Secretory Homeostasis and Fungal Pathogenesis: Characterization Of

Home , Aspergillus fumigatus

Secretory Homeostasis and Fungal Pathogenesis: Characterization of the Contribution of Calnexin, SrgA, and the IreA Kinase to the Growth and Virulence of Aspergillus fumigatus

A dissertation submitted to the

Division of Research and Advanced Studies of the University of Cincinnati

in partial fulfillment of the requirements for the degree of

DOCTOR of PHILOSOPHY

in the Pathobiology and Molecular Medicine Graduate Program of the College of Medicine

2013

Margaret MV Powers-Fletcher

B.S., Alma College, 2009

Committee Chair: David S. Askew, Ph.D. Abstract

Invasive aspergillosis (IA) is an often fatal infection most frequently caused by the opportunistic mold pathogen, Aspergillus fumigatus. Current treatment options for IA rely on a limited number of antifungal targets and are plagued by low efficacy and host toxicity. Improving treatment options for IA requires expanding our understanding of the pathways that support A. fumigatus growth and virulence in order to identify points of vulnerability that could be targeted with novel antifungal drug therapies. Because of its important role in A. fumigatus nutrient acquisition and filamentous growth, it is thought that the secretory pathway contributes to A. fumigatus pathogenesis.

Homeostasis within the secretory pathway is maintained through four broad mechanisms: ER quality control (ERQC), vesicle transport, ER associated degradation (ERAD), and the unfolded protein response (UPR). ERQC, vesicle transport, and ERAD are basal functions of the secretory pathway that provide the processing capacity required to meet the secretory demands of the organism. When this balance of capacity versus demand is disrupted, the secretory system can become overwhelmed and levels of misfolded proteins within the ER increase. In order to adapt, the cell utilizes an ER stress response pathway known as the UPR.

As a result of UPR induction, components of homeostasis pathways are up-regulated in order to restore secretory homeostasis.

Previously, our laboratory demonstrated that the UPR contributes to the virulence of A. fumigatus. However, very little is known about how the other secretory homeostasis pathways,

ERQC, vesicle transport, and ERAD, contribute to fungal pathogenesis. Additionally, the UPR regulatory mechanisms contributing to pathogenesis are not fully understood. Therefore, the purpose of this dissertation was to characterize for the first time the contribution of key proteins involved in these homeostasis pathways, including the chaperone calnexin (ERQC), the Rab

GTPase SrgA (vesicle transport), and the kinase domain of IreA (master regulator of the UPR), to the growth and virulence of A. fumigatus.

Using a gene-deletion approach, we found that calnexin and SrgA play important roles in facilitating the fungal response to unique in vitro stress conditions. Loss of calnexin increases A. fumigatus susceptibility to high temperatures, metal ion and nutrient limitation, and acute ER stress, while SrgA is required for optimal radial growth, asexual reproduction, and the response to chemical compounds that disrupt vesicle transport. Surprisingly, neither of these proteins were required for virulence. Similarly, we found that mutation within the IreA kinase resulted in altered in vitro phenotypes but did not reduce the virulence of A. fumigatus. We do not think that the dispensable nature of calnexin, SrgA, and an intact IreA kinase suggests that these proteins, and the pathways to which they contribute, are unimportant to A. fumigatus. Rather, we speculate that this cellular robustness provides evidence for redundancy in secretory homeostasis mechanisms. More specifically, we speculate that the UPR is a broad-spectrum compensatory mechanism supporting homeostasis and virulence of A. fumigatus. Future studies dedicated to advancing our understanding of secretory homeostasis regulation could reveal novel and effective antifungal drug targets to improve the therapy of invasive aspergillosis.

Chapters II and III of this dissertation are adaptations of manuscripts published in the open- access journal, PLoS ONE. Both published works are distributed under the terms of the

Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. The citation for each article can be found on the title page of the corresponding chapter.

iii

Acknowledgements

This dissertation could not have been completed without the support and help from many individuals. I would first like to thank the students and faculty of the Pathobiology and Molecular Medicine program. Your dedication and enthusiasm for science is inspiring and I am honored to have been trained in such a remarkable program. I would especially like to thank Heather Anderson for not only being an exemplary program coordinator but also for becoming a valued friend. To the members of the Askew and Rhodes laboratories, I am truly grateful for your help. Your knowledge and experience has enhanced this dissertation, and working together the past four years has helped me grow into a more confident and capable scientist. I would also like to thank Jay Card for his unfailing assistance with figure preparation and for his patient and good- humored approach to each project. To Drs. David Askew, Judith Rhodes, George Smulian, Melanie Cushion, and Linda Parysek, I greatly appreciate your willingness to serve as members of my thesis committee. Your constructive feedback and unique perspectives have been key in guiding me through my dissertation work and in my development as a researcher. I would especially like to thank my mentors Drs. David Askew and Judith Rhodes. To Dr. Rhodes, I am honored that you were willing to take me under your guidance. You have not only helped me find my path, but have also served as a model for the level of expertise and good sense to which I aspire. To my advisor Dr. Askew, as much as I love planning, I could not have devised a more fitting mentor for my graduate career. You have taught me to think critically and communicate clearly, and these are attributes upon which I will rely in all future professional and personal endeavors. Your ability to combine encouragement, advice, wisdom, and tact is the epitome of good mentorship. Finally, I would like to say thank you to my family. To my extended family, thank you for being such a strong network of loving and supportive individuals. To my parents, thank you for giving me the support and tools to approach life with confidence and compassion. To my siblings, thank you for being the people with whom I will always want to huddle but who also inspire me to reach out to others. To the Fletchers, thank you for welcoming me in as one of your own with love and care. And to my husband, Jason, thank you for your endless encouragement, for helping me stay in the driver’s seat, and for making me laugh.

Table of Contents

Abstract...... i Copyright Notice ...... iii Acknowledgements ...... iv Table of Contents ...... v List of Figures and Tables ...... viii Chapter I: Introduction ...... 1 Section 1.1 – Background ...... 2 Section 1.2 –Pathobiology of Aspergillosis ...... 2 Section 1.2.1 The Microbe ...... 2 Section 1.2.2 The Host and the Damage ...... 5 Section 1.2.3 Clinical Significance of Invasive Aspergillosis ...... 8 Section 1.3 – What Makes A. fumigatus Such a Dangerous Pathogen?...... 10 Section 1.3.1 Virulence and Virulence Factors ...... 10 Section 1.3.2 Coincidental Selection of Virulence Attributes ...... 11 Section 1.4 – Is Maintenance of Secretory Homeostasis a Dual-Use Virulence Attribute of Aspergillus fumigatus? ...... 14 Section 1.4.1 Introduction to the Secretory Pathway...... 14 Section 1.4.2 Importance of Secretion to A. fumigatus ...... 17 Section 1.4.3 Maintenance of Homeostasis within the Secretory Pathway ...... 20 Section 1.4.3 Inspiration from the Cancer Field ...... 27 Section 1.4.4 Secretory Homeostasis and Fungal Pathogenesis ...... 28 Section 1.5 – How Does this Thesis Contribute to the Field of Aspergillosis Research? ...... 31 Chapter II: ERQC ...... 32 Section 2.1 – Background ...... 33 Section 2.2 – Materials and Methods ...... 34 Section 2.2.1 Strains and Culture Conditions...... 34 Section 2.2.2 Deletion and Reconstitution of the A. fumigatus clxA Gene ...... 35 Section 2.2.3 Analysis of Protease Secretion by Substrate Specificity Profiling ...... 37 Section 2.2.4 Animal Model of Invasive Aspergillosis ...... 38 Section 2.3 – Results and Discussion ...... 39 Section 2.3.1 Construction of a Calnexin-Deficient Strain of A. fumigatus ...... 39 Section 2.3.2 Loss of Calnexin Alters the Proteolytic Secretome of A. fumigatus ...... 41 Section 2.3.3 Calnexin Facilitates Growth Under Conditions of Thermal Stress ...... 44

Section 2.3.4 Calnexin Facilitates Growth under Conditions of Acute Protein Folding Stress 45 Section 2.3.5 Calnexin Facilitates Growth Under Starvation Conditions ...... 47 Section 2.3.6 Loss of Calnexin Promotes Growth on 2-deoxy-D-glucose ...... 48 Section 2.3.7 Calnexin is Required for Growth in Cation-Depleted Medium ...... 49 Section 2.3.8 Calnexin is Dispensable for A. fumigatus Virulence ...... 51 Section 2.4 – Summary ...... 52 Chapter III: Vesicle Transport ...... 54 Section 3.1 – Background ...... 55 Section 3.2 – Materials and Methods ...... 56 Section 3.2.1 Culture Conditions ...... 56 Section 3.2.2 Analysis of Intracellular Localization by GFP-tagging ...... 56 Section 3.2.3 Deletion of A. fumigatus srgA ...... 57 Section 3.2.4 Analysis of Conidiophore Development ...... 58 Section 3.2.5 Galleria mellonella Infection Model ...... 58 Section 3.3 – Results and Discussion ...... 59 Section 3.3.1 Identification of the Sec4 Homolog SrgA in A. fumigatus...... 59 Section 3.3.2 Loss of SrgA Generates Phenotypic Heterogeneity in Colony Morphology ...... 60 Section 3.3.3 Loss of SrgA Impairs Conidiation ...... 62 Section 3.3.4 Loss of SrgA Impairs Hyphal Growth ...... 65 Section 3.3.5 Deletion of srgA Alters Susceptibility to ER Stress ...... 66 Section 3.3.6 Loss of srgA Alters Virulence ...... 68 Section 3.3.7 Reproducibility of Phenotypic Heterogeneity Among ΔsrgA Isolates ...... 69 Section 3.4 – Summary ...... 72 Chapter IV: UPR ...... 74 Section 4.1 – Background ...... 75 Section 4.2 – Materials and Methods ...... 77 Section 4.2.1: Culture Conditions ...... 77 Section 4.2.2: Site-Directed Mutagenesis of the IreA Kinase Domain ...... 78 Section 4.2.3: Analysis of hacA mRNA Splicing by RT-PCR ...... 79 Section 4.2.4: Azocoll Assay ...... 80 Section 4.2.5: G. mellonella Infection Model ...... 80 Section 4.3 – Results and Discussion ...... 81 Section 4.3.1: Generation of a Kinase Domain Mutant Strain ...... 81 Section 4.3.2: The Endoribonuclease Domain of IreA Remains Active, Despite Mutation within the DFG Kinase Motif ...... 83

Section 4.3.3: Mutation within the DFG Kinase Motif Reduces A. fumigatus Radial Growth and Impairs Conidiation at 45°C ...... 84 Section 4.3.4: Increased Collagenase Secretion in the IreAD858A Mutant ...... 85 Section 4.3.5: Mutation with the DFG Motif Does Not Alter A. fumigatus Sensitivity to Acute ER Stress ...... 86 Section 4.3.6: Increased Growth of the IreAD858A Mutant under Metal Ion Starvation Conditions ...... 87 Section 4.3.7: The IreAD858A Mutant Displays Increased Resistance to Voriconazole ...... 89 Section 4.3.8: Mutation within the DFG Motif Does Not Decrease A. fumigatus Virulence in an Insect Model of IA ...... 91 Section 4.4 – Summary ...... 92 Chapter V: Discussion and Future Directions ...... 94 Section 5.1 – Summary ...... 95 ΔSection 5.2 – Maintenance of Secretory Homeostasis is a Pathogenic Determinant of Aspergillus fumigatus ...... 95 Section 5.2.1 The UPR is a Broad-Spectrum Compensatory Response to Homeostasis Perturbations ...... 96 Section 5.2.2 The UPR and its Regulators Have Expanded Functions in A. fumigatus ...... 97 Section 5.2.3 Revised Model for Maintenance of Secretory Homeostasis in A. fumigatus .....98 Section 5.2.4 The UPR is a Dual-Use Virulence Attribute ...... 102 Section 5.2.5 The UPR Could Be a Novel and Potent Antifungal Drug Target ...... 104 Section 5.3 – Future Studies and Directions ...... 108 Section 5.3.1 Understanding the Regulatory and Functional Components of the Fungal UPR ...... 108 Section 5.3.2 Clinical Application ...... 112 Section 5.4 – Conclusions ...... 115 APPENDIX ...... 116 Virulence-Related Genes in A. fumigatus ...... 116 REFERENCES ...... 119

vii

List of Figures and Tables

Figures

Schematic of Aspergillus fumigatus lifecycle and morphology ...... 3

Schematic of damage-response framework ...... 6

Schematic of how the secretory pathway supports filamentous growth ...... 19

Schematic of Secretory Homeostasis Mechanisms ...... 20

Schematic of the Unfolded Protein Response Pathways ...... 23

Schematic of Fungal UPR ...... 26

Schematic of Secretory Homeostasis Maintenance Model ...... 27

Schematic of Dissertation Hypothesis ...... 30

Schematic of Calnexin Cycle (Lectin-Mediated ERQC) ...... 33

Multiple sequence alignment of calnexin orthologs ...... 40

Schematic of deletion of calnexin from A. fumigatus ...... 41

Altered proteolytic secretome due to loss of calnexin ...... 43

Calnexin is required for thermotolerant growth ...... 44

Loss of calnexin does not increase sensitivity to caspofungin ...... 45

Calnexin promotes growth under conditions of acute ER stress ...... 47

Calnexin is required under nutrient starvation conditions ...... 48

Increased growth of the ∆clxA mutant on 0.1% 2DG ...... 49

Calnexin promotes growth in cation-depleted medium ...... 51

Calnexin is dispensable for A. fumigatus virulence ...... 52

Histopathology of infected lung tissue ...... 53

Relationship between A. fumigatus SrgA and Sec4 homologs ...... 60

Deletion of srgA from A. fumigatus ...... 61

Loss of SrgA is associated with diverse colony morphology ...... 62

viii

Loss of SrgA impairs conidiation ...... 63

Localization of GFP-SrgA to the conidiophore ...... 64

Loss of SrgA impairs hyphal growth ...... 65

Sensitivity of ∆srgA to ER stress ...... 67

Sensitivity of ∆srgA to brefeldin A ...... 67

Analysis of ∆srgA virulence in an insect model of A. fumigatus infection ...... 69

Phenotypic heterogeneity is a reproducible phenotype associated with srgA deletion ...... 71

Schematic of Expanded Functions of IreA ...... 76

Sequence comparison of Ire homologs ...... 82

HacA splicing in IreAD858A mutant ...... 84

Temperature sensitive radial growth and conidiation of the IreAD858A mutant ...... 85

Expression of the IreAD858A mutation increases secretion of collagenase ...... 86

Mutation within the IreA kinase domain promotes growth in cation-depleted medium ...... 88

The IreAD858A mutant shows slightly increased resistance to voriconazole ...... 90

Analysis of IreAD858A virulence in an insect model of A. fumigatus infection ...... 92

Up-regulation of the UPR in ERQC and Vesicle Transport Mutants ...... 97

Schematic of Revised Secretory Homeostasis Model ...... 99

Schematic of Disruption of Secretory Homeostasis ...... 101

The UPR is a dual-use virulence attribute of A. fumigatus ...... 103

Tables

PCR primers used in calnexin study ...... 37

PCR primers used in SrgA study ...... 57

PCR primers used in IreA kinase study ...... 80

Chapter I: Introduction

Section 1.1 – Background

In 1939, medical mycologist Arthur Henrici dismissed Aspergillus infections as being “so rare as to be of little practical importance” [2,13]. Since then, advancements in medical techniques have generated an ever-enlarging immunosuppressed patient population at-risk for opportunistic infections such as those caused by Aspergillus [17]. (Refer to Section 1.2.2). Of these infections, invasive aspergillosis is associated with the most significant morbidity and mortality, the latter ranging from 40-90% depending on patient population [17]. This high mortality rate, which is partially due to the difficulties in diagnosis and limitations of current antifungal therapies, has led the Infectious Disease Society of America to identify the major etiologic agent, Aspergillus fumigatus as a high-priority pathogen requiring substantial research to develop effective antifungal drugs [19]. To accomplish this, however, we must first improve our understanding of the biological factors contributing to pathogenesis. It is to this shared goal that the collective efforts of many Aspergillus researchers, including this dissertation, are dedicated.

