BASIC RESEARCH www.jasn.org

Hypertrophy in the Distal Convoluted Tubule of an 11b-Hydroxysteroid Dehydrogenase Type 2 Knockout Model

† Robert W. Hunter,* Jessica R. Ivy,* Peter W. Flatman, Christopher J. Kenyon,* Eilidh Craigie,* Linda J. Mullins,* Matthew A. Bailey,* and John J. Mullins*

*British Heart Foundation Centre for Cardiovascular Science and †Centre for Integrative Physiology, University of Edinburgh, Edinburgh, United Kingdom

ABSTRACT Na+ transport in the renal distal convoluted tubule (DCT) by the thiazide-sensitive NaCl cotransporter (NCC) is a major determinant of total body Na+ and BP. NCC-mediated transport is stimulated by aldo- sterone, the dominant regulator of chronic Na+ homeostasis, but the mechanism is controversial. Trans- port may also be affected by epithelial remodeling, which occurs in the DCT in response to chronic 2 2 perturbations in electrolyte homeostasis. Hsd11b2 / mice, which lack the enzyme 11b-hydroxysteroid dehydrogenase type 2 (11bHSD2) and thus exhibit the syndrome of apparent mineralocorticoid excess, provided an ideal model in which to investigate the potential for DCT hypertrophy to contribute to Na+ 2 2 retention in a hypertensive condition. The DCTs of Hsd11b2 / mice exhibited hypertrophy and hyper- plasia and the kidneys expressed higher levels of total and phosphorylated NCC compared with those of wild-type mice. However, the striking structural and molecular phenotypes were not associated with an increase in the natriuretic effect of thiazide. In wild-type mice, Hsd11b2 mRNA was detected in some tubule segments expressing Slc12a3, but 11bHSD2 and NCC did not colocalize at the protein level. Thus, the phosphorylation status of NCC may not necessarily equate to its activity in vivo, and the structural remodeling of the DCT in the knockout mouse may not be a direct consequence of aberrant corticosteroid signaling in DCT cells. These observations suggest that the conventional concept of mineralocorticoid signaling in the DCT should be revised to recognize the complexity of NCC regulation by corticosteroids.

J Am Soc Nephrol 26: 1537–1548, 2015. doi: 10.1681/ASN.2013060634

Na+ reabsorption in the renal distal convoluted tubule remodeling of DCTepithelium. In rodents, the DCT (DCT) determines total body Na+ and hence body fluid becomes hypertrophied and hyperplastic in re- volume and BP. Dysfunction of the NaCl cotransporter sponse to Na+ loading,9 loop diuretic therapy,9–11 (NCC) in the DCT perturbs BP not only in the extreme and genetic ablation of ROMK,12 as well as in mod- phenotypes of patients with Gitelman’s1 and Gordon’s2 els of Gordon’s syndrome.13,14 Conversely, DCT at- syndromes but also in healthy individuals,3 and the rophy has been observed in rats treated with thiazide inhibition of NCC by thiazide diuretics has a potent 4 antihypertensive effect. Received June 18, 2013. Accepted August 12, 2014. In the short term, NCC activity is regulated at the Published online ahead of print. Publication date available at molecular level; neurohormonal inputs converge on www.jasn.org. intracellular signaling networks (WNK-SPAK/OSR15 and SGK1/Nedd4-2 pathways6) that shuttle NCC to Correspondence: Dr. Robert Hunter, British Heart Foundation Centre for Cardiovascular Science, The Queen’sMedicalRe- 7 and from the plasma membrane and induce post- search Institute, University of Edinburgh, Room W3.33B, 47 Little translational protein modifications that modify trans- France Crescent, Edinburgh EH16 4TJ, UK. Email: robert. port function (phosphorylation8 and ubiquitylation6). [email protected] Sustained physiologic perturbations promote structural Copyright © 2015 by the American Society of Nephrology

J Am Soc Nephrol 26: 1537–1548, 2015 ISSN : 1046-6673/2607-1537 1537 BASIC RESEARCH www.jasn.org diuretics15 and in mice after the overexpression of wild-type considered to form part of the aldosterone-sensitive distal nephron WNK413 or after the genetic ablation of NCC16 or SPAK.17 In (ASDN). However, it is not known whether this effect is a direct some cases, structural remodeling correlates with changes in Na+ consequence of MR signaling in DCT cells or a secondary phe- transport function: DCT hypertrophy is associated with increased nomenon resulting from changes in electrolyte transport in other Na+ transport capacity in microperfused distal tubules in rats tubular segments. 2 2 exposed to chronic furosemide9,18 and with enhanced thiazide- Here we show that Hsd11b2 / mice exhibit hypertrophy sensitive Na+ excretion in a mouse model of Bartter’ssyndrome.19 and hyperplasia in the DCTand express phosphorylated NCC The cause of DCTremodeling is not fully understood; it has been (pNCC) in greater abundance. In wild-type mice, the DCT hypothesized that increased luminal Na+ delivery stimulates a does not express 11bHSD2 protein. We therefore conclude hypertrophic response dependent on proportional changes in that the structural and function changes in the DCT of 2 2 + 20,21 / [Na ]i. In the presence of a tonic stimulus to NaCl reabsorption Hsd11b2 mice were the indirect consequence of activated in the DCT, such a mechanism could result in a positive-feedback mineralocorticoid signaling pathways in other nephron loop whereby excessive NaCl reabsorption begets epithelial segments. hypertrophy and yet more NaCl reabsorption. We hypothesized that such a phenomenon contributes to the pathogenesis of hypertension in salt-retaining states. Such RESULTS positive feedback would ordinarily be suppressed by an intact renin-angiotensin-aldosterone system exerting negative feedback Hypertrophy and Hyperplasia of the DCT in 2 2 control of net urinary Na+ excretion. However, our work on a Hsd11b2 / Mice 2 2 mouse model of apparent mineralocorticoid excess (AME) The structure of the distal renal tubule in Hsd11b2 / and wild- provided an opportunity to study the consequences of epithelial type mice was evaluated by immunofluorescence. The thick remodeling when this negative feedback loop is interrupted. ascending loop of Henle (TALH) and DCT were recognized AME comprises low-renin hypertension, Na+ retention, hy- by apical immunoreactivity to NKCC2 and NCC antisera, re- pokalemic alkalosis, and polyuria in rare human kindreds spectively. AQP2 antiserum labeled a pool of cortical tubules carrying homozygous null mutations in the gene encoding comprising CNT and cortical collecting duct (CCD). In 2 2 11b-hydroxysteroid dehydrogenase type 2 (11bHSD2).22 This Hsd11b2 / mice, DCT cross-sections were larger in diam- enzyme is expressed in mineralocorticoid target tissue, where it eter and circumference and contained more cell nuclei than in inactivates glucocorticoids, thus preserving specificity at the the wild-type mice (Figure 1). The DCT epithelium was mineralocorticoid receptor (MR). Hypertension in AME is pre- thicker, reflecting increased cell height and nuclear crowding dominantly renal in origin and can be reversed by kidney trans- (Figure 1). Epithelial hyperplasia was most striking in those plantation.23 It is widely presumed that the Na+ retention results tubular cross-sections that were found in close proximity to from enhanced epithelial sodium channel (ENaC) activity in the glomeruli, suggesting that the remodeling was more pro- 2 2 connecting tubule (CNT) and collecting ducts,24–26 but several nounced in the proximal portion of the DCT. Hsd11b2 / kid- observations suggest a contribution from NCC activation. First, neys had fewer tubular cross-sections per unit area that expressed the ENaC inhibitor amiloride does not com- pletely ameliorate the hypertension in AME and is often used at high doses that may exert off-target effects.24,27 Second, thiazide diuretics can normalize BP in some patients with AME.28 Third, a gene variant associated with low 11bHSD2 activity was associated with increased thiazide sensitivity in BP in a hypertensive Sardinian population.29 Finally, a 2 2 mouse model of AME (Hsd11b2 / )exhibits hypertrophy in a tubular segment, tentatively identified using positional and morphologic criteria as the DCT.30,31 NCC activity is regulated by several neurohormonal systems, including the sym- patheticnerves,angiotensinII,glucocorticoids, sex steroids, vasopressin, and insulin.32 There is controversy regarding the influence of miner- alocorticoids, the dominant regulators of Figure 1. DCTs labeled with anti-NCC. Tiled fluorescence micrographs showing DCTs + 2 2 chronic Na balance. Aldosterone can activate in wild-type (A) and Hsd11b2 / (B) kidney cortex. Each image is taken from a different the NCC33–35;therefore,theDCTisclassically animal (55–65 days of age). Bar, 50 mm.

1538 Journal of the American Society of Nephrology J Am Soc Nephrol 26: 1537–1548, 2015 www.jasn.org BASIC RESEARCH

NKCC2 and AQP2 than in the wild-type mice, but this was not the case for the DCT. 2 2 Similarly, Hsd11b2 / kidneys had fewer tu- bular cells per unit area expressing NKCC2 and AQP2 than in the wild types but a greater density of tubular cells expressing NCC (Fig- ure 2, Supplemental Tables 1 and 2). Although these data were not obtained using formal morphometric methodology, they are never- theless consistent with the relative expansion of the DCT within the distal nephron.

Accelerated Epithelial Proliferation in the DCT A continuous infusion of bromodeoxyuri- dine (BrdU) was used to label the nuclei of cells that had divided during a 7-day period. ImmunostainingforNKCC2,NCC,orAQP2 permitted the calculation of the “BrdU in- dex” (the proportion of cell nuclei that had incorporated BrdU) within each segment of the distal nephron (Figure 3). The BrdU in- 2 2 dex was higher in the DCT of Hsd11b2 / kidneys than in the wild types at 60 days of age (Figure 3), suggesting that progressive DCT hyperplasia results from accelerated epithelial proliferation that continues throughout early adulthood. The BrdU in- dex was also elevated in AQP2-expressing cortical tubules but was suppressed in the 2 2 TALH of Hsd11b2 / mice, demonstrating that the proliferative phenotype extended into the CNT and/or collecting duct but did not reflect a global change in cell prolif- eration in the renal tubule (Figure 3). We Figure 2. Frequency distribution of histologic features in the distal renal tubule in wild- therefore concentrated our studies on mice 2 2 type and Hsd11b2 / kidneys. (A) Number of tubular cross-sections per field of view 2 2 at 60 days of age, reasoning that any process expressing NKCC2, NCC, or AQP2. Hsd11b2 / kidneys contain fewer tubular cross- contributing to DCT hypertrophy remained sections that express NKCC2 and AQP2 per unit area, but this is not the case for cross- active at this age and that previous work had sections expressing NCC. (B) Number of epithelial cell nuclei per field of view within 2 2 confirmed that hypertension in our model is NKCC2-, NCC-, and AQP2-expressing cortical tubules. Hsd11b2 / kidneys contain largely driven by renal Na+ retention at this fewer nuclei in NKCC2- and AQP2-expressing tubules but greater numbers of nuclei in 2 2 age.31 NCC-expressing tubules per unit area compared with the wild types. (C) Hsd11b2 / kidneys contain fewer glomeruli per field of view compared with the wild types. n=5 for Increased Total and Phosphorylated each genotype. *P,0.01 (genotypes compared by the unpaired t test). Full details of the NCC in the Plasma Membrane quantitative analysis are presented in Supplemental Tables 1 and 2. Immunoblotting of whole-kidney homo- genates was used to estimate the abundance of NCC and of the specific phosphorylated forms of NCC that Our antibody to total NCC raised bands of three distinct are associated with NaCl transport activity. Total NCC and the molecular masses; the lowest of these (at approximately 110 kD) phosphorylated forms pT53, pT58, and pS71 were more abundant was not present in plasma membranes but was enriched in 2 2 in Hsd11b2 / kidneys than in the wild types (Figure 4A). Differ- subapical membrane vesicles,nor was itrecognizedby antibodies ential centrifugation was used to prepare protein fractions enriched to pNCC (Figure 4, Supplemental Figures 1 and 2). These find- for plasma membranes (P1) or subapical membrane vesicles (P2). ings suggest that the lower band may represent a form of NCC Total NCC was more abundant in both fractions prepared from (either immature or partially degraded) that does not participate 2 2 Hsd11b2 / kidneysthaninthewildtypes(Figure4B). in active transport. However, given the uncertainty regarding the

J Am Soc Nephrol 26: 1537–1548, 2015 DCT in the Hsd11b2 Null Condition 1539 BASIC RESEARCH www.jasn.org

predominantly in the CNT or CCD (ENaC, NCX1, Trpv5, and calbindin-D28k), indicating that a molecular adaptation to increased solute transport extended into these segments.

