasma cells (SP2/0 and MPC-11 cells) and in adult testis (Fig. B TATA 4A). However, trace amounts ofPax-SA mRNAwere observed hPAX-5 CCCCAA. CCCCTATAAAAGTCTGGGGCGGCGCGGCAGC in midgestation embryos. The riboprobe ExlB/2 consisting of mPax-5 C CAA - -C-AG- 3' sequences of exon 1B fused to the 5' part of exon 2 was fully protected only by correctly spliced Pax-SB mRNA, but not by AGCACTGCTGCTCTCCCGGCTTCCCGCTCTACTCCGGCCGGGCCGG primary transcripts initiated at the upstream Pax-5 promoter G--T TG--C-TT-A-AC-T A--T- (Fig. 4B). Pax-SB transcripts were detected in embryos, adult and B cell that the downstream FIG. 3. Start site of the PAX-SA transcript. (A) 5' End mapping. testis, spleen, lines, indicating Poly(A)+ RNA (-55Lg) from the human B cell line BJA-B and the promoter is active in all Pax-5 expression domains (Fig. 4A). plasma cell line RPMI 8226 were used to determine the 5' terminus The relative abundance of the two Pax-5 transcripts was (5') of the PAX-5A mRNA by S1 nuclease and reverse transcription determined with riboprobe ExlA/2, indicating that the ratio of (RT) analyses. As the 5' ends of the cDNA products and the S1 DNA Pax-SA to Pax-SB transcripts varied from 6:1 in spleen to 1:1 probe were the same (Sau3AI site in exon 1A), all DNA fragments in WEHI-231 cells (Fig. 4A). A faint Pax-5A signal was also were electrophoresed together with the four sequencing reactions observed with embryonic RNA, thus confirming weak activity obtained with template pD10-B8.7 and the phosphorylated primer of the Pax-5 in the central used for reverse An artifact. The upstream promoter developing transcription. *, S1 digestion (B) nervous In the is human and mouse DNA sequences flanking the transcriptional initi- system. summary, upstream promoter pre- ation site (arrow) of exon 1A are shown together with the conserved dominantly active in B-lymphocytes, whereas the downstream TATA box. A gap of one nucleotide is indicated by a dot. promoter is used in all Pax-5 expression domains. Downloaded by guest on September 27, 2021 6132 Medical Sciences: Busslinger et al. Proc. Natl. Acad. Sci. USA 93 (1996)

0 O3 A co A v- e a0 ^^E3. iilii Hii o ,E12.5 c- e h t h t r L I C' c') ExlA 558 9.4 ExlB/2 - 200

-261 66 Exl A2 ! ..... B pKIS _ _ -211 /11''' B S BS E G BSH BSSE B -- -t- : -i------I·: :--- pBS8.6BB 3APDH '-97Y ; i ::: t : ·t pD10-B8.7 t w----* PAX-5 B 1A 1B breakpoint Ex1A --5 1A ? :I <------558 -- PAX-5A CACC CAAACir TA- vr._C v _AAATAD.TT -AA. (H) (B) [ e st~ WWWt~::~Rl:______pDl10-B8 7 ExlB/2 1lB , [e[e[e[~e[ .--- 200 >-i PAX-5B i[e[ I---YM:CIO~O~Y~Y:!DY pBS8.6BB T B t(9:14) ExIA/2 IA --- 211 :. PAX-5B IgH -1807 PAX-5 9p13 '^------261 - >- PAX-5A 14q32 FIG. 4. Differential regulation of the two Pax-5 promoters. (A) FIG. 5. The breakpoint of the KIS-1 translocation maps 1.8 kb RNase protection analysis. Total RNA was prepared from the embryo upstream of PAX-5 exon 1A. (A) Southern blot analysis. BamHI- proper (e) at day 11.5 postcoitum, from head (h) and trunk (t) of digested DNA of HeLa cells, the YAC clones 37G-D10 and 16D9, as embryos at day 12.5 and 13.5, from brain, testis, and spleen of adult well as the plasmid pD10-B8.7 were analyzed with the radiolabeled mice, and from HAFTL-lscl (pro-B), PD31 (pre-B), WEHI-231 (B) 1.6-kb BstEII-SacI DNA fragment (pKIS probe) of clone p8.5-1 (5). cells as well as from the plasma cell lines SP2/0 and MPC-11. Each The sizes (in kb) of two marker fragments are indicated. (B) Com- RNA (20 /Lg) was analyzed with the riboprobes shown to the left. Only parison of the restriction maps of pD10-B8.7 and pBS8.6BB (5). The the relevant part of the autoradiograph containing the RNase- position of the pKIS probe is indicated. The published DNA sequences protected fragment of the indicated size (given in nucleotides to the of clone pBS8.6BB and of the KIS-1 translocation breakpoint (5) are right) is shown. The ratio of Pax-5A to Pax-SB transcripts varied from shown and correspond to the lower strand of the PAX-5 sequence of 6:1 in spleen to 1:1 in WEHI-231 cells, as quantitated on a Phosphor- pD10-B8.7. Identical nucleotides are highlighted by black overlay. The Imager. (B) Schematic diagram of the different riboprobes. The number -1807 refers to the nucleotide position of the breakpoint lengths of the riboprobe sequences that are protected by the different relative to the transcription start site of PAX-5 exon 1A, and arrows Pax-5 mRNAs are indicated in nucleotides. B, BamHI; H, HindIII; T, denote the direction of transcription of the IgH and PAX-5 genes. B, TaqI. BamHI; BS, BstEII; G, BglII; E, EcoRI; H, HindIII; S, SacI. Translocation of the IgH Enhancer Next to the PAX-5 Exon DISCUSSION 1A in KIS-1 Cells. A t(9;14)(p13;q32) chromosomal translo- The Pax-5 gene coding for the transcription factor BSAP plays cation was previously identified in the KIS-1 cell line that was an essential role in early B-lymphopoiesis and midbrain de- established from a patient with diffuse large-cell lymphoma velopment (9). With the view of studying the transcriptional (5). Molecular cloning of the KIS-1 translocation breakpoint regulation of this gene, we have isolated the PAX-5 locus and demonstrated that the IgH locus on 14q32 was juxtaposed to in particular characterized its 5' region. The PAX-5 gene is chromosome 9p13 sequences of unknown function. These shown to contain two separate promoters and thus codes for sequences detected a 11-kb transcript in B-lymphoid cell BSAP proteins with distinct N termini due to alternative lines (5). We have previously estimated a size of -10 kb for the splicing of different 5' end exons to common coding sequences. PAX-5 mRNA (8) and localized the PAX-5 gene to chromo- The upstream promoter is predominantly used in B- some 9p13 (6), which suggested to us a possible involvement of lymphocytes, whereas the downstream promoter is active in all PAX-5 in the t(9;14) translocation. As shown in Fig. 5A, a Pax-5 expression domains. probe (pKIS) derived from 9p13 sequences flanking the trans- Analysis of the PAX-5 5' region also resulted in the identi- location breakpoint (5) indeed detected an identical BamHI fication ofPAX-5 as the so far elusive partner gene involved in fragment in HeLa cell, YAC 37G-D10, and pD10-B8.7 DNA, the chromosomal translocation of a diffuse large-cell lym- whereas this fragment was absent in YAC 16D9. Hence, the phoma (KIS-1). While we have localized PAX-5 to human KIS-1 translocation breakpoint must be located in the PAX-5 chromosome 9pl3 (6), Ohno et al. (5) characterized the 5' region between the BamHI site upstream of exon 1A and the breakpoint of a t(9;14)(p13;q32) translocation from the KIS-1 5' end of YAC 16D9 (Fig. 2A). Moreover, the published cell line. The breakpoint of this translocation was mapped on restriction map of clone pBS8.6BB containing the transloca- chromosome 14q32 immediately downstream of the JH6 join- tion breakpoint (5) was congruent with that of our subclone ing gene segment of the IgH locus (Fig. 6). The translocated pD10-B8.7 (Fig. SB). Direct comparison of the sequence at the immunoglobulin sequences had furthermore completed class t(9;14) junction (5) with clone pD10-B8.7 mapped