DOCSLIB.ORG

Regulation of the Heterochromatin Protein 1 by Phosphorylation of Histone H3 and the HP1 Hinge Domain Holger Dormann

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Regulation of the Heterochromatin Protein 1 by Phosphorylation of Histone H3 and the HP1 Hinge Domain Holger Dormann Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2009 Regulation of the Heterochromatin Protein 1 by Phosphorylation of Histone H3 and the HP1 Hinge Domain Holger Dormann Follow this and additional works at: http://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons Recommended Citation Dormann, Holger, "Regulation of the Heterochromatin Protein 1 by Phosphorylation of Histone H3 and the HP1 Hinge Domain" (2009). Student Theses and Dissertations. Paper 109. This Thesis is brought to you for free and open access by Digital Commons @ RU. It has been accepted for inclusion in Student Theses and Dissertations by an authorized administrator of Digital Commons @ RU. For more information, please contact [email protected]. REGULATION OF HETEROCHROMATIN PROTEIN 1 BY PHOSPHORYLATION OF HISTONE H3 AND THE HP1 HINGE DOMAIN A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Holger Dormann June 2009 © Copyright by Holger Dormann 2009 REGULatION OF HETEROCHROMATIN PROTEIN 1 BY PHOSPHORYLatION OF HISTONE H3 AND THE HP1 HINGE DOMAIN Holger Dormann, Ph. D. The Rockefeller University 2009 Chromatin, a polymer formed from DNA, histones, and associated proteins, is the physiological form of genetic information in all eukaryotic cells. Posttranslational modification of histones, such as acetylation, methylation, and phosphorylation, regulates various DNA-dependent processes, ranging from transcription to replication, DNA repair, and apoptosis. A key mechanism by which histone modifications exert these effects is by recruitment of specific binding partners (effector proteins), that in turn direct downstream functions. Insight into the underlying mechanisms are of great importance for a full understanding of chromatin structure and function. One of these effector proteins, Heterochromatin Protein 1 (HP1), plays important roles in heterochromatin formation. It is recruited to chromatin by interaction with methylated lysine 9 of histone H3 (H3K9me). However, it has remained enigmatic how HP1 reversibly dissociates from chromatin during mitosis, while the histone mark that recruits the protein, H3K9me, persists. In the first part of my thesis, my collaborators and I show through a combination of in vitro and in vivo experiments that this release depends on a novel mechanism, “methyl-phos switching”, in which two nearby histone marks collaborate to accomplish the dynamic regulation of effector protein binding. Phosphorylation of histone H3 at serine 10, immediately adjacent to HP1’s binding site at H3K9me, at the onset of mitosis interferes with HP1 binding to H3K9me, resulting in the release of the effector protein. In the second part of my thesis, I investigate to what extent posttranslational modification of HP1 itself is involved in the regulation of the effector protein. I identify ten novel phosphorylation sites for the three human HP1 isoforms (α, β, γ), most of which map to the HP1 “hinge region” and are specifically phosphorylated in mitosis. For one highly conserved site, HP1α serine 92 phosphorylation, I identify Aurora B as the responsible kinase in vivo. In vitro data suggest that mitotic phosphorylation of the HP1α hinge may play a role in the regulation of HP1 association with RNA. My thesis work indicates that HP1’s behavior and interactions in mitosis are regulated by posttranslational modifications on two levels: phosphorylation of histone H3 as well as phosphorylation of HP1 itself. ACKNOWLEDGMENTS First and foremost, I would like to thank my mentor, Dr. David Allis, for his support and guidance. His creativity and enthusiasm for science have been a source of inspiration throughout my thesis, with his constructive criticism, he encouraged me to think independently as a scientist, and when I felt discouraged, he cheered me up - I want to thank him for all that. I thank my faculty advisory committee, Dr. Günter Blobel, Dr. Hironori Funabiki, and Dr. Wolfgang Fischle, for their time, their interest in my work, and all their helpful suggestions. I also thank Dr. Ming-Ming Zhou for agreeing to serve on my thesis committee as my external member. I am grateful to Dr. Blobel also for the training and advice he gave me dur- ing my stay in his lab as an undergraduate and diploma student. This time has been extremely valuable for me, and I want to thank him for giving me the opportunity to work in his lab at a very early stage of my studies. I would like to thank Dr. Funabiki for serving as the chair of my commit- tee, for the fruitful collaboration on the "methyl-phos switching" project and for