DOCSLIB.ORG

Differential Regulation of CENP-A and Histone H3 Phosphorylation in G2/M

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Differential Regulation of CENP-A and Histone H3 Phosphorylation in G2/M RESEARCH ARTICLE 653 Differential regulation of CENP-A and histone H3 phosphorylation in G2/M Samantha G. Zeitlin1,*, Cynthia M. Barber2,*, C. David Allis2and Kevin E. Sullivan1,‡ 1Department of Cell Biology, The Scripps Research Institute, La Jolla, CA, USA 2Departments of Biochemistry and Molecular Genetics and Microbiology, University of Virginia, Charlottesville, VA, USA *These authors contributed equally to this work ‡Author for correspondence (e-mail: [email protected]) Accepted 28 November 2000 Journal of Cell Science 114, 653-661 © The Company of Biologists Ltd SUMMARY After DNA replication, cells condense their chromosomes both pericentric initiation and genome-wide stages in order to segregate them during mitosis. The of histone H3 phosphorylation. Quantitative condensation process as well as subsequent segregation immunocytochemistry reveals that CENP-A requires phosphorylation of histone H3 at serine 10. phosphorylation begins in prophase and reaches maximal Histone H3 phosphorylation initiates during G2 in levels in prometaphase. CENP-A phosphoepitope reactivity pericentric foci prior to H3 phosphorylation in the is lost during anaphase and becomes undetectable in chromosome arms. Centromere protein A (CENP-A), a telophase cells. Duplication of prekinetochores, detected as histone H3-like protein found uniquely at centromeres, the doubling of CENP-A foci, occurs prior to complete contains a sequence motif similar to that around H3 Ser10, histone H3 phosphorylation in G2. Mitotic phosphorylation suggesting that CENP-A phosphorylation might be linked of histone H3-family proteins shows tight spatial and to pericentric initiation of histone H3 phosphorylation. To temporal control, occurring in three phases: (1) pericentric test this hypothesis, we generated peptide antibodies H3 phosphorylation, (2) chromosome arm H3 against the putative phosphorylation site of CENP-A. phosphorylation and (3) CENP-A phosphorylation at ELISA, western blot and immunocytochemical analyses kinetochores. These observations reveal new cytological show that CENP-A is phosphorylated at the shared landmarks characteristic of G2 progression. motif. Simultaneous co-detection demonstrates that phosphorylation of CENP-A and histone H3 are separate Key words: CENP-A, Histone, Phosphorylation, Kinetochore, events in G2/M. CENP-A phosphorylation occurs after Mitosis INTRODUCTION terminal tails of each of the four core histones (reviewed by Luger and Richmond, 1998; Grunstein, 1998; Strahl and Allis, During the G2 phase of the cell cycle the replicated 2000). The chemical diversity of modifications, including chromosomes are extensively modified in preparation for lysine-N-acetylation, lysine-N-methylation, arginine mitosis. This process culminates in 20-100 fold chromosome methylation, ADP-ribosylation, ubiquitination and condensation and refolding into the familiar compact mitotic phosphorylation, has led to the ‘histone code hypothesis’, in configuration which facilitates efficient segregation as cells which each site of modification can serve a distinct function divide (Trask et al., 1993; Heck, 1997). Mitotic chromosome (Strahl and Allis, 2000). For example, acetylation of histone condensation involves both assembly and disassembly of H4 lysines 5 and 12 is correlated with deposition (Verrault et chromatin associated proteins as the chromosome switches al., 1996), and acetylation at residues 8 and 16 are associated from transcriptional activities to its transport form. During with transcriptional activation (Kuo et al., 1996), while G2, many transcription-associated proteins dissociate or hypoacetylation of histone H4 is associated with redistribute within the chromosomes (Platero et al., 1998), and heterochromatic domains (Turner et al., 1992). According specific mitosis-associated protein complexes are assembled or to the histone code model, modifications (singly or in activated (Hirano et al., 1997). One of these mitosis-specific combination) create changes in the overall charge density of complexes is the kinetochore, a tri-laminar plate-like structure histone tails, which in turn modulate histone interactions with that forms on the centromeric locus of each chromosome in DNA, with non-histone proteins and with other histones. By mitosis (reviewed by Rieder and Salmon, 1998). The this mechanism, histone modifications both receive