Studie Über Das Leukämogene Potential Der Hoxb4-Deltaprolin
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Genetic Variability in the Italian Heavy Draught Horse from Pedigree Data and Genomic Information
Supplementary material for manuscript: Genetic variability in the Italian Heavy Draught Horse from pedigree data and genomic information. Enrico Mancin†, Michela Ablondi†, Roberto Mantovani*, Giuseppe Pigozzi, Alberto Sabbioni and Cristina Sartori ** Correspondence: [email protected] † These two Authors equally contributed to the work Supplementary Figure S1. Mares and foal of Italian Heavy Draught Horse (IHDH; courtesy of Cinzia Stoppa) Supplementary Figure S2. Number of Equivalent Generations (EqGen; above) and pedigree completeness (PC; below) over years in Italian Heavy Draught Horse population. Supplementary Table S1. Descriptive statistics of homozygosity (observed: Ho_obs; expected: Ho_exp; total: Ho_tot) in 267 genotyped individuals of Italian Heavy Draught Horse based on the number of homozygous genotypes. Parameter Mean SD Min Max Ho_obs 35,630.3 500.7 34,291 38,013 Ho_exp 35,707.8 64.0 35,010 35,740 Ho_tot 50,674.5 93.8 49,638 50,714 1 Definitions of the methods for inbreeding are in the text. Supplementary Figure S3. Values of BIC obtained by analyzing values of K from 1 to 10, corresponding on the same amount of clusters defining the proportion of ancestry in the 267 genotyped individuals. Supplementary Table S2. Estimation of genomic effective population size (Ne) traced back to 18 generations ago (Gen. ago). The linkage disequilibrium estimation, adjusted for sampling bias was also included (LD_r2), as well as the relative standard deviation (SD(LD_r2)). Gen. ago Ne LD_r2 SD(LD_r2) 1 100 0.009 0.014 2 108 0.011 0.018 3 118 0.015 0.024 4 126 0.017 0.028 5 134 0.019 0.031 6 143 0.021 0.034 7 156 0.023 0.038 9 173 0.026 0.041 11 189 0.029 0.046 14 213 0.032 0.052 18 241 0.036 0.058 Supplementary Table S3. -
Differential Regulation of Parahox Genes by Retinoic Acid in the Invertebrate Chordate Amphioxus (Branchiostoma floridae)
Developmental Biology 327 (2009) 252–262 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/developmentalbiology Evolution of Developmental Control Mechanisms Differential regulation of ParaHox genes by retinoic acid in the invertebrate chordate amphioxus (Branchiostoma floridae) Peter W. Osborne a,1, Gérard Benoit b, Vincent Laudet b, Michael Schubert b,2, David E.K. Ferrier a,⁎,1,2 a Zoology Department, Oxford University, South Parks Road, Oxford, OX1 3PS, UK b Institut de Génomique Fonctionnelle de Lyon, Université de Lyon, CNRS, INRA, Université Claude Bernard Lyon 1, Ecole Normale Supérieure de Lyon, 46 allée d'Italie, 69364 Lyon Cedex 07, France article info abstract Article history: The ParaHox cluster is the evolutionary sister to the Hox cluster. Like the Hox cluster, the ParaHox cluster Received for publication 2 October 2008 displays spatial and temporal regulation of the component genes along the anterior/posterior axis in a Revised 19 November 2008 manner that correlates with the gene positions within the cluster (a feature called collinearity). The ParaHox Accepted 19 November 2008 cluster is however a simpler system to study because it is composed of only three genes. We provide a Available online 7 December 2008 detailed analysis of the amphioxus ParaHox cluster and, for the first time in a single species, examine the regulation of the cluster in response to a single developmental signalling molecule, retinoic acid (RA). Keywords: Amphioxus Embryos treated with either RA or RA antagonist display altered ParaHox gene expression: AmphiGsx Retinoic acid expression shifts in the neural tube, and the endodermal boundary between AmphiXlox and AmphiCdx shifts Gsx its anterior/posterior position. -
Modeling Renal Cell Carcinoma in Mice: Bap1 and Pbrm1 Inactivation Drive Tumor Grade
