Bioresource Technology 193 (2015) 8–14

Contents lists available at ScienceDirect

Bioresource Technology

journal homepage: www.elsevier.com/locate/biortech

Protozoan grazing reduces the current output of microbial fuel cells ⇑ Dawn E. Holmes a,b, , Kelly P. Nevin a, Oona L. Snoeyenbos-West a, Trevor L. Woodard a, Justin N. Strickland a, Derek R. Lovley a

a Department of Microbiology, University of Massachusetts, Amherst, MA, United States b Department of Physical and Biological Sciences, Western New England University, Springfield, MA, United States

highlights

Inhibition of eukaryotic grazing increased power output of sediment MFC 2–5-fold. Geobacteraceae and Euplotes were enriched on current-harvesting anodes. Anaerobic protozoa prey on G. sulfurreducens in pure culture studies. Protozoan grazing can reduce current up to 91% in G. sulfurreducens fuel cells. Anode biofilms are 4-fold thinner in fuel cells with protozoa.

article info abstract

Article history: Several experiments were conducted to determine whether protozoan grazing can reduce current output Received 28 April 2015 from sediment microbial fuel cells. When marine sediments were amended with eukaryotic inhibitors, Received in revised form 9 June 2015 the power output from the fuel cells increased 2–5-fold. Quantitative PCR showed that Geobacteraceae Accepted 12 June 2015 sequences were 120 times more abundant on anodes from treated fuel cells compared to untreated fuel Available online 17 June 2015 cells, and that Spirotrichea sequences in untreated fuel cells were 200 times more abundant on anode surfaces than in the surrounding sediments. Defined studies with current-producing biofilms of Keywords: Geobacter sulfurreducens and pure cultures of protozoa demonstrated that protozoa that were effective Sediment fuel cell in consuming G. sulfurreducens reduced current production up to 91% when added to G. sulfurreducens Anaerobic protozoa Geobacteraceae fuel cells. These results suggest that anode biofilms are an attractive food source for protozoa and that protozoan grazing can be an important factor limiting the current output of sediment microbial fuel cells. Ó 2015 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

1. Introduction One strategy to enhance power output is to increase the anode surface area available for microbial colonization. Unfortunately, Although many applications have been proposed for microbial studies have shown that as the surface area is increased the power fuel cells, powering electronic monitoring devices with energy har- output may not scale linearly (Ewing et al., 2014) and large surface vested from marine sediments is one of the few applications that anodes are unwieldy and difficult to deploy. Another approach is to appear to be currently practical (Franks and Nevin, 2010; Logan, increase the supply of electron donor to anode microbes. Current 2009). However, the output of sediment fuel cells is relatively output can be directly related to the rate that fermentable organic low (4–55 mW/m2)(Girguis et al., 2010), which has led to many matter is degraded within sediments (Wardman et al., 2014; investigations designed to identify factors limiting current produc- Williams et al., 2010), which can be increased with the addition tion in order to develop strategies to increase current output and of particulate organic matter (i.e. cellulose, chitin, or algal biomass) expand the types of devices that can be powered with sediment that can be fermented to electron donors that will support current fuel cells. production (Cui et al., 2014; Rashid et al., 2013; Rezaei et al., 2009). However, the technical difficulty of amending sediments with organic material, especially in deep environments, as well as the need for repeated additions of the organics for long-term deploy- ⇑ Corresponding author at: Department of Microbiology, 203N Morrill Science ments, limits the applicability of this approach. Another approach Center IVN, University of Massachusetts Amherst, Amherst, MA 01003, United is to provide electron donors for current production within the States. Tel.: +1 413 577 2439; fax: +1 413 577 4660. anode itself (Nevin et al., 2011), but this strategy is not applicable E-mail address: [email protected] (D.E. Holmes).