and complexity of kinetochore structure exemplifies the unique transmit changes in protein-protein interactions within functional configuration of mitotic chromosomes which results chromatin to and from higher-level signaling pathways. For from the G2 remodeling process. example, histone H3 phosphorylation levels are increased in The histones play a central role in modulating protein response to mitogen stimulation, raising levels of immediate- assembly on the chromatin fiber. This is regulated by post- early gene expression (Mahadevan et al., 1991; Thomson et al., translational modifications that occur on the flexible N- 1999; Chadee et al., 1999; Sassone-Corsi et al., 1999; Cheung 654 JOURNAL OF CELL SCIENCE 114 (4) et al., 2000). Understanding how histone modifications are performed as described (Muller et al., 1987). All antisera were diluted targeted to specific chromosomal loci and how regulation is 1:1000. For peptide competition experiments, 100 µl of antiserum was achieved in different nuclear compartments will be key steps incubated with 100 µg of peptide for 1 hour at room temperature prior toward unraveling chromatin-directed signaling pathways. to ELISA. The bound enzyme conjugate was quantitated by turnover Histone H3 phosphorylation at Ser10 in particular plays a of p-nitrophenyl phosphate substrate (Sigma), as detected by key role in mitotic chromosome condensation (Wei et al., 1998; absorbance at 405 nm. Wei et al., 1999; Hsu et al., 2000). In the absence of histone Acid extraction of histones H3 phosphorylation, chromosome condensation is incomplete HeLa cells grown to a density of ~1.5×105 cells/cm2 were treated with and anaphase chromosome separation is highly defective (Wei 15 µg/ml nocodazole and incubated for 18 hours, followed by et al., 1999; Hsu et al., 2000). Histone H3 phosphorylation is agitation to release loosely associated mitotic cells. Cells were highly regulated in G2, initiating specifically in pericentric collected by centrifugation and cell pellets were resuspended in one- heterochromatin in characteristic rings around the centromeres half volume nuclear isolation buffer (PBS, 0.1% Triton X-100, 1 mM prior to general H3 phosphorylation that occurs in chromatin MgCl2, 1 mM PMSF and 100 mg/ml DNase 1). Nuclei were spun throughout the chromosome arms (Hendzel et al., 1997). A down and stored frozen at –80°C. Resulting nuclei were resuspended unique histone H3-related protein, CENP-A, is found in 0.4 N sulfuric acid, incubated on ice for 30 minutes and acid- specifically at centromeres throughout the cell cycle where it insoluble proteins were pelleted by centrifugation at 12,000 g for 10 minutes. The soluble proteins were TCA precipitated on ice for 10 is thought to substitute for histone H3 in the nucleosomes minutes, spun at 12,000 g, washed with acetone/0.1% HCl, and of kinetochore-associated chromatin (Brenner et al., 1981; washed twice more with acetone, and resuspended in sterile water. Earnshaw and Rothfield, 1985; Sullivan et al., 1994; Yoda et al., 2000). In addition to a conserved H3-like histone fold Electrophoresis and immunoblotting domain, CENP-A contains an N-terminal tail that shares very Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS- little sequence identity with that of histone H3. However, PAGE) was performed as described (Laemmli, 1970). The specificity several amino acids surrounding the histone H3 Ser10 are of antibodies used in this report was analyzed by immunoblotting as conserved in CENP-A, suggesting that the mitotic described previously (Hendzel et al., 1997). Protein representing 104 phosphorylation motif might be shared between these two HeLa cell equivalents were run on each lane. Blots were blocked for proteins. If this were the case, it might help clarify the 1 hour with nonfat dry milk at 5% and incubated with antisera diluted 1:1000 in 5% nonfat dry milk. For the experiment shown in Fig. 2B, mechanisms through which histone H3 phosphorylation is affinity purified anti-CENP-A-Ser7P was used at 1:500. After regulated during G2/M. In this work we have demonstrated that washing, blots were probed with horseradish peroxidase-conjugated phosphorylation of CENP-A occurs at Ser7 within the shared secondary antibody and developed by ECL (Pierce, Rockford, IL) mitotic phosphorylation motif. Using immunocytochemistry, according to the manufacturer’s instructions. For alkaline phosphatase we compared the kinetic and spatial organization of CENP-A treatment, 104 HeLa cell equivalents were incubated with 10 units of and histone H3 phosphorylation in G2/M. Our results show that E. coli alkaline phosphatase (Sigma) at 37°C for 30 minutes prior to CENP-A phosphorylation is unlikely to play a role in the electrophoresis. initiation of histone H3 phosphorylation in pericentric Immunofluorescence regions. Instead, H3 phosphorylation precedes CENP-A phosphorylation, which occurs as a distinct reaction in prophase. Asynchronous human CENP-B-GFP U2OS cells were plated and grown to confluency on acid-washed glass coverslips (Fisher) for 2 days. Cells were fixed in 1% paraformaldehyde in PBS containing 140 mM NaF to inhibit phosphatases. Coverslips were then washed