Mechanisms Causing DCT Remodeling To explore the mechanisms driving DCT 2 2 hypertrophy in Hsd11b2 / kidneys, we tested the hypothesis that the structural phenotype was a direct consequence of the lack of 11bHSD2 in DCT cells. We used double-label immunofluorescence to determine the sites of 11bHSD2 expression in male C57BL6/J kidneys (used as the wild- type controls for the present experiments) relative to the following markers of known tubular segments: NKCC2, NCC, AQP2, parvalbumin, and calbindin-D28k (Figure 5, Supplemental Figure 3). The fluorescence signals associated with NCC and 11bHSD2 did not colocalize; in some sections, it was possible to observe the discontinuation of NCC expression and the start of 11bHSD2 expression in a continuous stretch of tubule (Figure 5). In microdissected tubular seg- ments, Hsd11b2 mRNA could be detected by PCR in the CCD, but was not consistently detected in the DCT (Figure 6). Our results 2/2 Figure 3. BrdU index within distal tubular segments in wild-type and Hsd11b2 support a model in which 11bHSD2 is ex- fl mice. (A) Representative uorescence micrograph showing NCC (green), BrdU (red), pressed in the CNT and CCD, but not the and gross structural information (DAPI stain, gray). The closed and open arrowheads DCT (Figure 7). mark examples of DCT cell nuclei staining positive and negative for BrdU, respectively. (B) 2 2 Because DCT hypertrophy in Hsd11b2 / Dual labeling of NKCC2 (green) and BrdU (red). (C) Dual labeling of AQP2 (green) and BrdU (red). There is some cross-reactivity of the secondary antibodies to BrdU and AQP2, but this mice did not result directly from the loss of does not impair the recognition of cell nuclei staining positive or negative for BrdU within 11bHSD2 from DCT cells, we sought a AQP2-expressing tubules. (D) BrdU index within cortical tubular epithelium expressing mechanism whereby changes in a different 2 2 NKCC2, NCC, or AQP2 in wild-type and Hsd11b2 / mice culled at 55–65 days of age nephron segment might influence DCT (n=5). Means and 95% confidence intervals are depicted by the solid and dashed lines, structure. Epithelial proliferation was sup- 2 2 respectively. *P,0.05 (genotypes compared by the unpaired t test). DAPI, 4’,6-diamidino- pressed within the TALH of Hsd11b2 / 2-phenylindole; D, DCT; G, glomerulus; P, proximal tubule. Scale bar, 50 mminA. mice, resulting in relative atrophy of this seg- 2 2 ment. Accordingly, Hsd11b2 / mice exhibited a progressive reduction in the molecular identity of each band, all three were evaluated in the abundance of NKCC2 as they aged (Figure 8), suggesting that densitometry analyses. diminished Na+ reabsorption in the TALH provides greater de- livery of Na+ to the DCT: a potent stimulus to DCT hypertrophy/ Molecular Adaptation in the Distal Renal Tubule of hyperplasia.9–12,21 However, changes in NKCC2 expression were 2 2 Hsd11b2 / Mice not sufficient to account for the DCT phenotype; the expression 2 2 To assess global changes in the molecular phenotype of the renal of NKCC2 in Hsd11b2 / mice at 30 days of age was no different 2 2 tubules in Hsd11b2 / mice, we used quantitative real-time PCR from the wild-type mice, whereas NCC was more abundant. (Q-PCR) to estimate the abundance of mRNA transcripts known 2 2 to be expressed in defined tubular segments. Transcripts ex- Thiazide-Sensitive Na+ Transport in Hsd11b2 / Mice pressed in the distal tubule were present in greater abundance We hypothesized that as a consequence of DCT hypertrophy 2 2 in Hsd11b2 / kidneys than in the wild types (Table 1). Tran- and increased NCC expression, a greater proportion of filtered scripts expressed in the DCT (NCC, parvalbumin, L-SPAK, and sodium would be reabsorbed through thiazide-sensitive path- 2 2 KS-WNK136,37) were more abundant, as were those expressed ways in Hsd11b2 / mice. We therefore measured the acute

1540 Journal of the American Society of Nephrology J Am Soc Nephrol 26: 1537–1548, 2015 www.jasn.org BASIC RESEARCH

2 2 Hsd11b2 / mice was no different from the wild type when assessed using an alternative thiazide diuretic (bendroflumethiazide) lacking carbonic anhydrase activity (Figure 9F). In order to provide a positive control cohort for the above studies of Na+ transport, wild-type mice were subjected to a continuous furosemide infusion for 7 days (a maneuver expected to augment Na+ reabsorption in the DCT).9,18 Phosphorylated forms of NCC (pT53 and pT58) were detected in greater abundance in the kidneys of furosemide- treated mice (Figure 10, A and B), consistent with activation of Na+ transport in the DCT as a consequence of greater Na+ delivery. These mice also exhibited an increase in the thiazide-induced increment in the frac- tional excretion of Na+ (Figure 10, C and D), demonstrating that in this context, increased expression of pNCC did correlate with greater thiazide-sensitive NaCl transport. Chronicfurosemideinducedsignificant 2 2 Figure 4. Total and phosphorylated forms of NCC in wild-type and Hsd11b2 / rises in plasma osmolality, plasma [Na+], and kidneys. Immunoblots of whole-kidney homogenates from wild-type (Hsd11b2, +) or hematocrit of a similar magnitude to those 2 2 knockout (2) mice culled at 55–65 days of age (n=5). (A) Total cellular protein (fraction detected in Hsd11b2 / mice (Supplemental – S0; 12 mg loaded per lane). Similar results are obtained in mice aged 30, 60, and 120 Tables 3). 150 days (Supplemental Figure 1). (B) Protein fractions are enriched by differential centrifugation for plasma membranes (P1, 6 mg per lane) or subapical membrane vesicles (P2, 30 mg per lane). Size markers are 117 kD (blots) and 55 kD (Coomassie gels). Signal densities are in arbitrary units relative to the wild-type group (mean and DISCUSSION 95% confidence interval). *P,0.05 (genotypes compared by the unpaired t test). The 2/2 specificity of these phosphoantibodies for NCC is confirmed by the presence of Hsd11b2 mice exhibit hypertrophy and a signal in immunoblots of the kidney cortex but not medulla (Supplemental Figure 2). hyperplasia of the DCT, with increased ex- AU, arbitrary unit; SAV, subapical membrane vesicle. pression of total and phosphorylated NCC. 11bHSD2 was not universally expressed in the DCT of wild-type mice. We conclude 2 2 response to hydrochlorothiazide (HCTZ) in conscious mice that the structural remodeling observed in the Hsd11b2 / housed in metabolic cages. The magnitude of the thiazide- mouse may be a secondary, rather than primary, response 2 2 induced natriuresis in Hsd11b2 / mice did not differ from that and we propose a modification to the conventional concept in wild-type mice (Figure 9, A and B). However, this experiment of the “aldosterone-sensitive” distal nephron. may have been confounded by thiazide-induced changes in glo- merular filtration or Na+ reabsorption via the ENaC in the CNT Molecular Definition of the ASDN and collecting ducts. Therefore, the acute response to HCTZ was The ASDN can be defined as that part of the nephron where evaluated by renal clearance in anesthetized mice receiving a con- 11bHSD2 is coexpressed with the MR. 11bHSD2 restricts the stant, volume-expanding infusion of a solution containing inulin bioavailability of glucocorticoids; thus, aldosterone is the domi- (permitting the calculation of a thiazide-induced increment in the nant corticosteroid regulating Na+ transport in this region. This fractional excretion of Na+) and during the constant infusion of paradigm of corticosteroid signaling enjoys robust empirical sup- the ENaC inhibitor benzamil. The magnitude of the thiazide- port in the CNT and CCD. ENaC expression/activity increases 2 2 induced natriuresis was no greater in Hsd11b2 / mice than in the when 11bHSD2 is inhibited by pharmacologic38,39 or genetic31 wild-typemice(Figure9,CandD).Similarresultswereobtained means, as a result of MR activation by glucocorticoids. in mice aged .120 days, when ENaC activity is downregulated in Whether the DCT should be included in the ASDN is less 2 2 Hsd11b2 / mice31 (Supplemental Figure 4). In this age group, clear and may depend on the species (Supplemental Table 5). the natriuresis induced by chronic treatment with HCTZ in wild- The unambiguous identification of DCT cells is critical; it is 2 2 type mice was blunted in Hsd11b2 / mice (Figure 9E). necessary to show coexpression of 11bHSD2 with NCC. This Urinary excretion of HCTZ did not differ between genotypes has been shown in the rabbit,40 so the ASDN comprises DCT, (Supplemental Figures 5). The acute natriuretic response in CNT, and CCD in this species. The presumption that the DCT

J Am Soc Nephrol 26: 1537–1548, 2015 DCT in the Hsd11b2 Null Condition 1541 BASIC RESEARCH www.jasn.org

Table 1. Estimate of transcript abundance by Q-PCR in whole-kidney forms part of the ASDN in the mouse arises homogenates from studies showing correlations between Expression Relative to the Wild Type NCC expression/activity and circulating P Gene 2 2 Value Wild Type Hsd11b2 / [aldosterone]; however, as discussed below, these effects could be indirect. Negative and positive controls 11bHSD2 1.00 (0.89 to 1.11) 0.00 (0.00 to 0.00) 3.02E-12a We found that NCC and 11bHSD2 were SGK1 1.00 (0.82 to 1.18) 1.31 (1.10 to 1.51) 1.91E-02b not colocalized at the protein level. Na+ transporters Hsd11b2 mRNA was absent or only weakly NHE3 1.00 (0.84 to 1.17) 0.78 (0.63 to 0.93) 3.61E-02b expressed in microdissected DCTs; the NKCC2 (total) 1.00 (0.87 to 1.13) 0.86 (0.68 to 1.03) 1.48E-01 physiologic significanceofthisisnotclear. NCC 1.00 (0.87 to 1.13) 1.77 (1.24 to 2.31) 5.03E-03b It is possible that 11bHSD2 expression was ENaCa 1.00 (0.92 to 1.08) 1.22 (1.06 to 1.38) 1.09E-02b below the detection sensitivity of our im- NDCBE 1.00 (0.86 to 1.15) 1.17 (0.87 to 1.48) 2.45E-01 munofluorescence or PCR approaches, but Other genes in the distal tubule fi 36,41 a others have reported similar ndings. Parvalbumin 1.00 (0.78 to 1.22) 2.04 (1.83 to 2.25) 1.20E-06 This suggests that protection of MR by Calbindin D28k 1.00 (0.87 to 1.13) 1.94 (1.67 to 2.20) 2.95E-06a 11bHSD2 is less robust in the DCT than NCX1 1.00 (0.87 to 1.13) 1.36 (1.05 to 1.67) 2.33E-02b TRPV5 1.00 (0.89 to 1.11) 2.02 (1.78 to 2.26) 3.12E-07a in the CNT and CCD, a concept with im- WNK4 1.00 (0.95 to 1.06) 1.31 (1.04 to 1.58) 1.94E-02b plications for corticosteroid signaling in WNK1 (total) 1.00 (0.85 to 1.15) 1.23 (0.89 to 1.56) 1.69E-01 these cells. Because the DCT expresses WNK1-L 1.00 (0.82 to 1.18) 1.10 (0.89 to 1.30) 4.15E-01 both the MR and glucocorticoid receptor, WNK1-KS 1.00 (0.86 to 1.14) 1.56 (1.17 to 1.95) 6.70E-03b Na+ transport is not likely to be regulated SPAK (total) 1.00 (0.81 to 1.19) 1.45 (1.23 to 1.66) 2.33E-03a solely by the canonical aldosterone signal- SPAK-L 1.00 (0.91 to 1.10) 1.35 (1.19 to 1.52) 6.82E-04a ing pathways present in principal cells; glu- SPAK-KS 1.00 (0.74 to 1.26) 1.46 (0.86 to 2.07) 1.19E-01 cocorticoids may exert a stronger influence OSR1 1.00 (0.92 to 1.08) 1.09 (0.96 to 1.22) 2.00E-01 here than in the CNT and CCD.42,43 It is PP4 1.00 (0.93 to 1.07) 1.00 (0.90 to 1.10) 9.73E-01 pertinentthatNCCisregulatedbythe fi Data are presented as the mean (95% con dence interval). Mice were culled at 55 to 65 days of age 6 (n=8 for each genotype). For each gene, transcript abundance was expressed relative to the mean SGK1/Nedd4-2 pathway in DCT cells. Al- abundance of three endogenous control genes (18S rRNA, TBP, and cyclophilin A) and then normalized though this is a classic target of MR signal- relative to the wild-type group. P values are from unpaired t tests. ing, this pathway may also be activated by aP,0.003, which is the individual error rate required to maintain the family error rate at 0.05 for 20 independent tests. glucocorticoids. bP,0.05. We therefore propose that murine DCT is not part of the ASDN. Whether this distinc- tion is anatomically fixed, or whether the DCT can be “recruited” to the ASDN in response to certain physiologic stimuli, is unknown. If the DCTisexcludedfromthe ASDN by virtue of its low or absent 11bHSD2 ex- pression, then the corollary is that NCC is not directly regulated by aldosterone. It is clear that aldosterone can increase both NCC expression33,34,44 and the natriuretic response to thiazides.45 However, it has not been shown that these effects are the direct consequence of MR activation in DCT cells. NCC is downregulated in mineralo- corticoid escape,46 suggesting that the effect of chronic aldosterone can be overridden by extrinsic factors. The effects of aldosterone on NCC could plausibly occur as a secondary consequence of MR activation in the CNT b – and CCD. For example, aldosterone-induced Figure 5. Expression of 11 HSD2 in the renal tubule of male C57BL/6J mice at 55 65 + days of age. (A) 11bHSD2 (red) and NCC (green) are not expressed in a common set of changes in distal K transport could affect + cortical tubules. Similar results are observed at 30 days of age. (B) High-power views of pNCC expression. Of relevance, K -induced the boxed regions in A, showing transitions between tubule segments expressing changes in the phosphorylation status of NCC and those expressing 11bHSD2. Bar, 200 mminA;100mminB. NCC are preserved in aldosterone-synthase

1542 Journal of the American Society of Nephrology J Am Soc Nephrol 26: 1537–1548, 2015 www.jasn.org BASIC RESEARCH

pNCC expression. Other facets of the AME phenotype might also activate NCC (e.g., hypokalaemia,47 alkalosis,48 chloride depletion,49 or sympathetic activation50). In this constitutive knockout, developmental effects are possible, including those resulting from increased glucocorticoid exposure in utero as a result of loss of the placental 11bHSD2 barrier.51 Our finding that there were fewer glomeruli per unit area in sections from 2 2 Hsd11b2 / kidneys suggests developmental nephron loss.