many helpful discussions also outside of my committee meetings. I owe Dr. Fischle thanks for many different things: He not only got me started in the Allis lab and trained me at the bench during the first years of my Ph.D., but he later on also served on my thesis committee, gave me the chance to work in his lab in Göttingen as a guest scientist and finally has made the long way from Germany for my defense. I want to thank him for all this, as well as for his friendship. I thank our collaborators Hillary Montgomery, Dr. Beatrix Ueberheide, Dr. Jeffrey Shabanowitz and Dr. Donald Hunt for their excellent mass spec- trometry work as well as the pleasant interaction during our collabora- tion. iii Boo Shan Tseng was our collaborator on the "methyl-phos switching" proj- ect and I thank her for all her work and contributions to this project. I also would like to acknowledge her for generously providing important reagents for some of my experiments. Dr. Gwen Lomberk and Dr. Raul Urrutia deserve many thanks for gener- ously sharing their antibody against phosphorylated HP1α with me. Dr. Alex Ruthenburg has helped me tremendously at various stages on my way to this thesis manuscript. From advice at the bench, comments on the manuscript, rendering of X-ray figures in Pymol ("mystic crystal revelations") to many late-night hours during the lay-out of this thesis, his help has been unwavering. I deeply appreciate this support and his friendship. I thank Aaron Goldberg, Dr. Monika Lachner, Dr. Tom Milne, and Dr. Greg Wang for critically reading parts of my thesis and for their helpful comments on my thesis talk. Amrita Basu helped me with computational analysis, and Nicolai Siegel with proof-reading and the final production process of this thesis. I would like to thank Dr. Emily Bernstein for help with RNA experiments, and her and Owen Wu for our ongoing collaboration on the RNA interac- tion of Heterochromatin Protein 1. I appreciate the collaboration with Dr. David Shechter and Dr. Sandra Hake for our joint publication on techniques of histone purification and analysis, and with Dr. Greg Wang on leukemogenic PHD finger fusions. I am very grateful to all past and present members of the Allis lab for their willingness to always share reagents and advice. There have been far too many occasions to list, so I can only acknowledge them collectively for all their help over the years. I also want to thank them for being excellent colleagues and for keeping up a good lab spirit. Many of them have become good friends, and I thank iv them for numerous late-night hours shared at the bench, entertaining lunches, and for teaching me English words that I can’t share here, be- cause otherwise this page would have to be censored. I thank the lab manager of the Allis lab, Jamie Winshell, for running the daily lab business and helping me out at countless little problems and de- sasters, and the laboratory administrator of the Allis lab, Chandra Egger, for help with many organizational things. The members of the Fischle lab in Göttingen were very generous in shar- ing their time, bench space, protocols and reagents with me, and I greatly appreciate their welcoming me during my stay in their lab. I thank Dr. Elias Coutavas and other members of the Blobel lab for advice, reagents, and the permission to use their cell disruptor. Upstate Biotechnology has helped me generously with reagents, and I want to thank the colleagues there for the many friendly interactions. I appreciate the friendly and professional assistance of the staff at the Rockefeller Bioimaging Resource Center, Proteomics Resource Center, Flow Cytometry Resource Center. I also thank the mass spectrometry fa- cility in Göttingen for their excellent work. I am indebted to the Dean’s office of the David Rockefeller Graduate Pro- gram for their help at countless occasions. Financial support was provided by the Boehringer Ingelheim Fonds and the David Rockefeller Graduate Program, and I want to thank them for it. I am grateful to my friends at Rockefeller and in New York for making my time in New York such a pleasant one. I thank my family, in particular my parents Elmar and Adelheid Dormann, for their support and constant encouragement. Lastly, I want to thank my wife Dorothee for her love and support and for being there for me at every step of the way. v TABLE OF CONTENTS ACKNOWLEDGMENTS.............................................................iii TABLE OF CONTENTS.............................................................vi LIST OF FIGURES....................................................................xii LIST OF TABLES......................................................................xvii ABBREVIATIONS..................................................................... xviii CHAPTER 1: GENERAL INTRODUCTION...............................