Load more

Recommended publications
  • Cross-Talk Between Histone H3 Tails Produces Cooperative Nucleosome Acetylation
    Cross-talk between histone H3 tails produces cooperative nucleosome acetylation Shanshan Li and Michael A. Shogren-Knaak1 Department of Biochemistry, Biophysics, and Molecular Biology, Iowa State University, Ames, IA 50011 Edited by Jerry L. Workman, Stowers Institute for Medical Research, Kansas City, MO, and accepted by the Editorial Board September 23, 2008 (received for review May 9, 2008) Acetylation of histone proteins by the yeast Spt-Ada-Gcn5-acetyl- nucleosomes, with an average distance between nucleosome cen- tansferase (SAGA) complex has served as a paradigm for under- ters of 212 bp (12). Although these nucleosomes are arrayed in a standing how posttranslational modifications of chromatin regu- linear fashion in genomic sequence, in many cases they adopt more late eukaryotic gene expression. Nonetheless, it has been unclear complex higher-order structures. Short-range interactions between to what extent the structural complexity of the chromatin sub- nucleosomes within a strand of chromatin allow chromatin to adopt strate modulates SAGA activity. By using chromatin model sys- a more compact 30-nm fiber structure (13, 14), and long-range tems, we have found that SAGA-mediated histone acetylation is interactions between distant nucleosomes provide a means for .(highly cooperative (cooperativity constant of 1.97 ؎ 0.15), employ- chromatin to potentially adopt 100- to 400-nm fiber structures (15 ing the binding of multiple noncontiguous nucleosomes to facili- Moreover, a number of recent studies suggest that different func- tate maximal acetylation activity. Studies with various chromatin tional forms of chromatin can adopt complex looping structures, substrates, including those containing novel asymmetric histone where regions of the genome that are separated by large distances octamers, indicate that this cooperativity occurs only when both in sequence can be brought together in space (16).
    [Show full text]
  • Histones H3 and H4 Are Components of Upstream Activation Factor Required for the High-Level Transcription of Yeast Rdna by RNA Polymerase I
    Proc. Natl. Acad. Sci. USA Vol. 94, pp. 13458–13462, December 1997 Biochemistry Histones H3 and H4 are components of upstream activation factor required for the high-level transcription of yeast rDNA by RNA polymerase I JOHN KEENER*, JONATHAN A. DODD*, DOMINIQUE LALO, AND MASAYASU NOMURA† Department of Biological Chemistry, University of California, Irvine, CA 92697-1700 Contributed by Masayasu Nomura, October 16, 1997 ABSTRACT RNA polymerase I (Pol I) transcription in consisting of Rrn6p, Rrn7p, and Rrn11p; refs. 3, 9, and 10), the yeast Saccharomyces cerevisiae is greatly stimulated in vivo Rrn3p (5), and Pol I are required. In addition to these factors, and in vitro by the multiprotein complex, upstream activation upstream activation factor (UAF) and TATA box-binding factor (UAF). UAF binds tightly to the upstream element of the protein, as well as the upstream element, are required for a rDNA promoter, such that once bound (in vitro), UAF does not high level of transcription from the yeast rDNA promoter (4, readily exchange onto a competing template. Of the polypep- 11). Purified UAF previously was shown to contain three tides previously identified in purified UAF, three are encoded genetically defined subunits, Rrn5p, Rrn9p, and Rrn10p, and by genes required for Pol I transcription in vivo: RRN5, RRN9, two uncharacterized subunits, p30 and p18 (4). and RRN10. Two others, p30 and p18, have remained unchar- DNA in the eukaryotic nucleus is organized as chromatin, acterized. We report here that the N-terminal amino acid consisting mostly of regularly repeating nucleosomes in which sequence, its mobility in gel electrophoresis, and the immu- DNA is wrapped around an octameric structure of core noreactivity of p18 shows that it is histone H3.