http://dx.doi.org/10.1016/j.biortech.2015.06.056 0960-8524/Ó 2015 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14 9 for the multi-year operation desired for many applications of sed- iment fuel cells. A proven strategy for increasing current densities in laboratory studies is to colonize anodes with those microorganisms that have the most effective current production capabilities. Characteristics that confer high current densities include the ability to directly transfer electrons to electrodes and the formation of electrically conductive biofilms that permit cells that are part of the anode bio- film but not in direct contact with anodes to contribute to current production (Lovley, 2012). To date, the combination of these char- acteristics has only been documented in members of the Geobacteraceae (Malvankar and Lovley, 2014). The common pre- dominance of Geobacteraceae on anodes harvesting current from sediments and other environments suggests that microorganisms Fig. 1. Current generated by H cell inoculated with G. sulfurreducens strain PCA with these favorable characteristics already have a competitive grown with acetate (10 mM) provided as the electron donor in the presence and absence of Trepomonas and eukaryotic inhibitors cycloheximide and colchicine. advantage in colonizing anodes in many instances (Lovley, 2012). In laboratory studies it is possible to genetically engineer microor- ganisms with improved current capabilities (Leang et al., 2013), fuel cells constructed with autoclaved sediments in the presence but the feasibility of preemptively colonizing anodes of sediment and absence of inhibitors was also monitored to ensure that the fuel cells with engineered microbes has not been intensively inhibitors did not have an abiotic impact on current produced by investigated. sediment fuel cells (Supplementary Fig. 1). In open environments, such as sediments, there may be factors As previously described by Holmes et al. (2004), graphite (grade other than substrate availability limiting the growth of G10, Graphite Engineering and Sales, Greenville, MI) anodes Geobacteraceae in anode biofilms. For example, when the growth (3.9 cm 3.9 cm 0.3 cm) were placed 2–5 cm below the sedi- of Geobacter species in the subsurface was stimulated with the ment surface, and electrically connected to cathodes, constructed addition of high concentrations of electron donor in the form of of the same size and material, that were suspended in overlying acetate, a bloom of protozoa accompanied increases in Geobacter seawater, which was continuously bubbled with air. A resistor of growth and substantially lowered the accumulation of Geobacter 560 X was included in the circuit between the anode and cathode. biomass below that expected in the absence of protozoan grazing Current and voltage measurements were collected with a Keithley (Holmes et al., 2013). An anode biofilm also represents a substan- model 2000 multimeter (Keithley Instruments, Cleveland, OH). tial enrichment of Geobacteraceae likely to enhance grazing oppor- Current produced by all 6 fuel cells was monitored for 43 days at tunities for protozoa. Amoeboid protozoa have been shown to an incubation temperature of 18 °C. consume bacteria within a biofilm at rates of 1465 bacteria h1 (Rogerson et al., 1996) and mixed cultures of amoeba and flagel- lates can consume 55–75% of the cells comprising a biofilm 2.2. Defined culture studies (Zubkov and Sleigh, 1999). Here we report on sediment and defined culture studies that suggest that protozoan grazing on Trepomonas agilis strain RCP-1 (ATCC 50286), Breviata anathema anode biofilms may be an important factor limiting the current (ATCC 50338), and Hexamita inflata strain AZ-4 (ATCC 50268) were output of sediment microbial fuel cells. purchased from the American Type Culture Collection (ATCC). Heteromita strain DH-1 was isolated from sediments collected from a uranium-contaminated aquifer located in Rifle, Colorado and has 2. Methods 18S rRNA and b-tubulin gene sequences that are 97% and 92% iden- tical to the flagellate, Heteromita globosa (D. Holmes et al., manu- 2.1. Sediment microbial fuel cells script in preparation). G. sulfurreducens was obtained from our laboratory culture collection. Marine sediments and overlying water were separately col- Strict anaerobic culturing and sampling techniques were used lected from The Great Sippewissett Marsh (West Falmouth, MA) throughout (Balch et al., 1979). All protozoan cultures were grown as previously described Holmes et al. (2004) at a depth of 0.5 m anaerobically with