Load more

Recommended publications
  • Cross-Talk Between Histone H3 Tails Produces Cooperative Nucleosome Acetylation
    Cross-talk between histone H3 tails produces cooperative nucleosome acetylation Shanshan Li and Michael A. Shogren-Knaak1 Department of Biochemistry, Biophysics, and Molecular Biology, Iowa State University, Ames, IA 50011 Edited by Jerry L. Workman, Stowers Institute for Medical Research, Kansas City, MO, and accepted by the Editorial Board September 23, 2008 (received for review May 9, 2008) Acetylation of histone proteins by the yeast Spt-Ada-Gcn5-acetyl- nucleosomes, with an average distance between nucleosome cen- tansferase (SAGA) complex has served as a paradigm for under- ters of 212 bp (12). Although these nucleosomes are arrayed in a standing how posttranslational modifications of chromatin regu- linear fashion in genomic sequence, in many cases they adopt more late eukaryotic gene expression. Nonetheless, it has been unclear complex higher-order structures. Short-range interactions between to what extent the structural complexity of the chromatin sub- nucleosomes within a strand of chromatin allow chromatin to adopt strate modulates SAGA activity. By using chromatin model sys- a more compact 30-nm fiber structure (13, 14), and long-range tems, we have found that SAGA-mediated histone acetylation is interactions between distant nucleosomes provide a means for .(highly cooperative (cooperativity constant of 1.97 ؎ 0.15), employ- chromatin to potentially adopt 100- to 400-nm fiber structures (15 ing the binding of multiple noncontiguous nucleosomes to facili- Moreover, a number of recent studies suggest that different func- tate maximal acetylation activity. Studies with various chromatin tional forms of chromatin can adopt complex looping structures, substrates, including those containing novel asymmetric histone where regions of the genome that are separated by large distances octamers, indicate that this cooperativity occurs only when both in sequence can be brought together in space (16).
    [Show full text]
  • Histones H3 and H4 Are Components of Upstream Activation Factor Required for the High-Level Transcription of Yeast Rdna by RNA Polymerase I
    Proc. Natl. Acad. Sci. USA Vol. 94, pp. 13458–13462, December 1997 Biochemistry Histones H3 and H4 are components of upstream activation factor required for the high-level transcription of yeast rDNA by RNA polymerase I JOHN KEENER*, JONATHAN A. DODD*, DOMINIQUE LALO, AND MASAYASU NOMURA† Department of Biological Chemistry, University of California, Irvine, CA 92697-1700 Contributed by Masayasu Nomura, October 16, 1997 ABSTRACT RNA polymerase I (Pol I) transcription in consisting of Rrn6p, Rrn7p, and Rrn11p; refs. 3, 9, and 10), the yeast Saccharomyces cerevisiae is greatly stimulated in vivo Rrn3p (5), and Pol I are required. In addition to these factors, and in vitro by the multiprotein complex, upstream activation upstream activation factor (UAF) and TATA box-binding factor (UAF). UAF binds tightly to the upstream element of the protein, as well as the upstream element, are required for a rDNA promoter, such that once bound (in vitro), UAF does not high level of transcription from the yeast rDNA promoter (4, readily exchange onto a competing template. Of the polypep- 11). Purified UAF previously was shown to contain three tides previously identified in purified UAF, three are encoded genetically defined subunits, Rrn5p, Rrn9p, and Rrn10p, and by genes required for Pol I transcription in vivo: RRN5, RRN9, two uncharacterized subunits, p30 and p18 (4). and RRN10. Two others, p30 and p18, have remained unchar- DNA in the eukaryotic nucleus is organized as chromatin, acterized. We report here that the N-terminal amino acid consisting mostly of regularly repeating nucleosomes in which sequence, its mobility in gel electrophoresis, and the immu- DNA is wrapped around an octameric structure of core noreactivity of p18 shows that it is histone H3.
