Telomere Elongation in Regenerating Tissues of the Grey Starfish

Home , Luidia clathrata, Luidia senegalensis, Sclerasterias

TELOMERE ELONGATION IN REGENERATING TISSUES OF THE GREY STARFISH,

LUIDIA CLATHRATA

Rebecca Varney

B.S., University of California Davis, 2011

A thesis submitted to the Department of Biology Hal Marcus College of Science and Engineering The University of West Florida In partial fulfillment of the requirements for the degree of Master of Science

2016

The thesis of Rebecca Michelle Varney is approved:

______Alexis M. Janosik, Ph.D., Committee Member Date

______Hui-Min Chung, Ph.D., Committee Member Date

______Christopher M. Pomory, Ph.D., Committee Chair Date

Accepted for the Department/Division:

______Christopher M. Pomory, Ph.D., Interim Department Chair Date

Accepted for the University:

______Jay Clune, Ph.D., Interim AVP for Academic Programs Date

ACKNOWLEDGMENTS

This project was made possible by a grant from the University of West Florida Scholarly and Creative Activities Committee.

I thank my committee members for guidance in and out of the lab, and for being equally generous with patience and time. I thank Reena Torrance and Nick Honeycutt of the Pomory Lab who were welcoming from my first day there, the Chung lab (especially Kendra Buer) for support and equipment training, and the Janosik Lab for inclusion and friendship.

I offer my gratitude to Colton Seals for gifting me starfish, animal care assistance, and humor. For help collecting and maintaining additional animals I thank Katie Vaccaro, Kathy

McCarthy, Mary Cvetan, and especially Stacy Cecil (who braved cold water to discover our first baby Luidia).

Thank you to Jim Hammond, who helped keep my starfish alive and the greenhouse running, and to Karen Gibbs, who keeps the world turning in our department and offered essential motivational sass. Thanks to innumerable other members of the UWF Biology

Department for support, including Mariah Pfleger, Bethany McAcy, Hillary Skowronski, and Dr.

Kari Clifton. Also thanks to Melissa Nehmens for being an inspiring scientist and friend.

Thank you to my students across all my semesters, in research laboratories and classrooms alike, who provided constant inspiration and reminded me daily why I was here.

Lastly, to all those who said yes when they could have more easily said no, my sincere and infinite thanks.

TABLE OF CONTENTS

ACKNOWLEDGMENTS ...... iv LIST OF TABLES ...... vi LIST OF FIGURES ...... vii ABSTRACT ...... viii CHAPTER I. INTRODUCTION ...... 1 A. Reproduction in Asteroids ...... 2 B. Autotomy in Asteroids ...... 2 C. Regeneration in Asteroids ...... 3 D. Telomeres and Telomerase ...... 5 E. The Grey Starfish, Luidia clathrata ...... 13 F. Purpose and Hypotheses ...... 15

CHAPTER II. MATERIALS AND METHODS ...... 16 A. Collection, Housing, and Injury ...... 16 B. Experimental Manipulation ...... 16 C. Genetic Analysis of Telomere Length ...... 19 D. Genetic Analysis of Telomerase Expression ...... 20 E. Statistical Analysis ...... 20

CHAPTER III. RESULTS ...... 22 A. Experiment 1: Telomere Length in Regenerating Arm Tissues ...... 22 B. Experiment 2: Telomere Length after a Simulated Fission ...... 23 C. Experiment 3: Telomere Length in Twice-Regenerated Arms ...... 26 D. Experiment 4: Telomere Length in Juvenile Luidia clathrata ...... 26 E. Experiment 5: Telomerase Expression in Regenerating Tissues ...... 27

CHAPTER II. DISCUSSION ...... 29 A. Simulated Fission and Regeneration ...... 29 B. Presence of Telomere Elongation ...... 30 C. Reasons for Elongation ...... 31 D. Limitations to Telomere Elongation ...... 33 E. Telomerase Expression ...... 34 F. Summary and Future Studies ...... 35

REFERENCES ...... 38

LIST OF TABLES

1. Experiment 1, Luidia clathrata, individual telomere DNA Ct (cycle threshold) values for experimental starfish regenerating two arms and non-regenerating controls for two time points………………………………………………..……………………………….……… 23

2. Experiment 2, Luidia clathrata, individual telomere DNA Ct (cycle threshold) values for experimental three-armed half starfish regenerating two arms and non-regenerating controls for two time points ………………………………………………..……………………...… 24

3. Experiment 3, Luidia clathrata, individual telomere DNA Ct (cycle threshold) values for experimental starfish regenerating two arms with one of the two removed twice.…………...…………………………………………………………………………… 26

4. Experiment 4, Luidia clathrata, individual telomere DNA Ct (cycle threshold) values for non-regenerating juveniles and adults ……………………………………………………... 27

5. Experiment 5, Luidia clathrata, individual telomerase mRNA Ct (cycle threshold) values for experimental starfish regenerating one arm at three time points ………………………...… 28

LIST OF FIGURES

1. Diagram of DNA forming a T-loop and subsequently formed D-loop ……………………... 6

2. Replication fork at the end of a chromosome, demonstrating the portion of DNA lost to replication of DNA ………………………………………………..……………………...… 7

3. Phylogenetic relationships of telomere sequences across Metazoans ………….…………… 9

4. Differing views of echinoderm evolutionary relationships ……………..…………………. 12

5. Phylogenetic tree of asteroid orders and families, illustrating groups where fissiparous reproduction occurs and the location of Luidia clathrata……………………...…………… 14

6. Experiments 1, 2, 3, and 5 wounding patterns of Luidia clathrata for experimental regeneration ………………………………………………………………………………… 18

7. Adult and juvenile Luidia clathrata side by side to illustrate size difference …………...… 19

8. Regeneration of one individual of Luidia clathrata during experiment 2, illustrating protruding stomach and uneven initial arm regeneration ………………………………….. 25

vii

ABSTRACT

TELOMERE ELONGATION IN REGENERATING TISSUES OF THE GRAYSTARFISH,

LUIDIA CLATHRATA

Rebecca Michelle Varney

Regeneration of body tissues in starfish remains poorly understood despite centuries of study. In 2015 elongation of telomere sequences was documented in the asexually reproducing starfish Coscinasterias tenuispina, the first time such a phenomenon had ever been observed in somatic tissues. Here, telomere sequences were investigated in Luidia clathrata, a sexually reproducing species. Telomere elongation was confirmed in Luidia clathrata, after both arm injury and a simulated asexual split. Telomeres of juvenile starfish were consistently longer than those of adults. Telomerase expression was detected prior to injury as well as during regeneration, suggesting constitutive expression. As Luidia clathrata are not immediately related to Coscinasterias tenuspina, the presence of telomere elongation suggests that this ability may be common to all starfish.

viii

CHAPTER I

INTRODUCTION

The regenerative ability of echinoderms has long fascinated scientists (Cuvier 1797;

Lamarck 1818). Though other animals are certainly proficient at regenerating extremities, few are capable of regenerating internal organs (Maginnis 2006). Additionally, the regenerated appendages of other groups frequently lack the complexity of the original (Jamison 1964).

Echinoderms by contrast are capable of regenerating both limbs and their respective internal organs, without a loss of function in either (Hyman 1955).

Regeneration is fundamentally a method by which echinoderms can maintain or increase their fitness within, or in spite of, their environment. In asteroids (starfish), regeneration of arms is found in all species (Lawrence 1992). As arm tissues are inexorably tied to fitness both in terms of survival and reproduction, asteroids would be expected to evolve sophisticated regenerative pathways on both an organismal and a cellular level. Yet only in the past twenty years have investigations of the genetic mechanisms underlying regeneration been pursued

(Moss et al. 1998; Vickery et al. 2001; Thorndyke et al. 2001; Czarkwiani et al. 2013).

From a genetic perspective, regeneration requires cells to return to a pluripotent state prior the subsequent tissue growth. This process is genetically complex: for example, the regeneration of lizard tails requires the activation of 326 different genes, as well as the use of satellite cells to permit the regeneration of skeletal-muscular tissues, suggesting extreme complexity from a molecular perspective (Hutchins et al. 2014). The sheer amount of cell growth necessary raises questions about the cell cycle within echinoderms, and through what mechanisms this level of proliferation is possible.

Reproduction in Asteroids

Despite consistent anatomical features, there is a wide diversity of reproductive modes in the asteroids, including protandry, brooding, broadcast and/or batch spawning, and fission. All are united by dependence on gonadal tissues and pyloric caeca within the arms, and thus the fitness of all individuals is linked to arm tissue. Most asteroids are batch-spawners (Raymond et al. 2004; Micael et al. 2011). In sexually reproducing species, pyloric caeca mass varies inversely to gonadal mass, indicating energetic reallocation during gonad development (Miller and Lawrence 1999). Likewise, in brooding starfish the pyloric caeca dramatically shrinks in size, demonstrating the reliance of female brooders on stores of energy until their young leave

(Chia 1969; Turner and Dearborn 1979; Jangoux and Lawrence 1982).