What Is the Functional Consequence of DCT Hypertrophy? DCT hypertrophy is associated with enhanced NaCl transport 9,18,19 Figure 6. Hsd11b2 expression in microdissected wild-type tu- in salt-losing states, contributing to a homeostatic defense bular segments. Tubular segments are microdissected from male against salt and water loss. We found that the increase in pNCC C57BL/6J kidneys, and cDNA prepared. Specific transcripts are evoked by chronic furosemide was associated with enhanced detected by using intron-spanning primer pairs in end-point PCR. thiazide-sensitive Na+ reabsorption. DCT hypertrophy has also Each lane represents a different microdissected tubule segment; been observed in mouse models of Gordon’s syndrome. This the positive control template is total kidney cDNA (+), and the hypertensive phenotype was substantially reversed by thiazide negative control templates are RT-negative control cDNA prep- diuretics or by crossbreeding to NCC knockout mice,13,14 2 aration from total kidney RNA (RT ) and water (aq). The Hsd11b2 indicating a close relationship between DCT structure and transcript is detected in the CCD, but is not consistently detected function. in the DCT. Slc12a3 (encoding NCC) is detected only in the DCT, 2/2 verifying the purity of the tubule preparations. Scnn1g (encoding However, in Hsd11b2 mice, DCT hypertrophy and in- ENaCg) is detected in the CCD, but also at lower levels in the creased expression of pNCC were not associated with an increased DCT. natriuretic response to thiazide either acutely or chronically. It is noteasytoaccountforsuchdissociation,be- cause the observed reduction of NHE3 and NKCC2 expression should preserve Na+ de- livery to the DCT. We can only speculate that 2 2 Na+ transport in the DCT of Hsd11b2 / mice might be limited by pathologic struc- tural remodeling, resulting in an epithelium that is not adapted for efficient solute trans- port. Abnormalities are found in subcellular (binucleation, nuclear hyperchromasia, and apical blebbing31)andtissuestructure(mul- Figure 7. Expression of 11bHSD2 protein in the wild-type renal tubule. Solid black tiplelayersofcellsonasinglebasement indicates strong expression, whereas hatched gray indicates weak expression. The membrane; Figure 1). discontinuous expression of AQP2 and 11bHSD2 in the CNT and CCD reflect the presence of these antigens in principal but not intercalated cells. We are unable to OurdatashowthatNCCphosphorylation detect 11bHSD2 protein in DCT cells. The Hsd11b2 transcript is detected at low levels status does not always correlate with awhole- in some microdissected DCT segments, but not in others. organ measure of transport activity. This dissociation has also been reported in SPAK heterozygote null mice, which have reduced knockout mice,47 demonstrating that K+ status can influence phosphorylation of NCC compared with wild-type mice but no pNCC expression via aldosterone-independent pathways. difference inthemagnitude ofthe thiazide-inducednatriuresis.52 We attempted to minimize confounding hemodynamic and off- 2 2 What Drives DCT Remodeling in Hsd11b2 / Mice? target effects in the design of our renal clearance protocol. We do With a lack of consistent 11bHSD2 expression in the DCT, the not think hemodynamic changes exerted a major effect on out- striking epithelial remodeling and increased expression of come in this study because our protocol achieves maximal NCC 2 2 pNCC observed in Hsd11b2 / mice is most likely to reflect blockade without affecting renal blood flow or GFR.53 It is un- 2 2 aberrant electrolyte transport elsewhere in the kidney. Herein, likely that the thiazide readout in Hsd11b2 / mice was masked we have implicated diminished NKCC2 expression, which by increased Na+ transport in the downstream tubule because would increase Na+ delivery out of Henle’s loop and into the we obtained the same results during concomitant ENaC block- DCT. In support of this, the remodeling appeared more pro- ade. We also discount a major contribution to the net natriuretic nounced in the proximal portion of the DCT and chronic response of off-target thiazide effects. Inhibition of Na+ reabsorp- administration of a loop diuretic evoked a similar increase in tion in the PCT after carbonic anhydrase inhibition is unlikely

J Am Soc Nephrol 26: 1537–1548, 2015 DCT in the Hsd11b2 Null Condition 1543 BASIC RESEARCH www.jasn.org

the male offspring of parents that were both homo- zygous for the null mutation; C57BL/6JOlaHsd wild-type controls were matched for age and sex. We confirmed that 11bHSD2 protein and enzyme 2 2 activity were absent from Hsd11b2 / kidneys (Supplemental Figure 6).

Immunofluorescence Administration of BrdU 2 2 Wild-type and Hsd11b2 / mice were implanted with an osmotic pump (model 1007D; Alzet) con- taining 50 mg/ml BrdU in 50% DMSO, which had been primed in 0.9% NaCl at 37°C overnight. 2 2 Figure 8. NKCC2 in wild-type and Hsd11b2 / kidneys. Immunoblots of total cellular Pumps remained in situ for 7 days before the ani- fi protein (fraction S0) from whole-kidney homogenates from wild-type (Hsd11b2, +) or mals were culled by perfusion xation. knockout (2) mice culled at three different ages (n=5 for each age). Twelve micro- grams are loaded per lane. Size markers are 117 kD (blots) and 55 kD (Coomassie Perfusion Fixation gels). *P,0.05 (genotypes compared by the unpaired t test). Kidneys were fixed in situ using a perfusion fixation protocol adapted from that described by Loffing and Kaissling.11,37 Under terminal anesthesia, the because similar results were obtained with bendroflumethiazide, infrarenal aorta was cannulated to permit retrograde perfusion with a which does not inhibit this enzyme. Similarly, blockade of the vent in the vena cava. Ten milliliters of heparinized saline (20 U/ml in sodium-dependent chloride/bicarbonate exchanger (NDCBE) PBS) was infused followed immediately by 50 ml fixative (fresh 4% by thiazides would increase renal Na+ excretion but in vivo in- para-formaldehyde in PBS, pH 7.4), delivered at a rate of 15 ml/min. hibition requires 6 hours54 and this natriuresis would not be The right kidney was removed, sectioned, and immersed in 4% para- captured in our acute study. formaldehyde at 4°C for 24 hours. The increased abundance of pNCC suggests that Na+ trans- 2 2 port in the DCTmay be upregulated in Hsd11b2 / mice; this Immunofluorescence is not supported by the renal clearance thiazide test. However, Indirect immunofluorescence detection of target antigens was per- both of these measures provide only an indirect assessment of formed using a Leica BOND-MAX robot, after an antigen retrieval NCC transport activity. This study does not provide a direct step. Primary antibodies and their dilutions were as follows: sheep measure of Na+ transport in the DCTand therefore we cannot anti-11bHSD2 (AB1296; EMD Millipore) at 1:6000, rabbit anti-NCC be sure of the true functional consequence of DCT hypertrophy (AB3553; EMD Millipore) at 1:2000, sheep anti-NKCC2 (Division of 2 2 in Hsd11b2 / mice. Signal Transduction Therapy, Dundee University) at 1:4000, goat 2 2 In conclusion, Hsd11b2 / mice exhibit hypertrophy and anti-AQP2 (sc-9882; Santa-Cruz Biotechnology) at 1:4000, rabbit hyperplasia of the DCT, with increased expression of total and anti-parvalbumin (PV25; Swant) at 1:60,000, rabbit anti-calbindin phosphorylated NCC. In our study, 11bHSD2 protein did not D-28k (CB38; Swant) at 1:100,000, and sheep anti-BrdU (20-BS17; colocalize with NCC in the wild-type renal tubule. Thus, the Fitzgerald) at 1:250. Secondary antibodies and their dilutions were as 2 2 structural remodeling of the DCT observed in Hsd11b2 / follows: goat anti-rabbit IgG-horseradish peroxidase (HRP) mice and the increased expression/phosphorylation of NCC (AB6112; Abcam, Inc.) at 1:500, rabbit anti-sheep IgG-HRP (Nordic may be a secondary consequence of unregulated MR activation Immunology) at 1:500, and rabbit anti-goat IgG-HRP (AP106P; EMD elsewhere in the nephron. This study contributes to a growing Millipore) at 1:500. The binding sites of HRP-conjugated secondary recognition that aldosterone is not necessarily the dominant antibodies were detected using a tyramide-labeled fluorophore (either controller of Na+ transport in the DCT, especially in the mouse. Cy3 or Cy5).

Semiquantitative Immunoblotting CONCISE METHODS Protein Sample Preparation Kidneys were homogenized in a buffer containing phosphatase, kinase, Complete methods are provided in the Supplemental Methods. andproteaseinhibitors(250mMsucrose,10mMtriethanolamine,2mM EDTA, 50 mM NaF, 25 mM Na b-glycerophosphate, 5 mM Na pyro- Animals phosphate, 1 mM Na orthovanadate, and 1% Protease Inhibitor Cocktail All experiments were conducted in accordance with UK Home Office Set III [Calbiochem], pH 7.6). Supernatants from two 15-minute cen- 2 2 regulations and the Animals (Scientific Procedures) Act 1986. Hsd11b2 / trifugations at 4000g were pooled to form a total cellular protein fraction mice were derived from a colony carrying a null mutation in the Hsd11b2 (S0), free from gross cellular and nuclear debris. This fraction was subject gene on the C57BL/6JOlaHsd background.31 Experimental animals were to a further centrifugation at 16,000g for 32 minutes to pellet a fraction

1544 Journal of the American Society of Nephrology J Am Soc Nephrol 26: 1537–1548, 2015 www.jasn.org BASIC RESEARCH

(P1) enriched in plasma membranes; the superna- tant from this spin was centrifuged at 200,000g for 60 minutes to pellet a fraction (P2) enriched in subapical membrane vesicles.

SDS-PAGE and Immunoblotting Samples were resolved by SDS-PAGE on NuPAGE Novex 3%–8% Tris-acetate gels (Invitrogen) and then transferred to an Amersham Hybond-P PDVF membrane (GE Healthcare). Primary anti- bodies and their dilutions were as follows: rabbit anti-NCC (AB3553; EMD Millipore) at 1:1000; sheep anti-pT53-NCC, anti-pT58-NCC, and anti-pS71-NCC (Division of Signal Transduction Therapy, Dundee University), each at 1:500 (0.2–1.2 mg/ml); and sheep anti-NKCC2 (DSTT, Dundee) at 1:10,000. For Western blots designed to recognize specific phosphorylated forms of NCC, the corresponding nonphos- phorylated peptide was included in the solution of primary antibody at a final concentration of 10 mg/ml. Secondary antibodies and their dilutions were as follows: goat anti-rabbit IgG-HRP (sc- 2030; Santa-Cruz Biotechnology) at 1:2000, and donkey anti-sheep IgG-HRP (A3415; Sigma-Aldrich) at 1:20,000. Peroxidase activity was revealed using SuperSignal West Pico Chemiluminescent Substrate to expose photo- graphic film. During densitometry analysis, the density of each band was divided by that of a band from the same sample stained with Coomassie blue.