    [Show full text]
  • Structure–Function Studies of Histone H3/H4 Tetramer Maintenance During Transcription by Chaperone Spt2
    Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Structure–function studies of histone H3/H4 tetramer maintenance during transcription by chaperone Spt2 Shoudeng Chen,1,5 Anne Rufiange,2,5 Hongda Huang,1 Kanagalaghatta R. Rajashankar,3,4 Amine Nourani,2 and Dinshaw J. Patel1 1Structural Biology Program, Memorial Sloan-Kettering Cancer Center, New York, New York 10065, USA; 2Groupe St-Patrick de Recherche en Oncologie Fondamentale, L’Hôtel-Dieu de Québec (Université Laval), Québec G1R 2J6, Canada; 3Northeastern Collaborative Access Team (NE-CAT), Advanced Photon Source, Argonne National Laboratory, Chicago, Illinois 60439, USA; 4Department of Chemistry and Chemical Biology, Cornell University, Ithaca, New York 14853, USA Cells use specific mechanisms such as histone chaperones to abrogate the inherent barrier that the nucleosome poses to transcribing polymerases. The current model postulates that nucleosomes can be transiently disrupted to accommodate passage of RNA polymerases and that histones H3 and H4 possess their own chaperones dedicated to the recovery of nucleosomes. Here, we determined the crystal structure of the conserved C terminus of human Suppressors of Ty insertions 2 (hSpt2C) chaperone bound to an H3/H4 tetramer. The structural studies demonstrate that hSpt2C is bound to the periphery of the H3/H4 tetramer, mimicking the trajectory of nucleosomal-bound DNA. These structural studies have been complemented with in vitro binding and in vivo functional studies on mutants that disrupt key intermolecular contacts involving two acidic patches and hydrophobic residues on Spt2C. We show that contacts between both human and yeast Spt2C with the H3/H4 tetramer are required for the suppression of H3/ H4 exchange as measured by H3K56ac and new H3 deposition.
    [Show full text]
  • The Histone Variant H3.3 Marks Active Chromatin by Replication-Independent Nucleosome Assembly
    Molecular Cell, Vol. 9, 1191–1200, June, 2002, Copyright 2002 by Cell Press The Histone Variant H3.3 Marks Active Chromatin by Replication-Independent Nucleosome Assembly Kami Ahmad and Steven Henikoff1 ment are not clear. A study in Tetrahymena concluded Fred Hutchinson Cancer Research Center that no protein difference between histone H3 variants 1100 Fairview Avenue North was required for replacement histone deposition and Seattle, Washington 98109 that expression of either variant outside of S phase ap- peared to be sufficient (Yu and Gorovsky, 1997). In con- trast, by examining the dynamics of histone proteins in Summary Drosophila nuclei we show that the major histone H3 and the replacement histone H3.3 proteins have distinct Two very similar H3 histones—differing at only four properties during in vivo chromatin assembly. Histone amino acid positions—are produced in Drosophila H3.3 participates in replication-independent (RI) nucleo- cells. Here we describe a mechanism of chromatin some assembly and is targeted to transcriptionally ac- regulation whereby the variant H3.3 is deposited at tive loci throughout the cell cycle. Transcription-coupled particular loci, including active rDNA arrays. While the deposition of H3.3-containing nucleosomes may be a major H3 is incorporated strictly during DNA replica- general mechanism for rapidly replacing permanently tion, amino acid changes toward H3.3 allow replica- modified nucleosomes and for heritably activating tion-independent (RI) deposition. In contrast to repli- genes. cation-coupled (RC) deposition, RI deposition does not require the N-terminal tail. H3.3 is the exclusive Results substrate for RI deposition, and its counterpart is the only substrate retained in yeast.