Reliance on the pyloric caeca is more extreme in cases of fissiparous reproduction.

Fissiparous starfish reproduce at least in part by dividing the body in half, and subsequently regenerating the lost portions to form two complete animals. Fission is rarely the sole reproductive mode, and some starfish species undergo fission at smaller sizes and sexual reproduction at larger sizes; while others undergo both sexual and asexual reproduction annually

(Fisher 1925; Alves et al. 2002; Barker and Scheibling 2008; Rubilar et al. 2011). Upon fission at least one half, if not both halves, must rely on stored reserves to fuel regeneration until the function of the mouth and stomach is restored (Lawrence 2013). Fissiparous starfish must therefore undergo dramatic regeneration as part of their reproductive cycle.

Autotomy in Asteroids

In starfish, autotomy refers to an individual deliberately dropping an arm or arm segment, and is distinct from injury (an arm or arm segment being forcibly removed through predation, etc.). Autotomy frequently follows injury of an arm (Kaiser 1996; Wilkie 2001). Though all

starfish species are capable of regeneration, the tendency of individuals to autotomize arms varies widely across asteroids (Mazzone et al. 2003).

The most immediate fitness benefit of arm loss is that of predator-avoidance.

Autotomized arms act as a decoy to facilitate escape from predators (Mauzey et al. 1968;

Lawrence and Vasquez 1996). Some starfish species may also autotomize arms for thermal regulation, the arm serving as a heat sink prior to detachment (Pincebourde et al. 2013). When disease is found on the arms, autotomy can stop the spread of the disease to the rest of the body

(Lawrence 1992). In the most extreme form of autotomy, individuals can split themselves through the central disc (Emson and Wilkie 1980). Disk fission is common within the comet stars, a group of asteroids that autotomize portions of the body and regenerate to produce multiple viable individuals (Edmondson 1935).

The cost of losing an arm is higher for asteroids than for ophiuroids (brittle stars) due to the presence of both pyloric caeca and gonad tissues in each arm. Not only does an individual forfeit the reproductive potential and energy reserves of the lost limb, but also the energy reserves of other limbs, which may be metabolized to aid in the regenerative process (Lawrence and Larrain 1994; Pomory and Lares 2000; Lawrence 2010).

Regeneration in Asteroids

Regeneration can take two forms: morphollaxis and epimorphosis. Morphollaxis is the rearrangement of existing cells to compensate for lost tissues, whereas epimorphosis creates a blastema that serves as a source of new cells throughout regeneration (Morgan 1901).

Echinoderm regeneration differs from that of vertebrates in magnitude. The most extensive vertebrate examples are the tails of lizards and legs of amphibians (Tsonis 2000; Bely and

Nyberg 2010). In contrast, most echinoderms can regenerate a majority of their bodies, notably

including internal organs (Carnevali 2006). Arguably both morphollaxis and epimorphosis occur in asteroids, though regeneration is viewed as at least initially morphollactic, making asteroid regeneration slower than that of crinoids (sea lilies, feather stars) and ophiuroids (Candia

Carnevali and Bonasoro 2001). However, the distinction between morphollaxis and epimorphosis at the organismal level is increasingly seen as an artificial one (Candia Carnevali and Bonasoro 2001; Matranga 2006). Additionally, migration of cells to the wound site was documented in one asteroid species (Coscinasteria muricata), an approach that fits neither method (Mazzone and Byrne 2000). In asteroids arm regeneration is nerve-dependent with part of the oral and radial nerve necessary for regeneration to occur (Huet 1975). In some asteroid species an entire animal can regrow from segments less than three centimeters in length, or less than 20 % of the individual’s size (Edmondson 1935).

Regeneration rate is altered by environmental factors. Decreasing salinity decreases regeneration rate substantially, but slight increases in salinity do not have a significant effect

(Kaack and Pomory 2011; Honeycutt 2015). In terms of acidity and alkalinity, pH has no measurable effect on rate of regeneration, but individuals kept at lower pH produced slightly shorter arms (Schram 2011). Temperature extremes, both low and high, decrease overall growth rate, but the tendency of starfish to behaviorally change their temperature environment ameliorates these effects (Pincebourde et al. 2008).

The genes involved in organ regeneration include genes relevant to cell shape such as actin to the gene families involved in developmental signaling pathways like those gene families

Wnt and Hox (Ortiz-Pineda et al. 2009). Nervous tissue regeneration, the most difficult and thus least common form of regeneration in vertebrates, occurs in sea cucumbers via de-differentiation and re-differentiation of glial cells into function nerve cells (Mashanov et al. 2013). In asteroids,

fewer genes have been identified thus far. Luidia foliolata (sand star) larvae were injured and genes examined for evidence of differential expression. Though nine genes (some in the aforementioned developmental pathways) were potentially identified, none were entirely specific to regeneration (Vickery et al. 2001). In Amphiura filiformis, a brittlestar, there is early segregation of the progenitor cells of muscle and skeleton, highlighting the early differentiation of tissues relative to tissue development (Czarkwiani et al. 2013). This phenomenon could provide the basis for an almost compensatory view of asteroid regeneration (Gilbert 2013). At the very least, cells de-differentiate by a few degrees before re-differentiating into the appropriate tissues (Fan et al. 2011). From a genetic perspective, the question that logically follows is how can asteroids continually regenerate limbs from existing cells, maintaining both tissue health and the ability to form gonads in the new tissues, with seemingly limitless capability?

Telomeres and Telomerase

Telomeres are repeating sequences at the ends of chromosomes, ranging anywhere from

300 base pairs to several kilobases (Shampay et al. 1984). Telomere sequences are conserved throughout most metazoans (Gomes et al. 2011). They serve two functions: protecting chromosome ends from degradation and double-strand break machinery, and protecting coding sequences from the lagging strand degradation that takes place during each round of replication

(Siderakis and Tarsounas 2007).

Protection from double-strand break machinery is necessary to avoid accidental joining of chromosomes and subsequent errors in mitosis. Likewise, DNA degradation by DNAses can only initiate at the ends of strands, and thus only at the ends of chromosomes. Both problems are avoided by the formation of T-loops, structures formed by the looping back of repeats and

subsequent strand invasion of the overhanging end to form a small D-loop (Figure 1). This loop binds chromosome ends to several proteins (notably the shelterin complex) and prevents attack from DNAses and double-strand break machinery (Martínez and Blasco 2010).

T-loop

Telomeric D-loop Coding sequence repeats

Figure 1: T-loop and D-loop formation at the end of a chromosome, with the shelterin protein complex denoted as a gray circle.

However, some loss of DNA is inherent to DNA replication, and thus telomeres also protect coding sequences from this loss by serving as sacrificial DNA. Replication relies on

RNA primers, which are subsequently converted to DNA after polymerase passes. The conversion of RNA primers to DNA relies on a portion of DNA upstream of the primer, and thus some sequence on the lagging strand will be lost each cycle (Figure 2) (Muller 1938). As long as this lost DNA is a telomeric repeat instead of a coding sequence, the cell will still be able to transcribe all necessary proteins. If a telomere gets too short, there is a risk of losing coding sequences. Telomeres below a certain threshold length will trigger apoptosis or programmed cell death.

Figure 2: Replication fork demonstrating the portion of DNA that is lost each cycle of DNA replication. RNA primers (pink) at the ends of lagging strands are unable to convert to DNA due to lacking the preceding 3' OH group. These remaining RNA sequences are cleaved, leaving a gradually shortening molecule.

Telomere sequences can be elongated by the enzyme telomerase, which occurs predominately in the sex cells of sexually reproducing organisms (Schaetzlein et al. 2004).

However, telomerase activity is thought to be potentially tumor-inducing, and in vertebrate adult animals lengthening of telomeres is rarely found outside of the gonad, except within cancerous tissues (Rhyu 1995).

Other mechanisms of telomere elongation include transposable elements and the

Alternative Lengthening of Telomeres (ALT) pathway. Transposable elements are fragments of

DNA that can relocate within the genome. In plants, as well as some arthropods, these transposable elements seem largely responsible for chromosomal end capping and protection

(Gomes et al. 2011). The ALT pathway exists in some arthropods, as well as a small fraction of 7

human cancers. This mechanism relies on mutual strand invasion of the ends of different chromosomes, which in turn form a primer for DNA polymerase to replicate DNA, before the chromosomes break apart again (Neumann and Reddel 2002).