G. sulfurreducens provided as the food source. B. in canning jars that were filled to the top and then sealed. Water anathema was maintained on medium containing a 1:3 mixture of from the sampling site was also collected in plastic containers as simplified ATCC medium 1171 (mucin, Tween-80, and rice starch previously described Holmes et al. (2004). Six 1-L glass beakers were omitted) and standard ATCC medium 802 (Sonneborn’s were filled 1/4 full with anoxic sediment and then the beakers Paramecium medium); T. agilis was maintained on ATCC 1171 were completely filled with water from the site. Prior to fuel cell TYGM-9 medium; H. inflata was maintained on ATCC 1773 construction, three of the sediments were amended with Hexamita medium; and Heteromita strain DH-1 was maintained 200 mg/L each of the eukaryotic inhibitors cycloheximide and col- on ciliate mineral medium consisting of (per liter distilled water): chicine. This concentration of inhibitors was selected because it 0.125 g K2HPO4, 0.025 g NH4Cl, 0.4 g NaCl, 0.2 g MgCl26H2O, 0.15 g has previously been shown to inhibit protozoan growth in sedi- KCl and 0.25 g CaCl22H2O, and 1% wheat starch (Sigma–Aldrich). ment microcosms (Holmes et al., 2014; Schwarz and Frenzel, For batch culture grazing studies, G. sulfurreducens strain PCAT 2005). In order to ensure that the eukaryotic inhibitors could not (ATCC51573) was grown in a bicarbonate-buffered freshwater act as electron shuttles, current generated by Geobacter sulfurre- medium (Lovley and Phillips, 1988) with fumarate (40 mM) pro- ducens in two-chambered ‘H-type’ fuel cells with acetate vided as the electron acceptor and H2 as the electron donor at (10 mM) provided as an electron donor in the presence of both 22 °C in the dark under N2–CO2 (80:20). Once cells reached station- inhibitors was monitored (Fig. 1). These pure culture studies ary phase (OD600nm of 0.8), protozoa were added to the medium. showed that similar current outputs were obtained by G. sulfurre- G. sulfurreducens cells were counted with acridine orange staining ducens grown in the presence or absence of inhibitors, indicating and epifluorescence microscopy as previously described (Hobbie that they could not act as shuttles. Power generated by sediment et al., 1977). Cells were diluted 100-fold, fixed with a 10% 10 D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14 glutaraldehyde solution, and stained with acridine orange (0.01% amplicon sizes ranging from 100 to 200 bp. Copies of the final concentration). One milliliter of this stained sample was then b-tubulin gene from strain DH-1 were quantified on the anode sur- concentrated with a vacuum pump (pressure was ca. 150 mm Hg) face and the surrounding medium from the G. sulfurreducens H-cell onto a 0.2 lm pore-size polycarbonate membrane filter (Millipore) with the following primer set: DH1-374f (50 and visualized by fluorescence microscopy on a Nikon Eclipse E600 GATGTGCACCTTCTCCGTTT 30) and DH1-494r (50 microscope. ATCGATCACCATCACCTCGT 30). Geobacteraceae 16S rRNA and G. sulfurreducens was cultured and grown in two-chambered Spirotrichea b-tubulin gene copies were amplified from the anode ‘H-type’ fuel cells with graphite anodes poised at +300 mV versus surface and surrounding sediments of a marine sediment fuel cell Ag/AgCl, as previously described Nevin et al. (2009) with continu- with Geobacteraceae 494f and Geobacteraceae 1050r (Holmes 0 ous gassing with H2 as the electron donor (H2/CO2/N2 7:20:73). et al., 2004) and Spirotrichea-13f (5 GGCGGGGGAAAGGAACTAA Anaerobically grown protozoan cultures (50 mL at a concentration 30) and Spirotrichea-127r (50 TTGACCCATTTGGTCTCTGCT 30). of 1 104 cells/mL) were concentrated by centrifugation at Quantitative PCR amplification and detection were performed 2000g for 15 min, resuspended in 5 mL of bicarbonate-buffered with the 7500 Real Time PCR System (Applied Biosystems) using freshwater medium (Lovley and Phillips, 1988), and added to the genomic DNA extracted from H-cells and marine sediment fuel anode chamber of fuel cells once current had stabilized (0.7– cells. All qPCR assays were run in triplicate. Each reaction mixture 1.0 mA). After a 5-day exposure to protozoan grazing by strain consisted of a total volume of 25 lL and contained 1.5 lL of the DH-1, biofilms were visualized with confocal scanning laser micro- appropriate primers (stock concentrations, 1.5 lM), 5 ng cDNA, scopy using LIVE/DEAD BacLight viability stain, as previously and 12.5 lL Power SYBR Green PCR Master Mix (Applied described Nevin et al. (2008). Percent reduction in current output