Section 1.2 –Pathobiology of Aspergillosis

Pathogenicity is defined as the capacity of a microbe to cause damage in a susceptible host [20]. By this definition, there are three factors that must be considered in order to understand the pathobiology of an infectious disease: the microbe, the host, and the potential damage that results from the interaction between the two.

Section 1.2.1 The Microbe Aspergillosis refers to a disease caused by fungi within the genus Aspergillus [17]. The genus was first described by Pier Antonio Micheli in 1729, who named it so because the features of the asexual reproductive structure, the conidiophore, reminded him of an aspergillum, an instrument used to sprinkle holy water [21]. (See Figure 1). Since this discovery,

Aspergillus species have been identified as pathogens of both animals and humans, with the

2 first case of human aspergillosis described by Virchow in 1856 [21], and Aspergillus is now the most common mold associated with invasive disease [22,23]. There are over 200 species within the genus Aspergillus, only a handful of which have been reported to cause disease in humans.

Of these potentially pathogenic species, the most frequently isolated are A. fumigatus, A. flavus,

A. niger, and A. terreus; of these four, A. fumigatus infections are associated with the highest morbidity and mortality [2].

Figure 1. Schematic of Aspergillus fumigatus lifecycle and morphology

The asexual reproductive lifecycle of Aspergillus fumigatus begins with the asexual spore, or conidium. Conidia remain metabolically inactive until environmental conditions are conducive for fungal growth. Sensing a favorable environment, the conidia begin to swell. After an initial period of isotropic growth, an axis of polarity is established and leads to the elaboration of a germ tube. Sustained polarized growth produces a filament known as a hypha, which compartmentalizes into a connected series of cells through the formation of pore-containing septa. A. fumigatus hyphae grow radially from the initial germination point, undergoing dichotomous branching. This results in a complex network of hyphae known as a mycelium. Specific environmental conditions promote the formation of the asexual reproductive structures within the mycelium. During this process, the surface hyphae provide the foundation for aerial hyphae which first terminate in an immature, swollen vesicle. From this vesicle, a single row of phialides is directly born. These rapidly dividing cells produce a column of daughter cells approximately 2-3 µm in diameter, which radiate from the conidial head. Perturbation of the conidial head stimulates the release of these conidia into the surrounding environment, thus completing the asexual reproductive cycle.

Aspergillus fumigatus:

The species A. fumigatus was first described in 1863 by Johann Baptist Georg Wolfgan

Fresenius [24]. It is included within the Aspergillus subgenus Fumigati section Fumigati [25,26].

As with all Aspergillus species, A. fumigatus is a hyalohyphomycete, or a mold that produces nonpigmented, regulatory septate hyphae [22]. It is a ubiquitous filamentous fungus, found throughout the world in its natural ecological niche of decaying vegetation, although composting piles of organic material are its most concentrated source [27]. Within this environment, A. fumigatus plays an important role in carbon and nitrogen recycling [28,29]; its saprophytic lifestyle facilitates the breakdown of a diverse array of complex polymeric substrates found within decaying organic debris. Unlike many other organisms, A. fumigatus is able to survive and flourish within this environment, which requires not only nutritional versatility but also the ability to adapt to harsh conditions (discussed in greater detail in Section 1.3.2).

Like many other Aspergillus species, A. fumigatus can propagate through sexual or asexual reproductive cycles, both of which are thought to occur within its natural ecological niche [30]. The teleomorphs, or sexual stages of Aspergillus species, are assigned to the

Neosartorya genus [31], although the dual naming system for anamorphos and teleomorphs of the same taxon has recently been called into question [32,33]. During this stage of the lifecycle, sexual spores called ascospores are packaged within an enclosed sac called an ascus, thus grouping Aspergillus species within the phylum Ascomycota [34]. The teleomorph of A. fumigatus, Neosartorya fumigata, was only recently described [35] and has been found to have a fastidious sexual cycle that requires unusually precise environmental parameters [30]. In contrast, the asexual reproductive cycle of A. fumigatus is relatively simple to induce and produces abundant conidia (Figure 1). Each conidiophore of A. fumigatus produces approximately 50,000 conidia, which are readily aerosolized into the surrounding environment, leading to average environmental counts ranging from 10-100 conidia per meter cubed (or

4 billions in more concentrated environments such as composting facilities) [2]. Consequently, exposure to A. fumigatus conidia is unavoidable and it is estimated that several hundreds of conidia are inhaled per person per day [17,36,37].

Section 1.2.2 The Host and the Damage While all humans are exposed to Aspergillus conidia, relatively few develop disease, highlighting the importance of host susceptibility for the pathogenesis of this microbe. As with many opportunistic pathogens, susceptibility is largely dictated by the immune status of the host

[17]. In the case of aspergillosis, this immune status also dictates the type of damage that results from the host-pathogen interaction. Therefore, it is near impossible to discuss the characteristics of host susceptibility without also describing the potential damage that can occur.

Normal Clearance Mechanisms:

Immunocompetent hosts are well-prepared to defend against the vast majority of airborne fungi, either via physical barrier protection or cell-mediated clearance. Conidia of many

Aspergillus species, which are often larger than A. fumigatus conidia, get trapped in the upper sinus and respiratory cavities and can be readily cleared by a functional mucociliary tract [38].

Because of their small size, inhaled A. fumigatus conidia are able to escape this initial barrier and can reach the distal airways of the lung [38]. In an individual with an intact immune system, however, these conidia are readily cleared before they are able to establish infection. Traditional clearance models assign pulmonary alveolar macrophages with the primary role of ingesting and inhibiting germination of conidia, while polymorphonuclear leukocytes (PMNs) defend against the hyphal growth of any germlings that were not cleared initially [2,39]. Despite this classical definition of roles, however, it is also thought that neutrophils can facilitate clearance by inhibiting germination of conidia [40,41]. While the innate immune system has been most well-studied in regards to Aspergillus clearance, studies have also shown a role for adaptive immune mechanisms for protection against infection [42-46]. Combined, the immune system works to maintain a balance of tolerance and clearance of the fungus to which it is constantly

5 exposed; disruption of this balance can result in significant morbidity and mortality. Therefore, hosts that are susceptible to damage associated with Aspergillus pathogenesis are those whose immune systems are functioning abnormally [17].

Disease Spectrum:

In a susceptible host, Aspergillus infections can result in a wide spectrum of disease that has been described using a damage-response framework in which the damage can be either host- or microbe-mediated [47]. Within this spectrum, there are three major categories of damage, including allergic, noninvasive, and invasive disease. (See Figure 2, adapted from

[47]).

Figure 2. Schematic of damage-response framework The type and level of damage caused by an infection with Aspergillus species varies based on immune status of the host. If the host immune response is hyperactive against fungal antigens, the resulting host-mediated damage is high and is characterized as an allergic disease. In a host where pre-disposing conditions promote fungal growth, but the immune response is neither too weak nor too strong, there is relatively minimal damage caused by this noninvasive infection. In contrast, if the host immune response is too weak for optimal fungal clearance, invasive fungal growth can cause substantial microbe- mediated damage to the host.

Allergic Disease: When the host immune response is hypersensitive to Aspergillus antigens, fungal tolerance is not maintained and can result in a hyperinflammatory response to fungal elements passing through the respiratory tract. This results in immune-mediated diseases including atopic sensitization with development of mold-induced asthma, hypersensitivity pneumonitis, and allergic bronchopulmonary aspergillosis (ABPA) [48]. ABPA is almost exclusively found in patients with asthma or cystic fibrosis (CF), which share a characteristic of

6 impaired mucociliary clearance [48]. Failure of initial clearance mechanisms allows germination and production of fungal antigens to which the host immune system responds. This response is antibody mediated and damage to the host is due to unresolved inflammation [49]. Treatment of

ABPA can be complicated due to characteristics of the underlying condition of asthma or CF

[48,50]. The use of oral glucocorticoids to modulate the immune response and the use of antifungal drugs to reduce antigenic burden, however, can significantly improve patient outcomes associated with ABPA [48].

Non-Invasive Disease: When the response of the immune system to fungi is neither hyperinflammatory nor completely inadequate, non-invasive colonization called an aspergilloma can occur. Aspergillomas are colonies of Aspergillus growing in a pre-existing cavity of the lung, which can be created by a variety of pulmonary disorders including cancer, tuberculosis, and sarcoidosis [49]. Cases of aspergillomas are usually asymptomatic. Over time the cavity can expand, however, and lead to the erosion of blood vessels, resulting in hemoptysis [50].

Treatment of aspergillomas often requires surgery, as drug penetration into the cavity is often insufficient [51].

Invasive Disease: At the opposite end of the damage-response continuum from immune- mediated disease is microbe-mediated disease, of which invasive aspergillosis (IA) is associated with the most significant morbidity and mortality. Patients at highest risk for IA include those who are immunocompromised, in particular those suffering from hematologic malignancies, recipients of hematopoietic stem cell transplants (HSCT) and recipients of solid organ transplants (SOT) [22,52-56]. Also at risk for IA are those being treated with chronic corticosteroid therapy or broad-spectrum antibiotic therapy, and those with prolonged intensive care unit stays, primary immune deficiencies such as chronic granulomatous disease (CGD), or poorly controlled diabetes [22,57-63].

What many of these at-risk patient populations have in common is a deficiency in innate immune clearance mechanisms, which allows for conidial germination and hyphal growth.

Uninhibited hyphae grow without respect for anatomical barriers, leading to extensive tissue damage and angioinvasion. Hyphal fragments can then break off, allowing the fungus to disseminate through the vasculature to distant organ sites [63]. This wide-spread fungal burden is the major cause of disease-associated damage to the host, which can be exacerbated by the host immune response in cases of immune reconstitution [64]. Invasive aspergillosis is associated with the highest morbidity and mortality compared to allergic or non-invasive disease and is therefore the focus of much of the aspergillosis-related research, including the work presented in this thesis.

Section 1.2.3 Clinical Significance of Invasive Aspergillosis In the past few decades, there has been a substantial rise in cases of IA [22,52,55,65-

68] primarily due to an ever-enlarging at-risk patient population [69]. Within patient populations with the highest risk for IA, prevalence can range from 10-15%, making Aspergillus the most common mold associated with invasive disease [22,23,70]. Aspergillus fumigatus is the most common etiologic agent of IA, responsible for approximately 90% of cases [71].

Unfortunately, there are multiple clinical challenges associated with IA. Not only is there an increasing at-risk patient population and unavoidable exposure to A. fumigatus, but diagnosis and therapeutic interventions for IA are limited. Diagnosis can be difficult because clinical signs and symptoms are often not specific for IA [2]. Therefore, definitive diagnosis requires a combination of both clinical and laboratory findings which must interpreted with a high-index of suspicion based on the patient’s medical history. (Refer to Insert on page 9). Once a diagnosis is made, there are very few antifungal options for the treatment of IA and those that are available are associated with low efficacy, host toxicity, and emerging antifungal resistance [72].

As a result of these combined challenges, the morbidity, mortality, and pharmacoeconomic burden associated with IA remains substantial [66,68,73], highlighting the need for improved diagnostic and therapeutic interventions. To this end, researchers are dedicating their efforts to improve our understanding of the pathogenesis of A. fumigatus.