    [Show full text]
  • Histone H3.3 and Its Proteolytically Processed Form Drive a Cellular Senescence Programme
    ARTICLE Received 21 Mar 2014 | Accepted 9 Sep 2014 | Published 14 Nov 2014 DOI: 10.1038/ncomms6210 Histone H3.3 and its proteolytically processed form drive a cellular senescence programme Luis F. Duarte1,2,3, Andrew R.J. Young4, Zichen Wang3,5, Hsan-Au Wu1,3, Taniya Panda1,2, Yan Kou3,5, Avnish Kapoor1,2,w, Dan Hasson1,2, Nicholas R. Mills1,2, Avi Ma’ayan5, Masashi Narita4 & Emily Bernstein1,2 The process of cellular senescence generates a repressive chromatin environment, however, the role of histone variants and histone proteolytic cleavage in senescence remains unclear. Here, using models of oncogene-induced and replicative senescence, we report novel histone H3 tail cleavage events mediated by the protease Cathepsin L. We find that cleaved forms of H3 are nucleosomal and the histone variant H3.3 is the preferred cleaved form of H3. Ectopic expression of H3.3 and its cleavage product (H3.3cs1), which lacks the first 21 amino acids of the H3 tail, is sufficient to induce senescence. Further, H3.3cs1 chromatin incorporation is mediated by the HUCA histone chaperone complex. Genome-wide transcriptional profiling revealed that H3.3cs1 facilitates transcriptional silencing of cell cycle regulators including RB/E2F target genes, likely via the permanent removal of H3K4me3. Collectively, our study identifies histone H3.3 and its proteolytically processed forms as key regulators of cellular senescence. 1 Department of Oncological Sciences, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, New York 10029, USA. 2 Department of Dermatology, Icahn School of Medicine at Mount Sinai, One Gustave L.
    [Show full text]
  • Abo1 Is Required for the H3k9me2 to H3k9me3 Transition in Heterochromatin Wenbo Dong1, Eriko Oya1, Yasaman Zahedi1, Punit Prasad 1,2, J
    www.nature.com/scientificreports OPEN Abo1 is required for the H3K9me2 to H3K9me3 transition in heterochromatin Wenbo Dong1, Eriko Oya1, Yasaman Zahedi1, Punit Prasad 1,2, J. Peter Svensson 1, Andreas Lennartsson1, Karl Ekwall1 & Mickaël Durand-Dubief 1* Heterochromatin regulation is critical for genomic stability. Diferent H3K9 methylation states have been discovered, with distinct roles in heterochromatin formation and silencing. However, how the transition from H3K9me2 to H3K9me3 is controlled is still unclear. Here, we investigate the role of the conserved bromodomain AAA-ATPase, Abo1, involved in maintaining global nucleosome organisation in fssion yeast. We identifed several key factors involved in heterochromatin silencing that interact genetically with Abo1: histone deacetylase Clr3, H3K9 methyltransferase Clr4, and HP1 homolog Swi6. Cells lacking Abo1 cultivated at 30 °C exhibit an imbalance of H3K9me2 and H3K9me3 in heterochromatin. In abo1∆ cells, the centromeric constitutive heterochromatin has increased H3K9me2 but decreased H3K9me3 levels compared to wild-type. In contrast, facultative heterochromatin regions exhibit reduced H3K9me2 and H3K9me3 levels in abo1∆. Genome-wide analysis showed that abo1∆ cells have silencing defects in both the centromeres and subtelomeres, but not in a subset of heterochromatin islands in our condition. Thus, our work uncovers a role of Abo1 in stabilising directly or indirectly Clr4 recruitment to allow the H3K9me2 to H3K9me3 transition in heterochromatin. In eukaryotic cells, the regions of the chromatin that contain active genes are termed euchromatin, and these regions condense in mitosis to allow for chromosome segregation and decondense in interphase to allow for gene transcription1. Te chromatin regions that remain condensed throughout the cell cycle are defned as het- erochromatin regions and are transcriptionally repressed2,3.