Published OnlineFirst May 4, 2017; DOI: 10.1158/2159-8290.CD-17-0292 RESEARCH ARTICLE Modeling Renal Cell Carcinoma in Mice: Bap1 and Pbrm1 Inactivation Drive Tumor Grade Yi-Feng Gu1,2, Shannon Cohn1,2, Alana Christie2, Tiffani McKenzie2,3, Nicholas Wolff1,2, Quyen N. Do4, Ananth J. Madhuranthakam4, Ivan Pedrosa2,4, Tao Wang2,5, Anwesha Dey6, Meinrad Busslinger7, Xian-Jin Xie2,8, Robert E. Hammer9, Renée M. McKay1,2, Payal Kapur2,3, and James Brugarolas1,2 Downloaded from cancerdiscovery.aacrjournals.org on September 26, 2021. © 2017 American Association for Cancer Research. 17-CD-17-0292_p900-917.indd 900 7/20/17 10:05 AM Published OnlineFirst May 4, 2017; DOI: 10.1158/2159-8290.CD-17-0292 ABSTRACT Clear cell renal cell carcinoma (ccRCC) is characterized by BAP1 and PBRM1 muta- tions, which are associated with tumors of different grade and prognosis. However, whether BAP1 and PBRM1 loss causes ccRCC and determines tumor grade is unclear. We conditionally targeted Bap1 and Pbrm1 (with Vhl ) in the mouse using several Cre drivers. Sglt2 and Villin proximal convoluted tubule drivers failed to cause tumorigenesis, challenging the conventional notion of ccRCC origins. In contrast, targeting with PAX8, a transcription factor frequently overexpressed in ccRCC, led to ccRCC of different grades. Bap1 -defi cient tumors were of high grade and showed greater mTORC1 activation than Pbrm1 -defi cient tumors, which exhibited longer latency. Disrupting one allele of the mTORC1 negative regulator, Tsc1 , in Pbrm1 -defi cient kidneys triggered higher grade ccRCC. This study establishes Bap1 and Pbrm1 as lineage-specifi c drivers of ccRCC and histologic grade, implicates mTORC1 as a tumor grade rheostat, and suggests that ccRCCs arise from Bowman capsule cells. -
Homeobox Gene Expression Profile in Human Hematopoietic Multipotent
Leukemia (2003) 17, 1157–1163 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu Homeobox gene expression profile in human hematopoietic multipotent stem cells and T-cell progenitors: implications for human T-cell development T Taghon1, K Thys1, M De Smedt1, F Weerkamp2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium; and 2Department of Immunology, Erasmus Medical Center, Rotterdam, The Netherlands Class I homeobox (HOX) genes comprise a large family of implicated in this transformation proces.14 The HOX-C locus transcription factors that have been implicated in normal and has been primarily implicated in lymphomas.15 malignant hematopoiesis. However, data on their expression or function during T-cell development is limited. Using degener- Hematopoietic cells are derived from stem cells that reside in ated RT-PCR and Affymetrix microarray analysis, we analyzed fetal liver (FL) in the embryo and in the adult bone marrow the expression pattern of this gene family in human multipotent (ABM), which have the unique ability to self-renew and thereby stem cells from fetal liver (FL) and adult bone marrow (ABM), provide a life-long supply of blood cells. T lymphocytes are a and in T-cell progenitors from child thymus. We show that FL specific type of hematopoietic cells that play a major role in the and ABM stem cells are similar in terms of HOX gene immune system. They develop through a well-defined order of expression, but significant differences were observed between differentiation steps in the thymus.16 Several transcription these two cell types and child thymocytes. -
Divergent Genes in Gerbils: Prevalence, Relation to GC-Biased Substitution, and Phenotypic Relevance Yichen Dai, Rodrigo Pracana and Peter W
Dai et al. BMC Evolutionary Biology (2020) 20:134 https://doi.org/10.1186/s12862-020-01696-3 RESEARCH ARTICLE Open Access Divergent genes in gerbils: prevalence, relation to GC-biased substitution, and phenotypic relevance Yichen Dai, Rodrigo Pracana and Peter W. H. Holland* Abstract Background: Two gerbil species, sand rat (Psammomys obesus) and Mongolian jird (Meriones unguiculatus), can become obese and show signs of metabolic dysregulation when maintained on standard laboratory diets. The genetic basis of this phenotype is unknown. Recently, genome sequencing has uncovered very unusual regions of high guanine and cytosine (GC) content scattered across the sand rat genome, most likely generated by extreme and localized biased gene conversion. A key pancreatic transcription factor PDX1 is encoded by a gene in the most extreme GC-rich region, is remarkably divergent and exhibits altered biochemical properties. Here, we ask if gerbils have