    [Show full text]
  • Structure–Function Studies of Histone H3/H4 Tetramer Maintenance During Transcription by Chaperone Spt2
    Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Structure–function studies of histone H3/H4 tetramer maintenance during transcription by chaperone Spt2 Shoudeng Chen,1,5 Anne Rufiange,2,5 Hongda Huang,1 Kanagalaghatta R. Rajashankar,3,4 Amine Nourani,2 and Dinshaw J. Patel1 1Structural Biology Program, Memorial Sloan-Kettering Cancer Center, New York, New York 10065, USA; 2Groupe St-Patrick de Recherche en Oncologie Fondamentale, L’Hôtel-Dieu de Québec (Université Laval), Québec G1R 2J6, Canada; 3Northeastern Collaborative Access Team (NE-CAT), Advanced Photon Source, Argonne National Laboratory, Chicago, Illinois 60439, USA; 4Department of Chemistry and Chemical Biology, Cornell University, Ithaca, New York 14853, USA Cells use specific mechanisms such as histone chaperones to abrogate the inherent barrier that the nucleosome poses to transcribing polymerases. The current model postulates that nucleosomes can be transiently disrupted to accommodate passage of RNA polymerases and that histones H3 and H4 possess their own chaperones dedicated to the recovery of nucleosomes. Here, we determined the crystal structure of the conserved C terminus of human Suppressors of Ty insertions 2 (hSpt2C) chaperone bound to an H3/H4 tetramer. The structural studies demonstrate that hSpt2C is bound to the periphery of the H3/H4 tetramer, mimicking the trajectory of nucleosomal-bound DNA. These structural studies have been complemented with in vitro binding and in vivo functional studies on mutants that disrupt key intermolecular contacts involving two acidic patches and hydrophobic residues on Spt2C. We show that contacts between both human and yeast Spt2C with the H3/H4 tetramer are required for the suppression of H3/ H4 exchange as measured by H3K56ac and new H3 deposition.
    [Show full text]
  • The Histone Variant H3.3 Marks Active Chromatin by Replication-Independent Nucleosome Assembly
    Molecular Cell, Vol. 9, 1191–1200, June, 2002, Copyright 2002 by Cell Press The Histone Variant H3.3 Marks Active Chromatin by Replication-Independent Nucleosome Assembly Kami Ahmad and Steven Henikoff1 ment are not clear. A study in Tetrahymena concluded Fred Hutchinson Cancer Research Center that no protein difference between histone H3 variants 1100 Fairview Avenue North was required for replacement histone deposition and Seattle, Washington 98109 that expression of either variant outside of S phase ap- peared to be sufficient (Yu and Gorovsky, 1997). In con- trast, by examining the dynamics of histone proteins in Summary Drosophila nuclei we show that the major histone H3 and the replacement histone H3.3 proteins have distinct Two very similar H3 histones—differing at only four properties during in vivo chromatin assembly. Histone amino acid positions—are produced in Drosophila H3.3 participates in replication-independent (RI) nucleo- cells. Here we describe a mechanism of chromatin some assembly and is targeted to transcriptionally ac- regulation whereby the variant H3.3 is deposited at tive loci throughout the cell cycle. Transcription-coupled particular loci, including active rDNA arrays. While the deposition of H3.3-containing nucleosomes may be a major H3 is incorporated strictly during DNA replica- general mechanism for rapidly replacing permanently tion, amino acid changes toward H3.3 allow replica- modified nucleosomes and for heritably activating tion-independent (RI) deposition. In contrast to repli- genes. cation-coupled (RC) deposition, RI deposition does not require the N-terminal tail. H3.3 is the exclusive Results substrate for RI deposition, and its counterpart is the only substrate retained in yeast.