Biosystems). Standard curves covering 8 orders of magnitude were from protozoan grazing was determined with the following constructed with serial dilutions of known amounts of DNA quan- calculation: tified with a NanoDrop ND-1000 spectrophotometer at an absor- bance of 260 nm. Gene copy numbers and qPCR efficiencies (95– current prior to inoculation with protozoa ¼ 1 100% : 99%) were calculated from appropriate standard curves. current 5 days after protozoan inoculation Optimal thermal cycling parameters consisted of an activation step at 50 °C for 2 min, an initial 10 min denaturation step at 95 °C followed by 50 cycles of 95 °C for 15 s and 60 °C for 1 min. 2.3. Analysis of bacterial and protozoan communities associated with After 50 cycles of PCR amplification, dissociation curves were made sediment fuel cells for all qPCR products by increasing the temperature from 60 °Cto 95 °C at a ramp rate of 2%. The curves all yielded a single predom- The composition of the microbial community found on anode inant peak, further supporting the specificity of the qPCR primer biofilms and surrounding sediments was determined as previously pairs. described (Holmes et al., 2004). Sediments (0.5 g) or the top mil- limeter of the anode scraped off with a sterile razor blade were resuspended in 1 mL TE/sucrose buffer (10 mM Tris–HCl, 1 mM 2.5. Phylogenetic analysis EDTA, 6.7% sucrose; pH 8.0). Sodium dodecyl sulfate (SDS 0.5% final concentration), proteinase K (0.1 mg/mL), and lysozyme (1 mg/mL 16S rRNA and b-tubulin sequences were assembled with final concentration) were then added and samples were incubated Geneious 5.6 and compared to GenBank nucleotide and protein at 37 °C for 30 min. Lysing matrix E (MP BioMedical) was added to databases with the blastn and blastx algorithms. Alignments were the tubes and they were placed in a FastPrep-24 bead-beater (MP made in ClustalX before phylogenetic trees were constructed with BioMedical) for 60 s at 5.5 m/s. Tubes were then centrifuged at Mega v6. The maximum likelihood algorithm with the 13,200 rpm for 15 min and supernatant was collected for DNA Nearest-Neighbor Interchange was used to construct all phyloge- extraction with the FastDNA SPIN Kit for Soil (MP Biomedicals). netic trees. All evolutionary distances were computed with the Several previously described primer pairs were used for ampli- Tamura-Nei substitution model with 100 bootstrap replicates. fication of 16S rRNA, and b-tubulin gene fragments from genomic The nucleotide sequences of 18S rRNA, b-tubulin from strain DNA. Gene fragments from the 16S rRNA gene were amplified with DH1 and 16S rRNA and b-tubulin sequences from marine sediment 8F (Eden et al., 1991) and 519R (Lane et al., 1985); and BT107F and fuel cells have been deposited in the GenBank database under BT261R (Baker et al., 2004) was used to amplify the b-tubulin gene. accession numbers KR047867–KR047883. A50lL PCR reaction consisted of the following solutions: 10 lL Q buffer (Qiagen), 0.4 mM of each dNTP, 1.5 mM MgCl2, 0.2 lMof 3. Results and discussion each primer, 5 lg bovine serum albumin (BSA), 2.5 U Taq DNA polymerase (Qiagen) and 10 ng of PCR template. Amplification 3.1. Impact of protozoan grazing on marine sediment fuel cells was performed with a minicycler PTC 200 (MJ Research) starting with 5 min at 94 °C, followed by 35 cycles consisting of denatura- In order to evaluate the impact that protozoan grazing might tion (30 s at 94 °C), annealing (45 s at 55–60 °C), extension (45 s at have on current output of microbial fuel cells, current production 72 °C), and a final extension at 72 °C for 10 min. was monitored in marine sediment fuel cells constructed with sed- After PCR amplification of these gene fragments, PCR products iments treated with or without the eukaryotic inhibitors cyclohex- were purified with the Gel Extraction Kit (Qiagen), and cloned into imide and colchicine (Fig. 2). There was variability in the current the TOPO TA cloning vector, version M (Invitrogen, Carlsbad, CA). output in both treatments, which is typical of sediment microbial One hundred plasmid inserts from each of these clone libraries fuel cells (Reimers et al., 2001; Tender et al., 2002). During the first were sequenced with the M13F primer at the University of 5 days of the experiment, current generated by treated fuel cells Massachusetts Sequencing Facility. was lower than untreated fuel cells. In this initial phase of anode colonization sulfide produced at a distance from the anode is likely 2.4. Quantitative PCR to be a more important electron donor for current until a