proteins in addition to PDX1 that are aberrantly divergent in amino acid sequence, whether they have also become divergent due to GC-biased nucleotide changes, and whether these proteins could plausibly be connected to metabolic dysfunction exhibited by gerbils. Results: We analyzed ~ 10,000 proteins with 1-to-1 orthologues in human and rodents and identified 50 proteins that accumulated unusually high levels of amino acid change in the sand rat and 41 in Mongolian jird. We show that more than half of the aberrantly divergent proteins are associated with GC biased nucleotide change and many are in previously defined high GC regions. We highlight four aberrantly divergent gerbil proteins, PDX1, INSR, MEDAG and SPP1, that may plausibly be associated with dietary metabolism. -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
Homeobox A10 Promotes the Proliferation and Invasion of Bladder Cancer Cells Via Regulation of Matrix Metalloproteinase‑3
ONCOLOGY LETTERS 18: 49-56, 2019 Homeobox A10 promotes the proliferation and invasion of bladder cancer cells via regulation of matrix metalloproteinase‑3 CHUNLEI LIU1*, MINGZHU GE2*, JUN MA1*, YANHUI ZHANG1, YANHUI ZHAO1 and TAO CUI1 Departments of 1Urology and 2Ultrasound, Qingdao Central Hospital, Qingdao, Shandong 266042, P.R. China Received February 9, 2018; Accepted January 31, 2019 DOI: 10.3892/ol.2019.10312 Abstract. Homeobox A10 (HOXA10) belongs to the family Smoking and obesity are risk factors for BC (2), and genetic of HOX genes, which are closely connected with embryonic mutations and abnormal protein expression serve important development and serve important roles in various tumors. roles in the genesis, development and progression of BC (4). However, the role of HOXA10 in bladder cancer (BC) remains Therefore, exploring new anomalous molecules involved in unclear. In the present study, the role of HOXA10 in BC and the development of BC may advance the understanding of the underlying mechanisms by which it promotes the disease the mechanisms behind this disease and contribute to the progression were investigated. Immunohistochemical analysis improvement of treatment strategies. demonstrated that the expression of the HOXA10 protein Homeobox A10 (HOXA10) belongs to the family of HOX was significantly higher in BC tissues as compared with that genes, which are classified into four subgroups, namely HOX in adjacent normal tissues. Subsequent statistical analysis A-D (5), and are closely connected with embryonic develop- revealed that upregulation of HOXA10 was significantly ment (6). HOXA10 encodes a DNA-binding transcription factor associated with the pathological grade and clinical stage of that serves vital roles in regulating gene expression, viability BC patients. -
Noelia Díaz Blanco
Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
NF-Ya Activates Multiple Hematopoietic Stem Cell (HSC) Regulatory Genes and Promotes HSC Self-Renewal
NF-Ya activates multiple hematopoietic stem cell (HSC) regulatory genes and promotes HSC self-renewal Jiang Zhu, Yi Zhang, Gerard J. Joe, Richard Pompetti, and Stephen G. Emerson* Departments of Medicine and Pediatrics, and Abramson Cancer Center, University of Pennsylvania School of Medicine, Philadelphia, PA 19104 Communicated by Zhu Chen, Shanghai Second Medical University, Shanghai, People’s Republic of China, April 25, 2005 (received for review December 15, 2004) Hematopoietic stem cell (HSC) self-renewal and differentiation are chased from The Jackson Laboratory and maintained in the animal influenced through multiple pathways, including homeobox tran- facilities of the University of Pennsylvania with sterile water or with scription factors, signaling through -catenin and Notch-1, telom- the water supplemented with neomycin sulfate and polymyxin B erase, and p27. How these multiple pathways interact and are (Sigma) within 3–4 weeks after BMT. orchestrated is currently unknown. We now report that NF-Ya, the regulatory and DNA-binding subunit of the trimeric transcription NF-Ya cDNA, MigR1 Retroviral Vector, and Preparation of Retrovi- factor NF-Y, plays a central, integrating role in several of these HSC ruses. cDNA for NF-Ya was amplified from human normal bone pathways. NF-Ya is preferentially expressed in HSC-enriched bone marrow (BM) cell RNA by using Pfu DNA polymerase (Strat- marrow subpopulations, and NF-Ya mRNA rapidly declines with agene) (7). MigR1 retroviral vector was obtained from Warren HSC differentiation. Overexpression of NF-Ya in primitive hema- Pear (Department of Pathology and Laboratory Medicine, Uni- topoietic cells activates the transcription of multiple HOX4 paral- versity of Pennsylvania). -