Insert: Diagnosis and Therapy of IA

Diagnosis Diagnosis of invasive fungal infections (IFI) can be classified as proven, probable, or possible based on a combination of both clinical and laboratory findings [1]. The clinical presentation for IA is often non-distinct, including symptoms such as fever, a cough which may be dry or productive, and dyspnea; pleuritic chest pain, hemoptysis, altered mental status, and respiratory failure may also be present [2]. The presence of key radiological features, including a halo sign (consisting of a macronodule and a perimeter of ground-glass opacity) [3] or an air crescent sign (in which a semilunar pocket of gas surmounts a macronodule) [3], using computed tomography (CT) can support a diagnosis of IA [1]. However, as with the patient signs and symptoms, these findings are not unique to IA and must be interpreted with a high index of suspicion for IA due to the patient’s history [3]. Therefore, classification of an IA diagnosis as proven requires laboratory testing, which can include histology of and culture from infected tissue [1]. Within tissue, A. fumigatus grows in a characteristically radial fashion, in which hyphae of approximately 3-5 µm in diameter can be observed with acute, dichotomous branching. Aspergillus fumigatus is not restricted by anatomical barriers and is often seen invading blood vessels, leading to its common designation as a vascular-tropic fungus [4,5]. Conidiophores are rarely seen in tissue during invasive disease, although they have been observed in non-invasive specimens, such as an aspergilloma. In addition to direct observation in tissue, isolation of Aspergillus from patient specimens from normally sterile sites can be used as a definitive diagnostic means for IA [1]. Fungi can be cultured from patient specimens on multiple types of media at temperatures of ≤ 30°C [6]. Under these conditions, Aspergillus fumigatus can be recognized by its blue-green colony front (due to the production of conidia), which becomes more slate gray in color as the colony ages [6]. A. fumigatus forms hyaline hyphae, giving the colony back a white to tan appearance. Microscopic analysis of conidiophores allows more definitive speciation of a growing colony; the conidiophores of A. fumigatus are approximately 300 µm long and 5-8 µm wide with a dome-shaped vesicle approximately 20-30 µm in diameter. The conidial heads are strongly columnar, with a single row of phialides on the upper half of the vesicle producing subglobose to globose conidia that are 2-3.5 µm in diameter. An additional unique characteristic of A. fumigatus, which allows it to be distinguished from other species of Aspergillus, is its ability to grow at 45°C [6]. These conventional diagnostic methods generally lack sensitivity and are typically positive when infection is advanced and fungal burden is high [7]. Therefore, efforts are being made to develop diagnostic techniques that provide earlier identification of infection. The use of antigen detection, specifically a carbohydrate component of the fungal cell wall called galactomannan, has proven to be an effective method for monitoring patients at-risk for IA [6]. Additionally, the use of polymerase chain reaction (PCR) for the detection of fungal DNA has been successful. However, lack of standardization currently limits the use of this diagnostic technique [8]. Antifungal Therapy: There are three major classes of antifungal compounds that are used for therapy of aspergillosis: the polyenes, the azoles, and the echinocandins [9]. Polyenes: The polyenes, of which amphotericin B is the most commonly used compound, target the major sterol component of fungal plasma membranes, ergosterol. Binding of polyenes to ergosterol results in the formation of a transmembrane channel that allows increased membrane permeability, disruption of intracellular homeostasis, and ultimately cell death [10,11]. Historically, the use of amphotericin B has been associated with adverse side effects, including infusion-related reactions and nephrotoxicity. However, modifications to drug delivery, including lipid-based formulations of amphotericin B, have helped reduce this toxicity [10]. Azoles: The azoles, which are the most widely used antifungal agents [12], also target ergosterol, but their mechanism of action is through disruption of ergosterol biosynthesis rather than direct binding. This class of drugs inhibits the fungal CYP450-dependent enzyme lanosterol 14α-demethylase which results in a toxic accumulation of 14-methylsterol intermediates and a destabilization of the fungal plasma membrane [12]. There are also CYP450-dependent isoenzymes in mammals and, therefore, the use of azole antifungals can result in toxic side effects due to non-specific interactions. Additionally, use of azoles are limited due to their potential for adverse reactions with other drugs, many of which are commonly used to treat at-risk patient populations [12]. Despite these limitations, the azole voriconazole is currently the recommended primary therapy option for IA [14]. Echinocandins: The echinocandins are the most recently developed class of drugs, gaining FDA approval thirty years ago [15,16]. Echinocandins, such as caspofungin or micafungin, target the cell wall through the inhibition of beta-1,3,-D-glucan synthase. This inhibition results in osmotic shock and ultimate lysis of the cell [18]. While this mechanism of action only results in a fungistatic, rather than a fungicidal, effect on A. fumigatus, the echinocandins are generally well-tolerated and clinical data support their use in salvage treatment of invasive aspergillosis [18].

Section 1.3 – What Makes A. fumigatus Such a Dangerous Pathogen?

Although the damage caused by a pathogen is dependent upon both microbial and host factors, the major focus of our laboratory’s research is identifying pathogenic determinants that are specific to the microbe. Defining these characteristics could lead to the identification of points of vulnerability that could be targeted as a means of reducing the pathogenesis associated with A. fumigatus infections.

Section 1.3.1 Virulence and Virulence Factors While often used interchangeably with pathogenicity, virulence is defined as the relative capacity of a microbe to cause damage to a host. As such, pathogens can be characterized within ranges of virulence, and efforts to understand microbial pathogenesis focus on defining the mechanistic factors that make a microbe more or less virulent. Traditionally, these “virulence factors” are defined as pathogen components that, when deleted, abrogate virulence, but not viability, of the microbe [74]. For example, the bacterial pathogen Vibrio cholerae produces enterotoxins that contribute to the severe damage caused within the human intestine during infection. Nonenterotoxigenic V. cholerae cells lacking the genes encoding these toxins are reduced in virulence and unable to cause this damage, despite their ability to grow under in vitro conditions [75]. Similarly, the intracellular bacterial pathogen Listeria monocytogenes utilizes a variety of virulence factors, including a fibronectin-binding protein (FbpA) that is required for full virulence in a murine infection model but not for growth in vitro [76]. In contrast, for pathogenesis of A. fumigatus, there has yet to be identified any true “virulence factors” that meet the parameters of this classical definition [77-79].

Environmental abundance alone cannot account for the increased prevalence of A. fumigatus infections compared to other Aspergillus species [2]; A. fumigatus makes up less than half of airborne Aspergillus isolates, but is the predominant clinical isolate [36]. Furthermore, conidial size is also not the only trait contributing to virulence. A recent study examined the correlation between conidial size and posttransplant Aspergillus colonization of adult lung

10 transplant recipients by dividing species into either a small conidia group (average conidia diameter ≤ 3.5 µm) and a large conidia group (average conidia diameter > 3.5 µm). Colonization by the small conidia Aspergillus group was dominated by a single species, A. fumigatus (83% of colonization), despite the inclusion of at least three other small conidia species in the group (A. nidulans, A. terreus, and A. flavipes) [80]. Therefore, despite its apparent lack of true virulence factors, it is likely that A. fumigatus possesses a unique set of fitness-related attributes that, combined, set it apart from less pathogenic environmental molds [36,50,80,81]. Consistent with this hypothesis, among the genetic mutant A. fumigatus strains studied so far, 60% of mutants had altered virulence [50]. Very few of these gene deletions or disruptions, however, have resulted in complete loss of virulence. Instead, loss of individual gene products often results in slight to moderate reductions in virulence compared to wild-type [81]. Combined, this suggests that the pathogenesis of A. fumigatus is complex and multifactorial, relying on the coordinated activity of multiple gene products to support fitness and virulence [50,81].

Section 1.3.2 Coincidental Selection of Virulence Attributes The lack of true virulence factors and complexity of A. fumigatus pathogenesis is likely due to the evolutionary selection pressures, or lack thereof, imposed upon this microbe. Unlike an obligate parasite, environmental opportunists like A. fumigatus do not rely on a host to complete their biological cycle [2] and, therefore, do not evolve through a dynamic relationship with humans. Instead, they are exposed to the selection pressures within their natural ecological niche. These pressures include, but are not limited to, high temperatures [82,83], oxidative stress [84,85], and hypoxia [86,87]. Importantly, many of these ecological stresses are also present within the human host (discussed below). Therefore, while improving fitness for growth under stress conditions in the environment is the factor driving adaptation of the species [88], overlap between pressures found within both the natural ecological niche and the human host can result in pre-adaptation of the species and the coincidental selection of virulence attributes.

The metabolic and physiologic properties acquired for survival within the ecological niche could

11 then serve a dual-use by assisting with adaptation to growth within the mammalian host

[17,50,81,88,89]. Consistent with this model of dual-use virulence attributes, the genes that have been identified to date as playing a role in A. fumigatus pathogenesis can be broadly categorized into key physiological pathways that also improve fitness of the organism within its natural ecological niche of decaying vegetation. Representative genes from some of these categories will be briefly discussed here, but a more complete list of genes can be found in the

Appendix.

Thermotolerance: Intense microbial activity within decaying vegetation produces heat as a byproduct, resulting in extreme temperatures during the composting cycle [29]. Therefore, organisms living within this environment must be able to adapt to high temperatures in order to survive. As a thermotolerant organism, A. fumigatus grows most rapidly at 37° to 42°C but can survive temperatures up to 70°C [82,83]. This thermotolerance contributes to the pathogenesis of A. fumigatus, as the core body temperature of humans of 37°C is often a limiting factor for the virulence of microbes that are not equipped to survive this thermal stress. Not surprisingly, therefore, studies have shown that some of the genes that facilitate the growth of A. fumigatus under these thermal stress conditions also contribute to virulence. For example, deletion of the gene encoding the α-1,2-mannosyltransferase, kre2 afmnt1, which is required for growth and cell wall integrity at 48°C, reduces the virulence of A. fumigatus [90]. Similarly, an A. fumigatus strain lacking the gene encoding the nucleolar protein CgrA, which is responsible for ribosome biogenesis, is not only unable to grow in vitro at 37°C but is also hypovirulent in a murine model of invasive aspergillosis [91,92].

Response to Oxidative Stress: In the ecological niche of decaying vegetation, the byproducts of photolysis of humic substances and photosensitizing toxins secreted by other microbes within the environment create oxidative stress conditions to which A. fumigatus must respond [84,85]. To counteract this stress, the fungus is equipped with catalases and other enzymes that help protect the cell in the environment [93,94]. Some of these genes, such as

12 those encoding mycelial catalases, cat1 and cat2, also contribute to pathogenesis of A. fumigatus, as the release of reactive oxygen species (ROS) by phagocytes is an important immune mechanism for fungal killing [93,95]. Furthermore, genetic defects in this process due to mutations within the NADPH oxidase complex, as can be found in patients with chronic granulomatous disease (CGD), is a major predisposing factor for Aspergillus infections [96], demonstrating the importance of this stress response to fungal pathogenesis.

Response to Hypoxia: Not only does the composting process generate oxidative stress conditions, but hypoxic conditions as well. Depending on microbial activity, oxygen concentrations in compost piles can range from atmospheric (21%) to hypoxic (1.5% and lower)

[87,97]. In the mammalian host, it is thought that the damage caused by infection-related inflammation and necrosis reduces tissue perfusion and limits oxygen supply to the site of infection, resulting in a similarly hypoxic environment [97]. In response to this type of stress, A. fumigatus relies upon a transcriptional response pathway in which activation of a sterol- regulatory element binding protein homolog, SrbA, up-regulates the expression of downstream effectors proteins that are involved in ergosterol biosynthesis, maintenance of cell polarity, and general hypoxia adaptation [97]. Recently, Willger et al. demonstrated that not only is the fungus exposed to a hypoxic environment within host tissue, but also that A. fumigatus requires this response pathway for virulence [98].

Nutrient Sensing and Acquisition: Finally, A. fumigatus can be found growing on a variety of complex, polymeric substrates, from which it must be able to acquire nutrients in order to survive. This nutrient acquisition requires exquisite sensing mechanisms in order to dictate the specific array of degradative enzymes that are released into the environment. Furthermore,

A. fumigatus relies on a plethora of up-take and sequestration methods in order to compete for nutrients within the environment. These same types of nutrient acquisition tools contribute to growth in the mammalian host. Sequestration of nutrients such as zinc and iron is a known host defense mechanism against microbial growth [99-101]. Transcriptional analysis of A. fumigatus

13 from mammalian tissue has indicated that the fungus is sensing a nutrient deplete environment, including not only metal ion limitation but also carbon and nitrogen starvation as well [102].

Deletion of key genes involved in a variety these nutrient acquisition processes, such as alp/asp f 13 (encoding an alkaline serine protease involved in protein degradation) [103-105], rhbA

(encoding a Ras-related GTPase involved in nitrogen sensing and acquisition) [106], cpcA

(encoding a transcriptional activator involved in amino acid biosynthesis) [107], sidA (encoding an L-ornithine hydroxylase that is the first common step of siderophore synthesis) [108,109] and other siderophore-related genes [110], and zafA (encoding a zinc-responsive transcriptional activator) [111] limits the fungus’ ability to grow under nutrient stress conditions, and also attenuates the virulence of A. fumigatus.

Section 1.4 – Is Maintenance of Secretory Homeostasis a Dual-Use

Virulence Attribute of Aspergillus fumigatus?

The link between dual-use virulence attributes and environmental fitness highlights the potential to gain insight into A. fumigatus pathogenesis by improving our understanding of its normal saprophytic lifestyle and the pathways that contribute to the stress response of this fungus. To this end, our laboratory is dedicated to investigating one of the staple physiological pathways of saprophytic filamentous fungi, the secretory pathway, and the homeostatic mechanisms that support its function under stress conditions.

Section 1.4.1 Introduction to the Secretory Pathway Secretion is the process through which biomolecules are released into the extracellular environment. The process is carried out by the secretory pathway, which refers to the endomembrane system through which these biomolecules pass as they are shuttled to their target destination [112]. This pathway has been extensively studied in the model fungus,

Saccharomyces cerevisiae, which provides the foundation for much of our understanding of basic eukaryotic biology [113]. Using this data as a foundation, studies in filamentous fungi such

14 as Trichoderma reesei, Aspergillus nidulans, and Aspergillus oryzae have begun to construct a model for how the secretory pathway has been conserved or diverged in these fungi that are morphologically distinct from the single-celled yeast S. cerevisiae [114-117]. Unfortunately, however, the limited analysis in A. fumigatus prevents a detailed description of this pathway from the perspective of this pathogen. Therefore, for the purpose of this introduction, an overview of the fungal secretory pathway and homeostasis mechanisms has been provided using the available mycology literature.

Endoplasmic Reticulum: Secretion begins with the endoplasmic reticulum (ER), which is a membrane-bound organelle associated with the nucleus. It is within this organelle that synthesis and first stages of processing of secretory proteins occurs. In filamentous fungi, ER material can be found throughout both apical and subapical cells, but appear to have gradient distribution with increasing content towards the hyphal tip of apical compartments and a highly differentiated and dynamic distribution in subapical compartments [117]. This suggests that compartmental regulation in filamentous fungi may play a role in the maintenance of ER homeostasis in eukaryotic multicellular microorganisms [117].