the trans- switch recombination to the Ca2 gene, suggesting that the location breakpoint to position -1807 upstream of the trans- KIS-1 lymphoma cell line originated from an activated B- criptional start site of exon 1A. Therefore, the t(9;14) trans- lymphocyte undergoing plasma cell differentiation. We have location brought the potent Ep, enhancer (19) of the IgH locus now localized the KIS-1 translocation breakpoint on chrom- into close proximity of the two PAX-5 promoters (Fig. 6). some 9p13 to the 5' flanking region of PAX-5 at position Hence, these data suggest that the KIS-1 translocation dereg- -1807 upstream of exon 1A. The PAX-5 and IgH genes are ulates PAX-5 transcription by enhancer insertion. therefore arranged in a head-to-head configuration by this Downloaded by guest on September 27, 2021 Medical Sciences: Busslinger et al. Proc. Natl. Acad. Sci. USA 93 (1996) 6133

breakpoint X +t ^ PAX-5 chr. 9 -1 807

+1 Cc2 Sc Si E _ der(1 4) ... 0 0 2. , 6 -2670 -2460

chu SLDL Eu , JH 1kb chr. 14-- IgH 6 543 21 FIG. 6. Juxtaposition of the EA, enhancer of the IgH locus next to the PAX-5 promoters in the KIS-1 lymphoma. Schematic diagram of the 5' region of the PAX-5 gene, the JH-to-C/L region of the IgH locus and the corresponding sequences present on the derivative chromosome 14 of KIS-1 cells (5). The core region of the intronic E/L enhancer (19) is shown together with its nucleotide positions relative to the PAX-5 transcription start site on derivative chromosome 14. The diagram is drawn with the centromere to the left and the telomere to the right. translocation event which juxtaposes the intronic Etl enhancer A recent survey of karyotypically abnormal non-Hodgkin next to the upstream promoter of PAX-5 (Fig. 6). In addition, lymphomas identified the t(9;14)(pl3;q32) translocation in 9 the putative 3'a enhancer of the human IgH locus that, by out of 408 patients analyzed (3). Seven cases were small analogy to the corresponding rodent genes (20), must be lymphocytic lymphomas with plasmacytoid differentiation. In located downstream of the Ca2 gene is also brought into three of these patients, the t(9;14) translocation was the only proximity of the PAX-5 promoters due to deletion of most karyotypic abnormality. Two patients carried only the der(14) immunoglobulin constant genes from the der(14) chromosome chromosome, whereas both reciprocal translocation partners by class switching. Moreover, Ohno et al. (5) detected with the were detected in other cases. Together these observations 9p13-specific pKIS probe a -11-kb transcript in KIS-1 and suggest that the der(14) chromosome containing the deregu- other B-lymphoid cells that agrees well with our size estimate lated PAX-5 gene, but not the reciprocal translocation event, of 10 kb for the PAX-5 mRNA (8). The identity of the 11-kb correlates with the genesis of small lymphocytic lymphomas of transcript as PAX-5 mRNA was further confirmed by the the plasmacytoid subtype. The cells of this B cell tumor show observation that the pKIS probe comprises the entire exon 1A morphological signs of plasma cell differentiation, usually of PAX-5 (Fig. 5B). express immunoglobulins at the surface as well as in the Does the KIS-1 translocation result in deregulated expres- cytoplasm, transcribe the BSAP target gene CD19 and are sion of the PAX-5 gene? First, it is important to note that this thought to arise by neoplastic transformation of peripheral translocation leaves the coding sequences of PAX-5 intact and B-lymphocytes that have been stimulated to differentiate to may thus affect only the