Kaderschmiede
2 |12 Kaderschmiede FWF START/Wittgenstein 2012: Exzellenz9 » TRP: Wider besseres Wissen » Frau in der Wissenschaft: Verena Jantsch- Plunger » Interview: Helmut Denk » Persönliche Paradigmen: Gerhard Herndl INHALT 20 TRP: WIDer BESSERES WISSEN 30 FraU IN Der WISSENSCHAFT: VERENA JANTSCH- PLUNGER KaDER- SCHMIEDE 6 FWF 12 STAWI 2012: EXZELLENZ9 KONTEXT EDITORIAL 27 ERC-Broschüre: Excellent Prospects 4 PROJEKTVORSTELLUNGEN 28–29 Statement of Principles for Scientific 5 BRIEF DES PRÄSIDENTEN Merit Review 35 THEMA INTERVIEW: 6–11 Kaderschmiede FWF PANOPTIKUM HELMUT DENK 30–34 Frau in der Wissenschaft FOKUS Verena Jantsch-Plunger 12–15 STAWI 2012: Exzellenz9 35–39 Interview 16–18 Kursbestätigung Helmut Denk 19 Das letzte NFN 40–41 International ausgezeichnet 20–21 Wider besseres Wissen Meinrad Busslinger 22–23 FWF-Infoveranstaltungen: 42–45 Persönliche Paradigmen Auf ein Neues! Friedrich Stadler im Gespräch 24 FWF-E-Book-Library mit Gerhard Herndl 25 Aufwertung der studentischen Mitarbeit 46–47 Unterwegs 26 The Journal of Universal Rejection Around the World EDITORIAL 42 PERSÖNLICHE PARADIGMEN: GERHARD HERNDL TRP: WIDer BESSERES WISSEN ms mas stb Der Forschungs-Kader » Bei der Verwendung des Wortes „Kader“ muss man als Autor vorsichtig sein. Zu ambivalent ist der Begriff besetzt, das Spek- trum reicht von negativ besetzten militärischen oder politischen Zusammenhängen bis hin zu positiv assoziierten Bereichen wie Sport sowie „positiv besetzten“ Eliten. Die Spitzenforschung mit ihren hoch qua- lifizierten Wissenschafterinnen und Wissenschaftern ist so eine Elite. Eine Kaderschmiede zu sein, ist also in ausgewählten Bereichen eine Auszeich- nung. So versteht es auch der FWF, wenn er im Zusammenhang mit seiner „Qualitätsselektion“ im Bereich wissenschaftlicher Projekte und ihrer da- hinter stehenden Personen als Kaderschmiede für Spitzenforschung be- 46 zeichnet wird. -
Lampreys, the Jawless Vertebrates, Contain Only Two Parahox Gene Clusters
Lampreys, the jawless vertebrates, contain only two ParaHox gene clusters Huixian Zhanga,b,1, Vydianathan Ravia,1, Boon-Hui Taya, Sumanty Toharia, Nisha E. Pillaia, Aravind Prasada, Qiang Linb, Sydney Brennera,2, and Byrappa Venkatesha,c,2 aInstitute of Molecular and Cell Biology, Agency for Science, Technology and Research, Biopolis, Singapore 138673, Singapore; bChinese Academy of Sciences (CAS) Key Laboratory of Tropical Marine Bioresources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences, Guangzhou 510301, China; and cDepartment of Paediatrics, Yong Loo Lin School of Medicine, National University of Singapore, Singapore 119228, Singapore Contributed by Sydney Brenner, July 6, 2017 (sent for review March 20, 2017; reviewed by José Luis Gómez-Skarmeta and Nipam H. Patel) ParaHox genes (Gsx, Pdx,andCdx) are an ancient family of develop- elephant shark, Callorhinchus milii; as well as the lobe-finned fish, mental genes closely related to the Hox genes. They play critical roles in coelacanth (Latimeria chalumnae), and spotted gar (Lepisosteus the patterning of brain and gut. The basal chordate, amphioxus, con- oculatus), a basal ray-finned fish (Actinopterygian), possess an ad- tains a single ParaHox cluster comprising one member of each family, ditional Pdx gene (called Pdx2)linkedtoGsx2 (Fig. 1) (8–10). In- whereas nonteleost jawed vertebrates contain four ParaHox genomic terestingly, teleosts that have experienced an additional round of loci with six or seven ParaHox genes. Teleosts, which have experienced genome duplication (3R) possess only six ParaHox genes distrib- an additional whole-genome duplication, contain six ParaHox genomic uted in six genomic loci (11, 12) (Fig. 1). As a consequence of the loci with six ParaHox genes.