Proteins destined for secretion are co- or post-translationally translocated into the ER through the SEC61 translocation complex. They are then immediately bound by ER chaperones, which include members of the heat shock protein 70 (HSP70) family, the most important of which is Bip (binding protein) [116]. These chaperones stabilize the polypeptide as it is modified and folded in the ER through specific quality control processes (discussed in greater detail in Section 1.4.3). The folding process itself is facilitated by protein folding catalysts in the peptidyl-prolyl cis/trans isomerase (PPI), ERV1, and protein disulfide isomerase families

(PDI) [116].

Golgi Equivalents: After folding and the initial stages of modifications are completed in the ER, proteins destined for secretion are packaged into vesicles and transported through the distal secretory network. This vesicle trafficking is a cytoskeleton-assisted process and can be

15 divided into two stages; first, transport from the ER to the Golgi, then from the Golgi to the plasma membrane [116]. In contrast to mammalian cells, the Golgi of most ascomycetes, including both S. cerevisiae and Aspergillus species, is not made up of stacked cisternae, but is instead made up of discrete, ring-shaped cytoplasmic bodies with tubular connections and is thus referred to as Golgi equivalents (GE). These GE can be divided into early and late GE based on specific markers; in filamentous fungi, early GE appear evenly dispersed throughout the hyphal compartments whereas late GE are strongly polarized toward the hyphal tip [114].

Tip Growth Apparatus: From the GE, secretory proteins are then targeted to their final destination via secretory vesicle trafficking. At this stage, filamentous fungi differ significantly from yeast. Current evidence suggests that in filamentous fungi, cell growth largely occurs at the hyphal apex [118] and requires both exocytosis and endocytosis, which are spatially coupled at the tip [119]. To accomplish this, the fungus relies on a highly structured, yet dynamic, tip growth apparatus, which is made up of a Spitzenkörper, a ring of actin/actin-binding protein A

(ABPA) patches, a region of SYNA (a synaptobrevin homolog) at the plasma membrane, SECC

(an exocyst component), and an actin spot at the apex [119]. The Spitzenkörper is an apical cluster of vesicles and cytoskeletal components that serves as a vesicle supply center for rapid delivery of enzymes into and across the apical cell membrane via exocytosis [120]. Polarized trafficking delivers these vesicles to the Spitzenkörper [121], which contrasts secretion in the budding yeast S. cerevisiae, where the continual delivery of vesicles across the entire cell surface promotes spherical rather than polarized growth [122]. The vesicle formation, transport, and fusion process is controlled by a high number of proteins and protein complexes [116], which will be discussed in greater detail in Section 1.4.3. Following exocytosis, the actin/ABPA patches at the tip facilitate the recycling of plasma membrane and other vesicle components, as well as nutrient, through the process of endocytosis [119].

Section 1.4.2 Importance of Secretion to A. fumigatus Filamentous fungi are adapted for high-capacity secretion, or the ability to secrete large quantities of proteins. This adaptation has been exploited by humans through the industrial use of filamentous fungi as “secretory factories” for the production of heterologous proteins [123].

For example, Trichoderma reesei protein expression systems have been developed for production of cellulolytic and hemicellulolytic enzymes that are used in textiles, food, feed, pulp, and paper and detergent industries [116]. These systems are very efficient, with some molds producing up to 20 grams of an individual protein per liter of culture [124,125]. Of course, this high-capacity secretion has not evolved for the industrial gain of humans, but rather to support the filamentous fungal lifestyle in the ecologically diverse niche of decaying organic material.

Nutrient Acquisition: As saprobes, fungi must be able to breakdown and absorb nutrients from the surrounding environment. Within decaying organic matter, the ecological niche of A. fumigatus, the potential nutrient sources are complex polymeric substrates [126,127]. Therefore, to be competitive, the fungus must synthesize and use a vast armamentarium of degradative enzymes. To this end, A. fumigatus secretes an extensive array of secreted hydrolases [127], with more than one percent of its genome dedicated to secreted proteases alone [128,129]. The secretory pathway facilitates this entire process by transporting these hydrolytic enzymes to the hyphal apex, where they are exocytosed into the surrounding environment [130,131].

Cell Structure and Polarized Growth: Not only does the secretory pathway support nutrient acquisition, but also the synthesis and maintenance of both the plasma membrane and cell wall of fungi. Filamentous fungi elongate and branch by apical extension, a mode of growth that involves the establishment of a stable axis of polarity, followed by the maintenance of growth in the same direction [132]. The ability to sustain polarized growth requires a constant stream of new cell wall and plasma membrane material to the hyphal apex [133]. This is accomplished by packaging components required for membrane and cell wall biogenesis into

17 membrane-enclosed vesicles of the secretory system and delivering them to the Spitzenkörper at the growing tip cell [121].

Figure 3. Schematic of how the secretory pathway supports filamentous growth

The secretory pathway consists of an endomembrane system through which biomolecules are synthesized, processed, and transported. In filamentous fungi, this network is largely polarized with secretion moving from the basal to apical compartments of the hypha. In contrast to yeast, both the exocytic and endocytic processes of filamentous fungi are thought to be localized to the growing hyphal tip. Within the apical compartment, vesicles transport biomolecules to the intracellular structure known as the Spitzenkörper, which is an apical accumulation of vesicles. Here, the secretory biomolecules are released to their target destination.

Spitzenkörper

In its ecological niche of decaying vegetation, A. fumigatus must be able to acquire nutrients from a diverse array of complex, polymeric substrates (represented by the various shades of green/brown in the figure below). The secretion of a multitude of hydrolytic enzymes into the surrounding environment (bottom left) facilitates nutrient acquisition by breaking down these substrates into absorbable and usable simple molecules (bottom right). Additionally, the delivery of plasma membrane and cell wall components to the growing hyphal tip through the secretory pathway facilitates elongation of the hypha and drives the formation of foraging hyphae into nutrient replete substrates.

Section 1.4.3 Maintenance of Homeostasis within the Secretory Pathway Because of its central role in supporting nutrient acquisition and polarized hyphal growth of the fungus, it is important for the secretory pathway to be functioning efficiently. To do so, secretory homeostasis must be maintained. Maintenance of this homeostasis requires a fine- tuned balance of secretory capacity, or the ability of the secretory machinery to make, process and transport biomolecules, with secretory demand, or the secretory requirements placed on the cell by its own metabolism and surrounding environment. As the organelle responsible for the initial stages of protein secretion, the secretory capacity of the ER largely dictates the homeostasis status of the entire network. Very generally, there are four broad mechanisms that support the secretory capacity of the ER: 1) protein folding and processing, also known as ER quality control (ERQC); 2) vesicle transport; 3) ER-associated degradation (ERAD); and 4) the unfolded protein response (UPR) [134] (See Figure 4).

Figure 4. Schematic of Secretory Homeostasis Mechanisms

(1) The ER quality control (ERQC) pathway stabilizes and prevents the premature degradation or escape of folding glycoproteins from the ER. (2) Properly folded proteins are transported in vesicles from the ER through the distal secretory network to the apical tip. (3) Terminally misfolded proteins are retro-translocated from the ER into the cytosol to be degraded by the proteasome through the ER-associated degradation (ERAD) pathway. (4) The accumulation of misfolded proteins in the ER triggers the Unfolded Protein Response (UPR), which up-regulates the transcription of secretory components to restore homeostasis.

ER Quality Control: The first three processes, ERCQ, vesicle transport, and ERAD, are basal functions of the ER, meaning that they play an important role supporting secretion under normal conditions. As polypeptides are translocated into the ER, destined for secretion, they immediately undergo post-translational modifications [135,136]. One of the most common post- translational modifications is N-linked glycosylation, or the addition of a core glycan to an asparagine within the polypeptide chain [136]. This glycosylation not only contributes to the function of the protein, but also facilitates its recognition by lectins, or sugar-binding moieties, during processing of the polypeptide. During this modification step, the core glycan is added to the growing polypeptide chain by an oligosaccharyltransferase (OST) [137]. The glycan is then immediately modified by the removal of two of the three terminal glucose residues by glucosidase I and II [137,138], generating a monoglucosylated glycan. This structure is recognized by the ER transmembrane lectin chaperone calnexin [139]. Association with calnexin stabilizes the unfolded polypeptide, preventing premature degradation. Additionally, calnexin serves as a scaffold for foldases from the PDI family to interact with the polypeptide as well, thus promoting proper folding conditions [137,140]. A final round of de-glucosylation catalyzed by glucosidase II removes the remaining glucose from the core glycan, thus preventing further association of the glycosylated polypeptide with calnexin. If the polypeptide remains mis- or unfolded, it is re-glucosylated by the folding status sensor UDP- glucose:glycoprotein glucosyltransferase (UGGT) and can associate with calnexin for another folding attempt [141]. This cycle of de- and re-glucosylation continues until the protein is either folded correctly or labeled as terminally misfolded [137]. Because the majority of proteins secreted by fungi are thought to be glycosylated [142-144], this lectin-mediated ERQC is an important first step of the secretory process [145].

Vesicle Transport: If the protein achieves its proper conformation through the ERQC process, it is next packaged into vesicles to be transported through the distal secretory network.

A multitude of regulatory and effector proteins facilitate this process, coordinating both the

21 packaging and directed vesicle trafficking of specific secretory proteins to precise target sites

[112,119,135,146,147]. Some of these regulators are general for all vesicle transport steps, while others are specific for one individual step. For example, Sec17 and Sec18/NSF proteins are involved in all stages of vesicle trafficking, while SAR1/ARF1 type small GTPases are involved in vesicle budding, the v-SNARE and t-SNARE type proteins are specific to vesicle and target membranes [116], and Rab GTPases are major determinants of membrane identify [114] and play an important role in vesicle fusion [116]. A. nidulans has ten characterized Rab

GTPases [114]: two that are involved in early endosome formation, one late endosome/vacuole

Rab GTPase, three Golgi Rabs, two with an uncertain role but belonging to the

Rab2/Rab4/Rab14 subgroup, one completely unrelated to most other Rab GTPases, and one

Sec4p homolog which would thus be predicted to play a role in trans-Golgi to plasma membrane transport based on Sec4 studies in yeast [148].

ER Associated Degradation: If polypeptides do not achieve the correct conformation within the ER through ERQC processing, they are not included in this transport process.

Instead, terminally misfolded proteins are retro-translocated from the ER into the cytosol and are targeted for degradation by the proteasome through the third process of ER homeostasis,

ER-associated degradation (ERAD) [112,119,135,147,149]. In this process, a set of mannosidase or mannosidase-like proteins regulate the selection of misfolded glycoproteins for degradation by trimming mannose residues from the core N-glycan [150,151]. This allows recognition of the polypeptide by lectins, which escort the terminally misfolded polypeptide to a channel for dislocation. As polypeptides are moved through the export channel into the cytosol, they are polyubiquitinated, which targets them for degradation by the proteasome [151].

Secretory Stress: Despite the relative effectiveness of these basal processes, the homeostasis balance within the ER can be disturbed by a variety of conditions ranging from increased flux of proteins through the secretory system to external stressors that induce protein unfolding within the network, such as high temperatures, oxidative stress, hypoxia, and nutrient

22 limitation [152-157]. Such disruptions can result in an accumulation of misfolded proteins within the ER, which is referred to as secretory or ER stress. This accumulation can be toxic to the cell and the organism, resulting in protein aggregations and disruption of normal cellular functions, ultimately leading to cell death [158]. Therefore, eukaryotic cells utilize an adaptive ER stress response pathway, the UPR, to counteract this stress and restore secretory homeostasis [159].

Figure 5. Schematic of the Unfolded Protein Response Pathways

The UPR in vertebrates is a dynamic regulatory network controlled by three independent stress sensors, Ire1α, PERK, and ATF6. Upon activation, these sensors transduce a signal that results in differential translational or transcriptional regulation to restore secretory homeostasis. In contrast, only a single, linear pathway, regulated by a sole sensor, Ire1, has been identified for the UPR in the yeast S. cerevisiae.

Unfolded Protein Response: The UPR is a conserved stress response in eukaryotes. In higher eukaryotes, such as mammals, the UPR is made up of three branches, each regulated by one of three separate stress sensors: inositol-requiring protein 1α (Ire1α), protein kinase

RNA-like ER kinase (PERK), or activating transcription factor 6 (ATF6) [160]. All three sensors are transmembrane proteins located in the ER. Ire1α is a bifunctional enzyme with both kinase and endoribonuclease (RNase) domains in its cytosolic region [161]. Under ER stress conditions, Ire1α dimerizes, which allows for autotransphosphorylation [162,163]. This phosphorylation likely causes conformational shifts and activates the RNase domain, which then processes mRNA encoding the X box-binding protein 1 (XBP1u) [164,165]. In this processing,

23 an unconventional intron is removed from the mRNA, allowing for translation of the active transcription factor, spliced XBP1 (XBP1s). XBP1s translocates into the nucleus and regulates the transcription of UPR-target genes involved in ERQC, ERAD, and phospholipid biosynthesis to help restore the protein homeostasis in the ER [159,160]. Ire1α also contributes to this restoration of homeostasis with XBP1-independent mechanisms (Ire1α*), either through regulated Ire1-dependent decay (RIDD) of certain mRNAs or through induction of “alarm stress pathways” via binding to a variety of regulator and adaptor proteins that assemble to activate and modulate downstream responses [160].

Similar to Ire1α, PERK has an active kinase domain in its cytosolic region. Activation of this sensor results in phosphorylation of the eukaryotic translation initiation factor 2α (eIF2α).

Phosphorylation of eIF2α broadly attenuates translation to limit the flux of new polypeptides into the secretory network [166], but allows for selective translation of mRNAs such as those encoding the activating transcription factor 4 (ATF4) [167]. ATF4 controls transcription of genes involved in autophagy, apoptosis, amino acid metabolism, and antioxidant response and thus contributes to the determination of cell fate under stress conditions [160].

The third stress sensor, ATF6, also localizes to the ER in unstressed cells. Under conditions of stress, however, it is transported to the Golgi via interactions with the COPII (coat protein II) vesicle complex [160]. There, ATF6 is cleaved by site 1 and 2 proteases (S1P and

S2P, respectively) [168-171], which releases the cytosolic domain fragment containing a basic leucine zipper (bZIP) transcription factor, ATF6f [160]. Translocation of this transcription factor to the nucleus allows for up-regulation of components involved in ERAD, as well as the gene encoding the transcription factor XBP1 [160,164].