current-producing biofilm is established. It is possible that H2S All quantitative PCR (qPCR) primers were designed according to generated by sulfate reducing protozoan symbionts (Edgcomb the manufacturer’s specifications (Applied Biosystems) and had et al., 2011) can transfer electrons to the electrode and generate D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14 11

0.12

0.1 no eukaryotic inhibitors with eukaryotic inhibitors

) 0.08 2

0.06

0.04

Power density Power density (W/m 0.02

0 0 5 10 15 20 25 30 35 40 45 50 -0.02 Time (days)

Fig. 2. Power produced by marine sediment fuel cells assembled with sediment and water collected from The Great Sippewissett Salt Marsh in the presence or absence of the eukaryotic inhibitors cycloheximide and colchicine. Results are the mean and standard error of triplicate fuel cells for each treatment. some current. When inhibitors are added, both the protozoa and Previous studies have shown that Euplotes species are bacteri- their symbionts are destroyed and this abiotic effect is no longer ovorus (Turley et al., 1986). Thus, the specific association of observed, however further investigation into this possibility is Euplotes in anode biofilms and the increased current output from required. sediments treated with eukaryotic inhibitors are consistent with After this initial lag, fuel cells made with sediments treated with the hypothesis that protozoan grazing of anode biofilms can reduce eukaryotic inhibitors typically produced substantially more cur- the current output of sediment fuel cells. rent than those with anodes suspended in untreated sediments. Whereas power densities from untreated sediments were compa- 3.2. Studies with defined cultures rable to those previously reported in fuel cells assembled with 2 these same sediments and averaged 0.022 Watts per m of elec- In order to further evaluate whether protozoan grazing might trode surface area (Bond et al., 2002), power densities generated limit the output of sediment fuel cells, studies were conducted by fuel cells constructed with treated sediments were 2–5-fold with G. sulfurreducens, which typically serves as the model organ- 2 higher and averaged 0.046 W/m (Fig. 2). In fact, at the end of ism in studies on current production by Geobacteraceae (Lovley, the incubation period the sediment fuel cells with anodes in the 2012). H2 served as the electron donor to prevent potential inhibi- sediments treated with eukaryotic inhibitors produced current tion of grazing with an organic carbon source. that was 4.5-fold higher than the microbial fuel cells with T. agilis, H. inflata, and B. anathema were chosen as potential G. untreated sediments and the overall area of the power density plot sulfurreducens grazers because they are related to protozoa previ- from the treated fuel cells was 2.11 times greater than that from ously detected in Geobacter-enriched groundwater (Holmes et al., untreated controls. 2013) and Heteromita strain DH-1 is a protozoan isolate from those Bacterial communities found on fuel cell anodes from both sed- groundwaters (D.E. Holmes et al., manuscript in preparation). iment types were similar to previously reported studies (Bond Heteromita strain DH-1 grazed G. sulfurreducens most heavily, but et al., 2002; Holmes et al., 2004) with a predominance of T. agilis and H. inflata were also effective grazers (Fig. 4). Grazing Geobacteraceae species; accounting for 72% and 61% of the 16S rates of B. anathema were much slower. rRNA gene sequences recovered from anodes of the When the protozoa that were effective in grazing G. sulfurre- inhibitor-treated sediments and controls, respectively (Fig. 3A). ducens were added to anode chambers that contained The majority of Geobacteraceae 16S rRNA gene sequences (56% pre-established current-producing biofilms, there was a substan- and 55% on treated and untreated anodes) were most similar to tial reduction in current (Fig. 5). The lowest current outputs were Desulfuromusa succinoxidans (98% sequence identity). achieved in the presence of strain DH-1, which was the most effec- In addition to the specific enrichment of Geobacteraceae species tive predator of G. sulfurreducens in batch culture studies. Grazing on the current-harvesting electrodes, there was a specific enrich- by DH-1 resulted in a 91% reduction in current output (0.861 mA ment of protozoa associated with the anodes in untreated sedi- prior to inoculation compared to 0.0719 mA after 5 days of graz- ments (Fig. 3B). b-Tubulin sequences from the ciliate class ing). In contrast, there was no impact on current output in the Spirotrichea accounted for 65% of the protozoan population and presence of B. anathema, consistent with batch culture studies that 87% of these Spirotrichea sequences were most similar to showed this species was an ineffective grazer of G. sulfurreducens. Euplotes raikovi (91% nucleotide identity). In contrast, only 20% The addition of a heat-killed mixed culture of T. agilis, H. inflata, and 4% of the sequences amplified from surrounding sediments and strain DH-1 cells also had no impact on current production. clustered within the class Spirotrichea and the genus Euplotes.As In order to determine whether Heteromita strain DH-1, the most expected, no protozoa were detected on electrodes in the sedi- effective G. sulfurreducens grazer, was specifically associated with ments that were amended with eukaryotic inhibitors. the anode, as would be expected if it was actively grazing on the Quantitative PCR with specific primers for Spirotrichea biofilm, cells were quantified with qPCR primers targeting the b-tubulin and Geobacteraceae 16S rRNA genes demonstrated that, strain DH-1 b-tubulin gene. Heteromita strain DH-1 b-tubulin in the untreated sediments, Spirotrichea and Geobacteraceae were genes in DNA extracted from the anode biofilms 2 orders of magnitude higher on the anode surface than in the sed- (6.41 104 ± 5220; n = 3) were 10-fold more abundant than in iments surrounding the anodes. Although 16S rRNA library analy- the surrounding medium (8.2 103 ± 1909). ses indicated that the proportion of Geobacteraceae found on Imaging the anode biofilms with confocal scanning laser micro- treated and untreated anodes was similar, qPCR showed that scopy revealed that the presence of Heteromita strain DH-1 sub- Geobacteraceae were significantly (124 times) more abundant on stantially decreased the abundance of G. sulfurreducens on the treated anodes. anode. Biofilms found on anodes in control fuel cells were much 12 D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14

unclassified 100% betaproteobacteria 90% Tenericutes Spirochetes 80% Planctomycetes 70% other deltaproteobacteria Geobacteraceae 60% gammaproteobacteria 50% Firmicutes Fibrobacteres/Acidobacteria

sequences 40% epsilonproteobacteria Cyanobacteria 30% Chloroflexi 20% Chlamydiae/Verrucomicrobia Bacteroidetes/Chlorobi