    [Show full text]
  • Histone H3.3 and Its Proteolytically Processed Form Drive a Cellular Senescence Programme
    ARTICLE Received 21 Mar 2014 | Accepted 9 Sep 2014 | Published 14 Nov 2014 DOI: 10.1038/ncomms6210 Histone H3.3 and its proteolytically processed form drive a cellular senescence programme Luis F. Duarte1,2,3, Andrew R.J. Young4, Zichen Wang3,5, Hsan-Au Wu1,3, Taniya Panda1,2, Yan Kou3,5, Avnish Kapoor1,2,w, Dan Hasson1,2, Nicholas R. Mills1,2, Avi Ma’ayan5, Masashi Narita4 & Emily Bernstein1,2 The process of cellular senescence generates a repressive chromatin environment, however, the role of histone variants and histone proteolytic cleavage in senescence remains unclear. Here, using models of oncogene-induced and replicative senescence, we report novel histone H3 tail cleavage events mediated by the protease Cathepsin L. We find that cleaved forms of H3 are nucleosomal and the histone variant H3.3 is the preferred cleaved form of H3. Ectopic expression of H3.3 and its cleavage product (H3.3cs1), which lacks the first 21 amino acids of the H3 tail, is sufficient to induce senescence. Further, H3.3cs1 chromatin incorporation is mediated by the HUCA histone chaperone complex. Genome-wide transcriptional profiling revealed that H3.3cs1 facilitates transcriptional silencing of cell cycle regulators including RB/E2F target genes, likely via the permanent removal of H3K4me3. Collectively, our study identifies histone H3.3 and its proteolytically processed forms as key regulators of cellular senescence. 1 Department of Oncological Sciences, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, New York 10029, USA. 2 Department of Dermatology, Icahn School of Medicine at Mount Sinai, One Gustave L.
    [Show full text]
  • Abo1 Is Required for the H3k9me2 to H3k9me3 Transition in Heterochromatin Wenbo Dong1, Eriko Oya1, Yasaman Zahedi1, Punit Prasad 1,2, J
    www.nature.com/scientificreports OPEN Abo1 is required for the H3K9me2 to H3K9me3 transition in heterochromatin Wenbo Dong1, Eriko Oya1, Yasaman Zahedi1, Punit Prasad 1,2, J. Peter Svensson 1, Andreas Lennartsson1, Karl Ekwall1 & Mickaël Durand-Dubief 1* Heterochromatin regulation is critical for genomic stability. Diferent H3K9 methylation states have been discovered, with distinct roles in heterochromatin formation and silencing. However, how the transition from H3K9me2 to H3K9me3 is controlled is still unclear. Here, we investigate the role of the conserved bromodomain AAA-ATPase, Abo1, involved in maintaining global nucleosome organisation in fssion yeast. We identifed several key factors involved in heterochromatin silencing that interact genetically with Abo1: histone deacetylase Clr3, H3K9 methyltransferase Clr4, and HP1 homolog Swi6. Cells lacking Abo1 cultivated at 30 °C exhibit an imbalance of H3K9me2 and H3K9me3 in heterochromatin. In abo1∆ cells, the centromeric constitutive heterochromatin has increased H3K9me2 but decreased H3K9me3 levels compared to wild-type. In contrast, facultative heterochromatin regions exhibit reduced H3K9me2 and H3K9me3 levels in abo1∆. Genome-wide analysis showed that abo1∆ cells have silencing defects in both the centromeres and subtelomeres, but not in a subset of heterochromatin islands in our condition. Thus, our work uncovers a role of Abo1 in stabilising directly or indirectly Clr4 recruitment to allow the H3K9me2 to H3K9me3 transition in heterochromatin. In eukaryotic cells, the regions of the chromatin that contain active genes are termed euchromatin, and these regions condense in mitosis to allow for chromosome segregation and decondense in interphase to allow for gene transcription1. Te chromatin regions that remain condensed throughout the cell cycle are defned as het- erochromatin regions and are transcriptionally repressed2,3.