The vast majority of metazoans follow the “vertebrate” motif of (TTAGGG)n, with telomeres elongated by telomerase, but there are several exceptions (Figure 3). These exceptions include Nematoda (round worms, which follows a (TTAGGC)n motif and elongates via an unknown mechanism) (Wicky et al. 1996), Acanthocephala (Rotifera) (which contains an as-of- yet undetermined repeat), and Arthropoda (in which most members follow (TTAGG)n) (Traut et al. 2007). Notably within arthropods, Coleoptera (beetles) contains several differing motifs that show no phylogenetic consistency (Sahara et al. 1999), and Myriapoda (millipedes, centipedes) also lacks the (TTAGG)n motif (Gomes et al. 2011). Additionally, some arthropods use either the ALT pathway or retrotransposons rather than telomerase (Mason and Biessmann 1995).

Figure 3: Phylogenetic relationships of differing telomere sequences and elongation mechanisms. Data compiled from (Rinkevich and Loya 1986; Mason and Biessmann 1995; Fajkus et al. 1996; Wicky et al. 1996; Klapper et al. 1998; Sahara et al. 1999; Francis et al. 2006; Traut et al. 2007; Ebert et al. 2008; Gomes et al. 2011; Tasaka et al. 2013)

Regeneration of tissues is only possible if the limitations of cell senescence are circumvented. Thus telomeres are expected to elongate in some way for regeneration to take place. However, telomerase activity differs greatly within metazoans, constitutively expressed in some animals, and a regulated response pathway in others (Gomes et al. 2010).

Telomerase regulation is possible to some degree in some organisms; a recent study of yeast telomerase verified a pathway to turn off the protein after expression (Tucey and Lundblad

2014). In Porifera (sponges), telomerase is expressed in clusters of cells, but not in single cells, suggesting that telomerase expression is somehow linked to cell adhesion (Koziol et al. 1998).

This supports the idea that sponges are to some degree immortal and can undergo indefinite

vegetative propagation (Gomes et al. 2011). Cnidarians (jellies) demonstrate telomerase activity in the gonads, but nowhere else despite regeneration capability, and do show signs of aging suggesting a non-immortal cellular lifespan (Rinkevich and Loya 1986).

Platyhelminthes (Planarians) are extensively studied, owing to their established regenerative abilities (Morgan 1901). Telomerase is active during asexual reproduction throughout the entire animal, and thus telomeres are longer in the resulting animal throughout the body, not only in newly regenerated tissue (Tan et al. 2012). Planarian lineages are distinctly sexual or asexual. In sexually reproducing lines, telomerase is expressed only in reproductive tissues, and telomeres in the remaining body tissues shorten with age. In contrast, in asexual lines telomerase is active throughout the body and telomere length remains constant (Tasaka et al.

2013).

Telomerase is active throughout tissues of adult lobsters and crabs (Klapper et al. 1998).

In fishes, telomerase expression is found distinctly in regenerating fin tissues, indicating a response pathway specific to regeneration (Elmore et al. 2008). In most other vertebrates high levels of telomerase expression in adults is only found in reproductive tissues, or in cancerous cells (Gomes et al. 2011).

The rapid cell proliferation necessary for regeneration should be an ideal time for cancer to appear. Telomerase activity is down-regulated in adult tissues of most organisms to decrease the risk of cancer (Cooper 2000; Gomes et al. 2011). There is no record of any cancerous tissues in echinoderms. In fact, even when hydrocarbons and other carcinogens were directly injected into regenerating tissues in asteroids, no neoplasia, or uncontrolled cell growth, was induced

(Wellings 1969). Extracted compounds from three different asteroids had varying chemopreventive effects (Farokhi et al. 2010; Lee et al. 2011; Mutee 2012), suggesting that

echinoderms have the potential to suppress cancer and thus permit constitutive telomerase expression.

Echinoderms do express telomerase, but the degree of expression is variable (Elmore et al. 2008). As echinoderms are capable of regenerating the same limb multiple times without difficulty, there must be mechanisms to maintain cell growth potential (and thus to some degree telomere length). Telomeres of Echinoidea (sea urchins) do not shorten consistently across the lifespan of individuals, suggesting that telomerase must remain active to some degree in urchins throughout their lifespans (Francis et al. 2006). Starfish gonads are expected to contain active telomerase due to the necessity of gametes having telomeres of maximum length. As starfish re- form their gonads seasonally, it seems logical that starfish would have active telomerase in at least some regions of their arms. This expectation makes more sense in sexually reproducing species, as fitness is dependent at least in part on the genetic health of gametes.

In 2015, Garcia-Cisneros et al. documented a novel phenomenon in a species of fissiparous starfish, Coscinasterias tenuispina. Not only did this species regenerate half of the body post-fission, but in the newly regenerated portion, telomeres were significantly longer than in the original tissues (Garcia-Cisneros et al. 2015). Though maintenance of telomere length has been previously associated with regeneration, this is the first instance of significant telomere elongation in healthy asteroid tissue. The question that follows is whether this phenomenon is unique to this species, to fissiparous starfish, or if all starfish are capable of telomere elongation and thus potential immortality.

The activity of telomerase in echinoids (sea urchins) and an asteroid (starfish), and the extensive capacity of crinoids (feather stars), holothuroids (sea cucumbers), and ophiuroids

(brittlestars) to regenerate, support the idea of conserved evolution of constitutive telomerase

activity. Postulating about this ability being universal in all echinoderms, or only certain groups, is complicated by the discord among theories of evolutionary relationships. Two competing hypotheses are currently held: cryptosyringia and asterozoa. The cryptosyringia hypothesis postulates that asteroids are basal to ophiuroids, with holothuroids and echinoids representing the most derived sister groups. By contrast, the asterozoa hypothesis groups asteroids and ophiuroids together, and also holothuroids and echinoids together, with crinoids basal to both nodes (Figure

4) (Wanninger 2015). Prior to detection of telomerase activity in asteroids, it was possible in both views that this ability was unique to the echinoid/holothuroid branch.

Figure 4: Alternative views of echinoderm evolutionary relationships, with the asterozoa hypothesis on the left, and the cryptosyringia hypothesis on the right (Wanninger 2015)

The Grey Starfish, Luidia clathrata

Luidia clathrata (Say 1825), or the grey sea star, is found in shallow waters of the Gulf of

Mexico, the Caribbean Sea, and the western Atlantic Ocean (Hendler et al. 1995). Luidia clathrata reproduces exclusively sexually, with gonads formed seasonally in the fall prior to spawning (Hintz and Lawrence 1994). Luidia clathrata undergoes frequent regeneration of arms; estimates in the field found approximately 60 % of individuals regenerating one or more arms

(Pomory and Lares 2000). This frequent regeneration suggests that L. clathrata might possess any mechanisms found among the asteroids to maintain fitness throughout and after the regenerative process, including telomerase activity.

Luidia clathrata (Family Luidiidae) is also interesting from a phylogenetic perspective.

Intriguingly, fissiparity is not monophyletic among asteroids. It occurs in families Asteriidae

(genera Coscinasteria, Stephanasteria, and Sclerasterias), Ophidiasteridae (particularily the genus Linckia) and Asterinidae (genus Nepanthia), (Fisher 1925; Ottesen and Lucas 1982).

Asteriidae and Asterinidae are in different orders, which are non-adjacent phylogenetically

(Figure 5) (Mah and Blake 2012). Luidiidae falls almost exactly between the extreme groups, making it an ideal indicator for the prevalence of a trait among all asteroids.

Figure 5: A phylogenetic analysis of asteroid orders and families (Mah and Blake 2012). Green families indicate groups where fissiparous reproduction occurs, with the star indicating the placement of the species with documented telomere elongation (Garcia-Cisneros et al. 2015). The blue family is Luidiidae containing Luidia clathrata

Purpose and Hypotheses

Experiments were performed to determine if Luidia clathrata is capable of elongating telomeres in regenerating tissues. Telomere length was measured in regenerating arms following arm amputation and quantified relative to lengths prior to injury and regeneration (Experiment

1). In light of the fissiparous starfish in which telomere elongation was first documented, telomere lengths were also measured in regenerating tissues following a simulated fission event

(Experiment 2). As telomere extension provides a distinct advantage, I hypothesized that L. clathrata would demonstrate telomere elongation in both experiments. To determine if potential elongation could continue to occur in the same limb, one arm was amputated again in three individuals from Experiment 1, and telomere lengths were measured in the twice-regenerated arm (Experiment 3). I hypothesized that the telomeres would continue to elongate after two amputations, but not to the same extent. The opportunity to collect very small juveniles arose during experiments, and telomere length was measured in three juveniles to determine if telomeres were shorter in adults than in juveniles (Experiment 4). As continual elongation seemed unlikely, I hypothesized that juvenile telomeres would be longer on average than adult telomeres. Lastly, the expression of telomerase was measured before injury and throughout regeneration (Experiment 5). Though perceived as disadvantageous due to the longer regeneration time, the slower cellular response could provide time for activation of more specific responses. Thus I hypothesized that telomerase expression levels will increase in the time following injury and remain at a high level in regenerating tissues relative to non-regenerating tissues.