Proportion of bacterial 16S rRNA gene 16S rRNA of bacterial Proportion 10% alphaproteobacteria 0% Acnobacteria electrode + inhibitor sediment + inhibitor electrode sediment

100% 90% Uroleptus 80% Spumella Sorogena 70% Paraphysomonas 60% Oxytrichidae 50% Oligohymenophorea 40% Jacobida 30%

from protozoan taxa protozoan from Euplotes 20% Euglenozoa

Percentage of B-tubulin sequences B-tubulin of Percentage 10% Colponema 0% Cercozoa sediment biofilm

Fig. 3. (A) Distribution of 16S rRNA gene sequences recovered from the surface of the anode or the surrounding sediments in marine sediment fuel cells in the presence or absence of the eukaryotic inhibitors. Results are the average of triplicate fuel cells for each treatment. (B) Distribution of the protozoan community found on the marine sediment fuel cell anode surface or in the surrounding sediments as determined by analysis of b-tubulin clone libraries. Results are the average of triplicate fuel cells for each treatment.

1.00E+10 control (no protozoa) Trepomonas Breviata Hexamita DH-1

1.00E+09

1.00E+08

1.00E+07

1.00E+06

1.00E+05 Number of G. sulfurreducens cells per ml of G. sulfurreducens Number

1.00E+04 0 50 100 150 200 250 Time (hours)

Fig. 4. Predation of Geobacter sulfurreducens by various anaerobic protozoan species (Breviata anathema, Trepomonas agilis, Hexamita inflata,orHeteromita strain DH-1). Results are the mean and standard deviation for triplicate cultures. thicker than biofilms exposed to protozoan grazing; 24 ± 10 lm culture studies demonstrated that protozoa effective in grazing on compared to 5 ± 4 lm. In addition, protozoan cells were apparent G. sulfurreducens reduced anode biofilm thickness and current out- in large areas of grazing within the strain DH-1 inoculated biofilm. put. Thus, the elimination of protozoan grazing is the most likely explanation for the increased current output when the sediments 3.3. Implications were treated with eukaryotic inhibitors. These results suggest that even if factors such as low electron donor availability that limit cur- The results suggest that protozoan grazing may be an important rent production of sediment fuel cells could be overcome, protozoan factor limiting the current output of sediment fuel cells. The pure grazing is likely to diminish power outputs well below those that can D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14 13

1.2 Current prior to inoculation with protozoa 5 days after inoculation with protozoa

1

0.8

0.6 Current (mA) (mA) Current

0.4

0.2

0 control (dead control (no protozoa) Breviata strain DH-1 Trepomonas Hexamita protozoa)