    [Show full text]
  • Posttranslational Modification of CENP-A Influences The
    Posttranslational modification of CENP-A influences the conformation of centromeric chromatin Aaron O. Baileya,1, Tanya Panchenkob,1, Kizhakke M. Sathyanc, Janusz J. Petkowskid, Pei-Jing Paie, Dina L. Baif, David H. Russelle, Ian G. Macarad, Jeffrey Shabanowitzf, Donald F. Huntf,g, Ben E. Blackb,2, and Daniel R. Foltza,c,2 Departments of aCell Biology, cBiochemistry and Molecular Genetics, dMicrobiology, fChemistry, and gPathology, University of Virginia, Charlottesville, VA 22908; bDepartment of Biochemistry and Biophysics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104-6059; and eDepartment of Chemistry, Texas A&M University, College Station, TX 77842-3012 Edited* by C. David Allis, The Rockefeller University, New York, NY, and approved June 13, 2013 (received for review January 7, 2013) Centromeres are chromosomal loci required for accurate segrega- of these proteins are highly divergent, sharing only 24% identity. tion of sister chromatids during mitosis. The location of the cen- Several lysine residues in the canonical H3 N terminus are highly tromere on the chromosome is not dependent on DNA sequence, conserved targets of acetylation and methylation that mediate but rather it is epigenetically specified by the histone H3 variant epigenetic regulation of local chromatin activity (12, 13). Post- centromere protein A (CENP-A). The N-terminal tail of CENP-A is translational modification (PTM) of histones is usually combi- highly divergent from other H3 variants. Canonical histone N natorial, and the net PTM status of these histones can negatively fl termini are hotspots of conserved posttranslational modification; or positively in uence transcription or direct global condensa- however, no broadly conserved modifications of the vertebrate tion of chromatin.
    [Show full text]
  • Phosphorylation of Histone H3: a Balancing Act Between Chromosome Condensation and Transcriptional Activation
    Review TRENDS in Genetics Vol.20 No.4 April 2004 Phosphorylation of histone H3: a balancing act between chromosome condensation and transcriptional activation Scott J. Nowak1,2 and Victor G. Corces1 1Department of Biology, The Johns Hopkins University, 3400 N. Charles St, Baltimore, MD 21218, USA 2Present address: Skirball Institute of Biomolecular Medicine, 540 First Avenue, New York, NY 10016, USA In recent years, the covalent modification of histone sufficiently malleable and modifiable to enable access to tails has emerged as a crucial step in controlling the genetic information. Such a structure is the composite transcription of eukaryotic genes. Phosphorylation of material termed chromatin, which contains the entire the serine 10 residue of the N-terminal tail of histone H3 genome and associated proteins [1]. Because DNA is is crucial for chromosome condensation and cell-cycle compacted into a highly condensed and ordered structure, progression during mitosis and meiosis. In addition, considerable interest has focused on how the transcrip- this modification is important during interphase tional machinery gains access to the genes contained because it enables the transcription of an increasing within chromatin and expresses them in an organized number of genes that are activated as a consequence of program, as is required in the processes of cellular a variety of cell-signaling events. The location of the differentiation and development. The alteration of chro- serine 10 residue in close proximity to other modifiable matin organization, via covalent modification and/or amino acids in the histone H3 tail enables the possibility remodeling of this structure, is thought to provide access of an interaction between phosphorylation of serine 10 to the genes for the transcription apparatus.