Figure 9. Natriuretic response to thiazide in mice at 55–65 days of age. (A) Natriuretic Q-PCR response to HCTZ (20 mg/kg body wt intraperitoneally) administered to conscious RNA was extracted from frozen mouse kidneys 2/2 mice in metabolic cages (wild-type mice, n=11; Hsd11b2 mice, n=10). (B) Meta- using the QIAGEN RNeasy Mini Kit, using a + bolic cage data are presented as the thiazide-induced increment in urinary Na ex- protocol that included an on-column treatment fi . cretion for each mouse. There is no signi cant difference between genotypes (P 0.05 with DNase I. cDNAwas transcribed from 500 ng by the unpaired t test). (C) The FENa in anesthetized mice in a renal clearance study 2 2 of total RNA using the Applied Biosystems (wild-type mice, n=9; Hsd11b2 / mice, n=8) is determined at baseline, after BZM High-Capacity cDNA Reverse Transcription Kit. and after BZM plus HCTZ (2 mg/kg intravenously). Neither the diuretic responses to BZM, nor the response to HCTZ, differs between genotypes (P.0.05 by two-way Q-PCR assays made use of the Roche Universal repeated measures ANOVA and post hoc Bonferroni tests). (D) Clearance data are ProbeLibrary (Supplemental Table 4). Reactions presented as the thiazide-induced increment in FENa for each mouse (i.e., FENa during were run on a Roche LightCycler 480. 18S rRNA, HCTZ and BZM minus FENa during BZM only). There is no significant difference between TBP, and cyclophilin A were selected as endoge- genotypes (P.0.05 by the unpaired t test). (E) UNaV in mice aged .120 days treated with nous control genes because these transcripts did 2 2 chronic HCTZ. Mice receive daily intraperitoneal injections of vehicle during the baseline not differ in abundance between Hsd11b2 / and period (days 22 to 0) and then daily injections of HCTZ (20 mg/kg intraperitoneally) for 7 wild-typekidneys.Allotherassayswereexpressed 2/2 , days (wild-type mice, n=5; Hsd11b2 mice, n=5). P 0.05 (for genotype, time, and relative to the mean of the endogenous control genes. interaction by two-way ANOVA). *P,0.05 (for comparison between genotypes by post 2/2 hoc Bonferroni test). (F) FENa in a renal clearance study (wild-type mice, n=5; Hsd11b2 mice, n=3 aged .120 days) determined at baseline and after BFZ (12 mg/kg in- Tubule Segment Microdissection travenously). There is no significant difference between genotypes. All data are means Microdissection and Preparation of RNA and 95% confidence intervals. BFZ, bendroflumethiazide; BW, body weight; BZM, benzamil; and cDNA + Wild-type male C57BL/6 mice were subjected to FENa, fractional excretion of Na ;UNaV, urinary sodium excretion. terminalanesthesia.The left kidneywasperfused in situ though a catheter placed in the abdominal aorta with 1 ml ice-cold heparinized 0.9% NaCl

J Am Soc Nephrol 26: 1537–1548, 2015 DCT in the Hsd11b2 Null Condition 1545 BASIC RESEARCH www.jasn.org

MgCl2, 0.025 U/ml Taq DNA polymerase (Thermo Fisher Scientific), and template cDNA from approximately 25 mm of tubule. PCR condi- tions were as follows: 95°C for 3 minutes, then 33 cycles of 94°C for 20 seconds, 59°C for 30 seconds, 72°C for 45 seconds, and then 72°C for 7 minutes. Intron-spanning primers were designed to amplify gene products from Hsd11b2 (59-ctgctggct- gctctcgactg and 59-ccagaacacggctgatgtcctc), Slc12a3 (59-ctaccaatggcaaggtcaag and 59-tagga- gatggtggtccagaa), and Scnn1g (59-ccaaagccag- caaataaacaaa and 59-gcggcgggcaataatagaga).

Thiazide-Sensitive Tubular Na+ Reabsorption Acute HCTZ Mice were housed individually in metabolic cages that enabled the independent collection of urine and feces and were left to acclimatize for 4 days before any experimental data were ob- tained. Each mouse was given an intraperitoneal injection of vehicle (approximately 0.2 ml 2% Figure 10. Molecular and functional adaptation to chronic furosemide in wild-type mice. (A and B) Immunoblots of total and phosphorylated NCC in wild-type mice DMSO), immediately followedbya6-hoururine treated with chronic furosemide (approximately 90 mg/kg per day for 7 days; n=5) and collection. Mice received an injection of HCTZ in untreated controls (n=5). Size markers are 117 kDa (blots) and 55 kDa (Coomassie (20 mg/kg body wt) 24 hours later, followed by a gels). *P,0.05 (comparison between treated and untreated groups by the unpaired further 6-hour urine collection. Urine collec- t test). (C) FENa in anesthetized mice (control mice, n=7; furosemide-treated mice, tions were timed to fall during the animal’s active n=6). Data are presented as in Figure 9C. ***P,0.001 (comparison between control phase (i.e., the dark phase of a 24-hour dark/ and furosemide-treated groups by two-way repeated-measures ANOVA and post hoc light cycle). Bonferroni test). (D) Data are presented as the thiazide-induced increment in FENa for each mouse (as in Figure 9D). *P,0.05 (comparison between control and furosemide- Chronic HCTZ treated groups by the unpaired t test). All data are means and 95% confidence in- Mice were housed individually in metabolic tervals. AU, arbitrary unit; FE , fractional excretion of Na+. Na cages and acclimatized as above. Each mouse was given an intraperitoneal injection of vehicle followed by 2 ml HBSS (in mM: NaCl 140, KCl 5, MgSO4 0.8, MgCl2 1, (approximately 0.2 ml 2% DMSO) daily for 3 days during the baseline

Na2HPO4 0.33, NaH2PO4 0.44, CaCl2 0.5, glucose 5, HEPES 10, and period and then an injection of HCTZ (20 mg/kg body wt) daily for NaOH 5, pH 7.4) and then 2 ml collagenase solution containing 7 days during the test period. Urine samples were collected over 250 mg/ml collagenase type IA (Sigma-Aldrich) in HBSS. The kidney 24 hours. was decapsulated and cut into thin corticomedullary wedges, which were incubated in collagenase solution for 30 minutes at 37°C. These Renal Clearance were then transferred to microdissection medium (0.1% BSA, 10 mM Renal clearance experiments were performed as previously de- ribonucleoside vanadyl complex in HBSS) and placed on ice during 1–2 scribed.31 Mice were anesthetized with thiobutabarbital sodium salt hours of microdissection. DCTs and CCDs were dissected from the hydrate (Inactin; Sigma-Aldrich) and catheters were inserted into the cortex. trachea, jugular vein, carotid artery, and bladder. A bolus dose Approximately 0.5-mm lengths of tubule were transferred into (0.1 ml/10 g body wt) of physiologic saline solution was given via 400 ml denaturing solution (4 M guanidine thiocyanate, 25 mM Na the jugular catheter as soon as intravenous access was established, citrate, pH 7, 0.5% sarcosyl, and 100 mM b-mercaptoethanol). RNA followed by a continuous infusion of 0.2 ml/10 g per hour. This in- was prepared by phenol-chloroform extraction, and the total RNA fusate comprised 100 mM NaCl, 5 mM KCl, 15 mM NaHCO3,and from each 0.5-mm tubule used as the template for cDNA synthesis 0.25% FITC-inulin (pH 7.4). A 60-minute equilibration period was using the Applied Biosystems High-Capacity cDNA Reverse Tran- followed by three 40-minute collection periods, during which urine scription Kit. was collected under water-saturated mineral oil. After the first con- trol collection, a bolus dose of benzamil (2 mg/kg body wt) was PCR administered intravenously, followed by a continuous infusion Template cDNA was amplified by PCR in 20-ml reactions containing (1 mg/kg per hour for the remainder of the experiment). A 20-minute 0.1 mM dNTPs, 0.5 mM each of forward and reverse primers, 1.5 mM period of re-equilibration was followed by a second 40-minute urine

1546 Journal of the American Society of Nephrology J Am Soc Nephrol 26: 1537–1548, 2015 www.jasn.org BASIC RESEARCH collection. Mice then received a bolus dose of HCTZ (2 mg/kg body 2. Wilson FH, Kahle KT, Sabath E, Lalioti MD, Rapson AK, Hoover RS, wt), followed by another 20-minute re-equilibration and then a final Hebert SC, Gamba G, Lifton RP: Molecular pathogenesis of inherited hypertension with hyperkalemia: The Na-Cl cotransporter is inhibited 40-minute urine collection. Approximately 80-ml blood samples were – fi bywild-typebutnotmutantWNK4.Proc Natl Acad Sci U S A 100: 680 obtained from the arterial line at the end of the rst equilibration 684, 2003 period and after each urine collection; these were used to determine 3. Ji W, Foo JN, O’Roak BJ, Zhao H, Larson MG, Simon DB, Newton-Cheh plasma [inulin]. At the end of the protocol, a 1-ml sample of blood was C, State MW, Levy D, Lifton RP: Rare independent mutations in renal obtained for the measurement of plasma [Na+], [K+], and osmolality. salt handling genes contribute to blood pressure variation. Nat Genet – A subset of mice was used in a renal clearance study to determine 40: 592 599, 2008 fl 4. Ernst ME, Moser M: Use of diuretics in patients with hypertension. the acute natriuretic effect of bendro umethiazide (12 mg/kg body wt NEnglJMed361: 2153–2164, 2009 intravenously). A 40-minute baseline collection period was followed 5. Ko B, Hoover RS: Molecular physiology of the thiazide-sensitive so- by the bendroflumethiazide bolus, followed by 20 minutes of re- dium-chloride cotransporter. Curr Opin Nephrol Hypertens 18: 421– equilibration and then a second 40-minute collection period. 427, 2009 6. Arroyo JP, Lagnaz D, Ronzaud C, Vázquez N, Ko BS, Moddes L, Ruffieux-Daidié D, Hausel P, Koesters R, Yang B, Stokes JB, Hoover RS, Chronic Furosemide Treatment Gamba G, Staub O: Nedd4-2 modulates renal Na+-Cl- cotransporter Mice were implanted with a subcutaneous osmotic pump (model via the aldosterone-SGK1-Nedd4-2 pathway. J Am Soc Nephrol 22: 2001; Alzet) containing furosemide (80 mg/ml in 50% DMSO, pH 8.0), 1707–1719, 2011 delivering a dose of approximately 90 mg/kg per day. The pumps 7. Sandberg MB, Riquier AD, Pihakaski-Maunsbach K, McDonough AA, Maunsbach AB: ANG II provokes acute trafficking of distal tubule Na remained in situ for 7 days, during which time the mice had access to +-Cl(-) cotransporter to apical membrane. Am J Physiol Renal Physiol both tap water and salt solution (0.8% NaCl, 0.1% KCl). 293: F662–F669, 2007 8. Chiga M, Rai T, Yang SS, Ohta A, Takizawa T, Sasaki S, Uchida S: Dietary salt regulates the phosphorylation of OSR1/SPAK kinases and the so- Statistical Analyses – Data are presented as the mean and 95% confidence interval for the dium chloride cotransporter through aldosterone. Kidney Int 74: 1403 1409, 2008 mean. Experimental groups were compared by the unpaired t test or 9. Ellison DH, Velázquez H, Wright FS: Adaptation of the distal convoluted by ANOVAwith post hoc Bonferroni or Dunnett’s tests as appropriate. tubule of the rat. Structural and functional effects of dietary salt intake For multiple comparisons by t test, the Dunn–Sidák method was used and chronic diuretic infusion. JClinInvest83: 113–126, 1989 to apply a correction to maintain the family-wise error rate (p)at 10. Kaissling B, Stanton BA: Adaptation of distal tubule and collecting duct 0.05, where the individual error rate is a =1–(1–p)1/n, for n inde- to increased sodium delivery. I. Ultrastructure. Am J Physiol 255: F1256–F1268, 1988 pendent tests. 11. Loffing J, Le Hir M, Kaissling B: Modulation of salt transport rate affects DNA synthesis in vivo in rat renal tubules. Kidney Int 47: 1615–1623, 1995 12. Wagner CA, Loffing-Cueni D, Yan Q, Schulz N, Fakitsas P, Carrel M, ACKNOWLEDGMENTS Wang T, Verrey F, Geibel JP, Giebisch G, Hebert SC, Loffing J: Mouse model of type II Bartter’s syndrome. II. Altered expression of renal so- The authors thank Mike Millar (Immunodection Core Facility, Queen’s dium- and water-transporting proteins. Am J Physiol Renal Physiol 294: F1373–F1380, 2008 Medical Research Institute) for his assistance with immunofluores- 13. Lalioti MD, Zhang J, Volkman HM, Kahle KT, Hoffmann KE, Toka HR, ’ cence. Wealso thank Kevin O Shaughnessy (Cambridge University) and Nelson-Williams C, Ellison DH, Flavell R, Booth CJ, Lu Y, Geller DS, Annie Mercier Zuber (Lausanne University) for their invaluable advice Lifton RP: Wnk4 controls blood pressure and potassium homeostasis regarding tubule segment microdissection. via regulation of mass and activity of the distal convoluted tubule. Nat – The authors acknowledge support from aBritish HeartFoundation Genet 38: 1124 1132, 2006 14. YangS-S,MorimotoT,RaiT,ChigaM,SoharaE,OhnoM,UchidaK,Lin Centre of Research Excellence Award and from Kidney Research UK. S-H, Moriguchi T, Shibuya H, Kondo Y, Sasaki S, Uchida S: Molecular R.W.H. received an Edinburgh Clinical Academic Track Fellowship pathogenesis of pseudohypoaldosteronism type II: Generation and funded by the Wellcome Trust. J.R.I. was supported by a British Heart analysis of a Wnk4(D561A/+) knockin mouse model. Cell Metab 5: 331– Foundation Scholarship. 344, 2007 15. Loffing J, Loffing-Cueni D, Hegyi I, Kaplan MR, Hebert SC, Le Hir M, Kaissling B: Thiazide treatment of rats provokes apoptosis in distal tu- bule cells. Kidney Int 50: 1180–1190, 1996 DISCLOSURES 16. Loffing J, Vallon V, Loffing-Cueni D, Aregger F, Richter K, Pietri L, None. Bloch-Faure M, Hoenderop JG, Shull GE, Meneton P, Kaissling B: Al- tered renal distal tubule structure and renal Na(+) and Ca(2+) handling in a mouse model for Gitelman’s syndrome. JAmSocNephrol15: 2276–2288, 2004 REFERENCES 17. McCormick JA, Mutig K, Nelson JH, Saritas T, Hoorn EJ, Yang C-L, Rogers S, Curry J, Delpire E, Bachmann S, Ellison DH: A SPAK isoform 1. Simon DB, Nelson-Williams C, Bia MJ, Ellison D, Karet FE, Molina AM, switch modulates renal salt transport and blood pressure. Cell Metab Vaara I, Iwata F, Cushner HM, Koolen M, Gainza FJ, Gitleman HJ, Lifton 14: 352–364, 2011 RP: Gitelman’s variant of Bartter’s syndrome, inherited hypokalaemic 18. Stanton BA, Kaissling B: Adaptation of distal tubule and collecting duct alkalosis, is caused by mutations in the thiazide-sensitive Na-Cl cotransporter. to increased Na delivery. II. Na+ and K+ transport. Am J Physiol 255: Nat Genet 12: 24–30, 1996 F1269–F1275, 1988