These three UPR stress sensors have been shown to have fundamental differences in both the timing of their signaling and their response to particular ER stress stimuli [160], and thus coordinate to serve as a dynamic regulatory network to restore homeostasis within the cell

(Figure 5). In contrast, in S. cerevisiae, the organism in which ER stress signaling was initially

24 characterized, there appears to be only a single, linear pathway regulated by only one of these stress sensors, Ire1 (IreA in A. fumigatus) [172]. (Refer to Figure 5). Similar to mammalian cells, accumulations of misfolded proteins within the ER activate Ire1, which then processes the mRNA encoding the downstream transcription factor, Hac1 (HacA in A. fumigatus) [173-175].

Splicing of the unconventional intron allows for the translation of the master transcriptional regulator of the UPR, known as Hac1i in yeast and HacAi in A. fumigatus (i for induced) [176], which translocates to the nucleus and up-regulates the transcription of multiple UPR target genes, many of which encode proteins involved in protein folding and quality control, degradation, and vesicular transport [177,178]. (See Figure 6). Unlike Ire1α, Hac1-independent functions of yeast Ire1 have yet to be identified; yeast deletion mutants lacking either ire1 or hac1 have overlapping in vitro phenotypes [178-180]. Instead, the differential gene regulation mediated through the Ire1/Hac1-dependent pathway appears to be sufficient to adjust the secretory capacity of the system and restore homeostasis (See Figure 7).

Figure 6. Schematic of Fungal UPR

Under conditions of low ER stress, the UPR regulator remains in an inactive state, bound by the chaperone BipA (blue circle). Under conditions of high ER stress, BipA dislocates from IreA, allowing oligomerization and trans-autophosphorylation of IreA via its kinase domain, which in turn activates the IreA endoribonuclease (RNase) domain. A fully activated IreA then facilitates the splicing of an unconventional intron from mRNA encoding the transcription factor, HacA. The spliced version (hacAi) is then translated and the newly synthesized HacAi protein translocates to the nucleus, where it differentially regulates the transcription of a multitude of UPR-target genes. Differential regulation of these genes, and the protein products that they encode, restores homeostasis within the ER.

Figure 7. Schematic of Secretory Homeostasis Maintenance Model

Sustained secretory homeostasis depends on maintaining a balance between secretory capacity and secretory demand. Capacity refers to the ability to make, process, and transport proteins and thus relies on the combined function of folding (ERQC), degradation (ERAD), and vesicle transport mechanisms. Under basal conditions, these processes are sufficient to meet the demands placed on the cell. However, under conditions of stress, such as changes in nutrient source that require an increased flux of secretory proteins or external pressures that promote protein unfolding, the secretory demand is larger than capacity and homeostasis becomes disrupted. In response, the UPR up- regulates targeted gene expression within ERQC, ERAD, and vesicle transport pathways in order to restore balance between capacity and demand, thus maintaining secretory homeostasis.

Section 1.4.3 Inspiration from the Cancer Field Because of the important role maintenance of secretory homeostasis plays in supporting cell viability, especially in cells that rely on high-capacity secretion, it can be a point of vulnerability for the cell if disrupted. Both the UPR and ERAD have served as effective targets for anticancer therapy, specifically for highly secretory tumors such as multiple myelomas [181-

187]. It is thought that the high-secretory capacity of these tumors makes them more vulnerable to attack on secretory homeostasis mechanisms than other normal, host cells [188]. We posit that in infectious fungal growth can be addressed in a similar manner to invasive cancer growth, in that both scenarios there is an invading eukaryotic cell that must be targeted and killed with minimal damage to the host cells. Furthermore, invasive fungal growth parallels the growth of highly secretory tumors in that maintenance of high-capacity secretion also contributes to the pathogenesis of A. fumigatus. Proteases have been shown to be secreted in vivo [189-191],

27 while highly polar growth allows A. fumigatus to explore and invade blood vessels and tissues, resulting in the necrosis characteristic of invasive aspergillosis [77,192]. Therefore, inspired by successful anticancer strategies, we hypothesized that disruption of the homeostasis mechanisms within the secretory pathway of A. fumigatus would be a similarly effective antifungal strategy.

Section 1.4.4 Secretory Homeostasis and Fungal Pathogenesis The role of secretory homeostasis mechanisms in fungi has been most extensively studied from an industrial perspective, where a better understanding of these mechanisms can help identify methods for bypassing secretory bottlenecks that limit the industrial production of heterologous proteins [193-200]. How these mechanisms can be manipulated to reduce fungal pathogenesis, however, has not been studied as thoroughly. Therefore, in our initial stages of testing the hypothesis that targeting secretory homeostasis would reduce fungal pathogenesis, our laboratory used a genetic proof-of-principle approach to demonstrate that A. fumigatus depends on the master transcriptional regulator of the UPR, HacA, for full virulence [179,201].

This study was the first to provide evidence that a eukaryotic pathogen is under ER stress in the mammalian host and needs the UPR to sustain the infection by restoring homeostatic balance to the secretory pathway.

Similar findings to this breakthrough study were made in other fungal pathogens as well.

For example, Alternaria brassicicola, a necrotrophic plant pathogen that kills host cells through the secretion of numerous enzymes and toxins, also relies heavily on the UPR for virulence.

Deletion of A. brassicicola hacA decreased the secretory capacity of the fungus, resulting in impaired virulence and increased susceptibility to plant antimicrobial metabolites [202]. The

UPR has also been shown to be critical for pathogenesis of the human fungal pathogen,

Cryptococcus neoformans. Deletion of ire1 results in severe growth defects at 37°C, hypersensitivity to ER, cell wall, and thermal stress, and attenuated virulence [203]. Similarly, deletion of ire1 from the pathogenic dimorphic fungus Candida glabrata increased sensitivity to

ER stress and attenuated virulence [204], while the deletion of hac1 from the related pathogen

Candida albicans demonstrated a role for the UPR in the ER stress response, polarized growth, and the expression of factors that are known to play a role in the virulence [205]. Combined, these data suggests that the UPR plays an important role in fungal pathogenesis. The extent to which pathogenic fungi, A. fumigatus in particular, rely on the basal secretory mechanisms of

ERQC, vesicle transport, or ERAD, however, remains poorly understood.

Interestingly, there are a few key pieces of evidence that suggest that it is not only disruption of the master regulators of the UPR that has a detrimental effect on fungal virulence, but also that other secretory homeostasis mechanisms may be required for important stress responses and pathogenesis. Notably, the rice blast fungus Magnaporthe oryzae has been shown to rely on the ER chaperone LHS1 for its virulence [206]. Because LHS1 is only one component of secretory homeostasis and a downstream target of the UPR [207,208], this suggests that individual chaperones could contribute to fungal pathogenesis. Furthermore, lectin-mediated ERQC also appears to be important in fungi, as deletion of the gene encoding the chaperone calnexin results in hypersensitivity to laboratory-induced stress in fungal organisms, such as Saccharomyces cerevisiae and Aspergillus oryzae [209-211], and lethality in others, such as Schizosaccharomyces pombe [212]. Similarly, loss of glucosidase II results in secretory dysfunction in fungal cells [142,213-216] and decreases the growth rate and virulence of the fungal pathogen, Candida albicans [217]. Finally, proteins involved in vesicle transport have been shown to be involved in virulence of C. albicans [218,219] and M. oryzae

[220,221]. This, combined with our data demonstrating the importance of the UPR to pathogenesis, led us to hypothesize that the secretory pathway could be sufficiently disrupted by targeting major secretory homeostasis mechanisms in order to impair the growth and virulence of A. fumigatus (Figure 8).

Figure 8. Schematic of Dissertation Hypothesis

If the UPR of A. fumigatus is impaired by deletion of hacA, the organism is still able to maintain secretory homeostasis under basal conditions and thus displays limited in vitro growth defects. However, when secretory demand exceeds secretory capacity under conditions of stress, the corresponding up-regulation of ERQC, ERAD, and vesicle transport effectors cannot occur because the UPR is impaired and homeostasis is not restored. Therefore, because capacity and demand remain imbalanced, the ΔhacA mutant displays an impaired stress response and attenuated virulence.

Based on this model, we hypothesized that disruption of key mechanisms supporting secretory capacity, such as ERQC (red piece removed from figure), through targeted gene deletion would result in similar, if not greater, defects in A. fumigatus. Under basal conditions, the reduction in secretory capacity due to loss of a key component would disrupt the balance and cause impaired growth. Conditions of stress would then amplify this deficiency because the downstream target was not present to be up-regulated by the UPR, resulting in an impaired stress response and attenuated virulence.

Section 1.5 – How Does this Thesis Contribute to the Field of

Aspergillosis Research?

To test this hypothesis, our laboratory simultaneously began to investigate how key components of the folding/ERQC, transport, and degradation mechanisms of secretory homeostasis contributed to fungal pathogenesis. Additionally, we also began to investigate the role of the upstream regulator of the UPR, the transmembrane stress sensor IreA. As a part of this combined effort, the following chapters of this dissertation characterize for the first time the contribution of the lectin chaperone calnexin (folding/ERQC), the Rab GTPase SrgA (transport), and the IreA kinase to the growth and virulence of A. fumigatus. Completion of this work provides important insight into the determinants contributing to the virulence of this dangerous mold pathogen, with the long-term goal of facilitating the identification of points of vulnerability that could be targeted as a novel and effective antifungal drug strategy.

Chapter II: ERQC

Adapted From: Impact of the Lectin Chaperone Calnexin on the Stress Response, Virulence and

Proteolytic Secretome of the Fungal Pathogen Aspergillus fumigatus

Margaret V. Powers-Fletcher1, Kalyani Jambunathan2, Jordan L. Brewer1, Karthik Krishnan1, Xizhi Feng1, Amit K. Galande2 and David S. Askew1*

1Department of Pathology & Laboratory Medicine, University of Cincinnati College of Medicine, 231 Albert Sabin Way, Cincinnati, OH 45267-0529 2SRI International, 140 Research Drive, Harrisonburg, VA 22802-2552

Key words: Aspergillus fumigatus, UPR, calnexin, calreticulin, chaperone

*Corresponding author: David S. Askew, Ph.D. Dept. of Pathology, University of Cincinnati PO Box 670529 Cincinnati, OH 45267-0529 Phone: 513-558-2395 Fax: 513-558-2141 [email protected]

Citation: Powers-Fletcher MV, Jambunathan K, Brewer JL, Krishnan K, Feng X, et al. (2011) Impact of the Lectin Chaperone Calnexin on the Stress Response, Virulence and Proteolytic Secretome of the Fungal Pathogen Aspergillus fumigatus. PLoS ONE 6(12): e28865. doi:10.1371/journal.pone.0028865

Section 2.1 – Background

One of the major pathways within the ERQC process is the calnexin cycle, also known as the lectin-mediated ERQC system [222]. In metazoans, two key chaperones participate in the calnexin cycle; calnexin itself, a type 1 transmembrane protein, together with calreticulin, a soluble homolog of calnexin [223]. However, only calnexin has been identified in fungal species

[224,225]. Functional studies have revealed that calnexin promotes protein folding by binding to the N-linked glycans that are added to nascent polypeptides as they enter the ER, thereby preventing aggregation. The glycoprotein-calnexin interaction undergoes cycles of release and re-binding until the glycoprotein achieves its native conformation, after which the protein is released for secretion into the distal secretory pathway [222] (Figure 9). Because the majority of secreted proteins undergo N-linked glycosylation [142-144], lectin-mediated ERQC is in an influential position to affect homeostasis within the secretory pathway.

Figure 9. Schematic of Calnexin Cycle (Lectin-Mediated ERQC)

As polypeptides are translocated into the ER, destined for secretion, one of the most common post-translation modifications to occur is N-linked glycosylation. The addition of this core glycan to the polypeptide chain allows it to be recognized and bound by the chaperone, calnexin. Calnexin is thought to facilitate folding by serving as a scaffold for foldases and preventing the premature degradation of unfolded polypeptides. After its initial interaction with calnexin, a glucose moiety is removed from the core glycan, thus preventing the recognition by calnexin. If the polypeptide remains unfolded, it is re- glucosylated and re-establishes its interaction with calnexin for another folding attempt. This cycle continues until the protein is folded correctly and allowed to enter the distal secretory network through vesicle transport

or the polypeptide is labeled as terminally misfolded and targeted for degradation by the proteasome through the process of ERAD.

Deletion of calnexin results in hypersensitivity to laboratory-induced stress in fungal organisms, such as Saccharomyces cerevisiae and Aspergillus oryzae [209-211], and lethality in others, such as Schizosaccharomyces pombe [212], but the role of calnexin in the fungal pathogen A. fumigatus is unknown. In this study, we examined the contribution of calnexin to stress responses that would be encountered by A. fumigatus in its native environment as well as the host. Although clxA was dispensable for most aspects of A. fumigatus physiology, it was required under conditions of thermal, ER and nutrient stress. The virulence of the ΔclxA mutant was indistinguishable from that of wild type (wt) A. fumigatus however, indicating that clxA- dependent functions are largely dispensable for infection of the host.

Section 2.2 – Materials and Methods

Section 2.2.1 Strains and Culture Conditions Strains were maintained on Aspergillus Minimal Medium (AMM) [226] containing 0.01 M ammonium tartrate as the nitrogen source. The wild type (wt) strain used was H237, a clinical isolate. Unless otherwise noted, all experiments were conducted at 37°C to recapitulate in vivo growth conditions. Thermotolerance was assessed by inoculating 5,000 conidia into the center of a plate of rich medium (Inhibitory Mold Agar, IMA) and radial growth was monitored for 3 days at different temperatures. For analysis of DTT susceptibility, 5,000 conidia were inoculated into each well of a 24-well plate containing liquid AMM supplemented with different concentrations of

DTT. Plates were incubated at 37°C for 3 days without shaking. The medium was aspirated, and the hyphae adhering to the base of the well were stained with 0.5% (w/v) methylene blue for 1 hour at 37°C. After removing the methylene blue solution the adherent hyphae were rinsed with sterile water and dried prior to photographing. Sensitivity to tunicamycin (10-100

g/ml) and brefeldin A (5-15 g/ml) was determined by spotting conidia onto the center of a plate of AMM containing the drug and monitoring radial growth for 2-4 days at 37oC.