CHAPTER II

MATERIALS AND METHODS

Collection, Housing, and Injury

Individuals of Luidia clathrata were collected by hand via snorkel in shallow, sandy areas within Pensacola Bay (30.324189° N, -87.209636° W), and transported back to a climate- controlled greenhouse at the University of West Florida maintained at approximately 25 °C.

Starfish were housed individually in plastic tubs (42 cm x 32 cm, water depth approximately 15 cm) with air-driven filters containing activated charcoal and filter floss. Each tub contained sand from Pensacola Beach to a depth of 1.5 cm. Starfish were fed three times weekly (approximately

1 g per feeding) on a manufactured starfish food consisting of alginate (3 %), mineral premix (16

%), vitamin premix (0.5 %), carbohydrate (21 %), lipid (3.1 %), marine animal meal (39.6 %), protein (16.8 %) (A.L. Lawrence, Texas AgriLife Research Mariculture Laboratory, Port

Aransas, Texas). Salinity was measured daily via refractometer and maintained at 30 g kg−1. All starfish were acclimated for at least one week prior to experimental manipulation.

Experimental Manipulation

In Experiment 1 (September 23, 2015) two arms were amputated with sterilized scissors in either an adjacent (n = 4), or opposite configuration (n = 4) (Figure 6, wounding pattern 1a or

1b). One of each pair of amputated arms was preserved in 95 % ethanol. When functional tube feet appeared on regenerating arm buds, 5-10 tube feet were removed from one arm bud with sterilized forceps and preserved in 95 % ethanol. Two individuals were left uninjured to serve as controls and had tube feet removed from the same arm on September 23 and at the end of the experiment for comparison.

Prior to the start of Experiment 2, tissue from both disc and tube feet of intact individuals

(n = 8) was taken to serve as a pre-regeneration sample. To simulate a fissiparous split, starfish in Experiment 2 were cut in half with sterilized scissors (October 21, 2015). All starfish were cut the same way relative to the inter-radial stripe to ensure as much uniformity as possible (Figure

6, wounding pattern 2). Three- and two-arm halves were placed into separate tanks. When functional tube feet appeared on regenerating arm buds of the three-arm halves, 5-10 tube feet were removed from one arm with sterilized forceps and preserved in 95 % ethanol. Two uninjured individuals served as controls, with samples taken from the same arm on the day of injury and at the end of the experiment.

After all samples had been collected for Experiment 1, the same group of individuals was used for Experiment 3 (April 28, 2016). In three randomly selected individuals, one of the two amputated arms was amputated again with sterilized scissors and allowed to regenerate. When functional tube feet appeared on the twice-regenerating arm bud, 5-10 tube feet were removed with sterilized forceps and preserved in 95 % ethanol.

In May 2016, juvenile starfish were discovered at the same collecting site as the adults

(Figure 7). For Experiment 4 two arms were removed as described for Experiment 1 (Figure 6, wounding pattern 1a) from three juveniles, and preserved in 95 % ethanol for analysis of tube feet tissue. All tube feet from the arm were detached for DNA digestion due to their small size and thus concerns of having sufficient quantities of genetic material. Three adult pre-injury starfish samples were randomly selected from Experiment 1 for comparison.

Experiment 5 required the collection of a new group of adult starfish (May 14, 2015).

Following acclimation, tissue was taken from three individuals from a single, randomly selected arm (Pre-Injury sample). As tissue collection was equivalent to wounding, immediately after

tissue collection the selected arm was amputated (Figure 6, wounding pattern 3). Additional samples of tube feet were collected from the wound site after full closure (1 week) and after regeneration progressed to the formation of a visible arm bud (3 weeks). All tissues were immediately preserved in RNALater (Thermo Fisher Scientific) for subsequent RNA extraction.

Figure 6: Wounding patterns of Luidia clathrata for the three regeneration experiments. Note the inter-radial stripe, which permits identification of the same arms in each individual. Red lines indicate cuts made for Experiments 1 and 3 (1a & 1b), Experiment 2 (2), and Experiment 5 (3)

Figure 7: Adult and juvenile Luidia clathrata

Genetic Analysis of Telomere Length

DNA was extracted for Experiments 1-4 using the Qiagen DNeasy Kit (Qiagen, Valencia,

CA). DNA samples were quantified and assayed for purity with a Qubit (Thermo Fisher

Scientific) broad range assay. All DNA samples were diluted to 0.5 ng/µL. Samples were stored at -20 °C until analysis.

Quantitative PCR (qPCR) was used to measure telomere lengths in each sample using a

Step One Plus qPCR thermocycler (Applied Biosystems). Primers used were those standard for telomeric repeats, which are conserved throughout deuterostomes: Forward

5′CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT3′, Reverse

5′GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT3′ (Farzaneh-Far et al. 2008).

A standard curve of genomic DNA concentrations created from a mixture of samples was run, with concentrations of 10 ng/µL, 1 ng/µL, 0.1 ng/µL, 0.01 ng/µL, and 0.001 ng/µL DNA.

Power SYBR Green PCR Master Mix (ThermoFisher Scientific) was used in all qPCR assays. Each reaction was of 20 µL volume consisting of 10 µL Power SYBR Green PCR Master

Mix, 2 µL forward primer (1 µM), 4 µL reverse primer (1 µM), 3 µL Milli-Q purified water, and

1 µL DNA (0.5 ng/µL). Negative controls substituted an additional 1 µL of purified water for

DNA. All samples were run in triplicate, with resulting Ct (cycle threshold) values averaged. The qPCR program consisted of an initial 10:00 minutes at 95 °C (per manufacturer’s instruction to initiate the hot-start Taq), followed by 40 cycles of [95 °C for 15 seconds, 56 °C for 1 minute].

At the conclusion of each run, a melt curve was run based on the automatically generated parameters of the instrument.

Genetic Analysis of Telomerase Expression

RNA for Experiment 5 was extracted via a Maxwell RSC automated nucleic acid extractor (Promega, Madison, WI) with the Maxwell 16 Total RNA Purification Kit (Promega,

Madison, WI). Telomerase mRNA levels were measured via RTq-PCR, following the protocol of Ohunchida et al. (2005). Briefly, RNA was reverse-transcribed via a High-Capacity RNA to cDNA Kit (Applied Biosciences) before qPCR was run with primers specific to mRNA of the human telomerase enzyme hTERT (Forward 5’GCGGAAGACAGTGGTGAACT3’, Reverse

5’AGCTGGAGTAGTGCGTCTC3’) (Ohunchida et al. 2005).

Statistical Analysis

An independent t-test not assuming equal variances was used to test for differences in telomere length between opposite and adjacent wounding patterns in Experiment 1. A paired t-

test was used to test for differences in telomere length between pre- and post-regenerating starfish, and between respective time points of control starfish, in Experiments 1 and 2. A repeated measures ANOVA and the LSD multiple comparison procedure were used to test for differences in telomere length among all time points in Experiment 3. An independent t-test not assuming equal variances was used to test for differences in telomere length between adults and juveniles in Experiment 4. A repeated measures ANOVA and the LSD multiple comparison procedure were used to test for differences in telomerase expression among all time points in

Experiment 5. All statistical analyses were carried out in IBM SPSS.

CHAPTER III

RESULTS

Luidia clathrata were kept successfully and permitted to regenerate arms. Starfish are continuing to regenerate nine months later, making this one of the longest time periods of keeping L. clathrata in captivity (Lawrence et al. 1986; Ramsay et al. 2001; Schram et al. 2011).

Starfish remained in the same water they were first placed in, with salinity maintained by the addition of deionized water and no water changes performed. Nitrate levels remained low, suggesting that the waste produced by an individual starfish is negligible in the presence of the bacteria and algae that naturally colonized the filters. Symptoms consistent with bacterial infection were noted in several individuals over the course of the experiment, including superficial lesions and in one instance extruding of pus from an arm. Sand in holding tanks was increased to a depth of two centimeters, after which symptoms ceased progression and individuals recovered. The ability to bury may therefore be relevant to disease control in captive starfish.

Experiment 1: Telomere Length in Regenerating Arm Tissues

Individuals regenerated arms to the point of functional tube feet in approximately 10 weeks, with the exception of two individuals that died during the course of the study. There was no significant difference between opposite and adjacent wounding patterns (independent t-test, equal variances not assumed: t3.906 = 2.108, P = 0.104), so samples were combined for analysis.

Ct (cycle threshold) values were significantly lower in regenerated tissues than in initial tissues

(paired t-test: t5 = 4.61, P = 0.006) indicating telomeres were longer post-regeneration, while in both control animals Ct values were slightly higher, but not significantly different, at the conclusion of the experiment (paired t-test: t1 = -2.405, P = 0.251) (Table 1).