transcriptional regulation of this gene. plasma cells (3). This type of small lymphocytic lymphoma is By cell transfection experiments and analyses in transgenic initially an indolent disease that displays a tendency to trans- mice, we have recently located important B-lymphoid and form with time into a more aggressive large-cell lymphoma (3). neuronal control elements within the 5' flanking region of the In summary, our data combined with the study of Offit et al. PAX-5 gene upstream of the KIS-1 translocation breakpoint (3) strongly implicate deregulation of the PAX-5 gene by the (S. Vambrie, P.P., and M.B, unpublished data). Hence, the t(9;14)(pl3;q32) translocation as a critical step in the genesis of PAX-5 gene is dissociated from its own upstream regulatory small lymphocytic lymphomas with plasmacytoid differentiation. sequences and is brought under the control of the potent An oncogenic role has been proposed for PAX genes enhancers of the IgH locus by the t(9;14) translocation. In primarily based on the consistent involvement of PAX-3 and agreement with this finding, a moderate increase (-3-fold) in PAX-7 in the genesis of alveolar rhabdomyosarcoma (25, 26). PAX-5 transcript levels was observed in the KIS-1 cell line In this pediatric muscle tumor, a specific translocation between compared with other B-lymphoid cells (5). Increased PAX-5 one of the two PAX loci and the fork head domain gene FKHR expression could per se result in deregulation of BSAP func- creates a novel fusion gene that codes for a potent chimeric tion, as the activity of transcription factors of the Pax protein transcription factor (27). To date, deregulated expression of family often show a narrow concentration dependence which PAX-5 has been implicated in the formation of medulloblas- is also reflected by the haploinsufficient nature of most PAX toma (28) and in progression of malignant astrocytoma (29), gene mutations (for review, see ref. 21). Apart from such a although no molecular mechanism for oncogenic activation of quantitative effect, the insertion of the E,L enhancer by the PAX-5 has yet emerged in either case. In contrast, the t(9;14) KIS-1 translocation is more likely to force the PAX-5 gene to translocation of the KIS-1 large-cell lymphoma provides a be active at a time in B cell differentiation when the endog- molecular explanation for oncogenic conversion of PAX-5 by enous PAX-5 gene is usually switched off. Indeed, the PAX-5 disruption of its normal transcriptional control mechanism. gene is normally repressed in stimulated B-lymphocytes during their transition to terminally differentiated plasma cells (22), We are grateful to T. Honjo, M. K. McCormick, P. Urbanek, and S. which is Nutt for providing DNA probes and clones, to A. Weith for advice on also reflected by the absence of PAX-5 expression in YAC cloning, to G. Schaffner for oligonucleotide synthesis, to R. myeloma cell lines (8). On the other hand, the E,L enhancer is Kurzbauer and I. Botto for DNA sequencing, and to A. Weith, U. known to be highly active in immunoglobulin-secreting plasma Jager, and S. Nutt for critical reading of the manuscript. This work was cells (23). Moreover, PAX-5 has been implicated in the pro- in part supported by a grant from the Austrian Industrial Research liferation control of mature B-lymphocytes, as antisense oli- Promotion Fund. gonucleotide inhibition of BSAP synthesis prevented mitotic stimulation of these cells (24). We therefore hypothesize that 1. Korsmeyer, S. J. (1992) Annu. Rev. Immunol. 