Caspofungin susceptibility was determined using the Etest antifungal susceptibility kit (AB

BIODISK) according to the manufacturer’s instructions, with the following modifications. One million conidia were spread evenly onto the surface of a 150 mm plate of IMA agar using a glass rod. The inoculated agar surface was allowed to dry for approximately one hour before Etest strips containing caspofungin were applied. The plates were incubated at 37°C for 24 hours.

The minimal inhibitory concentration was read as the lowest drug concentrations at which the border of the elliptical inhibition zone intercepted the scale on the antifungal strip. Sensitivity to

Congo red (CR, 25-150 g/ml), nikkomycin (50-250 g/ml), or calcofluor white (CFW, 5-35

g/ml) was determined by spotting 2,000 conidia onto the center of a plate of IMA containing the compound and monitoring radial growth for 24 hours (CR and CFW) or 36 hours (Nikkomycin) at 37oC.

Growth under starvation conditions was determined as previously described [227].

Briefly, 200 conidia were spread onto the surface of a YG plate (0.5% yeast extract and 2% glucose) and incubated overnight at 37°C. Hyphal plugs containing individual colonies were obtained using the tip of a sterile glass pasture pipette and transferred onto the center of a plate of water/agarose medium (1% agarose in sterile deionized distilled water) and the extent of radial growth was monitored after 7 days of incubation at 37oC.

For analysis of growth under conditions of metal ion depletion, 3 x 104 conidia were inoculated onto sterile glass coverslips submerged in 3 mL of AMM containing 1 mM EDTA and incubated at 37°. Coverslips were removed after 2 and 6 days incubation, rinsed with sterile water, and photographed by differential interference contrast microscopy.

Section 2.2.2 Deletion and Reconstitution of the A. fumigatus clxA Gene PCR primers used in the study are listed in Table 1. Total RNA was extracted from overnight cultures of wt A. fumigatus by crushing the mycelium in liquid nitrogen and resuspending in TRI reagent LS (Molecular Research Center, Cincinnati, OH). The RNA was then reverse-transcribed using the Superscript II reverse transcriptase first-strand synthesis system (Invitrogen) and PCR amplified using primers 639 and 640.

The calnexin gene was replaced with the hygromycin resistance gene using the split- marker method [228]. The first two-thirds of the hygromycin resistance cassette were amplified from pAN7-1 using primers 398 and 395, creating PCR product #1. The second two-thirds of hygromycin were then amplified with primers 396 and 399, creating PCR Product #2. The left arm of the clxA gene was amplified from wt DNA using primers 632 and 633, and the right arm was amplified with primers 634 and 635, generating PCR products #3 and #4, respectively.

PCR products #1 and #3 were then combined in an overlap PCR reaction with primers 632 and

395 to generate PCR product #5 and PCR products #2 and #4 were combined in an overlap reaction with primers 396 and 635 to generate PCR product #6. PCR products #5 and #6 were then cloned into pCR-Blunt II-TOPO (Invitrogen) to create plasmids p569 and p568, respectively. The p569 and p568 plasmids were linearized with NsiI and EcoRI, respectively, and transformed into A. fumigatus protoplasts as previously described [92]. Loss of the clxA gene was confirmed by Southern blot analysis of genomic DNA isolated from hygromycin resistant monoconidial isolates using an internal probe that was PCR-amplified from wt genomic

DNA using primers 636 and 637 (Figure 11), as well as an upstream probe that was PCR- amplified from wt genomic DNA using primers 632 and 633, corresponding to the left arm of the calnexin-deletion cassette (Figure 11).

Table 1. PCR primers used in calnexin study

M13-derived sequences used for overlap PCR are underlined Primer Sequence (5’-3’) 395 CTCCATACAAGCCAACCACGG 396 CGTTGCAAGACCTGCCTGAA 398 CGCCAGGGTTTTCCCAGTCACGACAAGTGGAAAGGCTGGTGTGC 399 AGCGGATAACAATTTCACACAGGATCGCGTGGAGCCAAGAGCGG 632 GATGCTTCTTGTCAGTATCCT 633 GTCGTGACTGGGAAAACCCTGGCGGCTAATACCCGAGATCTCTG 634 TCCTGTGTGAAATTCTTATCCGCTGGATACGGGCGAATAATACG 635 CAAAGGACGACGATGTTGTT 636 TACGTCGGTGAATGGGCTGT 637 AGGCGCTGTCATGTGCTTCT 639 CAGAGATCTCGGGTATTAGC 640 CGTATTATTCGCCCGTATC 641 GGCTTTCGACAGAACATTGG 672 AGGTCCCGTCATCTATTTCC

To construct the clxA complementation plasmid, the clxA gene including 472 bp upstream of the ATG was PCR-amplified from wt genomic DNA using primers 641 and 672 and cloned into pCR-Blunt II-TOPO (Invitrogen) to create p575. A phleomycin resistance cassette was then excised from plasmid 565 and inserted into p575 to create p612. Plasmid 612 was linearized with XbaI, transformed into ΔclxA protoplasts, and stable integrants were selected on plates containing phleomycin. Ectopic reconstitution of the clxA gene was confirmed by genomic Southern blot analysis of phleomycin-resistant monoconidial isolates using the internal and upstream clxA probes shown in Figure 11.

Section 2.2.3 Analysis of Protease Secretion by Substrate Specificity Profiling Conidia were inoculated to a concentration of 1 x 105 conidia/ml in 60 mL of AMM supplemented with 10% heat-inactivated human AB serum (Innovative Research). After incubating at 37oC for 72 h at 150 rpm, the mycelium was removed by filtration and each culture supernatant was diluted 1:50 in sterile-filtered HEPES buffer (50 mM HEPES, 100 mM NaCl, 10 mM CaCl2, pH 8.0). These dilutions were found to give comparable fluorescence intensity values in preliminary experiments. A FRET peptide library comprised of 512 microtiter plate wells, each containing an equimolar mixture of up to 8 individual peptides, was obtained

(Mimotopes, Clayton, Australia) [229]. Each well (50 nmol of peptide) was dissolved in 100 μL of 50% acetonitrile in ultrapure water. This solution (5 μL/well) was transferred to low volume black microtiter plates (Molecular Devices, Sunnyvale, CA) containing 20 μL of HEPES buffer.

Diluted fungal culture supernatant (20 μL per well) was added to each well. Time-resolved fluorescence data were obtained on an Analyst HT instrument (Molecular Devices) using excitation and emission filters of 320 nm and 420 nm, respectively. The fluorescence intensity fold change after 5 hr at room temperature was calculated as Ffinal/Finitial and each data set was normalized to the highest global signal intensity. No fluorescence was observed in control culture medium lacking fungal supernatant. Heat maps were generated from these data in which each square corresponds to a single assay well (Heatmap Builder, Ashley Lab, Stanford) [230].

Section 2.2.4 Animal Model of Invasive Aspergillosis For the corticosteroid immunosuppression model, groups of 8 CF-1 outbred female mice were given a single dose of the synthetic corticosteroid triamcinolone acetonide (40 mg/kg of body weight injected subcutaneously) on day -1. On day 0, the mice were anaesthetized with

3.5% isofluorane and inoculated intranasally with a 20 μL saline suspension containing 2 x 105 conidia from wt or the ΔclxA mutant, or with 20 l of a 0.9% sodium chloride solution for a mock infection control (4 mice). Mortality was monitored for 7 days, and statistical significance was assessed by the log-rank test using Sigma Stat 3.5.

For the neutropenic model, groups of 12 CF-1 outbred female mice were immunosuppressed by intraperitoneal injection of cyclophosphamide (150mg/kg) on days -2 and

+3, as well as subcutaneous injections of triamcinolone acetonide (40 mg/kg) on days -1 and

+6. Mice were inoculated with 2 x 105 conidia and mortality was monitored for 14 days.

Statistical significance was assessed using the Sigma Stat 3.5 log-rank test.

For histopathologic analysis, CF-1 outbred female mice were immunosuppressed according to the neutropenic model described above, infected with 2 x 105 conidia, and sacrificed on day +3. The lungs were fixed by inflation with 4% phosphate-buffered

38 paraformaldehyde, dehydrated and embedded in paraffin, sectioned at 5 m, and stained with hematoxylin and eosin (HE) or Grocott methenamine silver (GMS). Microscopic examinations were performed on an Olympus BH-2 microscope and imaging system using Spot software version 4.6.

Section 2.3 – Results and Discussion

Section 2.3.1 Construction of a Calnexin-Deficient Strain of A. fumigatus The A. fumigatus calnexin mRNA (Genbank accession: AY560606) encodes a protein with the same two sets of repeated peptide motifs that are characteristic of the calreticulin/calnexin family, together with a predicted membrane-spanning domain (Figure 10).

The protein is most closely related to that of other filamentous fungi, but among yeast species it is more closely related to the Schizosaccharomyces pombe ortholog (46% identity) than to the

Saccharomyces cerevisiae ortholog (28% identity).

Figure 10. Multiple sequence alignment of calnexin orthologs

The A. fumigatus calnexin protein (Af; XP_751547) is compared to orthologs from A. niger (An; AJ299945), S. pombe (Sp; P26581), H. sapiens (Hs; P27824), and S. cerevisiae (Sc; P27825). Black boxes denote identical amino acids, whereas grey boxes denote similar amino acids. The sequence was aligned using DNAMAN software (Lynnon Corp, Canada) using default parameters. Results were exported in CLUSTALW format for shading using BOXSHADE 3.21 (http://www.ch.embnet.org/software/BOX_form.htm l). The two sets of repeated peptide motifs (1-4) that are characteristic of the calreticulin/calnexin family are shown by the brackets. The asterisk denotes the transmembrane domain of A. fumigatus calnexin predicted by TMHMM Server v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM-2.0).

A calnexin deficient strain of A. fumigatus was constructed by replacing the gene (clxA) with a hygromycin resistance cassette (Figure 11). The ΔclxA mutant was viable and grew normally on either minimal or rich medium (data not shown). This contrasts the essentiality of calnexin in S. pombe [212], but is similar to the viability of calnexin mutants reported in A. niger

[211], Aspergillus oryzae [231] and S. cerevisiae [210].

Figure 11. Schematic of deletion of calnexin from A. fumigatus

The clxA gene was deleted by replacing the coding region with the hygromycin resistance cassette (HYG). Southern blot analysis of SacI-digested genomic DNA using a probe located with the clxA coding region identified the predicted 2.7 kb fragment in wt A. fumigatus, which was not present in the ΔclxA mutant. The portion of the calnexin gene that was used to generate the complemented strain (C’) contains a single internal SacI site, so the 3.7 kb band evident with this probe reflects a single ectopic integration of the reintroduced clxA gene. B) Southern blot analysis of BamHI-digested genomic DNA using a flanking probe located upstream of the clxA gene was used to confirm calnexin gene deletion. Replacement of the clxA gene with the hygromycin resistance cassette introduced a BamHI site that reduced a 5.6 kb wt fragment to the expected 3.7 kb. Two closely migrating bands above 5.6 kb were also evident in the ΔclxA mutant, indicating the presence of at least two ectopic integrations of the disruption cassette. The complemented strain (C’) contains a single ectopic integration of the clxA gene, which is evident by the unique 5.0 kb band that is smaller than the wt 5.6 kb band because it lacks the flanking BamHI sites.

Section 2.3.2 Loss of Calnexin Alters the Proteolytic Secretome of A. fumigatus Previous studies in yeast have shown that loss of calnexin function is associated with increased secretion of some proteins [232-235]. In this study, we used a more comprehensive approach to determine how loss of calnexin would affect the proteolytic secretome of A. fumigatus, using a combinatorial library of internally quenched fluorogenic peptide substrates

[229]. This library is comprised of a panel of up to eight individual fluorogenic peptides in each well of a microtiter plate. When the substrates are cleaved, a fluorophore is liberated from a quenching moiety, resulting in a fluorescence signal that is proportional to the extent of cleavage. A. fumigatus culture supernatants were used to screen the library as described in

Materials and Methods, and heat maps were generated from the resulting data. As shown in

Figure 12, loss of clxA altered the secreted proteolytic signature of the fungus, with a remarkably high number of substrates showing increased cleavage by ΔclxA supernatants relative to wt (indicated by the red squares). However, this was not associated with any changes in the ability of the mutant to grow on a complex protein source such as skim milk or fetal bovine serum (data not shown). The precise mechanism by which loss of calnexin increases the secretion of some proteins in both yeast and A. fumigatus is not yet clear. However, since part of calnexin’s role in protein quality control is to retain incompletely folded proteins in the ER until they achieve the appropriate conformation [222], the loss of this retention function may allow for more rapid secretion of proteins that would ordinarily take longer to traffic through the secretory pathway. It is possible that some of these prematurely released proteins could be partially unfolded. However, given the large number of functional proteases identified in ΔclxA supernatants in this study, it appears that redundant mechanisms of protein folding in the ER can adequately compensate for loss of calnexin and ensure that secreted proteases achieve the appropriate conformation for functionality.

Figure 12. Altered proteolytic secretome due to loss of calnexin

Secreted protease activity in culture supernatants was profiled using a library of fluorescence resonance energy transfer (FRET) labeled peptide substrates, as described in Materials and Methods. Equimolar mixtures of up to 8 individual FRET peptides in each well of duplicate microtiter plates were incubated with culture supernatants from the indicated strains and heat maps were generated from the average fluorescent signals generated by substrate cleavage, with each square corresponding to a single assay well. Panel 1: wt A. fumigatus. Panel 2: ΔclxA mutant. Panel 3: Relative change in substrate specificity profile expressed as the difference of normalized fold change values in panels 1 and 2 (wt minus ΔclxA). Wells containing substrates with greater cleavage in ΔclxA supernatants relative to wt supernatants are shown in red. The range of fold change values used to generate the wt and ΔclxA heat maps is 1-55 and the range of values used to generate the subtracted heat map (difference) is -25 to + 25.

Section 2.3.3 Calnexin Facilitates Growth Under Conditions of Thermal Stress In nature, A. fumigatus resides in composting material, an environment that undergoes wide fluctuations in temperature because of intense microbial activity [236]. A. fumigatus has responded to the thermal selection pressure in this environmental niche by evolving mechanisms of thermotolerance that allow the fungus to thrive at temperatures up 60° C, with an optimum between 37oC and 42oC [91,237]. As shown in Figure 13, the ΔclxA mutant grew normally at temperatures up to 37°C, but showed a 45% reduction in growth rate at 42°C indicating a role for calnexin in the thermotolerance of this fungus.