Table 1: Experiment 1, Luidia clathrata, individual telomere DNA Ct (cycle threshold) values for experimental starfish regenerating two arms and non-regenerating controls for two time points

Pre-Regeneration Ct Post-Regeneration Ct Individual Control time 1 Ct Control time 2 Ct 3 19.47 17.1 6 17.98 17.63 9 20.07 17.87 10 18.67 17.93 26 21.02 18.85 28 20.06 18.3 Control 1 17.69 21.47 Control 2 17.98 19.54

Experiment 2: Telomere Length after a Simulated Fission

The majority of the two-armed halves of L. clathrata lived at least two weeks, but all died within three weeks. During this time, they exhibited normal behaviors (e.g. righting response, burying), but could not eat due to lacking a mouth. One three-armed half died prior to regeneration. One individual also dropped another arm after injury and was excluded from the experiment. Three-armed halves initiated regeneration of arms prior to closing the wound.

Stomach was visible protruding from the body cavity up until the regenerating arm buds reached the point of developing tube feet and mobility. The upper part of the wound was closed at approximately the same time functional tube feet emerged on regenerating arms. In two individuals, the two regenerating arms initially grew back unevenly, with one arm longer than the other (Figure 8). Arms evened out prior to 50 % regeneration. Ct (cycle threshold) values were significantly lower in regenerated tissues than in initial tissues (paired t-test: t5 = 3.335, P =

0.021) indicating telomeres were longer post-regeneration, while in both control animals Ct values were slightly higher, but not significantly different, at the conclusion of the experiment

(paired t-test: t1 = -4.560, P = 0.137) (Table 2).

Table 2: Experiment 2, Luidia clathrata, individual telomere DNA Ct (cycle threshold) values for experimental three-armed half starfish regenerating two arms and non-regenerating controls for two time points

Pre-Regeneration Ct Post-Regeneration Ct Individual Control time 1 Ct Control time 2 Ct 15 18.91 18.33 17 19.71 19.58 7 21.55 20.22 25 22.02 21.17 30 20.49 19.84 8 18.97 18.82 Control 1 18.43 19.82 Control 2 19.52 20.41

A B

C D

Figure 8: Experiment 2, Luidia clathrata, regeneration after bisection in one three-armed half individual. Note protruding stomach (arrow, A), and uneven initial regeneration of arms (C)

Experiment 3: Telomere Length in Twice-Regenerated Arms

Functional tube feet appeared more quickly, in only three to four weeks, but regeneration times varied more between individuals than in the first regeneration experiment. Ct (cycle threshold) values were significantly lower in regenerated tissues than in initial tissues (Repeated

Measures ANOVA with Greenhouse-Geiser adjustment: F1.004, 2.008 = 77.338, P = 0.013) indicating telomeres were longer post-regeneration (Table 3). Telomere lengths increased significantly after both the first and second regenerations (LSD multiple comparisons: Pre-

Regeneration – Post Regeneration P = 0.001, Post-Regeneration – Post-Second Regeneration P =

0.036).

Table 3: Experiment 3, Luidia clathrata, individual telomere DNA Ct (cycle threshold) values for experimental starfish regenerating two arms with one of the two removed twice.

Individual Pre-Regeneration Ct Post-Regeneration Ct Post-Second Regeneration Ct 10 25.59 22.25 19.1 9 22.2 18.91 15.27 28 18.67 17.93 16.97

Experiment 4: Telomere Length in Juvenile Luidia clathrata

Ct (cycle threshold) values were significantly lower in juveniles than in adults

(independent t-test, equal variance not assumed: t4 = -3.674, P = 0.001) indicating telomeres were longer in juveniles (Table 4).

Table 4: Experiment 4, Luidia clathrata, individual telomere DNA Ct (cycle threshold) values for non-regenerating juveniles and adults

Group Individual Ct Juveniles 3 16.36 38 15.87 40 15.86 Adults 28 21.82 9 22.2 3 20.93

Experiment 5: Telomerase Expression in Regenerating Tissues

Telomerase expression was detected at all time points. Ct (cycle threshold) values were significantly higher in regenerated tissues than in initial tissues (Repeated Measures ANOVA of rank-transformed data, Greenhouse-Geisser adjustment: F1, 2 = 52, P = 0.019) indicating telomerase expression decreased slightly in arm buds (Table 5). Pre-injury telomerase expression and wound closure telomerase expression were both significantly higher than the arm bud telomerase expression (LSD multiple comparisons: Pre-injury – Arm bud P = 0.038, Wound closure – Arm bud P = 0.005). Telomerase expression was not significantly different between pre-injury and wound closure samples (LSD multiple comparisons: Pre-injury – Would closure P

= 0.057).

Table 5: Experiment 5, Luidia clathrata, individual telomerase mRNA Ct (cycle threshold) values for experimental starfish regenerating one arm at three time points

Individual Pre-Injury Ct Wound Closure Ct Arm Bud Ct 5 31.51 31.2 32.01 11 31.73 31.55 32.16 18 30.85 30.55 31.7

In summary, telomeres elongated after both an arm amputation and a simulated fissiparity. When a regenerated arm was removed, telomeres elongated even further during the second sequential regeneration. Juvenile starfish had longer telomeres than adult starfish.

Telomerase expression was similar before and after an injury, and decreased slightly after regeneration had begun.

CHAPTER IV

DISCUSSION

Simulated Fission and Regeneration

The ability of L. clathrata individuals to survive a simulated fission event was unknown.

The frequency of regeneration based on field observations would suggest that arm injury is common in L. clathrata (Pomory and Lares 2000), but there are not any recorded observations of disk bisection being survived. The majority of 2-arm halves (5 of 8) lived to the two week mark, and did close their wounds. During this time, individuals displayed normal behaviors (e.g. burying and righting response). However, whether due to the lack of disc tissues from which to regenerate or the inability to feed during regeneration, all died within 3 weeks.

Three-armed halves survived and regenerated. One individual dropped a third arm and was removed from the experiment (though it did survive and regenerate). The tendency of three- armed individuals to leave their wounds open was very surprising. The stomach extruded from this wound for several weeks. During this time, starfish still ate regularly and appeared normal in other respects. The reason for this unexpected behavior is unknown. Awareness of the absence of predation risk in captivity seems unlikely in starfish due to the lack of a brain and thus sophisticated processing. The sand in the tanks was not deep enough for individuals to bury themselves entirely; perhaps that burying may have served as a stimulus to keep the stomach within the body cavity. Alternatively, L. clathrata is simply not accustomed to such a catastrophic injury, and may not have had the ability to close such a large wound immediately.

This hypothesis supported by one observation of arm loss in a month-old Luidia sarsi in which stomach was observed protruding from the wounds, though this individual did not survive

(Wilson 1978).

A large degree of variation was observed in the way regeneration took place within the three-armed halved individuals. Specifically, two individuals exhibited dramatically uneven growth in the two arms for an unknown reason. Measurements were taken with calipers to verify that bisection cuts were made equidistant from the center of the disc, and no consistent differences in cuts were found. However, regeneration always begins on the ventral side of the animal. If scissors were slanted slightly during bisection, leading to one arm with slightly more ventral tissues compared to the other, uneven regeneration would be explained.

Presence of Telomere Elongation

The initial hypothesis that L. clathrata would elongate telomere sequences was supported by Experiment 1. In all individuals, telomere lengths were longer in regenerated tissues than in initial tissues, as illustrated by a significantly lower Ct value (Table 1). This study marks the second time that telomere elongation post-injury in somatic tissues has been documented. The results of this study directly contradict that of Hernroth et al. (2010), which found no significant difference in telomere lengths between regenerated and non-regenerated arm tissues in Asterias rubens (Hernroth et al. 2010). However, several differences in experimental approach may account for the discrepancy. Hernroth et al. (2010) used FISH (fluorescence in-situ hybridization), while the present study and most other studies published in the past few years

(Ohunchida et al. 2005, Elmore et al. 2008, Mavrogiannou et al. 2007) have used qPCR.

Hernroth et al. (2010) also induced autotomy, while the current study injured starfish by cutting off the limb.

Most critically, Hernroth et al. (2010) compared telomere sequences of a regenerating arm bud to a non-regenerating adjacent arm. Though the incidence of injury in situ appears lower than that of L. clathrata (approximately 26% of A. rubens had current injuries to at least one

arm) (Marrs et al. 2000), it can still be assumed that the probability of an individual having sustained an arm injury over the course of its life is high. Furthermore, the frequency of arm injuries was significantly higher in specimens with arm lengths 5 cm and under (Marrs et al.

2000), precisely the size class investigated by Hernroth et al. (2010) for telomere length. When an individual of L. clathrata loses an arm, a distinctive lighter coloration remains on the appendage for some time. A thorough search of the literature did not yield any such observations for A. rubens, and exploring all available images of regenerating individuals indicated no alterations in appearance of a regenerating limb beyond size. Thus, it is not possible to visually tell which arms of A. rubens may be recently regenerated, and so comparisons of one regenerating arm to an adjacent but separate arm do not make sense. When considering a starfish, and perhaps any echinoderm, each component that can be regenerated independently must be considered to have a separate genetic age.