    [Show full text]
  • Posttranslational Modification of CENP-A Influences The
    Posttranslational modification of CENP-A influences the conformation of centromeric chromatin Aaron O. Baileya,1, Tanya Panchenkob,1, Kizhakke M. Sathyanc, Janusz J. Petkowskid, Pei-Jing Paie, Dina L. Baif, David H. Russelle, Ian G. Macarad, Jeffrey Shabanowitzf, Donald F. Huntf,g, Ben E. Blackb,2, and Daniel R. Foltza,c,2 Departments of aCell Biology, cBiochemistry and Molecular Genetics, dMicrobiology, fChemistry, and gPathology, University of Virginia, Charlottesville, VA 22908; bDepartment of Biochemistry and Biophysics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104-6059; and eDepartment of Chemistry, Texas A&M University, College Station, TX 77842-3012 Edited* by C. David Allis, The Rockefeller University, New York, NY, and approved June 13, 2013 (received for review January 7, 2013) Centromeres are chromosomal loci required for accurate segrega- of these proteins are highly divergent, sharing only 24% identity. tion of sister chromatids during mitosis. The location of the cen- Several lysine residues in the canonical H3 N terminus are highly tromere on the chromosome is not dependent on DNA sequence, conserved targets of acetylation and methylation that mediate but rather it is epigenetically specified by the histone H3 variant epigenetic regulation of local chromatin activity (12, 13). Post- centromere protein A (CENP-A). The N-terminal tail of CENP-A is translational modification (PTM) of histones is usually combi- highly divergent from other H3 variants. Canonical histone N natorial, and the net PTM status of these histones can negatively fl termini are hotspots of conserved posttranslational modification; or positively in uence transcription or direct global condensa- however, no broadly conserved modifications of the vertebrate tion of chromatin.
    [Show full text]
  • Phosphorylation of Histone H3: a Balancing Act Between Chromosome Condensation and Transcriptional Activation
    Review TRENDS in Genetics Vol.20 No.4 April 2004 Phosphorylation of histone H3: a balancing act between chromosome condensation and transcriptional activation Scott J. Nowak1,2 and Victor G. Corces1 1Department of Biology, The Johns Hopkins University, 3400 N. Charles St, Baltimore, MD 21218, USA 2Present address: Skirball Institute of Biomolecular Medicine, 540 First Avenue, New York, NY 10016, USA In recent years, the covalent modification of histone sufficiently malleable and modifiable to enable access to tails has emerged as a crucial step in controlling the genetic information. Such a structure is the composite transcription of eukaryotic genes. Phosphorylation of material termed chromatin, which contains the entire the serine 10 residue of the N-terminal tail of histone H3 genome and associated proteins [1]. Because DNA is is crucial for chromosome condensation and cell-cycle compacted into a highly condensed and ordered structure, progression during mitosis and meiosis. In addition, considerable interest has focused on how the transcrip- this modification is important during interphase tional machinery gains access to the genes contained because it enables the transcription of an increasing within chromatin and expresses them in an organized number of genes that are activated as a consequence of program, as is required in the processes of cellular a variety of cell-signaling events. The location of the differentiation and development. The alteration of chro- serine 10 residue in close proximity to other modifiable matin organization, via covalent modification and/or amino acids in the histone H3 tail enables the possibility remodeling of this structure, is thought to provide access of an interaction between phosphorylation of serine 10 to the genes for the transcription apparatus.