10, 785-807. the t(9;14)(p13;q32) translocation interferes with normal 2. Dalla-Favera, R., Ye, B. H., Lo Coco, F., Chang, C.-C., Cechova, cell differentiation due to of PAX-5 K., Zhang, J., Migliazza, A., Mellado, W., Niu, H., Chaganti, S., plasma deregulation expres- Chen, W., Rao, P. H., Parsa, N. Z., Louie, D. C., Offit, K. & sion by the ELt enhancer that may prevent cells from exiting the Chaganti, R. S. K. (1994) Cold Spring Harbor Symp. Quant. Biol. cell cycle. In support of this hypothesis, the KIS-1 cells have 59, 117-123. undergone class switching of the IgH locus (5), which is one of the 3. Offit, K., Parsa, N. Z., Filippa, D., Jhanwar, S. C. & Chaganti, processes accompanying terminal B cell differentiation. R. S. K. (1992) Blood 80, 2594-2599. Downloaded by guest on September 27, 2021 6134 Medical Sciences: Busslinger et al. Proc. Natl. Acad. Sci. USA 93 (1996) 4. Lennert, K. (1978) Malignant Lymphomas Other than Hodgkin's 16. Pierce, J. C., Sauer, B. & Sternberg, N. (1992) Proc. Natl. Acad. Disease (Springer, New York). Sci. USA 89, 2056-2060. 5. Ohno, H., Furukawa, T., Fukuhara, S., Zong, S. Q., Kamesaki, 17. Kozmik, Z., Kurzbauer, R., Dorfler, P. & Busslinger, M. (1993) H., Shows, T. B., Le Beau, M. M., McKeithan, T. W., Kawakami, Mol. Cell. Biol. 13, 6024-6035. T. & Honjo, T. (1990) Proc. Natl. Acad. Sci. USA 87, 628-632. 18. Kozak, M. (1991) J. Biol. Chem. 266, 19867-19870. 6. Stapleton, P., Weith, A., Urbanek, P., Kozmik, Z. & Busslinger, 19. Rabbitts, T. H., Forster, A., Baer, R. & Hamlyn, P. H. (1983) M. (1993) Nat. Genet. 3, 292-298. Nature (London) 306, 806-809. 7. Busslinger, M. & Urbanek, P. (1995) Curr. Opin. Genet. Dev. 5, 20. Pettersson, S., Cook, G. P., Brfiggemann, M., Williams, G. T. & 595-601. Neuberger, M. S. (1990) Nature (London) 344, 165-168. 8. Adams, B., Dorfler, P., Aguzzi, A., Kozmik, Z., Urbanek, P., 21. Stuart, E. T., Kioussi, C. & Gruss, P. (1994)Annu. Rev. Genet. 28, Maurer-Fogy, I. & Busslinger, M. (1992) Genes Dev. 6, 1589- 219-236. 1607. 22. Stiiber, E., Neurath, M., Calderhead, D., Fell, H. P. & Strober, 9. E. F. & W. (1995) Immunity 2, 1-15. Urbanek, P., Wang, Z.-Q., Fetka, I., Wagner, Busslinger, 23. Banerji, J., Olson, J. & Schaffner, W. (1983) Cell 33, 729-740. M. (1994) Cell 79, 901-912. 24. Wakatsuki, Y. W., Neurath, M. F., Max, E. E. & Strober, W. 10. Burke, D. T., Carle, G. F. & Olson, M. V. (1987) Science 236, (1994) J. Exp. Med. 179, 1099-1108. 806-811. 25. Galili, N., Davis, R. J., Fredericks, W. J., Mukhopadhyay, S., 11. McCormick, M. K., Buckler, A., Bruno, W., Campbell, E., Shera, Rauscher III, F. J., Emanuel, B. S., Rovera, G. & Barr, F. G. K., Torey, D., Deaven, L. & Moyzis, R. (1993) Genomics 18, (1993) Nat. Genet. 5, 230-235. 553-558. 26. Davis, R. J., D'Cruz, C. M., Lovell, M. A., Biegel, J. A. & Barr, 12. Pierce, J. C., Sauer, B. & Sternberg, N. (1992) Proc. Natl. Acad. F. G. (1994) Cancer Res. 54, 2869-2872. Sci. USA 89, 2056-2060. 27. Fredericks, W.J., Galili, N., Mukhopadhyay, S., Rovera, G., 13. Kozmik, Z., Wang, S., Dorfler, P., Adams, B. & Busslinger, M. Bonnicelli, J., Barr, F. G. & Rauscher III, F. J. (1995) Mol. Cell. (1992) Mol. Cell. Biol. 12, 2662-2672. Biol. 15, 1522-1535. 14. Busslinger, M., Moschonas, N. & Flavell, R. A. (1981) Cell 27, 28. Kozmik, Z., Sure, U., Riiedi, D., Busslinger, M. & Aguzzi, A. 289-298. (1995) Proc. Natl. Acad. Sci. USA 92, 5709-5713. 15. Bergers, G., Graninger, P., Braselmann, S., Wrighton, C. & 29. Stuart, E. T., Kioussi, C., Aguzzi, A. & Gruss, P. (1995) Clin. Busslinger, M. (1995) Mol. Cell. Biol. 15, 3748-3758. Cancer Res. 1, 207-214. Downloaded by guest on September 27, 2021