Reasons for Elongation

The presence of telomere elongation in L. clathrata refutes the suggestion that telomere elongation is unique to asexually reproducing starfish (Garcia-Cisneros et al. 2015). Fissiparity alone then is not sufficient to explain the phenomenon. Telomere elongation appears to be a response to injury, as control animal telomeres shortened slightly over the course of the experiment. The question is what advantage, if any, exists for an animal with longer telomeres in only an arm.

Gonad tissues are contained within the arm, but are generated via cell division from the central disc (Mercier and Hamel 2013). Longer telomeres are unlikely to yield any reproductive fitness advantage, through either an easier growth process for gonads or through healthier gametes with longer telomeres.

Garcia-Cisneros et al. (2015) allude to the idea of immortality for the fissiparous starfish in which this ability was first documented. Cells with elongated telomeres would theoretically have a longer life-span, but for L. clathrata the age of an individual would be best reflected by the age of the central disc. As that portion of the animal is less likely to be injured, the ability to elongate telomeres is unlikely to have an effect on the lifespan of an individual of L. clathrata. In control starfish, Ct values did increase slightly across the time of the experiment, possibly indicating some shortening of telomere sequences over time. Though differences were not statistically significant, it is evident that a small sample size reduced power as the numbers differ at the beginning and end of experiments. If this is the case, L. clathrata does “age” from a genetic perspective, and would “age” despite regenerated arms becoming “younger”.

With regard to fissiparity, telomeres did not elongate to a greater extent in L. clathrata after a simulated fission than after arm regeneration alone. Garcia-Ciscernos et al. (2015) found an average difference of 3 Ct between initial and final telomere length, a slightly greater difference than the present study (averaging at 1.5 Ct). Naturally fissiparous starfish may exhibit elongation to a slightly greater degree. This would be logical, as fissiparity requires much more growth to fully regenerate than a single arm. Further studies on species of both types (sexual and fissiparous) are needed to make a proper comparison.

A majority of L. clathrata are regenerating at least one arm at any given time in the wild

(Pomory and Lares 2000), so arm regeneration can be considered common over an animal’s lifespan. Perhaps the assumption that an individual will lose many arms, and thus is likely to lose the same arm multiple times, explains the need for the ability to elongate telomeres. Considering the incredible amount of cell growth necessary to regenerate an arm, it is possible that telomere sequences would be exhausted by the end of the process or at least much shorter (and the arm

thus “older”). Perhaps this ability evolved not as a step toward genetic immortality, but rather as a mechanism by which starfish can regenerate body parts without prematurely aging that body part.

If this were true, telomere elongation could be expected to occur only initially in regeneration, resulting in new tissues being genetically younger than the rest of the animal only temporarily. This experiment took samples immediately after tube feet were long enough for dissection, when arms were only approximately 10 % regenerated. In contrast, Hernroth et al.

(2010) took samples at 2 cm, which was almost 50 % regeneration relative to the original arm length. Perhaps telomeres are elongated only early on in regeneration, ensuring that by the end of regeneration, despite the cell proliferation that occurs, telomeres will not be any shorter than the rest of the animal. Future studies should take samples across regeneration, and compare the telomere lengths over time to see if new tissues retain a longer telomere than original tissues.

Limitations to Telomere Elongation

As determined in Experiment 3, telomeres did elongate further after a second injury to the same arm. Individuals from Experiment 1 were allowed to regenerate for six months prior to re-injury. After the second injury, arm buds appeared again in only 3 weeks, and in under 5 weeks, all individuals had functional tube feet on the respective arm buds. Regeneration thus occurred more quickly following the second injury. Telomere lengths increased consistently through first and second regenerations; there was no detectable decrease in the ability to lengthen telomeres the second time.

Juvenile starfish in general are poorly studied, largely due to the difficulty in obtaining sufficient numbers for research. The juveniles in this experiment are possibly the youngest of this species collected for experimentation without being cultured in the laboratory. They were

located by chance the first week of May, in water temperatures of 24 °C. The diameter of individuals collected was approximately 30 mm; larvae of other species in genus Luidia reared in the laboratory reached this size at 5-6 months post-metamorphosis (Delap and Delap 1907;

Wilson 1978).

Telomere lengths of juvenile starfish (Experiment 4) were all longer than those of adults.

Adult telomere lengths following two injuries did approach juvenile telomere lengths, but did not elongate past them. A classic view of telomere aging, wherein over an organism’s lifetime telomeres shorten slowly, fits this data. This contrasts with investigations of echinoids (sea urchins) which found a lack of age-associated shortening in telomere sequences (Francis et al.

2006). However, a finite telomere length is suggested by the longer telomeres of juveniles.

Solely in consideration of space in the nucleus, it would be expected that at some point longer telomere lengths would interfere with common nucleic activities (e.g. transcription of other proteins).

Telomerase Expression

Telomerase mRNAs were successfully detected via qPCR. Telomerase levels did not rise immediately following injury, refuting the hypothesis for Experiment 5. Surprisingly in view of the previous experiments, telomerase activity was detected at all three time-points, as evidenced by the presence of the telomerase mRNA. This contrasts with expectations, as the shortening of telomeres in control starfish seemed to indicate chromosomal aging. If telomerase was active in all tissues, a constant telomere length would have been expected. Telomerase is constitutively expressed in echinoids (sea urchins), permitting sea urchins to avoid age-associated telomere shortening (Francis et al. 2006), so a similar phenomenon in starfish would not be surprising.

However, telomeres in L. clathrata shortened in spite of telomerase being expressed.

The dichotomy above suggests some form of downstream regulation of telomerase activity. Several mechanisms for post-transcriptional regulation of telomerase activity are known, including RNAi (studied chiefly for the inhibition of cancer cells, in which small fragments of RNA bind to mRNA and cause their degradation prior to translation) (Gandellini et al. 2007), and also mediated assembly/disassembly of the telomerase complex to regulate functionality in yeast (Tucey and Lundblad 2014). Perhaps starfish engage one of these pathways, allowing expression of telomerase at a low level continuously, but activity only during regeneration. In turn, this is one possible explanation for the lack of cancer seen in asteroids.

Cancer is fundamentally a disease of uncontrolled cell growth. If telomerase activity is inhibited, rather than upregulated as in vertebrate cancers (Cooper 2000, Gomes et al. 2011), cancerous cells would not be capable of unrestrained growth. Perhaps cancerous cells do occur in starfish, but simply cannot grow into observable forms (e.g. tumors).

Summary and Future Studies

This study demonstrates that L. clathrata is capable of elongating telomeres post- regeneration, whether injury is confined to arms or includes disc tissues. Telomere sequences were shorter in juvenile starfish than in adults, and in non-injured starfish shortened slightly.

This supports a classic view of chromosomal aging in starfish, wherein telomeres shorten across cell divisions. However, telomere sequences elongated after injury, and elongated further after a second injury. Telomere lengths therefore cannot be viewed as a possible metric for assessing the age of individuals, due to the high probability of regeneration having occurred in any one starfish. It may be possible to target disc tissues, but the ability of individuals to recover from bisection underlies the impossibility of knowing how old any given piece of tissue is on any one animal.

Telomerase was expressed at all points investigated, even in uninjured tissues. Starfish should be examined for post-transcriptional regulation of telomerase, whether by RNAi or other mechanisms. The fact that individuals were capable of repeated elongation of telomeres introduces a new question: is there a limitation to elongation, or can it continue indefinitely?

Future experiments could examine greater numbers of repeated injuries to ascertain whether a finite limit of telomere length exists. If juveniles are available, genetic examination of regeneration in juveniles would likewise aid in establishing this potential upper boundary, as would genetic examination of larvae.

Considering the phylogenetic position of L. clathrata and C. tenuspina, it can be hypothesized that the ability to elongate telomeres may be common to all starfish, and perhaps all echinoderms. Telomerase expression has been detected in non-injured tissues in echinoids

(Ebert 2008), holothuroids (Elmore et al. 2008), and now asteroids. It can therefore be hypothesized that constitutive telomerase expression may be conserved among echinoderms.

Investigations of other echinoderms to determine which groups may elongate telomeres only post-regeneration and which groups elongate telomeres continuously should be carried out to fully characterize this ability. This in turn warrants future studies on other metazoans to determine the presence or absence of telomerase expression across phylogenetic groups. Lastly, an overlay of known instances of neoplasia relative to this ability might characterize any chemo- preventative effects of telomerase regulatory mechanisms.