    [Show full text]
  • 1 Enhancer Regions Show High Histone H3.3 Turnover That Changes During 1 Differentiation 2 3 4 Aimee M. Deaton1,2, Mariluz
    1 Enhancer regions show high histone H3.3 turnover that changes during 2 differentiation 3 4 5 Aimee M. Deaton1,2, Mariluz Gómez-Rodrı́guez3, Jakub Mieczkowski1, Michael Y. 6 Tolstorukov1, Sharmistha Kundu1, Ruslan Sadreyev1,4, Lars E.T. Jansen3*, Robert E. 7 Kingston1*. 8 9 1 Department of Molecular Biology, Massachusetts General Hospital and Department of Genetics 10 Harvard Medical School, Boston, MA 02114. 11 2 Present address: Amgen Inc, 360 Binney St, Cambridge, MA 02142. 12 3 Instituto Gulbenkian de Ciencia, 2780-156, Oeiras, Portugal. 13 4 Department of Pathology, Massachusetts General Hospital and Harvard Medical School, Boston, MA. 14 15 * For correspondence: [email protected] (LETJ), [email protected] (REK) 16 17 18 Abstract 19 20 The organization of DNA into chromatin is dynamic; nucleosomes are frequently 21 displaced to facilitate the ability of regulatory proteins to access specific DNA 22 elements. To gain insight into nucleosome dynamics, and to follow how dynamics 23 change during differentiation, we used a technique called time-ChIP to 24 quantitatively assess histone H3.3 turnover genome-wide during differentiation of 25 mouse ESCs. We found that, without prior assumptions, high turnover could be used 26 to identify regions involved in gene regulation. High turnover was seen at 27 enhancers, as observed previously, with particularly high turnover at super- 28 enhancers. In contrast, regions associated with the repressive Polycomb-Group 29 showed low turnover in ESCs. Turnover correlated with DNA accessibility. Upon 30 differentiation, numerous changes in H3.3 turnover rates were observed, the 31 majority of which occurred at enhancers.
    [Show full text]
  • Histone H4 and the Maintenance of Genome Integrity
    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Histone H4 and the maintenance of genome integrity Paul C. Megee, 1 Brian A. Morgan, 2 and M. Mitchell Smith 3 Department of Microbiology, University of Virginia School of Medicine Charlottesville, Virginia 22908 USA The normal progression of Saccharomyces cerevisiae through nuclear division requires the function of the amino-terminal domain of histone H4. Mutations that delete the domain, or alter 4 conserved lysine residues within the domain, cause a marked delay during the G2 +M phases of the cell cycle. Site-directed mutagenesis of single and multiple lysine residues failed to map this phenotype to any particular site; the defect was only observed when all four lysines were mutated. Starting with a quadruple lysine-to-glutamine substitution allele, the insertion of a tripeptide containing a single extra lysine residue suppressed the G2+M cell cycle defect. Thus, the amino-terminal domain of histone H4 has novel genetic functions that depend on the presence of lysine per se, and not a specific primary peptide sequence. To determine the nature of this function, we examined H4 mutants that were also defective for G2/M checkpoint pathways. Disruption of the mitotic spindle checkpoint pathway had no effect on the phenotype of the histone amino-terminal domain mutant. However, disruption of RADg, which is part of the pathway that monitors DNA integrity, caused precocious progression of the H4 mutant through nuclear division and increased cell death. These results indicate that the lysine-dependent function of histone H4 is required for the maintenance of genome integrity, and that DNA damage resulting from the loss of this function activates the RAD9-dependent G2/M checkpoint pathway.