J Am Soc Nephrol 26: 1537–1548, 2015 DCT in the Hsd11b2 Null Condition 1547 BASIC RESEARCH www.jasn.org

19. Cantone A, Yang X, Yan Q, Giebisch G, Hebert SC, Wang T: Mouse versus glucocorticoid receptor occupancy mediating aldosterone- model of type II Bartter’s syndrome. I. Upregulation of thiazide-sensitive stimulated sodium transport in a novel renal cell line. J Am Soc Nephrol Na-Cl cotransport activity. Am J Physiol Renal Physiol 294: F1366–F1372, 16: 878–891, 2005 2008 40. Velázquez H, Náray-Fejes-Tóth A, Silva T, Andújar E, Reilly RF, Desir 20. Stanton BA, Kaissling B: Regulation of renal ion transport and cell GV, Ellison DH: Rabbit distal convoluted tubule coexpresses NaCl co- growth by sodium. Am J Physiol 257: F1–F10, 1989 transporter and 11 beta-hydroxysteroid dehydrogenase II mRNA. 21. Beck FX, Ohno A, Müller E, Seppi T, Pfaller W: Inhibition of angiotensin- Kidney Int 54: 464–472, 1998 converting enzyme modulates structural and functional adaptation to 41. Náray-Fejes-Tóth A, Fejes-Tóth G: Novel mouse strain with Cre re- loop diuretic-induced diuresis. Kidney Int 51: 36–43, 1997 combinase in 11beta-hydroxysteroid dehydrogenase-2-expressing 22. Hassan-Smith Z, Stewart PM: Inherited forms of mineralocorticoid hy- cells. Am J Physiol Renal Physiol 292: F486–F494, 2007 pertension. Curr Opin Endocrinol Diabetes Obes 18: 177–185, 2011 42. Ellison DH, Brooks VL: Renal nerves, WNK4, glucocorticoids, and salt 23. Palermo M, Delitala G, Sorba G, Cossu M, Satta R, Tedde R, Pala A, transport. Cell Metab 13: 619–620, 2011 Shackleton CH: Does kidney transplantation normalise cortisol me- 43. Hunter RW, Ivy JR, Bailey MA: Glucocorticoids and renal Na+ transport: tabolism in apparent mineralocorticoid excess syndrome? JEndocrinol Implications for hypertension and salt sensitivity. JPhysiol592: 1731– Invest 23: 457–462, 2000 1744, 2014 24. Quinkler M, Stewart PM: Hypertension and the cortisol-cortisone 44. Chen Z, Vaughn DA, Blakely P, Fanestil DD: Adrenocortical steroids shuttle. JClinEndocrinolMetab88: 2384–2392, 2003 increase renal thiazide diuretic receptor density and response. JAm 25. Cowley AW Jr: The genetic dissection of essential hypertension. Nat Soc Nephrol 5: 1361–1368, 1994 Rev Genet 7: 829–840, 2006 45. van der Lubbe N, Lim CH, Meima ME, van Veghel R, Rosenbaek LL, 26. Knops NB, Monnens LA, Lenders JW, Levtchenko EN: Apparent min- Mutig K, Danser AHJ, Fenton RA, Zietse R, Hoorn EJ: Aldosterone does not eralocorticoid excess: Time of manifestation and complications despite require angiotensin II to activate NCC through a WNK4-SPAK-dependent treatment. Pediatrics 127: e1610–e1614, 2011 pathway. Pflugers Arch 463: 853–863, 2012 27. Cooper M, Stewart PM: The syndrome of apparent mineralocorticoid 46. Wang XY, Masilamani S, Nielsen J, Kwon TH, Brooks HL, Nielsen S, excess. QJM 91: 453–455, 1998 Knepper MA: The renal thiazide-sensitive Na-Cl cotransporter as me- 28.MorineauG,SulmontV,SalomonR,Fiquet-KempfB,JeunemaîtreX, diator of the aldosterone-escape phenomenon. JClinInvest108: 215– Nicod J, Ferrari P: Apparent mineralocorticoid excess: Report of six new 222, 2001 cases and extensive personal experience. JAmSocNephrol17: 3176– 47. Sorensen MV, Grossmann S, Roesinger M, Gresko N, Todkar AP, 3184, 2006 Barmettler G, Ziegler U, Odermatt A, Loffing-Cueni D, Loffing J: Rapid 29. Williams TA, Mulatero P, Filigheddu F, Troffa C, Milan A, Argiolas G, dephosphorylation of the renal sodium chloride cotransporter in re- Parpaglia PP, Veglio F, Glorioso N: Role of HSD11B2 polymorphisms in sponse to oral potassium intake in mice. Kidney Int 83: 811–824, 2013 essential hypertension and the diuretic response to thiazides. Kidney 48. Fanestil DD, Vaughn DA, Blakely P: Metabolic acid-base influences on Int 67: 631–637, 2005 renal thiazide receptor density. Am J Physiol 272: R2004–R2008, 1997 30. Kotelevtsev Y, Brown RW, Fleming S, Kenyon C, Edwards CR, Seckl JR, 49. Pacheco-Alvarez D, Cristóbal PS, Meade P, Moreno E, Vazquez N, Mullins JJ: Hypertension in mice lacking 11beta-hydroxysteroid de- Muñoz E, Díaz A, Juárez ME, Giménez I, Gamba G: The Na+:Cl- co- hydrogenasetype2.JClinInvest103: 683–689, 1999 transporter is activated and phosphorylated at the amino-terminal 31. Bailey MA, Paterson JM, Hadoke PW, Wrobel N, Bellamy CO, Brownstein domain upon intracellular chloride depletion. J Biol Chem 281: 28755– DG, Seckl JR, Mullins JJ: A switch in the mechanism of hypertension in the 28763, 2006 syndrome of apparent mineralocorticoid excess. J Am Soc Nephrol 19: 50. Mu S, Shimosawa T, Ogura S, Wang H, Uetake Y, Kawakami-Mori F, 47–58, 2008 Marumo T, Yatomi Y, Geller DS, Tanaka H, Fujita T: Epigenetic modulation 32. Reilly RF, Ellison DH: Mammalian distal tubule: Physiology, patho- of the renal b-adrenergic-WNK4 pathway in salt-sensitive hypertension. physiology, and molecular anatomy. Physiol Rev 80: 277–313, 2000 Nat Med 17: 573–580, 2011 33. Velázquez H, Bartiss A, Bernstein P, Ellison DH: Adrenal steroids stim- 51. Wyrwoll CS, Seckl JR, Holmes MC: Altered placental function of 11beta- ulate thiazide-sensitive NaCl transport by rat renal distal tubules. Am J hydroxysteroid dehydrogenase 2 knockout mice. Endocrinology 150: Physiol 270: F211 –F219, 1996 1287–1293, 2009 34. Kim GH, Masilamani S, Turner R, Mitchell C, Wade JB, Knepper MA: 52. Yang S-S, Lo Y-F, Wu C-C, Lin S-W, Yeh C-J, Chu P, Sytwu H-K, Uchida S, The thiazide-sensitive Na-Cl cotransporter is an aldosterone-induced Sasaki S, Lin SH: SPAK-knockout mice manifest Gitelman syndrome and protein. Proc Natl Acad Sci U S A 95: 14552–14557, 1998 impaired vasoconstriction. J Am Soc Nephrol 21: 1868–1877, 2010 35. Knepper MA, Kim GH, Masilamani S: Renal tubule sodium transporter 53. Hunter RW, Craigie E, Homer NZM, Mullins JJ, Bailey MA: Acute in- abundance profiling in rat kidney: Response to aldosterone and varia- hibition of NCC does not activate distal electrogenic Na+ reabsorption tions in NaCl intake. Ann N Y Acad Sci 986: 562–569, 2003 or kaliuresis. Am J Physiol Renal Physiol 306: F457–F467, 2014 36. Câmpean V, Kricke J, Ellison D, Luft FC, Bachmann S: Localization of 54. Leviel F, Hübner CA, Houillier P, Morla L, El Moghrabi S, Brideau G, thiazide-sensitive Na(+)-Cl(-) cotransport and associated gene products Hassan H, Parker MD, Kurth I, Kougioumtzes A, Sinning A, Pech V, in mouse DCT. Am J Physiol Renal Physiol 281: F1028–F1035, 2001 Riemondy KA, Miller RL, Hummler E, Shull GE, Aronson PS, Doucet A, 37. Loffing J, Loffing-Cueni D, Valderrabano V, Kläusli L, Hebert SC, Rossier Wall SM, Chambrey R, Eladari D: The Na+-dependent chloride-bicarbonate BC, Hoenderop JG, Bindels RJ, Kaissling B: Distribution of transcellular exchanger SLC4A8 mediates an electroneutral Na+ reabsorption process in calcium and sodium transport pathways along mouse distal nephron. the renal cortical collecting ducts of mice. J Clin Invest 120: 1627–1635, Am J Physiol Renal Physiol 281: F1021–F1027, 2001 2010 38. Bailey MA, Unwin RJ, Shirley DG: In vivo inhibition of renal 11beta- hydroxysteroid dehydrogenase in the rat stimulates collecting duct sodium reabsorption. Clin Sci (Lond) 101: 195–198, 2001 39. Gaeggeler HP, Gonzalez-Rodriguez E, Jaeger NF, Loffing-Cueni D, This article contains supplemental material online at http://jasn.asnjournals. Norregaard R, Loffing J, Horisberger JD, Rossier BC: Mineralocorticoid org/lookup/suppl/doi:10.1681/ASN.2013060634/-/DCSupplemental.

1548 Journal of the American Society of Nephrology J Am Soc Nephrol 26: 1537–1548, 2015 DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 1 of 22

SUPPLEMENTAL FIGURES & TABLES

JASN-2013-06-0634

Title: Hypertrophy in the Distal Convoluted Tubule of an 11β- Hydroxysteroid Dehydrogenase Type 2 Knockout Model

DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 2 of 22

Supplemental Figure S1. Total and phosphorylated forms of NCC in wild-type and Hsd11b2–/– kidneys at c. 30 and 120 – 150 days of age. Immunoblots of total cellular protein (fraction ‘S0’) from whole kidney homogenates from wild-type (Hsd11b2 ‘+’) or knockout (‘−’) mice culled at 32 – 39 or 120 – 150 days of age. 12 µg loaded per lane. A representative Coomassie stain (in each case taken from the gel used for the total NCC immunoblot) is shown for each age group. Size markers, 117 kDa for each blot and 55 kDa for each gel. Band densities are in arbitrary units relative to the wild-type group; mean and 95 % confidence interval, n = 5. * p < 0.05, genotypes compared by unpaired t-test.

DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 3 of 22

Supplemental Figure S2. Immunoblotting with antibodies to pNCC on preparations of renal cortex and medulla. 8 µg of total cellular protein (fraction S0) prepared from a homogenate of cortex (C) or medulla (M) of wild-type kidney were loaded per lane. Total NCC could be detected in cortex but not medulla, whereas NKCC2 was detected in both. The antibodies to the phosphorylated forms of NCC (pT53-, pT58- and pS71-) recognised antigen in kidney cortex but not medulla, confirming the specificity of these antibodies for NCC. The results for anti-pT58 are subject to the caveat that only a very faint signal was recognised in kidney cortex, perhaps reflecting the fact that this site is not heavily phosphorylated under control conditions. Size markers, 117 kDa (blots) and 55 kDa (Coomassie stains).

DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 4 of 22

Supplemental Figure S3. Expression of 11β-HSD2 in the renal tubule of male C57BL/6J mice at 55 – 65 days of age. (a) – (c) Serial sections showing the degree of co-localisation between 11β-HSD2 (red) and, in green, NCC (a), parvalbumin (b) and calbindin-D28k (c). Parvalbumin and 11β-HSD2 did not co-localise. In serial sections, parvalbumin and NCC co-localised almost completely. This conflicts with the observation of a ‘late DCT’ or ‘DCT2’ in rats and female mice, in which parvalbumin expression is absent1 and may reflect the fact that this subsegment is poorly developed in male mice2. Calbindin D28k exhibited a partial overlap with 11β-HSD2; all tubules expressing 11β-HSD2 also expressed calbindin D28k, but some tubules (located in the cortex and outside the medullary rays) expressed calbindin D28k but not 11β-HSD2. (d) 11β-HSD2 (red) and AQP2 (green) were expressed in a common set of renal tubules, although the subcellular site of expression differed, with AQP2 expressed at the apical cell membrane and 11β-HSD2 expressed in the perinuclear region. (e) High- power view of tubules labelled with 11β-HSD2 (red) and APQ2 (green). Scale bars, 200 µm (a – c), 100 µm (d), 25 µm (e).

DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 5 of 22

Supplemental Figure S4. Natriuretic response to thiazides in anaesthetised mice at 120 – 150 days of age. (a) FENa in anaesthetised mice in a renal clearance study (wild-type n = 7, Hsd11b2–/– n = 8) determined at baseline, following benzamil (BZM) and following BZM plus hydrochlorothiazide (HCTZ, 2 mg per kg IV). * p < 0.05 for comparison between genotypes by 2-way repeated measures ANOVA and post-hoc Bonferroni’s test. (b) Data presented as the thiazide-induced increment in FENa for each mouse. The mean and 95 % confidence interval for each group and depicted by the solid and dashed lines respectively. There was no significant difference between genotypes (p > 0.05 by unpaired t-test).

DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 6 of 22

Supplemental Figure S5. Urinary HCTZ excretion in wild-type and Hsd11b2-/- mice. (a) Urinary [HCTZ] following an intravenous bolus of HCTZ (2 mg per kg body weight) in the renal clearance study presented in Figure 8. There was no significant difference between genotypes (p > 0.05 by unpaired t-test). (b) The same data were used to derive the estimated concentration of HCTZ in the distal renal tubule: DTHCTZ = UHCTZ . (POsm / UOsm). There was no significant difference between genotypes.

DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 7 of 22

Supplemental Figure S6. 11β-HSD2 expression and activity are absent in Hsd11b2 null kidneys. (a) & (b) 11β-HSD2 activity in kidney homogenates was assayed by using thin-layer chromatography to detect conversion of [3H]corticosterone (B) to [3H]dehydrocorticosterone (A). (a) Representative TLC blot. Steroid standards were loaded in the two lanes at the right-hand side. (b) % conversion of B to A in kidney homogenates during a 60 minute equilibration; kidneys were from wild-type (‘+/+’), Hsd11b2 haploinsufficient (‘+/-‘) or Hsd11b2 null (‘-/-‘) mice. The conversion in Hsd11b2 null kidneys was no different from zero. (c) & (d) 11β-HSD2 protein was not detectable by immunofluorescence in Hsd11b2 null kidneys. Representative fluorescent micrographs from Hsd11b2 null and wild-type kidneys are presented, using identical imaging parameters. (c) Dual-label immunofluorescence for 11β-HSD2 protein (red) and AQP2 (green) in Hsd11b2 null kidney. (d) Dual-label immunofluorscence for 11β-HSD2 (red) and NCC (green) in wild-type kidney.

DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 8 of 22

wild-type (n = 5) Hsd11b2–/– (n = 5)

number of glomerular cross-sections per mm 2 total 17.3 ( 14.9 - 19.7 ) 12.6 ( 9.8 - 15.5 ) **

number of tubular cross-sections per mm 2 all tubules 426 ( 378 - 475 ) 344 ( 256 - 432 ) NKCC2 + 102.0 ( 89.0 - 115.0 ) 65.0 ( 50.0 - 80.0 ) ** NCC + 49.7 ( 42 - 57.4 ) 47.0 ( 42.3 - 51.7 ) AQP2 + 60.1 ( 52.2 - 68.1 ) 34.0 ( 26.0 - 42.0 ) **

% of total tubular cross-sections NCC + 11.7 ( 9.3 - 14.2 ) 13.5 ( 10.5 - 16.6 )

tubular cell nuclei per mm 2 NKCC2 + 543 ( 459 - 626 ) 465 ( 366 - 565 ) NCC + 405 ( 335 - 475 ) 627 ( 545 - 709 ) ** AQP2 + 532 ( 438 - 626 ) 344 ( 287 - 401 ) **

tubular cell nuclei per tubule cross-section NKCC2 + 5.32 ( 4.80 - 5.85 ) 7.23 ( 6.03 - 8.43 ) ** NCC + 8.48 ( 7.90 - 9.06 ) 13.37 ( 11.77 - 14.96 ) ** AQP2 + 8.84 ( 7.80 - 9.87 ) 10.25 ( 8.51 - 11.99 )

Supplemental Table S1. Quantitative analysis of distal tubular structure in Hsd11b2–/– mice. Wild- type and Hsd11b2–/– mice were culled at 55 – 65 days of age. ‘NKCC2 +’, ‘NCC +’ and ‘AQP2 +’ refer to those cortical tubules expressing NKCC2, NCC and AQP2. Data for ‘all tubules’ were obtained by counting all tubular cross-sections in those sections stained for NCC and therefore represent all cortical nephron segments (and not just those of the distal renal tubule). Data are presented as mean (95 % confidence interval). ** p < 0.01 (comparison between genotypes by unpaired t-test).

DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 9 of 22

wild-type (n = 5) Hsd11b2–/– (n = 5)

number of glomerular cross-sections included in analysis per subject glomeruli 68.8 ( 59.3 - 78.3 ) 50.2 ( 38.9 - 61.5 )

number of tubular cross-sections included in analysis per subject all tubules 443 ( 393 - 493 ) 357 ( 266 - 449 ) NKCC2 + 150 ( 131 - 169 ) 95.0 ( 73.0 - 118.0 ) NCC + 125 ( 106 - 144 ) 118 ( 106 - 130 ) AQP2 + 88.4 ( 76.7 - 100.1 ) 50.0 ( 38.3 - 61.7 )

number of tubular cell nuclei included in analysis per subject NKCC2 + 798 ( 675 - 920 ) 684 ( 538 - 831 ) NCC + 952 ( 603 - 1301 ) 1574 ( 1368 - 1780 ) AQP2 + 781 ( 643 - 920 ) 505 ( 422 - 589 )

Supplemental Table S2. Number of histological features counted per experimental subject as part of the quantitative analysis presented in Figure 2. Values are mean (95 % confidence interval). ‘NKCC2 +’, ‘NCC +’ and ‘AQP2 +’ refer to data derived from tubular cross-sections expressing NKCC2, NCC or AQP2.

DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 10 of 22

+ + cohort haematocrit plasma Osm plasma [Na ] plasma [K ] GFR / µl per min / mOsm / mM / mM per 100 g

cohorts aged 55 – 65 days wild-type 43.0 297.4 139.8 5.9 703.2 (n = 9) (42.1 – 43.9) (291.8 – 303.0) (137.2 – 142.3) (5.7 – 6.1) (520.1 – 886.2)

Hsd11b2–/– 46.8 * 308.9 * 146.6 * 2.7 * 700.3 (n = 8) (45.5 – 48.1) (299.6 – 318.2) (144.0 – 149.2) (2.3 – 3.2) (516.3 – 884.2)

cohorts aged 120 – 150 days wild-type 42.2 297.4 141.9 5.2 546.4 (n = 7) (41.3 – 43.2) (285.3 – 309.6) (139.8 – 143.9) (5.0 – 5.3) (400.8 – 692.1)

Hsd11b2–/– 43.6 316.5 * 149.9 * 2.6 * 796.9 (n = 8) (42.5 – 44.7) (309.9 – 323.1) (148.8 – 151.0) (2.3 – 2.8) (578.5 – 1015.2) furosemide-treated 44.2 319.0 * 149.7 * 4.6 616.2 (n = 6) (41.3 – 47.0) (309.7 – 328.3) (148.4 – 151.0) (4.0 – 5.3) (467.9 – 764.5)

Supplemental Table S3. Characteristics of the wild-type, Hsd11b2–/– and furosemide-treated cohorts used for renal clearance experiments. Haematocrit and GFR were determined during the baseline sampling period; osmolality, [Na+] and [K+] were determined on a terminal blood sample. Data are mean and 95 % confidence interval. * p < 0.05 for comparison with wild-type control group of the same age (by unpaired t-test at 55 – 65 days or by 1-way ANOVA and post-hoc Dunnett’s test at 120 – 150 days of age).

DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 11 of 22

gene accession number forward primer reverse primer UPL

18S rRNA NR_003278.1 Ctcaacacgggaaacctcac cgctccaccaactaagaacg 77 TBP NM_013684 Gggagaatcatggaccagaa gatgggaattccaggagtca 97 cyclophilin A NM_008907.1 Acgccactgtcgcttttc gcaaacagctcgaaggagac 46 11βHSD2 NM_008289.2 Cactcgaggggacgtattgt gcaggggtatggcatgtct 26 SGK1 NM_001161845 Gattgccagcaacacctatg ttgatttgttgagagggacttg 91 NHE3 NM_001081060 tccatgagctgaatttgaagg tacttggggagcgaatgaag 5 NKCC2 (total) NM_183354 (isoform A) Tgctggtgccaacatctct atggtccctctggggatg 85 NCC NM_019415 Cctccatcaccaactcacct ccgcccacttgctgtagta 12 ENaC alpha NM_011324.2 ccaagggtgtagagttctgtga agaaggcagcctgcagttta 45 NDCBE NM_021530.2 Agagggggaagatgctgagt tcctccacatcctcttcaaac 83 parvalbumin NM_013645 ttctggacaaagacaaaagtgg tgaggagaagcccttcagaat 88 calbindin D28k NM_009788 aaggcttttgagttatatgatcagg ttcttctcacacagatctttcagc 42 NCX1 NM_011406 ccatgctagagatcatccgatt gtcagtggctgcttgtcatc 6 TRPV5 NM_001007572 Gagagggacgagctctgga acaggaaacgaggcattttc 67 WNK4 NM_175638 Tccgatttgatctggatgg gggcaggatgaactcattgta 26 WNK1-total AY309076 Ccagcaagcagttctggag tgactgtgttattggagtttgttct 68 WNK1-L AY309076 cttttgccaagagtgtgataggt caacggattcatcatatttctcc 92 WNK1-KS AY311934 / AY309076 Tgctgctgttctcaaaagga acttcaggaattgctactttgtca 20 SPAK-total ENSMUST00000102715 tttaaaaacgttgacatttaagttgg cccgatcagcttcacttcat 71 SPAK-L ENSMUST00000102715 gtacgagctccaggaggttatc tcttgcctgggtttgcat 27 SPAK-KS JN368425 ttaccgtcattcctaactttactgc gaatgcgcttactccaaaatct 18 OSR-1 NM_133985 Tgccttcaaaaggatccaga tggaaaaatttgtgcctcaac 84 PP4 ENSMUST00000032936.6 Tggactcgccagtcacagta gggacatcgccacctactc 17

Supplemental Table S4. Primers and probes used for Q-PCR. ‘UPL’ refers to the reference number of the probe in the Roche Universal ProbeLibrary.

DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 12 of 22

Method expression of 11β-HSD2 (H) & MR (M)

1 2

- - PCR

- sp. reference ISH IHC Cre activity SN TALH DCT DCT CNT CCD Velazquez et al. « « H ? +++ * +++ * ? ++ (1998) 3 M ? ? ? ? ?

Bonvalet et al. (1990) « H ++ ? ? ? ++ 4 M ? ? ? ? ?

5 BIT Farman et al. (1991) « H ? ? ? ? ? M ++ ++ * ++ * ++ ++ RAB Bostanjoglo et al. « « H − − ++ ++++ +++ (1998) 6 M + + ++ ++ ++

7 - Schmitt et al. (1999) « « H − − ++ ++ ++ 1 – 8 days old M ? ? ? ? ?

Smith et al. (1997) 8 « H + ++ * ++ * ++ * ++ embryonic – adult M ? ? ? ? ?

RAT (Sprague RAT Dawley) Kyossev et al. (1996) « H + ? ? +++ +++ 9 M ? ? ? ? ?

Hirasawa et al. (1997) « H ++ ++ * ++ * ? ++ 10 M ++ ++ * ++ * ? ++ HUMAN Campean et al. « H − − ± +++ +++ (2001) 2 NMRI mice M ? ? ? ? ?

11 Cole (1995) « H − ++ * ++ * ++ * ++ C57BL6 mice M ? ? ? ? ?

Naray-Fejes-Toth & « « H − − − ++ ++ 12 Fejes-Toth (2007) HSD2 / iCre × ROSA26 M ? ? ? ? ? MOUSE mice

Supplemental Table S5. 11β-HSD2 expression in the distal renal tubule: a literature review. All studies were conducted in adult animals unless stated otherwise. Methods used to detect 11β-HSD2 expression were in situ hybridisation (ISH), immunohistochemistry (IHC), a Cre-Lox genetic reporter system (Cre), enzyme activity studies using radiolabelled tracers in microdissected nephron segments (activity) or single-nephron RT-PCR in microdissected nephron segments. Key: ‘–’ = reported as absent; ‘+’ to ‘++++’ = reported as present; ‘?’ = not reported; ‘*’ denotes study in which no attempt was made to identify DCT1, DCT2 or CNT.

DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 13 of 22

COMPLETE METHODS

Animals All experiments were conducted in accordance with UK Home Office regulations and the

Animals (Scientific Procedures) Act 1986. Mice were housed in groups (n ≤ 5) and were given free access to water and a standard mouse chow containing 0.25 % Na, 0.38 % Cl and

0.67 % K. C57BL/6JOlaHsd wild-type mice were supplied by Harlan UK. Hsd11b2–/– mice were derived from a colony carrying a null mutation in the Hsd11b2 gene on the

C57BL/6JOlaHsd background13. We confirmed that 11β-HSD2 protein and enzyme activity were absent from Hsd11b2–/– kidneys (Supplemental Figure S7). Experimental animals were the male offspring of parents that were both homozygous for the null mutation; wild-type controls were age and sex-matched. Separate cohorts of wild-type and Hsd11b2–/– mice were used to prepare tissue for histological analysis, protein extraction, RNA extraction and for the analysis of Na+ transport function.

Immunofluorescence

Administration of BrdU Wild-type and Hsd11b2–/– mice were implanted with an osmotic pump (Alzet ® model

1007D) containing 50 mg / ml BrdU in 50 % DMSO, which had been primed in 0.9 % NaCl at

37 ° C overnight. Mice received inhaled isofluorane anaesthesia and subcutaneous analgesia

(buprenorphrine 50 µg per kg body weight as Vetergesic ®) before the pump was implanted into a subcutaneous pocket at the back of the neck. Pumps remained in situ for 7 days before the animals were culled by perfusion fixation. The dose of BrdU delivered to the wild-type group was 25.6 ± 1.0 mg / kg / day (mean ± SD); the knockout group received 28.3 ± 3.3 mg / kg / day.

Perfusion fixation Kidneys were fixed in situ using a perfusion fixation protocol adapted from that described by Loffing and Kaissling1,14,15. Mice were anaesthetised with Sagatal (sodium pentobarbital, 50 mg / kg IP), and the infra-renal aorta was cannulated to permit retrograde perfusion with a vent in the vena cava. 10 ml heparinised saline (20 units / ml in PBS) were infused followed immediately by 50 ml fixative (fresh 4 % PFA in PBS, pH 7.4), delivered at a rate of 15 ml / min by a Gilson Minipuls 3 peristaltic pump. The right kidney was DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 14 of 22 removed, the poles cut off and discarded, and the central portion immersed in 4 % PFA at 4

° C for 24 hours before being embedded in paraffin wax. 5 micron sections were cut for indirect immunofluorescence.

Immunofluorescence Sections were de-waxed and hydrated through graded alcohols and then heated in the presence of Novocastra Bond Epitope Retrieval Solution 1, pH 6.0 (ER1, Leica). Indirect immunofluorescent detection of target antigens was performed using a Leica BOND-MAX

TM robot. Primary antibodies and their dilutions were: sheep anti-11β-HSD2 (Millipore,

AB1296) at 1:6000; rabbit anti-NCC (Millipore, AB3553) at 1:2000; sheep anti-NKCC2

(Division of Signal Transduction Therapy, Dundee University) at 1:4000; goat anti-AQP2

(Santa-Cruz, sc-9882) at 1:4000; rabbit anti-parvalbumin (Swant, PV25) at 1:60000; rabbit anti-calbindin D-28k (Swant, CB38) at 1:100000; sheep anti-BrdU (Fitzgerald, 20-BS17) at

1:250. Secondary antibodies and their dilutions were: goat anti-rabbit IgG-HRP (Abcam,

AB6112) at 1:500; rabbit anti-sheep IgG-HRP (Nordic immunology) at 1:500; rabbit anti-goat

IgG-HRP (Millipore, AP106P) at 1:500. The binding sites of HRP-conjugated secondary antibodies were detected using a tyramide-labelled fluorophore (either Cy3 or Cy5). For double-stainings (in which two different fluorophores were used to stain two different targets on the same sample) the sample was heated for 10 mins in the presence of ER1 solution after the first detection, in order to strip off the first primary and secondary antibodies. All sections were counter-stained with DAPI (4',6-diamidino-2-phenylindole).

Image acquisition and analysis Images were obtained using a Zeiss LSM 510 Meta Confocal Laser Scanning Microscope.

A blue diode 405 nm laser and HeNe 546 and 633 nm lasers were used to excite DAPI, Cy3 and Cy5 respectively, with appropriate detection. To facilitate the quantitative analysis of morphological parameters, a set of fluorescent micrographs was obtained from cohorts of wild-type and Hsd11b2–/– kidneys using the following standard method. A region of the cortex was selected at random whilst viewing through the DAPI channel (thus blinded to the fluorescent signals providing information regarding the localisation of specific nephron segments and proliferating cells). A merged image was then obtained through all three channels (Cy3, Cy5 and DAPI) and stored for quantitative analysis. A different region of cortex was then selected using the DAPI filter-set and the process repeated. In this way, a DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 15 of 22 series of five images representing a random discontinuous sample of kidney cortex (total area approximately 1.5 mm 2) were obtained from each kidney section. In each case these were drawn from regions distributed roughly evenly throughout the cortex. Images were analysed using ImageJ 1.46r (http://imagej.nih.gov/ij) with the Cell Counter plugin. Each kidney specimen was assigned a random 4-digit code at the time of tissue fixation. Images were therefore acquired and analysed blinded to the identity of the sample. Furthermore they were analysed in a random order (so that the five images obtained from each kidney section were not necessarily examined in sequential order). The total number of histological features counted to generate the quantitative analysis of distal tubular structure are presented in Supplemental Table S2.

Semi-quantitative immunoblotting

Protein sample preparation Kidneys were homogenised in a buffer containing phosphatase, kinase and protease inhibitors (250 mM sucrose,10 mM triethanolamine, 2 mM EDTA, 50 mM NaF, 25 mM Na β- glycerophosphate, 5 mM Na pyrophosphate, 1 mM Na orthovanadate, 1 % Protease

Inhibitor Cocktail Set III, Calbiochem ®, pH 7.6). Supernatants from two 15 minute centrifugations at 4000 g were pooled to form a total cellular protein fraction (‘S0’), free from gross cellular and nuclear debris. This fraction was subject to a further centrifugation at

16000 g for 32 mins to pellet a fraction (‘P1’) enriched in plasma membranes; the supernatant from this spin was centrifuged at 200000 g for 60 mins to pellet a fraction (‘P2’) enriched in subapical membrane vesicles16.

SDS-PAGE and immunoblotting Samples were heated to 70 ° C for 15 mins in sample buffer (NuPAGE LDS sample buffer,

Invitrogen) containing 50 mM DTT, separated by SDS-PAGE on NuPAGE Novex TM 3 – 8 %

Tris-Acetate gels (Invitrogen) and then transferred to an Amersham Hybond TM-P PDVF membrane (GE Healthcare). Membranes were incubated with blocking buffer (5 % w/v non- fat dry milk powder / 0.2 % v/v Tween-20 in PBS) on a rolling shaker at room temperature for 1 hr and then incubated with primary antibody overnight at 4 ° C. Primary antibodies and their dilutions were: rabbit anti-NCC (Millipore, AB3553) at 1:1000; sheep anti-pT53-

NCC, anti-pT58-NCC and anti-pS71-NCC (Division of Signal Transduction Therapy,

Dundee University), each at 1:500 (= 0.2 – 1.2 µg / ml); sheep anti-NKCC2 (DSTT, Dundee) at DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 16 of 22

1:10000. For Western blots designed to recognise specific phosphorylated forms of NCC, the corresponding non-phosphorylated peptide was included in the solution of primary antibody at a final concentration of 10 µg / ml. After three five-minute washes with wash buffer (0.2 % v/v Tween-20 in PBS) the membrane was incubated with an HRP-conjugated secondary antibody for 1 – 2 hrs at room temperature and then washed again (three ten- minute washes). Secondary antibodies and their dilutions were: goat anti-rabbit IgG-HRP

(Santa-Cruz, sc-2030) at 1:2000; donkey anti-sheep IgG-HRP (Sigma, A3415) at 1:20000.

Peroxidase activity was revealed using SuperSignal ® West Pico Chemiluminescent Substrate to expose photographic film.

Densitometry Films were photographed using a digital SLR camera (Nikon D40) with the exposure set to maximise dynamic range without significant pixel saturation. Images were analysed as 8- bit .tiffs in ImageJ (version 1.43u). A rectangular region of interest (ROI) was drawn to encompass the entire vertical range of each lane and the area under this curve was taken as a measure of the band density. No background subtraction step was applied. The bottom portion of each gel was excised prior to transfer to the PVDF membrane and stained with

Coomassie blue. The density of each lane on the film was divided by the density of the corresponding Coomassie lane in order to correct for variation in the total amount of protein loaded for each sample. The final data were normalised so that for each assay, the wild-type group had a mean value of 1.0.

Q-PCR

RNA extraction and cDNA preparation RNA was extracted from frozen mouse kidneys using the QIAGEN RNeasy ® Mini Kit, using a protocol that included an on-column treatment with DNaseI. The integrity of the

RNA preparations was verified by agarose gel electrophoresis and staining with ethidium bromide. cDNA was transcribed from 500 ng of total RNA using the Applied Biosystems

High Capacity cDNA Reverse Transcription Kit.

Quantitative real-time PCR (Q-PCR) Q-PCR assays were designed to permit the detection of specific product by the real-time measurement of fluorescence using the Roche Universal ProbeLibrary. The primers and probes used for each assay are presented in Supplemental Table S4. Reactions were DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 17 of 22 assembled in 10 µl volumes, each containing 2 µl of sample cDNA (diluted 1:40), forward and reverse primers each at a final concentration of 200 nM and the relevant probe at a final concentration of 100 nM. All plates included a 7-point standard curve, in which aliquots from all of the cDNA samples were pooled and diluted 1:10 to form a ‘1 × standard’ which was then subjected to serial 1:2 dilutions, and three negative controls (water, no-template and no-reverse transcriptase). All samples, standards and controls were performed in triplicate. Reactions were run on a Roche Lightcycler 480 using the following cycling conditions: 95 ° C for 5 mins, then 95 ° C for 10 secs, 60 ° C for 30 secs repeated for 60 cycles, then 40 ° C for 30 sec. The threshold cycle (Cp) for each well was identified by finding the maximum value in a plot of the second derivative of fluorescence vs. time. Triplicate results were analysed and replicates excluded if the Cp standard deviation was > 0.4. The results of any given assay were only accepted if the standard curve was satisfactory (efficiency 1.7 –

2.1 and error < 0.05) and all negative controls (water, no template and reverse transcriptase- negative) were negative. For each assay, Cp values were converted to mean template abundance (in arbitrary units), using the 7-point standard curve. 18S rRNA, TBP and cyclophilin A were selected as endogenous control genes, as these transcripts did not differ in abundance between Hsd11b2–/– and wild-type kidneys. All other assays were expressed relative to the endogenous control genes – i.e. for each sample, the abundance of a ‘test’ transcript was divided by the mean abundance of the three endogenous control transcripts in that sample. The final data were normalised so that for each assay, the wild-type group had a mean value of 1.0.