The role telomeres play in chromosomal aging is well understood, but here is presented another potential function: the determination of regenerative potential. Further studies of other metazoans should relate findings to the presence or absence of regeneration. Perhaps the ability to elongate telomeres is restricted to organisms capable of substantial regeneration. Likewise the

expression of telomerase may be tied to regenerative abilities. Tracking telomeres and telomerase phylogenetically would be worthwhile.

The reasons for elongating telomeres could be further clarified by longer-term regeneration studies of both fissiparous and sexually reproducing species of asteroids.

Measurements taken through regeneration may demonstrate that telomere elongation occurs only at the onset, and that the telomeres of the body parts in question return to lengths comparable to the rest of the individual by the completion of regeneration. Whatever such studies discover, telomeres hold an essential function worthy of continued investigation, and echinoderms offer novel systems in which to examine genetic abilities lacking in vertebrates.

REFERENCES

Alves LSS, Pereira A, Ventura C (2002) Sexual and asexual reproduction of Coscinasterias tenuispina (Echinodermata: Asteroidea) from Rio de Janeiro, Brazil. Marine Biology 140:95– 101

Barker MF, Scheibling RE (2008) Rates of fission, somatic growth and gonadal development of a fissiparous sea star, Allostichaster insignis, in New Zealand. Marine Biology 153:815–824

Bely AE, Nyberg KG (2010) Evolution of animal regeneration: re-emergence of a field. Trends in Ecology & Evolution 25:161–170

Candia Carnevali MD, Bonasoro F (2001) Microscopic overview of crinoid regeneration. Microscopy Research and Technique 55:403–426

Candia Carnevali MD (2006) Regeneration in echinoderms: repair, regrowth, cloning. Invertebrate Survival Journal 3:64–76

Chia F-S (1969) Histology of the pyloric caeca and its changes during brooding and starvation in a starfish, Leptasterias hexactis. Biological Bulletin 136:185–192

Cooper G (2000) The Development and Causes of Cancer. The Cell: A Molecular Approach, 2nd Edition. Sinauer Associates, Sunderland MA, pp 713–722

Cuvier G (1797) Tableau élémentaire de l’histoire naturelle des animaux. Baudouin, Paris.

Czarkwiani A, Dylus DV, Oliveri P (2013) Expression of skeletogenic genes during arm regeneration in the brittle star Amphiura filiformis. Gene Expression Patterns 13:464–472

Delap M, Delap C (1907) Notes of the plankton of Valencia Harbour 1902-1905. Report of the Sea and Inland Fisheries of Ireland for 1905, Part II, Scientific Investigations pp 141–159

Ebert TA, Russell MP, Gamba G, Bodnar A (2008) Growth, survival, and longevity estimates for the rock-boring sea urchin Echinometra lucunter lucunter (Echinodermata, Echinoidea) in Bermuda. Bulletin of Marine Science 82:381–403

Edmondson CH (1935) Autonomy and regeneration in Hawaiian starfishes. Bernice P. Bishop Museum Occasional Paper XI:3–20

Elmore LW, Norris MW, Sircar S, et al. (2008) Upregulation of telomerase function during tissue regeneration. Experimental Biology and Medicine. 233:958–967

Emson RH, Wilkie I (1980) Fission and autotomy in echinoderms. Oceanography and Marine Biology: An Annual Review 18:155–250

Fajkus J, Kovarik A, Kralovics R (1996) Telomerase activity in plant cells. FEBS Letters 391:307–309

Fan T, Fan X, Du Y, et al. (2011) Patterns and cellular mechanisms of arm regeneration in adult starfish Asterias rollestoni (Bell). Journal of Ocean University of China 10:255–262

Farokhi F, Wielgosz-Collin G, Clement M, et al. (2010) Cytotoxicity on human cancer cells of ophidiacerebrosides isolated from the African starfish Narcissia canariensis. Marine Drugs 8:2988–2998

Farzaneh-Far R, Cawthon RM, Na B, et al. (2008) Prognostic value of leukocyte telomere length in patients with stable coronary artery disease: data from the heart and soul study. Arteriosclerosis, Thrombosis, and Vascular Biology 28:1379–1384

Fisher WK (1925) Asexual reproduction in the starfish, Sclerasterias. Biological Bulletin 48:171–175

Francis N, Gregg T, Owen R, et al. (2006) Lack of age-associated telomere shortening in long- and short-lived species of sea urchins. FEBS Letters 580:4713–4717

Gandellini P, Folini M, Bandiera R, et al. (2007) Down-regulation of human telomerase reverse transcriptase through specific activation of RNAi pathway quickly results in cancer cell growth impairment. Biochemical Pharmacology 73:1703–1714

Garcia-Cisneros A, Pérez-Portela R, Almroth BC, et al. (2015) Long telomeres are associated with clonality in wild populations of the fissiparous starfish Coscinasterias tenuispina. Heredity 115:437–443

Gilbert SF (2013) Developmental Biology, 10th edition. Sinauer, Sunderland

Gomes NMV, Ryder OA, Houck ML, et al. (2011) Comparative biology of mammalian telomeres: hypotheses on ancestral states and the roles of telomeres in longevity determination. Aging Cell 10:761–768

Gomes NMV, Shay JW, Wright WE (2010) Telomere Biology in Metazoa. FEBS letters 584:3741–3751

Hendler G, Miller JE, Pawson DE, Kier PM (1995) Sea Stars, Sea Urchins, and Allies: Echinoderms of Florida and the Caribbean. Smithsonian Institution Press, Washington DC

Hintz JL, Lawrence JM (1994) Acclimation of gametes to reduced salinity prior to spawning in Luidia clathrata (Echinodermata: Asteroidea). Marine Biology 120:443–446

Honeycutt N (2015) Effects of salinity and feeding on arm regeneration of the grey sea star Luidia clathrata. Master’s Thesis, University of West Florida

Huet M (1975) Role of the nervous system during the regeneration of an arm in a starfish: Asterina gibbosa (Penn.) (Echinodermata, Asteriidae). Journal of Embryology and Experimental Morphology 33:535–552

Hutchins ED, Markov GJ, Eckalbar WL, et al. (2014) Transcriptomic analysis of tail regeneration in the lizard Anolis carolinensis reveals activation of conserved vertebrate developmental and repair mechanisms. PLoS ONE 9:e105004

Hyman LH (1955) The Invertebrates, Vol. 4: Echinodermata, 1st edition. The Maple Press Company, New York

Jamison JP (1964) Regeneration subsequent to intervertebral amputation in lizards. Herpetologica 20:145–149

Jangoux M, Lawrence JM (1982) Echinoderm Nutrition. CRC Press, Boca Raton, Florida

Kaack KE, Pomory CM (2011) Salinity effects on arm regeneration in Luidia clathrata (Echinodermata: Asteroidea). Marine and Freshwater Behaviour and Physiology 44:359–374

Kaiser M (1996) Starfish damage as an indicator of trawling intensity. Marine Ecology Progress Series 134:303–307

Klapper W, Kühne K, Singh KK, et al. (1998) Longevity of lobsters is linked to ubiquitous telomerase expression. FEBS letters 439:143–146

Koziol C, Borojevic R, Steffen R, Müller WE (1998) Sponges (Porifera) model systems to study the shift from immortal to senescent somatic cells: the telomerase activity in somatic cells. Mechanisms of Ageing and Development 100:107–120

Lamarck JPBA (1818) Histoire naturelle des animaux sans vertebres, 1st edition. Verdiere, Paris, France

Lawrence JM, Klinger TS, McClintock JB, et al. (1986) Allocation of nutrient resources to body components by regenerating Luidia clathrata (Say) (Echinodermata: Asteroidea). Journal of Experimental Marine Biology and Ecology 102:47–53

Lawrence J, Larrain A (1994) The cost of arm autotomy in the starfish Stichaster striatus. Marine Ecology Progress Series 109:311–313

Lawrence J, Vasquez J (1996) The effect of sublethal predation on the biology of echinoderms. Oceanologica Acta 19:431–440

Lawrence JM (1992) Arm loss and regeneration in Asteroidea (Echinodermata). In: Scalera-Liaci L, Canicatti C (Eds.) Echinoderm Research 1991. Baklema, Rotterdam, pp 39–52

Lawrence JM (2010) Energetic costs of loss and regeneration of arms in stellate echinoderms. Integrative and Comparative Biology 50:506–514

Lawrence JM (2013) Starfish : biology and ecology of the Asteroidea. The Johns Hopkins University Press, Baltimore

Lee K-S, Shin J-S, Nam K-S (2011) Cancer chemopreventive effects of starfish polysaccharide in human breast cancer cells. Biotechnology and Bioprocess Engineering 16:987–991

Maginnis TL (2006) The costs of autotomy and regeneration in animals: a review and framework for future research. Behavioral Ecology 17:857–872

Mah CL, Blake DB (2012) Global diversity and phylogeny of the Asteroidea (Echinodermata). PLoS ONE 7:e35644