Fig. 5. Current generated by G. sulfurreducens grown in H-cells (H2 was provided as the electron donor) prior to addition of protozoa and 5 days after inoculation. Results are average of triplicate H-cells. be obtained with pure cultures of effective current-producing References microorganisms unless the grazing can be prevented. It is not sustainable to amend sediments with eukaryotic inhibi- Baker, B.J., Lutz, M.A., Dawson, S.C., Bond, P.L., Banfield, J.F., 2004. Metabolically active eukaryotic communities in extremely acidic mine drainage. Appl. tors for routine deployment of sediment fuel cells. However, the Environ. Microbiol. 70 (10), 6264–6271. size difference between current-producing Geobacteraceae Balch, W.E., Fox, G.E., Magrum, L.J., Woese, C.R., Wolfe, R.S., 1979. Methanogens: (1 0.5 lm) and protozoa (most are >5 lm) may make it feasible reevaluation of a unique biological group. Microbiol. Rev. 43 (2), 260–296. Bond, D.R., Holmes, D.E., Tender, L.M., Lovley, D.R., 2002. Electrode-reducing to provide a size-exclusion screen that would permit microorganisms that harvest energy from marine sediments. Science 295 current-producing microbes to access current-harvesting elec- (5554), 483–485. trodes while excluding protozoa. Another factor that may be limit- Cui, Y.F., Rashid, N., Hu, N.X., Rehman, M.S.U., Han, J.I., 2014. Electricity generation and microalgae cultivation in microbial fuel cell using microalgae-enriched ing accumulation of Geobacter biomass during subsurface anode and bio-cathode. Energy Convers. Manage. 79, 674–680. bioremediation is phage (Holmes et al., 2015). It would not be sur- Du, Z.W., Li, H.R., Gu, T.Y., 2007. A state of the art review on microbial fuel cells: a prising if phage also play a role in limiting biofilm densities on promising technology for wastewater treatment and bioenergy. Biotechnol. Adv. 25 (5), 464–482. electrodes harvesting current in sediments. Eden, P.A., Schmidt, T.M., Blakemore, R.P., Pace, N.R., 1991. Phylogenetic analysis of A frequently proposed application for microbial fuel cells other Aquaspirillum magnetotacticum using polymerase chain reaction amplified 16S than sediment fuel cells is anaerobic wastewater treatment with ribosomal RNA specific DNA. Int. J. Syst. Bacteriol. 41 (2), 324–325. simultaneous current harvesting (Du et al., 2007; Li et al., 2014). Edgcomb, V.P., Leadbetter, E.R., Bourland, W., Beaudoin, D., Bernhard, J.M., 2011. Structured multiple endosymbiosis of bacteria and archaea in a ciliate from It seems likely that protozoan grazing, and potentially phage, marine sulfidic sediments: a survival mechanism in low oxygen, sulfidic would be a factor limiting current outputs in these systems. sediments? Front. Microbiol. 2, 55. However, further investigations into this possibility are required. Ewing, T., Ha, P.T., Babauta, J.T., Tang, N.T., Heo, D., Beyenal, H., 2014. Scale-up of sediment microbial fuel cells. J. Power Sources 272, 311–319. Franks, A.E., Nevin, K.P., 2010. Microbial fuel cells, a current review. Energies 3 (5), 4. Conclusions 899–919. Girguis, P.R., Nielsen, M.E., Reimers, C.E., 2010. Fundamentals of sediment-hosted fuel cells. In: Raebey, K. (Ed.), Bioelectrical Systems, First ed. Springer Verlag Protozoan grazing appears to have an impact on power output Press. by marine sediment fuel cells. Addition of eukaryotic inhibitors Hobbie, J.E., Daley, R.J., Jasper, S., 1977. Use of nuclepore filters for counting bacteria by fluorescence microscopy. Appl. Environ. Microbiol. 33 (5), 1225–1228. to marine sediments significantly increased current. Molecular Holmes, D.E., Bond, D.R., O’Neill, R.A., Reimers, C.E., Tender, L.R., Lovley, D.R., 2004. studies showed that Geobacteraceae were enriched on Microbial communities associated with electrodes harvesting electricity from a current-harvesting anodes recovered from inhibitor treated and variety of aquatic sediments. Microb. Ecol. 48 (2), 178–190. Holmes, D.E., Giloteaux, L., Chaurasia, A.K., Williams, K.H., Luef, B., Wilkins, M.J., untreated sediments and that anaerobic protozoa from the genus Wrighton, K.C., Thompson, C.A., Comolli, L.R., Lovley, D.R., 2015. Evidence of Euplotes were associated with anode biofilms from untreated fuel Geobacter-associated phage in a uranium-contaminated aquifer. ISME J. 9 (2), cells. Defined studies with G. sulfurreducens showed that protozoa 333–346. were able to reduce current production up to 91% and that G. sul- Holmes, D.E., Giloteaux, L., Orellana, R., Williams, K.H., Robbins, M.J., Lovley, D.R., 2014. Methane production from protozoan endosymbionts following furreducens anode biofilms grown in the presence of protozoa were stimulation of microbial metabolism within subsurface sediments. Front. 4-fold thinner than biofilms from protozoan-free controls. Microbiol. 5. Holmes, D.E., Giloteaux, L., Williams, K.H., Wrighton, K.C., Wilkins, M.J., Thompson, C.A., Roper, T.J., Long, P.E., Lovley, D.R., 2013. Enrichment of specific protozoan Acknowledgement populations during in situ bioremediation of uranium-contaminated groundwater. ISME J. 7 (7), 1286–1298. This research was supported by Office of Naval Research Grant Lane, D.J., Pace, B., Olsen, G.J., Stahl, D.A., Sogin, M.L., Pace, N.R., 1985. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc. N00014-13-1–0550. Natl. Acad. Sci. U.S.A. 82 (20), 6955–6959. Leang, C., Malvankar, N.S., Franks, A.E., Nevin, K.P., Lovley, D.R., 2013. Engineering Geobacter sulfurreducens to produce a highly cohesive conductive matrix with Appendix A. Supplementary data enhanced capacity for current production. Energy Environ. Sci. 6 (6), 1901– 1908. Supplementary data associated with this article can be found, in Li, W.W., Yu, H.Q., He, Z., 2014. Towards sustainable wastewater treatment by using microbial fuel cells-centered technologies. Energy Environ. Sci. 7 (3), 911–924. the online version, at http://dx.doi.org/10.1016/j.biortech.2015.06. Logan, B.E., 2009. Exoelectrogenic bacteria that power microbial fuel cells. Nat. Rev. 056. Microbiol. 7 (5), 375–381. 14 D.E. Holmes et al. / Bioresource Technology 193 (2015) 8–14