11β-HSD2 enzyme activity 11β-HSD2 enzyme activity in kidney homogenates was assessed using thin-layer chromatography to measure conversion of [3H]corticosterone to [3H]dehydrocorticosterone as previously described17.

Tubule segment micro-dissection

Micro-dissection and preparation of RNA and cDNA Wild-type male C57BL/6 mice were subjected to terminal anaesthesia. The left kidney was perfused in situ though a catheter placed in the abdominal aorta with 1 ml ice-cold heparinised 0.9 % NaCl followed by 2 ml HBSS (in mM: NaCl 140, KCl 5, MgSO4 0.8, MgCl2

1, Na2HPO4 0.33, NaH2PO4 0.44, CaCl2 0.5, glucose 5, HEPES 10, NaOH 5, pH 7.4) then 2 ml DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 18 of 22 collagenase solution containing 250 µg / ml collagenase type IA (Sigma) in HBSS. The kidney was decapsulated and cut into thin cortico-medullary wedges, which were incubated in collagenase solution for 30 mins at 37 °C. These were then transferred to microdissection medium (0.1 % BSA, 10 mM ribonucleoside vanadyl complex in HBSS) and placed on ice during 1 – 2 hrs of microdissection. PCTs, DCTs and CCDs were dissected from the cortex.

c. 0.5 mm lengths of tubule were transferred into 400 µl denaturing solution (4M guanidine thiocyanate, 25 mM Na citrate pH 7, 0.5 % sarcosyl, 100 mM β-mercaptoethanol).

RNA was prepared by phenol-chloroform extraction (adding 0.1 vols 2M Na acetate pH 4.0,

1 vol phenol, 0.2 vols chloroform and 0.004 vols isoamylalcohol). RNA was precipitated from the aqueous phase by the addition of 450 µl isopropanol in the presence of 20 µg glycogen. After three ethanol washes, the pellet was re-suspended in 10 µl 2 mM DTT containing 0.5 mcl RNaseOUTTM. All 10 µl were used as the template for cDNA synthesis using the Applied Biosystems High Capacity cDNA Reverse Transcriptase kit.

PCR Template cDNA was amplified by PCR in 20 µl reactions containing 0.1 mM dNTPs, 0.5

µM each of forward and reverse primers, 1.5 mM MgCl2, 0.025 U µl-1 Taq DNA polymerase

(ThermoScientific) and template cDNA from c. 25 µm of tubule. Positive control template was cDNA prepared from 1 ng of total kidney RNA. Negative control templates were reverse-transcriptase negative cDNA preparation from total kidney RNA and water. PCR conditions were: 95 °C for 3 mins, then 33 cycles of 94 °C for 20 secs, 59 °C for 30 secs, 72 °C for 45 secs then 72 °C for 7 mins. Intron-spanning primers were designed to amplify gene products from Hsd11b2 (5’-ctgctggctgctctcgactg & 5’-ccagaacacggctgatgtcctc), Slc12a3 (5’- ctaccaatggcaaggtcaag & 5’-taggagatggtggtccagaa) and Scnn1g (5’-ccaaagccagcaaataaacaaa &

5’-gcggcgggcaataatagaga).

Thiazide-sensitive tubular Na+ reabsorption

Metabolic cages (acute HCTZ) Mice were housed individually in metabolic cages that enabled the independent collection of urine and faeces and were left to acclimatise for four days before any experimental data were obtained. Each mouse was given an intraperitoneal injection of vehicle (c. 0.2 ml 2 % DMSO), immediately followed by a 6-hour urine collection. 24 hours DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 19 of 22 later mice received an injection of HCTZ (20 mg per kg body weight), followed by a further

6-hour urine collection. Urine collections were timed to fall during the animal’s active phase

(i.e. the dark phase of a 24 hr dark-light cycle).

Metabolic cages (chronic HCTZ) Mice were housed individually in metabolic cages and acclimatised as above. Each mouse was given an intraperitoneal injection of vehicle (c. 0.2 ml 2 % DMSO) daily for 3 days during the ‘baseline’ period and then an injection of HCTZ (20 mg per kg body weight) daily for 7 days during the test period. Urine samples were collected over 24 hours.

Renal clearance Renal clearance experiments were performed as previously described 13. Mice were anaesthetised with Inactin ® (thiobutabarbital sodium salt hydrate, Sigma) and catheters were inserted into the trachea, jugular vein, carotid artery and bladder. A bolus dose (0.1 ml per 10 g body weight) of physiological saline solution was given via the jugular catheter as soon as intravenous access was established, followed by a continuous infusion of 0.2 ml per

10 g per hour. This infusate comprised 100 mM NaCl, 5 mM KCl, 15 mM NaHCO3, 0.25 %

FITC-inulin, pH 7.4. FITC-inulin had been dialysed in a 2000 Da cut-off dialysis cassette

(Slide-A-Lyzer ®, Thermo) against at least 1600 ml 0.9 % NaCl, changed thrice over 24 hrs.

Mean arterial blood pressure was recorded from the carotid catheter in real time. A 60 minute equilibration period was followed by three 40-minute collection periods, during which urine was collected under water-saturated mineral oil. After the first ‘control’ collection, a bolus dose of benzamil (BZM, 2 mg per kg body weight IV) was administered, followed by a continuous infusion (1 mg per kg per hr for the remainder of the experiment).

A 20-minute period of re-equilibration was followed by a second 40-minute urine collection.

Mice then received a bolus dose of hydrochlorothiazide (HCTZ, 2 mg per kg body weight), followed by another 20 minute re-equilibration and then a final 40-minute urine collection.

This BZM dosing regime was found to produce a stable natriuresis during the length of the study; HCTZ was administered at the smallest dose that was found to elicit maximal natriuresis in wild-type mice (data not shown; to be published elsewhere). ~80 µl blood samples were obtained from the arterial line at the end of the first equilibration period and after each urine collection; these were used to determine plasma [inulin]. At the end of the DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 20 of 22 protocol, a 1 ml sample of blood was obtained for the measurement of plasma [Na+], [K+] and osmolality.

A subset of mice was used in a renal clearance study to determine the acute natriuretic effect of bendroflumethiazide (BFZ, 12 mg per kg body weight IV). A 40-minute baseline collection period was followed by the BFZ bolus, followed by 20 minutes of re-equilibration and then a second 40-minute collection period.

Analysis of urine and plasma [FITC-inulin] in plasma and urine was determined by measuring fluorescence intensity at pH 7.4, relative to a 9-point standard curve. [Na+] in plasma and urine was determined by ion-sensitive electrode using a calibrated Roche 9180 Electrolyte Analyzer. Osmolality was determined by freezing-point depression on a Vogel Osmometer OM 801. [HCTZ] in urine was determined by HPLC triple quadrupole mass spectrometry, using a method that has been submitted for publication elsewhere.

Chronic furosemide treatment Mice were implanted with a subcutaneous osmotic pump (Alzet ® model 2001) containing furosemide (80 mg ml – 1 in 50 % DMSO, pH 8.0), delivering a dose of c. 90 mg kg – 1 day – 1.

The pumps remained in situ for 7 days, during which time the mice had access to both tap water and salt solution (0.8 % NaCl, 0.1 % KCl) in order to prevent excessive volume and electrolyte losses. The mice were then either culled to yield tissue for immunoblotting or used for a renal clearance study.

Statistical analysis Data are presented as the mean and 95 % confidence interval for the mean. Experimental groups were compared by unpaired t-test or by ANOVA with post-hoc Bonferroni’s or

Dunnett’s tests as appropriate. For multiple comparisons by t-test, the Dunn-Sidák method was used to apply a correction to maintain the family-wise error rate (π) at 0.05, where the individual error rate, α = 1 – (1 – π)1/n, for n independent tests. DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 21 of 22

SUPPLEMENTAL REFERENCES

1. Loffing J, Loffing-Cueni D, Valderrabano V, Klausli L, Hebert SC, Rossier BC, Hoenderop JG, Bindels RJ, Kaissling B: Distribution of transcellular calcium and sodium transport pathways along mouse distal nephron. Am. J. Physiol. 281: F1021–7, 2001

2. Campean V, Kricke J, Ellison D, Luft FC, Bachmann S: Localization of thiazide-sensitive Na(+)- Cl(-) cotransport and associated gene products in mouse DCT. Am J Physiol 281: F1028–35, 2001

3. Velazquez H, Naray-Fejes-Toth A, Silva T, Andujar E, Reilly RF, Desir GV, Ellison DH: Rabbit distal convoluted tubule coexpresses NaCl cotransporter and 11 beta-hydroxysteroid dehydrogenase II mRNA. Kidney Int. 54: 464–72, 1998

4. Bonvalet JP, Doignon I, Blot-Chabaud M, Pradelles P, Farman N: Distribution of 11 beta- hydroxysteroid dehydrogenase along the rabbit nephron. J. Clin. Invest. 86: 832–7, 1990

5. Farman N, Oblin ME, Lombes M, Delahaye F, Westphal HM, Bonvalet JP, Gasc JM: Immunolocalization of gluco- and mineralocorticoid receptors in rabbit kidney. Am. J. Physiol. 260: C226–33, 1991

6. Bostanjoglo M, Reeves WB, Reilly RF, Velazquez H, Robertson N, Litwack G, Morsing P, Dorup J, Bachmann S, Ellison DH: 11Beta-hydroxysteroid dehydrogenase, mineralocorticoid receptor, and thiazide-sensitive Na-Cl cotransporter expression by distal tubules. J Am Soc Nephrol 9: 1347–58, 1998

7. Schmitt R, Ellison DH, Farman N, Rossier BC, Reilly RF, Reeves WB, Oberbaumer I, Tapp R, Bachmann S: Developmental expression of sodium entry pathways in rat nephron. Am. J. Physiol. 276: F367–81, 1999

8. Smith RE, Li KX, Andrews RK, Krozowski Z: Immunohistochemical and molecular characterization of the rat 11 beta-hydroxysteroid dehydrogenase type II enzyme. Endocrinology 138: 540–7, 1997

9. Kyossev Z, Walker PD, Reeves WB: Immunolocalization of NAD-dependent 11 beta- hydroxysteroid dehydrogenase in human kidney and colon. Kidney Int. 49: 271–281, 1996

10. Hirasawa G, Sasano H, Takahashi K, Fukushima K, Suzuki T, Hiwatashi N, Toyota T, Krozowski ZS, Nagura H: Colocalization of 11 beta-hydroxysteroid dehydrogenase type II and mineralocorticoid receptor in human epithelia. J. Clin. Endocrinol. Metab. 82: 3859–63, 1997

11. Cole TJ: Cloning of the mouse 11 beta-hydroxysteroid dehydrogenase type 2 gene: tissue specific expression and localization in distal convoluted tubules and collecting ducts of the kidney. Endocrinology 136: 4693–6, 1995

12. Naray-Fejes-Toth A, Fejes-Toth G: Novel mouse strain with Cre recombinase in 11beta- hydroxysteroid dehydrogenase-2-expressing cells. Am. J. Physiol. 292: F486–94, 2007

13. Bailey MA, Paterson JM, Hadoke PW, Wrobel N, Bellamy CO, Brownstein DG, Seckl JR, Mullins JJ: A switch in the mechanism of hypertension in the syndrome of apparent mineralocorticoid excess. J Am Soc Nephrol 19: 47–58, 2008 DCT in the Hsd11b2 null mouse – SUPPLEMENTAL MATERIAL page 22 of 22

14. Kaissling B: Ultrastructural organization of the transition from the distal nephron to the collecting duct in the desert rodent Psammomys obesus. Cell Tissue Res. 212: 475–95, 1980

15. Loffing J, Le Hir M, Kaissling B: Modulation of salt transport rate affects DNA synthesis in vivo in rat renal tubules. Kidney Int. 47: 1615–23, 1995

16. Marples D, Knepper MA, Christensen EI, Nielsen S: Redistribution of aquaporin-2 water channels induced by vasopressin in rat kidney inner medullary collecting duct. Am. J. Physiol. 269: C655–64, 1995

17. Bailey MA, Craigie E, Livingstone DEW, Kotelevtsev YV, Al-Dujaili EAS, Kenyon CJ, Mullins JJ: Hsd11b2 haploinsufficiency in mice causes salt sensitivity of blood pressure. Hypertension 57: 515–520, 2011