Marrs J, Wilkie IC, Sköld M, Maclaren WM, McKenzie JD (2000) Size-related aspects of arm damage, tissue mechanics, and autotomy in the starfish Asterias rubens. Marine Biology 137:59– 70

Martínez P, Blasco MA (2010) Role of shelterin in cancer and aging. Aging Cell 9:653–666

Mashanov VS, Zueva OR, García-Arrarás JE (2013) Radial glial cells play a key role in echinoderm neural regeneration. BMC Biology 11:1–19

Mason JM, Biessmann H (1995) The unusual telomeres of Drosophila. Trends in Genetics: TIG 11:58–62

Matranga V (2006) Echinodermata. Springer Science & Business Media, New York

Mauzey KP, Birkeland C, Dayton PK (1968) Feeding behavior of asteroids and escape responses of their prey in the Puget Sound Region. Ecology 49:603–619

Mavrogiannou E, Strati A, Stathopoulou A, Tsaroucha EG, Kaklamanis L, Lianidou ES (2007) Real-Time RT-PCR Quantification of human telomerase reverse transcriptase splice variants in tumor cell lines and non–small cell lung cancer. Clinical Chemistry 53:53–61

Mazzone F, Byrne M (2000) The haemal sinus -- a possible conduit for migratory cells involved in repair and regeneration of the radial nerve cord in Coscinasterias muricata following autotomy. In: Barker, M (ed) Echinoderms 2000. Balkema, Lisse, pp 167–191

Mazzone F, Byrne M, Thorndyke M (2003) Arm autotomy and regeneration in the seastar Coscinasterias muricata. In: Feral JP, David B (eds) Echinoderm Research 2001. Balkema, Lisse, pp 209–213

Mercier AM, Hamel J-F (2013) Reproduction in Asteroidea. Starfish: Biology and Ecology of the Asteroidea. JHU Press, pp 37–50

Micael J, Rodrigues AS, Barreto MC, et al. (2011) Allocation of nutrients during the reproductive cycle of Ophidiaster ophidianus (Echinodermata: Asteroidea). Invertebrate Reproduction & Development 55:205–216

Miller S, Lawrence JM (1999) Gonad and pyloric caeca production in the nine-armed starfish Luidia senegalensis off the Southwest Florida Gulf Coast during the annual reproductive cycle. Bulletin of Marine Science 65:175–184

Morgan TH (1901) Regeneration. The Macmillan Company, New York

Moss C, Hunter AJ, Thorndyke MC (1998) Patterns of bromodeoxyuridine incorporation and neuropeptide immunoreactivity during arm regeneration in the starfish Asterias rubens. Philosophical Transactions of the Royal Society of London B: Biological Sciences 353:421–436

Muller H (1938) The remaking of chromosomes. The Collecting Net 13:181–198

Mutee F (2012) Apoptosis induced in human breast cancer cell line by Acanthaster planci starfish extract compared to tamoxifen. African Journal of Pharmacy and Pharmacology 6:129– 134

Neumann AA, Reddel RR (2002) Telomere maintenance and cancer ? Look, no telomerase. Nature Reviews Cancer 2:879–884

Ohunchida K, Mizumoto K, Ogura Y, Ishikawa, N, Nagai, E, Yamaguchi, K, Tanaka, M (2005) Quantitative assessment of telomerase activity and human telomerase reverse transcriptase messenger RNA levels in pancreatic juice samples for the diagnosis of pancreatic cancer. Clinical Cancer Research 11:2285–2292

Ortiz-Pineda PA, Ramírez-Gómez F, Pérez-Ortiz J, et al. (2009) Gene expression profiling of intestinal regeneration in the sea cucumber. BMC Genomics 10:262

Ottesen PO, Lucas JS (1982) Divide or broadcast: Interrelation of asexual and sexual reproduction in a population of the fissiparous hermaphroditic seastar Nepanthia belcheri (Asteroidea: Asterinidae). Marine Biology 69:223–233

Pincebourde S, Sanford E, Helmuth B (2013) Survival and arm abscission are linked to regional heterothermy in an intertidal sea star. Journal of Experimental Biology 216:2183–2191

Pincebourde S, Sanford E, Helmuth B (2008) Body temperature during low tide alters the feeding performance of a top intertidal predator. Limnology and Oceanography 53:1562–1573

Pomory CM, Lares MT (2000) Rate of regeneration of two arms in the field and its effect on body components in Luidia clathrata (Echinodermata: Asteroidea). Journal of Experimental Marine Biology and Ecology 254:211–220

Ramsay K, Kaiser M, Richardson C (2001) Invest in arms: behavioural and energetic implications of multiple autotomy in starfish (Asterias rubens). Behavioral Ecology and Sociobiology 50:360–365

Raymond J-F, Himmelman JH, Guderley HE (2004) Sex differences in biochemical composition, energy content and allocation to reproductive effort in the brooding sea star Leptasterias polaris. Marine Ecology Progress Series 283:179–190

Rhyu M (1995) Telomeres, telomerase, and immortality. Journal of the National Cancer Institute 87:884–894

Rinkevich B, Loya Y (1986) Senescence and dying signals in a reef building coral. Experientia 42:320–322

Rubilar T, Villares G, Epherra L, et al. (2011) Fission, regeneration, gonad production and lipids storage in the pyloric caeca of the sea star Allostichaster capensis. Journal of Experimental Marine Biology and Ecology 409:247–252

Sahara K, Marec F, Traut W (1999) TTAGG telomeric repeats in chromosomes of some insects and other arthropods. Chromosome Research: An International Journal on the Molecular, Supramolecular and Evolutionary Aspects of Chromosome Biology 7:449–460

Schaetzlein S, Lucas-Hahn A, Lemme E, et al. (2004) Telomere length is reset during early mammalian embryogenesis. Proceedings of the National Academy of Sciences of the United States of America 101:8034–8038

Schram JB, McClintock JB, Angus RA, Lawrence JM (2011) Regenerative capacity and biochemical composition of the sea star Luidia clathrata (Say) (Echinodermata: Asteroidea) under conditions of near-future ocean acidification. Journal of Experimental Marine Biology and Ecology 407:266–274

Shampay J, Szostak JW, Blackburn EH (1984) DNA sequences of telomeres maintained in yeast. Nature 310:154–157

Siderakis M, Tarsounas M (2007) Telomere regulation and function during meiosis. Chromosome Research 15:667–679

Tan TCJ, Rahman R, Jaber-Hijazi F, et al. (2012) Telomere maintenance and telomerase activity are differentially regulated in asexual and sexual worms. Proceedings of the National Academy of Sciences of the United States of America 109:4209–4214

Tasaka K, Yokoyama N, Nodono H, et al. (2013) Innate sexuality determines the mechanisms of telomere maintenance. The International Journal of Developmental Biology 57:69–72

Thorndyke MC, Chen WC, Beesley PW, Patruno M (2001) Molecular approach to echinoderm regeneration. Microscopy Research and Technique 55:474–485

Traut W, Szczepanowski M, Vítková M, et al. (2007) The telomere repeat motif of basal Metazoa. Chromosome Research: An International Journal on the Molecular, Supramolecular and Evolutionary Aspects of Chromosome Biology 15:371–382

Tsonis PA (2000) Regeneration in vertebrates. Developmental Biology 221:273–284

Tucey TM, Lundblad V (2014) Regulated assembly and disassembly of the yeast telomerase quaternary complex. Genes & Development 2014. 28:2077–2089

Turner RL, Dearborn JH (1979) Organic and inorganic composition of post-metamorphic growth stages of Ophionotus hexactis (E.A. Smith) (Echinodermata: Ophiuroidea) during intraovarian incubation. Journal of Experimental Marine Biology and Ecology 36:41–51

Vickery MC, Vickery MS, McClintock JB, Amsler CD (2001) Utilization of a novel deuterostome model for the study of regeneration genetics: molecular cloning of genes that are differentially expressed during early stages of larval sea star regeneration. Gene 262:73–80

Wanninger A (2015) Evolutionary Developmental Biology of Invertebrates Volume 6: Deuterostomia. Springer, New York

Wellings S (1969) Neoplasia and primitive vertebrate phylogeny: echinoderms, prevertebrates, and fishes- a review. National Cancer Institute Monograph 31:59–128

Wicky C, Villeneuve AM, Lauper N, et al. (1996) Telomeric repeats (TTAGGC)n are sufficient for chromosome capping function in Caenorhabditis elegans. Proceedings of the National Academy of Sciences of the United States of America 93:8983–8988

Wilkie IC (2001) Autotomy as a prelude to regeneration in echinoderms. Microscopy Research and Technique 55:369–396

Wilson DP (1978) Some observations of bipinnariae and juveniles of the starfish genus Luidia. Journal of the Marine Biological Association of the United Kingdom 58:467–477