Figure 13. Calnexin is required for thermotolerant growth

Equal numbers of conidia were plated onto the center of an IMA plate and incubated for 3 days at the indicated temperatures. Values represent the average radial growth rate (mm/h) from three individual experiments + SD. *Statistically significant by Student’s T-test (p<0.001).

We have previously shown that loss of UPR signaling by deletion of hacA creates a cell wall defect that reduces thermotolerance by increasing hyphal fragility at higher temperatures, resulting in tip lysis [179]. The ΔclxA mutant showed no evidence of hyphal tip fragility at temperatures up to 50oC however (data not shown), indicating that A. fumigatus can maintain cell wall integrity at high temperatures in the absence of calnexin. Moreover, although calnexin has been previously implicated in cell wall synthesis in S. cerevisiae [238], the A. fumigatus

ΔclxA mutant showed wt sensitivity to multiple cell wall stressors, including caspofungin (Figure

14), calcofluor white, nikkomycin, or Congo red (data not shown).

Figure 14. Loss of calnexin does not increase sensitivity to caspofungin

Caspofungin sensitivity was determined using the Etest method. Etest strips containing caspofungin were applied to IMA plates inoculated with equal amounts of conidia. The plates were incubated at 37°C for 24 hours. The lowest drug concentrations at which the border of the elliptical zone of inhibition intercepted the scale on the antifungal strip (MIC) was indistinguishable between the strains, indicating that loss of calnexin did not alter caspofungin sensitivity. In addition, fungal growth was evident within the zone of inhibition in all three strains, consistent with the known fungistatic effects of this drug against A. fumigatus.

While these data do not eliminate the possibility that calnexin contributes to cell wall homeostasis in A. fumigatus, they suggest that any change in cell wall composition caused by loss of calnexin is relatively minor and unlikely to account for the heightened thermosensitivity of the ΔclxA mutant. Since protein folding is temperature dependent [239], we speculate that the chaperone function of calnexin promotes the folding of one or more client proteins that are needed for optimal growth at elevated temperatures. Alternatively, calnexin could increase overall fitness by preventing the toxic accumulation of misfolded proteins in the ER that may arise as a result of thermal stress.

Section 2.3.4 Calnexin Facilitates Growth under Conditions of Acute Protein Folding Stress Calnexin mRNA levels are increased by the UPR under conditions of acute ER stress, suggesting a role for this chaperone in the response to unfolded proteins [211,240,241]. To test

45 this, we compared growth in the presence of dithiothreitol (DTT), a reducing agent that induces the UPR by disrupting the disulfide bonds that are necessary for protein folding [177]. As shown in Figure 15, the ΔclxA mutant was unable to grow in concentrations of DTT that had minimal effects on the growth of the wt and complemented strains. This is similar to what has been described in calnexin mutant of A. oryzae [231], and supports a role for calnexin under conditions that induce acute ER stress. However, this finding contrasted the effects of the ER stress-inducing agents tunicamycin (TM) and brefeldin A (BFA), neither of which showed differential activity against the A. fumigatus ΔclxA mutant (data not shown). The inability of calnexin deletion to alter sensitivity to TM or BFA is likely due to the different mechanisms by which these agents induce ER stress. For example, TM increases the level of misfolded proteins in the ER by interfering with the N-linked glycosylation that is necessary for accurate protein folding [177]. Since calnexin binds N-linked glycans on nascent polypeptides as they begin to fold in the ER, TM may mask the effects of calnexin by interfering with the assembly of the glycan precursor on these proteins. Similarly, BFA induces ER stress by interfering with

ER-Golgi transport [242], which is a relatively late step in the secretory pathway where calnexin function may have less influence. The ability of the ΔclxA mutant to grow normally in the presence of TM and BFA contrasts the ΔhacA mutant, which is highly sensitive to these compounds [179]. This reflects the dominant role that HacA plays as a master regulator of the

UPR, as opposed to the more specialized role of calnexin in the process of ERQC.

Figure 15. Calnexin promotes growth under conditions of acute ER stress

Equal numbers of conidia were added to individual wells of a 24-well plate containing liquid AMM and the indicated concentrations of DTT. Plates were incubated at 37°C for 3 days, after which the mycelial biomass that was adhered to the plate surface was stained with methylene blue and photographed.

Section 2.3.5 Calnexin Facilitates Growth Under Starvation Conditions An increasing body of evidence suggests that A. fumigatus is under nutrient stress in the host environment and must undergo metabolic changes to adapt to these conditions [243]. To determine whether calnexin contributes to this process, the ΔclxA mutant was tested for its ability to grow under nutrient limiting conditions. Unlike wt A. fumigatus hyphae, which can support a limited amount of growth in the absence of extracellular nutrients [227], the ΔclxA mutant was unable to grow under these conditions, suggesting a role for calnexin in the adaptive response to acute starvation stress (Figure 16). This phenotype is reminiscent of the

A. fumigatus Δatg1 mutant, which is deficient in a serine kinase required for autophagy [227].

Autophagy is a catabolic pathway that employs a complex membrane trafficking system to degrade intracellular constituents into usable nutrients during periods of nutrient deprivation

[244]. Although the exact role that calnexin plays in the response to starvation is presently unknown, it is intriguing to speculate that autophagy components are important clients of the calnexin cycle in A. fumigatus.

Figure 16. Calnexin is required under nutrient starvation conditions

Agar plugs containing hyphae from overnight cultures of conidia plated onto YG plates were transferred to starvation medium (1% agarose in sterile distilled water) and colony diameters were measured after 7 days at 37oC. Values represent the average of 9 biological replicates + SD. *Statistically significant by Student’s T-test (p<0.001).

Section 2.3.6 Loss of Calnexin Promotes Growth on 2-deoxy-D-glucose Based on calnexin’s contribution to growth of A. fumigatus under starvation conditions, we speculated it would also play an important role in the fungal response to other conditions of nutrient deprivation. The glucose analog, 2-deoxy-D-glucose (2DG) is often used as an inhibitor of glycolysis because the replacement of one hydroxyl group with a hydrogen prevents its complete enzymatic processing [245]. To determine how loss of calnexin affected the ability of

A. fumigatus to respond to this type of energy deprivation, we incubated either wt or the ΔclxA mutant on solid AMM in which glucose was replaced with 0.1% 2DG as the sole carbon source.

Unexpectedly, we found that while both wt and ΔclxA grew similarly on this medium at 37°C, at

48 a lower temperature of 30°C the growth of the mutant was drastically different from that of wt

(Figure 17). Whereas wt grew very little, the ΔclxA was able to sustain a radial growth rate approximately three times that of wt. While the explanation for this altered, temperature- dependent response to 2DG is currently unclear, these results suggest calnexin plays an important role in regulating the biology of A. fumigatus under unique environmental conditions.

Figure 17. Increased growth of the ∆clxA mutant on 0.1% 2DG

Equal numbers of conidia were spot-plated onto solid agar plates made up of AMM in which glucose had been replaced with 0.1% 2DG as the sole carbon source. Colonies were incubated for 10 days at the indicated temperature and radial growth rate was determined as (colony diameter day 10 – colony diameter day 1)/hours of incubation. Data represent the average of 3 different plates ± standard deviation.

0.7 0.6 0.5 wt 0.4 0.3 ∆cnxclxA KO 0.2 0.1 0 Radial Growth Rate Rate (mm/hour) Growth Radial 30 37 temperature (°C)

Section 2.3.7 Calnexin is Required for Growth in Cation-Depleted Medium Sequestration of iron or zinc is a major mechanism through which the host inhibits microbial growth, and the ability of A. fumigatus to adapt to iron or zinc limitation is an established virulence mechanism for this fungus [111,246]. To determine whether calnexin impacts this adaptive response, we compared the ability of conidia to germinate in medium that was depleted of metal ions by the addition of the chelating agent ethylenediaminetetraacetic acid (EDTA). The germination of A. fumigatus conidia begins with a period of isotropic expansion (swelling), followed by the elaboration of a germ tube and the establishment of polarized hyphal growth. The germination rates of wt and ΔclxA conidia were indistinguishable

49 in the absence of EDTA (data not shown). In the presence of EDTA, wt conidia were able to germinate into hyphae within two days and had already started to branch (Figure 18A). This contrasted the ΔclxA mutant, which had only formed small germlings at the same time point, indicating a delay in germination (Figure 18A, day 2). Unlike wt, the ΔclxA germlings were unable to sustain polarized growth upon further incubation, resulting in abnormally swollen hyphae with irregular morphology (Figure 18B). Supplementation with an excess of Zn2+ or Fe2+ fully rescued the ability of ΔclxA conidia to elaborate hyphae at this concentration of EDTA

(Figure 18C and data not shown), consistent with metal ion deficiency as the cause of this phenotype. Interestingly, the ∆clxA mutant did not display increased sensitivity to ethylene glycol tetraacetic acid (EGTA), which is more selective for calcium chelation than EDTA (data not shown), suggesting that the impaired growth of the ∆clxA mutant in the presence of EDTA is due to more global metal ion chelation rather than calcium-specific depletion. This increased sensitivity of ΔclxA to EDTA may reflect the existence of specific calnexin client proteins involved in metal ion homeostasis, such as membrane transporters or zinc-finger transcription factors. Alternatively, since many ER functions are metal ion-dependent, it may be more difficult for a metal ion-depleted ER to tolerate the loss of calnexin functions. The observation that

EDTA induces the UPR is consistent with this latter possibility [247].

Figure 18. Calnexin promotes growth in cation-depleted medium

Equal numbers of conidia from the indicated strains were inoculated onto glass coverslips in liquid AMM containing 1 mM EDTA (AMM-EDTA) and incubated at 37°C. (A) Impaired germination of ΔclxA conidia in EDTA: coverslips were removed after 2 and 6 days incubation and fungal morphology was photographed by differential interference contrast microscopy. (B) Abnormal morphology of the ΔclxA mutant after prolonged incubation in EDTA: A high power image of the abnormally swollen conidia and hyphae of the ΔclxA mutant after 6 days of incubation in AMM-EDTA at 37oC is shown. (C) Supplementation with zinc rescues the growth of ΔclxA in AMM-EDTA: The ΔclxA conidia were inoculated into AMM-EDTA medium supplemented with 500 μM ZnS04 and cultured for 2 days at 37°C.

Section 2.3.8 Calnexin is Dispensable for A. fumigatus Virulence The virulence of the ΔclxA mutant was tested in two distinct mouse models of invasive aspergillosis that differ in the extent of immunosuppression; a corticosteroid model that involves transient immunosuppression with a single-dose of triamcinolone acetonide and a neutropenic model that involves a prolonged immunosuppression regimen that pairs neutrophil depletion with corticosteroid-induced immunosuppression. The loss of clxA has little-to-no effect on the virulence of A. fumigatus in the corticosteroid model and similar results were obtained using the neutropenic model (Figure 19). Histopathologic analysis of lung tissue in the neutropenic model confirmed similar levels of fungal growth and inflammation in both wt- and ΔclxA-infected mice

(Figure 20). Combined, these results indicate that calnexin functions are dispensable for surviving the major environmental stresses that are encountered in the mammalian host. This finding contrasts the situation in the plant fungal pathogen M. oryzae, where calnexin is required for the elaboration of a specialized infection structure called an appressorium that is essential

51 for virulence [248]. A. fumigatus does not form these structures however, which may account for the different requirements for calnexin in the pathogenicity of these diverse fungal pathogens.

Figure 19. Calnexin is dispensable for A. fumigatus virulence

A. B.

In two different animal models of IA, the virulence of the ΔclxA mutant was statistically indistinguishable from that of wt. A) Groups of 8 CF-1 outbred mice were immunosuppressed with a single dose of triamcinolone acetonide on day -1 and infected intranasally with conidia from the indicated strains on day 0. B) Groups of 12 CF-1 outbred mice were immunosuppressed with cyclophosphamide and triamcinolone acetonide and inoculated with 2 x 105 conidia. One of the four mock-infected control mice died on day +10 of a bacterial infection.

Section 2.4 – Summary

A. fumigatus is normally found in compost, a harsh environment that challenges the fungus to tolerate wide fluctuations in temperature, nutrient availability and the toxic effects of compounds released by competing microbes. Our data reveal that calnexin protects A. fumigatus from the adverse effects of high temperature, nutrient deprivation and toxins that disrupt ER homeostasis. This suggests that calnexin has important functions that contribute to the ability of A. fumigatus to thrive in the ecological niche of decaying organic debris. However, our data demonstrate that calnexin is dispensable for infection of a mammalian host, suggesting that redundant pathways of ER homeostasis are sufficient to support the virulence of this organism. Further work is needed to identify these pathways and determine how they

52 cooperate with calnexin to meet the challenge of protein folding in a fungus that is highly adapted for secretion.

Figure 20. Histopathology of infected lung tissue

Using the neutropenic immunosuppression model, mice were infected with 2 x 105 conidia in a separate experiment and sacrificed on day +3, as described in Materials and Methods. The lungs were sectioned at 5 m and stained with hematoxylin and eosin (HE) or Grocott methenamine silver (GMS). Comparable levels of fungal growth and inflammation were observed in both wt- and ΔclxA- infected mice, resulting in similar amounts of bronchiolar erosion and migration of the hyphae across the airway wall. Microscopic examinations were performed on an Olympus BH-2 microscope and imaging system using Spot software version 4.6. Scale bar represents 100 m.