    [Show full text]
  • Eighteenth Edition Rams - March 2021
    AATCGCCCAAGACAACATGGGGTTGCAGGTGTAAATCGATAAAAGAAG GGTAGGTATCGTTCACGGGGCACACTACTAGCGGGGCTTAGATAGCAA CTAGGGGTTCTTCACGCAEIGHTEENTHGCGCAAGA EDITIONCACATG -C MARCHGCTA T2021AAATGCTAGAT AACTGACATTATACTTATCAATGGGGAATAGGTCAGATAGATGGCACCA CATCGCACACTTATAGGCACGTCACCTGAGCCGACTCGAAATCCGCTTA TACTGCGACAAAATCATCCGCTCGGTTGATCTAGGATCGGGACTATATC CAGCGCRISPRCCCTAGCTCATTCTCAGAGGGAGCGACGAATGCTCAGC GAGGAGTTGTTCTGACCCGTGACGGAGTACTCTTTACTATCAAGTATAG CCAGTCTTGCCCCGATCGCTATACATTATTTGATGCCCCCCRISPRATAGC CGCAGTCATTCGACAGATTAGGCCCACCACCACCTCCCCTTGAGATTGG TATCRISPRCGCAACTGTAAGCAACATTACGGAAGGGCTACTCTAGATTG AACTCGCGTACAAGGTTTACCAAAGTGCATAAATCGACGGCCCCTCACG GCGGCCGTTAGCGCTCTAGAACCGAAACTAAGHACTACRISPRAACGCC GAAGACCCACGCCAATACAGTTCCGCGCCACGGAGGTAACTTACATGC CGCTCCCCGCRISPRGTTTACGGGTCATGCCTACCCCTCGGCATTCATGG GACTCAAACCTATCCCCGCAGCCGGAGCTTAAGAAAGAGCTAACACTTA GTTCGCATTCAAAATCGGTAAATTAATTAACATGCCGCAACGCGTCTATA AATGCCRISPRGTTCACCAACGTCCCGAGTTTTAACCTAGAAGCATATGTG CTGACCGTTAGCATGGAACTGCGTAACCTGACGGTCRISPRGTTCATCAC CTCGCGATCTCGTCAACTTGGCCATCGCCATCTGGTGGACCCCGGAATC AAAGCTGCTGACTAGAGGCGTTGAATCGCCCAAGACAACATGGCRISPR TTGCAGGTGTAAATCGATAAAAGAAGGGGTAGGTATCGTTCACGGGGC CATAGCCRISPRGGGGCTTAGATAGCAAACTAGGGGTTCTTCACGCAGC Interview: facing sex bias in biomedical research CAAGACACATGCGCTATAAATGCTAGATCAACTGACATTATACTTATCAA GGGGAZebrasATA ofG Medicine:GTCAG whenATA GthrombocytesATGGCA areCC scarceACCATCGCACACTTATAGGCAC TCACCOurTG futureAGC CwithGA CRISPR:CTCG a AbraveAAT newCC world?GCTTAGTACTGCGACAAAATCATCCG TCGGTCRISPR/Cas9TGATCTA geneGG editingATCG asG aG cancerACT therapyATATCGCAGCGCCCTAGCTCATTCTC
    [Show full text]
  • Spreading and Epigenetic Inheritance of Heterochromatin Require a Critical Density of Histone H3 Lysine 9 Tri-Methylation
    Spreading and epigenetic inheritance of heterochromatin require a critical density of histone H3 lysine 9 tri-methylation Amber R. Cutter DiPiazzaa, Nitika Tanejaa,1, Jothy Dhakshnamoorthya, David Wheelera, Sahana Hollaa, and Shiv I. S. Grewala,2 aLaboratory of Biochemistry and Molecular Biology, National Cancer Institute, NIH, Bethesda, MD 20892 Edited by Steven E. Jacobsen, University of California, Los Angeles, CA, and approved April 20, 2021 (received for review January 12, 2021) Heterochromatin assembly requires methylation of histone H3 domains coat pericentromeric, subtelomeric, and the silent mating- lysine 9 (H3K9me) and serves as a paradigm for understanding the type (mat) regions (9–12). Heterochromatin assembly is a multistep importance of histone modifications in epigenetic genome control. process that includes nucleation and spreading. The de novo nu- Heterochromatin is nucleated at specific genomic sites and spreads cleation of heterochromatin occurs at specific sites, such as repeat across extended chromosomal domains to promote gene silencing. elements within constitutive heterochromatin domains, from where Moreover, heterochromatic structures can be epigenetically inherited heterochromatin factors spread to surrounding sequences (13, 14). in a self-templating manner, which is critical for stable gene repres- RNAi machinery (13, 15), as well as factors involved in nuclear sion. The spreading and inheritance of heterochromatin are believed RNA processing and noncanonical RNA polymerase II termi- to be dependent on preexisting H3K9 tri-methylation (H3K9me3), nation (12, 16–19), nucleate heterochromatin by targeting the which is recognized by the histone methyltransferase Clr4/Suv39h multisubunit Clr4 methyltransferase complex (ClrC) (20) that is via its chromodomain, to promote further deposition of H3K9me. responsible for mono-, di-, and tri-methylation of histone H3K9 However, the process involving the coupling of the “read” and “write” (H3K9me1/2/3) (6, 21).
    [Show full text]