    [Show full text]
  • 1 Enhancer Regions Show High Histone H3.3 Turnover That Changes During 1 Differentiation 2 3 4 Aimee M. Deaton1,2, Mariluz
    1 Enhancer regions show high histone H3.3 turnover that changes during 2 differentiation 3 4 5 Aimee M. Deaton1,2, Mariluz Gómez-Rodrı́guez3, Jakub Mieczkowski1, Michael Y. 6 Tolstorukov1, Sharmistha Kundu1, Ruslan Sadreyev1,4, Lars E.T. Jansen3*, Robert E. 7 Kingston1*. 8 9 1 Department of Molecular Biology, Massachusetts General Hospital and Department of Genetics 10 Harvard Medical School, Boston, MA 02114. 11 2 Present address: Amgen Inc, 360 Binney St, Cambridge, MA 02142. 12 3 Instituto Gulbenkian de Ciencia, 2780-156, Oeiras, Portugal. 13 4 Department of Pathology, Massachusetts General Hospital and Harvard Medical School, Boston, MA. 14 15 * For correspondence: [email protected] (LETJ), [email protected] (REK) 16 17 18 Abstract 19 20 The organization of DNA into chromatin is dynamic; nucleosomes are frequently 21 displaced to facilitate the ability of regulatory proteins to access specific DNA 22 elements. To gain insight into nucleosome dynamics, and to follow how dynamics 23 change during differentiation, we used a technique called time-ChIP to 24 quantitatively assess histone H3.3 turnover genome-wide during differentiation of 25 mouse ESCs. We found that, without prior assumptions, high turnover could be used 26 to identify regions involved in gene regulation. High turnover was seen at 27 enhancers, as observed previously, with particularly high turnover at super- 28 enhancers. In contrast, regions associated with the repressive Polycomb-Group 29 showed low turnover in ESCs. Turnover correlated with DNA accessibility. Upon 30 differentiation, numerous changes in H3.3 turnover rates were observed, the 31 majority of which occurred at enhancers.
    [Show full text]
  • Histone H4 and the Maintenance of Genome Integrity
    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Histone H4 and the maintenance of genome integrity Paul C. Megee, 1 Brian A. Morgan, 2 and M. Mitchell Smith 3 Department of Microbiology, University of Virginia School of Medicine Charlottesville, Virginia 22908 USA The normal progression of Saccharomyces cerevisiae through nuclear division requires the function of the amino-terminal domain of histone H4. Mutations that delete the domain, or alter 4 conserved lysine residues within the domain, cause a marked delay during the G2 +M phases of the cell cycle. Site-directed mutagenesis of single and multiple lysine residues failed to map this phenotype to any particular site; the defect was only observed when all four lysines were mutated. Starting with a quadruple lysine-to-glutamine substitution allele, the insertion of a tripeptide containing a single extra lysine residue suppressed the G2+M cell cycle defect. Thus, the amino-terminal domain of histone H4 has novel genetic functions that depend on the presence of lysine per se, and not a specific primary peptide sequence. To determine the nature of this function, we examined H4 mutants that were also defective for G2/M checkpoint pathways. Disruption of the mitotic spindle checkpoint pathway had no effect on the phenotype of the histone amino-terminal domain mutant. However, disruption of RADg, which is part of the pathway that monitors DNA integrity, caused precocious progression of the H4 mutant through nuclear division and increased cell death. These results indicate that the lysine-dependent function of histone H4 is required for the maintenance of genome integrity, and that DNA damage resulting from the loss of this function activates the RAD9-dependent G2/M checkpoint pathway.