Lovley, D.R., 2012. Electromicrobiology. Annu. Rev. Microbiol. 66 (66), 391–409. Rezaei, F., Richard, T.L., Logan, B.E., 2009. Analysis of chitin particle size on Lovley, D.R., Phillips, E.J., 1988. Novel mode of microbial energy metabolism: maximum power generation, power longevity, and Coulombic efficiency in organic carbon oxidation coupled to dissimilatory reduction of iron or solid-substrate microbial fuel cells. J. Power Sources 192 (2), 304–309. manganese. Appl. Environ. Microbiol. 54 (6), 1472–1480. Rogerson, A., Hannah, F., Gothe, G., 1996. The grazing potential of some unusual Malvankar, N.S., Lovley, D.R., 2014. Microbial nanowires for bioenergy applications. marine benthic amoebae feeding on bacteria. Europ. J. Protistol. 32 (2), 271–279. Curr. Opin. Biotechnol. 27, 88–95. Schwarz, M.V.J., Frenzel, P., 2005. Methanogenic symbionts of anaerobic ciliates and Nevin, K.P., Kim, B.C., Glaven, R.H., Johnson, J.P., Woodard, T.L., Methe, B.A., their contribution to methanogenesis in an anoxic rice field soil. FEMS DiDonato, R.J., Covalla, S.F., Franks, A.E., Liu, A., Lovley, D.R., 2009. Anode biofilm Microbiol. Ecol. 52 (1), 93–99. transcriptomics reveals outer surface components essential for high density Tender, L.M., Reimers, C.E., Stecher, H.A., Holmes, D.E., Bond, D.R., Lowy, D.A., current production in Geobacter sulfurreducens fuel cells. PLoS One 4 (5). Pilobello, K., Fertig, S.J., Lovley, D.R., 2002. Harnessing microbially generated Nevin, K.P., Richter, H., Covalla, S.F., Johnson, J.P., Woodard, T.L., Orloff, A.L., Jia, H., power on the seafloor. Nat. Biotechnol. 20 (8), 821–825. Zhang, M., Lovley, D.R., 2008. Power output and columbic efficiencies from Turley, C., Newell, R., Robins, D., 1986. Survival strategies of two small marine biofilms of Geobacter sulfurreducens comparable to mixed community microbial ciliates and their role in regulating bacterial community structure under fuel cells. Environ. Microbiol. 10 (10), 2505–2514. experimental conditions. Mar. Ecol. Prog. Ser. 33, 59–70. Nevin, K.P., Zhang, P., Franks, A.E., Woodard, T.L., Lovley, D.R., 2011. Anaerobes Wardman, C., Nevin, K.P., Lovley, D.R., 2014. Real-time monitoring of subsurface unleashed: aerobic fuel cells of Geobacter sulfurreducens. J. Power Sources 196 microbial metabolism with graphite electrodes. Front. Microbiol. 5. (18), 7514–7518. Williams, K.H., Nevin, K.P., Franks, A., Englert, A., Long, P.E., Lovley, D.R., 2010. Rashid, N., Rehman, M.S.U., Han, J.I., 2013. Recycling and reuse of spent microalgal Electrode-based approach for monitoring in situ microbial activity during biomass for sustainable biofuels. Biochem. Eng. J. 75, 101–107. subsurface bioremediation. Environ. Sci. Technol. 44 (1), 47–54. Reimers, C.E., Tender, L.M., Fertig, S., Wang, W., 2001. Harvesting energy from the Zubkov, M.V., Sleigh, M.A., 1999. Growth of amoebae and flagellates on bacteria marine sediment-water interface. Environ. Sci. Technol. 35 (1), 192–195. deposited on filters. Microb. Ecol. 37 (2), 107–115.