    [Show full text]
  • Eighteenth Edition Rams - March 2021
    AATCGCCCAAGACAACATGGGGTTGCAGGTGTAAATCGATAAAAGAAG GGTAGGTATCGTTCACGGGGCACACTACTAGCGGGGCTTAGATAGCAA CTAGGGGTTCTTCACGCAEIGHTEENTHGCGCAAGA EDITIONCACATG -C MARCHGCTA T2021AAATGCTAGAT AACTGACATTATACTTATCAATGGGGAATAGGTCAGATAGATGGCACCA CATCGCACACTTATAGGCACGTCACCTGAGCCGACTCGAAATCCGCTTA TACTGCGACAAAATCATCCGCTCGGTTGATCTAGGATCGGGACTATATC CAGCGCRISPRCCCTAGCTCATTCTCAGAGGGAGCGACGAATGCTCAGC GAGGAGTTGTTCTGACCCGTGACGGAGTACTCTTTACTATCAAGTATAG CCAGTCTTGCCCCGATCGCTATACATTATTTGATGCCCCCCRISPRATAGC CGCAGTCATTCGACAGATTAGGCCCACCACCACCTCCCCTTGAGATTGG TATCRISPRCGCAACTGTAAGCAACATTACGGAAGGGCTACTCTAGATTG AACTCGCGTACAAGGTTTACCAAAGTGCATAAATCGACGGCCCCTCACG GCGGCCGTTAGCGCTCTAGAACCGAAACTAAGHACTACRISPRAACGCC GAAGACCCACGCCAATACAGTTCCGCGCCACGGAGGTAACTTACATGC CGCTCCCCGCRISPRGTTTACGGGTCATGCCTACCCCTCGGCATTCATGG GACTCAAACCTATCCCCGCAGCCGGAGCTTAAGAAAGAGCTAACACTTA GTTCGCATTCAAAATCGGTAAATTAATTAACATGCCGCAACGCGTCTATA AATGCCRISPRGTTCACCAACGTCCCGAGTTTTAACCTAGAAGCATATGTG CTGACCGTTAGCATGGAACTGCGTAACCTGACGGTCRISPRGTTCATCAC CTCGCGATCTCGTCAACTTGGCCATCGCCATCTGGTGGACCCCGGAATC AAAGCTGCTGACTAGAGGCGTTGAATCGCCCAAGACAACATGGCRISPR TTGCAGGTGTAAATCGATAAAAGAAGGGGTAGGTATCGTTCACGGGGC CATAGCCRISPRGGGGCTTAGATAGCAAACTAGGGGTTCTTCACGCAGC Interview: facing sex bias in biomedical research CAAGACACATGCGCTATAAATGCTAGATCAACTGACATTATACTTATCAA GGGGAZebrasATA ofG Medicine:GTCAG whenATA GthrombocytesATGGCA areCC scarceACCATCGCACACTTATAGGCAC TCACCOurTG futureAGC CwithGA CRISPR:CTCG a AbraveAAT newCC world?GCTTAGTACTGCGACAAAATCATCCG TCGGTCRISPR/Cas9TGATCTA geneGG editingATCG asG aG cancerACT therapyATATCGCAGCGCCCTAGCTCATTCTC
    [Show full text]
  • Differential Regulation of CENP-A and Histone H3 Phosphorylation in G2/M
    RESEARCH ARTICLE 653 Differential regulation of CENP-A and histone H3 phosphorylation in G2/M Samantha G. Zeitlin1,*, Cynthia M. Barber2,*, C. David Allis2and Kevin E. Sullivan1,‡ 1Department of Cell Biology, The Scripps Research Institute, La Jolla, CA, USA 2Departments of Biochemistry and Molecular Genetics and Microbiology, University of Virginia, Charlottesville, VA, USA *These authors contributed equally to this work ‡Author for correspondence (e-mail: [email protected]) Accepted 28 November 2000 Journal of Cell Science 114, 653-661 © The Company of Biologists Ltd SUMMARY After DNA replication, cells condense their chromosomes both pericentric initiation and genome-wide stages in order to segregate them during mitosis. The of histone H3 phosphorylation. Quantitative condensation process as well as subsequent segregation immunocytochemistry reveals that CENP-A requires phosphorylation of histone H3 at serine 10. phosphorylation begins in prophase and reaches maximal Histone H3 phosphorylation initiates during G2 in levels in prometaphase. CENP-A phosphoepitope reactivity pericentric foci prior to H3 phosphorylation in the is lost during anaphase and becomes undetectable in chromosome arms. Centromere protein A (CENP-A), a telophase cells. Duplication of prekinetochores, detected as histone H3-like protein found uniquely at centromeres, the doubling of CENP-A foci, occurs prior to complete contains a sequence motif similar to that around H3 Ser10, histone H3 phosphorylation in G2. Mitotic phosphorylation suggesting that CENP-A phosphorylation might be linked of histone H3-family proteins shows tight spatial and to pericentric initiation of histone H3 phosphorylation. To temporal control, occurring in three phases: (1) pericentric test this hypothesis, we generated peptide antibodies H3 phosphorylation, (2) chromosome arm H3 against the putative phosphorylation site of CENP-A.
    [Show full text]