Chapter III: Vesicle Transport

Adapted from:

Deletion of the sec4 homolog srgA from Aspergillus fumigatus is associated with an impaired stress response, attenuated virulence and phenotypic heterogeneity

Margaret V. Powers-Fletcher, Xizhi Feng, Karthik Krishnan and David S. Askew*

Department of Pathology & Laboratory Medicine, University of Cincinnati College of Medicine, 231 Albert Sabin Way, Cincinnati, OH 45267-0529

Key words: A. fumigatus, SrgA, Sec4, Rab GTPase

*Corresponding author: David S. Askew, Ph.D. Dept. of Pathology, University of Cincinnati PO Box 670529 Cincinnati, OH 45267-0529 Phone: 513-558-2395 Fax: 513-558-2141 [email protected]

Citation: Powers-Fletcher MV, Feng X, Krishnan K, and Askew DS (2013) Deletion of the sec4 Homolog srgA from Aspergillus fumigatus Is Associated with an Impaired Stress Response, Attenuated Virulence and Phenotypic Heterogeneity. PLoS ONE 8(6): e66741. doi:10.1371/journal.pone.0066741

Section 3.1 – Background

Vesicle transport is the major mechanism of trafficking secretory biomolecules, such as proteins, to their target site. Because of this role, the coordination of such transport is vital to maintenance of secretory function and homeostasis. In particular, members of the Rab family of

GTPases have pivotal functions in the regulation of vesicular trafficking in eukaryotes. By cycling between inactive (GDP-bound) and active (GTP-bound) states, the Rab GTPases, in coordination with their many effector proteins, orchestrate precise targeting of secretory vesicles

[249]. The Rab GTPase Sec4 is central to this process, contributing to the transport of vesicles from the trans-Golgi to the plasma membrane [148]. Loss of sec4 results in the accumulation of secretory vesicles and disruption of protein secretion, which is incompatible with viability in a number of fungal species [148,250-253]. Additionally, other Sec4 homologs have been linked to functions that contribute to fungal pathogenesis, such as the formation of specialized infection structures [254] or the extracellular release of vesicles containing virulence-related factors [252].

Very little is known about Rab GTPases in Aspergillus fumigatus, an opportunistic human mold pathogen that causes a life-threatening infection known as invasive aspergillosis

[255]. In this study, we characterized the A. fumigatus srgA gene, encoding a Sec4 homolog that was initially annotated in Aspergillus niger as secretion-related GTPase A (SrgA) [256]. An

A. fumigatus ΔsrgA mutant was constructed and shown to be associated with abnormal colony morphology, attenuated conidiation, reduced hyphal growth, and hypersensitivity to environmental stress. However, there was surprising phenotypic heterogeneity among independent isolates of this mutant, suggesting that the consequences of losing SrgA function is modified by the activation of different compensatory responses.

Section 3.2 – Materials and Methods

Section 3.2.1 Culture Conditions Conidia were harvested from strains grown on OSM plates (Aspergillus minimal media

(AMM) [226] containing 10 mM ammonium tartrate and osmotically stabilized with 1.2 M sorbitol). Unless otherwise noted, all experiments were conducted at 37°C. For analysis of dithiothreitol (DTT) susceptibility, 5,000 conidia were inoculated into each well of a 24-well plate containing liquid AMM supplemented with increasing concentrations of DTT. Plates were incubated at 37°C for three days without shaking. The medium was then aspirated, and the hyphae adhering to the base of the well were stained with 0.5% (w/v) methylene blue for one hour at 37°C. After removing the methylene blue solution, the adherent hyphae were rinsed with sterile water and dried prior to photographing. Sensitivity to tunicamycin (100 g/ml) and brefeldin A (5-15 g/ml) was determined by spotting conidia onto the center of a plate of AMM containing the compound and monitoring radial growth for 2-4 days at 37°C.

For analysis of hyphal growth, conidia were spot-plated onto the surface of a plate containing AMM agar and radial growth was monitored over a four-day incubation period at

37°C. The rate of radial growth was calculated as the colony diameter on day four minus the initial colony diameter after the first 24 hours of incubation divided by the incubation period.

Section 3.2.2 Analysis of Intracellular Localization by GFP-tagging PCR primers used in this study are listed in Table 2. Total DNA was extracted from overnight cultures of wt A. fumigatus and srgA was PCR amplified using primers 824 and 825.

The PCR product was then inserted into the NdeI and NotI sites of p538, a GFP-fusion cassette driven by the Aspergillus nidulans gpdA promoter [92], thus generating p626. Plasmid 626 was then ectopically introduced into the wt strain CBS144.89. The intracellular localization of the fusion protein was then determined by inoculating conidia from the GFP-SrgA A. fumigatus strain onto a glass coverslip submerged in liquid AMM and incubating overnight at 37°C.

Coverslips, with adhered germlings on the surface, were then inverted and mounted on a glass

56 slide. Images were acquired with a Zeiss LSM710 confocal with an Axio Observer Z1 set for

GFP detection. Images of developing conidiophores were acquired using an Olympus IX71 inverted microscope set for GFP detection.

Table 2. PCR primers used in SrgA study

M13-derived sequences used for overlap PCR are underlined

Primer Gene Sequence (5’-3’) 398 ble CGCCAGGGTTTTCCCAGTCACGACAAGTGGAAAGGCTGGTGTGC 408 ble TGCTCGCCGATCTCGGTCAT 409 ble AGCGGATAACAATTTCACACAGGATTAAAGCCTTCGAGCGTCC 410 ble GACAAGGTCGTTGCGTCAGTC 694 srgA AGCATCCATTAGAGACAGCC 695 srgA GTCGTGACTGGGAAAACCCTGGCGTCAAAAGAGCCGGTACTTGG 696 srgA TCCTGTGTGAAATTGTTATCCGCTGTTGTTATCCGCTGTTGTTAGGCATGCGCTTTC 697 srgA GTCCTCGAAGTTTGCACAAC 758 srgA CACTTTGGTGGCCATAGATC 759 srgA CCGATCCGTGATGGTCTATA 824 srgA GGAATTCCATATGGCCGGCACAAGAAATTA 825 srgA ATAAGAATGCGGCCGCCTAACAACATTTACCGCCAG

Section 3.2.3 Deletion of A. fumigatus srgA The gene encoding A. fumigatus SrgA (AFUA_4G04810) was replaced with the phleomycin resistance gene using the split-marker method [257]. The first two-thirds of the phleomycin resistance cassette were amplified from pAN7-1 using primers 398 and 408, creating PCR product #1. The second two-thirds of phleomycin were then amplified with primers 409 and 410, creating PCR Product #2. The left arm of the srgA gene was amplified from wild-type DNA using primers 694 and 695, and the right arm was amplified with primers

696 and 697, generating PCR products #3 and #4, respectively. PCR products #1 and #3 were then combined in an overlap PCR reaction with primers 398 and 695 to generate PCR product

#5 and PCR products #2 and #4 were combined in an overlap reaction with primers 696 and

410 to generate PCR product #6. PCR products #5 and #6 were then cloned into pCR-Blunt II-

TOPO (Invitrogen) to create plasmids p599 and p600, respectively. The p599 and p600 plasmids were linearized with XhoI/BamHI and EcoRI, respectively, and transformed into AfS28

(referred to here as wt) A. fumigatus protoplasts as previously described [92]. For each transformation, phleomycin-resistant colonies were plucked from the original selection plate and

57 transferred to secondary plates containing phleomycin. Monoconidial strains were obtained after two passages, in which conidia were spread on selection-free media and individual colonies were selected. Conidia from monoconidial colonies were then used to create the final 10% glycerol stocks.

Section 3.2.4 Analysis of Conidiophore Development For analysis of conidiophore morphology, conidia were inoculated onto the edge of an

OSM agar plug. A glass coverslip was placed on top of the plug and incubated for three days at

37°C. The coverslips were removed, mounted on a glass slide, and conidiophores were observed using bright-field microscopy. For analysis of conidia morphology, wt and the ∆srgA isolates were incubated on OSM plates for ten days at 37°C in tissue culture flasks; the flasks were then removed and incubated at room-temperature (RT) for seven days (RT incubation facilitated the conidiation of ∆srgA isolate C). Conidia were then harvested from the plates and analyzed microscopically.

Section 3.2.5 Galleria mellonella Infection Model G. mellonella larvae in the final instar stages were obtained from Vanderhorst, Inc (St.

Marys, OH). Twelve larvae per group, weighing between 250-350 milligrams, were inoculated with conidia from either wt A. fumigatus or one of the ∆srgA isolates. Five microliters of a 1 x 108 conidia/ml saline suspension (5 x 105 conidia) was injected into the last left pro-leg of each larva using a Hamilton syringe (Hamilton Company, Nevada). Two control groups were included, with six larvae per group; the saline controls were inoculated with five microliters of saline and the unmanipulated controls received no inoculum. All larvae were placed in petri dishes and incubated in the dark at 37°C for five days. Larvae were examined daily and mortality was defined as lack of movement upon physical stimulation. Survival rates were recorded using a

Kaplan-Meier survival curve and analyzed using a log-rank test, followed by a Holm-Sidak test for pairwise multiple comparisons (Sigma Stat 3.5).

Section 3.3 – Results and Discussion

Section 3.3.1 Identification of the Sec4 Homolog SrgA in A. fumigatus SrgA was previously identified in A. niger as one of five different secretion-related

GTPases thought to be involved in mediating different stages of vesicle transport [256]. The corresponding gene in A. fumigatus (AFUA_4G04810), encodes a 206 amino acid protein in which multiple Rab-family motifs are found. Included within these shared motifs are the five “G box” sequences, which are present in all small GTPase families [258]. As shown in Figure 21A, there is high sequence homology within these G box motifs between A. fumigatus SrgA and other previously characterized fungal Sec4 proteins. Conservation within the G2 domain is particularly noteworthy, as this region is the effector domain, responsible for functional specificity within the Rab GTPase family [256]. Also contributing to Rab GTPase function are two conserved C-terminal cysteine residues, which are post-translationally modified to allow for, and stabilize, the protein’s association with vesicle membranes [259].

To determine the intracellular localization of SrgA, the protein was tagged at its N- terminus with green fluorescent protein (GFP) and expressed in wild type (wt) A. fumigatus under the control of the gpdA promoter. As shown in Figure 21B, the GFP-SrgA fusion protein accumulated preferentially at hyphal tips, consistent with the putative role for SrgA in the regulation of apical vesicle transport in filamentous fungi.

Figure 21. Relationship between A. fumigatus SrgA and Sec4 homologs

A: Comparison of G-box motifs (G1-G5) and C-termini (C) from fungal Sec4 homologs in Saccharomyces cerevisiae (Sc), Schizosaccharomyces pombe (Sp), Candida albicans (Ca), Neurospora crassa (Nc)), Aspergillus niger (An), and Aspergillus fumigatus (Af). B: Intracellular localization of A. fumigatus SrgA. The SrgA protein was tagged at its N-terminus with GFP and expressed in A. fumigatus under the control of the gpdA promoter. Scale bar = 10 µm.

Section 3.3.2 Loss of SrgA Generates Phenotypic Heterogeneity in Colony Morphology A ΔsrgA strain was constructed by replacing the entire srgA coding region with a phleomycin-resistance cassette. The expected deletion was identified by probing HindIII- digested genomic DNA with a srgA 5’ flanking probe (probe A, Figure 22), revealing the loss of the wt 2.8 kb HindIII fragment and the appearance of the expected 10.3 kb fragment.

Figure 22. Deletion of srgA from A. fumigatus

Southern blot analysis of HindIII-digested genomic DNA using a probe located upstream of the srgA coding region (probe A) identified the predicted 2.8 kb fragment in wt A. fumigatus, which was lengthened to 10.3 kb in the ∆srgA mutant due to replacement of srgA with the phleomycin-resistance cassette (PHLEO).

The ΔsrgA mutant showed surprising phenotypic heterogeneity when plated for isolation on solid media, manifested by differences in colony size, the level of conidiation and colony sectoring (Figure 23A and B). Three distinct colonial morphologies were arbitrarily selected for further phenotypic analysis, using size and conidiation as a crude measure of individuality, hereafter referred to as ΔsrgA isolates A, B, and C (Figure 23C). Genotypic analysis by

Southern blot, using a probe that is upstream of the srgA open-reading frame (probe B, Figure

22) confirmed that each ΔsrgA isolate lacked the srgA gene (Figure 23D). Moreover, we could not recover wt conidia by plating the mutant onto non-selective media, suggesting that the mutants are not heterokaryons that are protected by wt nuclei. The presence of the phleomycin resistance cassette, in the absence of any detectable srgA gene was also confirmed by PCR in each of the ΔsrgA isolates (data not shown). Together, these findings suggest that deletion of srgA generates phenotypic diversity in colony morphology, possibly due to the activation of compensatory changes that were selected for based on their ability to improve fitness.

Figure 23. Loss of SrgA is associated with diverse colony morphology

A: Conidia harvested from the initial monoconidial ∆srgA mutant produced a heterogeneous population of colonies when spread for isolation. B: Colony sectoring was observed in ∆srgA isolates (shown here, isolate- A). C: Three individual ∆srgA isolates (A-C) were selected from the heterogeneous population shown in panel A. D: Southern blot analysis of HindIII-digested genomic DNA using a probe located upstream of the srgA coding region (Figure 2, probe B) identified the predicted 2.8 kb fragment in wt A. fumigatus, which was lengthened to 10.3 kb in the ∆srgA isolates due to replacement of srgA with the phleomycin-resistance cassette. 10kb

Section 3.3.3 Loss of SrgA Impairs Conidiation The decreased pigmentation of all ΔsrgA colonies suggested that loss of SrgA reduces the efficiency of asexual development. Consistent with this, dysmorphic conidiophores were observed in all three of the ∆srgA mutant isolates; the vesicle was attenuated in size and the phialides were irregularly shaped, often appearing swollen at the base (Figure 24A). In contrast to wt conidia, which formed uniform spheres approximately 2 µm in diameter, the conidia that were released from ΔsrgA colonies were heterogeneous in size, ranging from 2- 5 µm in diameter (Figure 24B). In addition, all three mutant isolates produced oval and tear-drop shaped conidia, some of which may represent the abnormal release of phialides from the mutant conidiophores rather than true conidia (Figure 24B, arrow). Despite this aberrant morphology, all of the mutant conidia were viable and germinated normally in liquid culture (data not shown).

The abnormal conidiation observed in ΔsrgA colonies could not be rescued by osmotic

62 stabilization of the medium with sorbitol (data not shown). Moreover, none of the ΔsrgA isolates showed increased sensitivity to the cell wall-targeting antifungal agent, caspofungin (data not shown). Combined, this data suggests that the observed reduction in conidiation is not due to a major defect in cell wall integrity.

Figure 24. Loss of SrgA impairs conidiation

A: All three ΔsrgA isolates have attenuated conidiophores and dysmorphic phialides (normal phialides are shown by the arrow in wt). B: All three ΔsrgA isolates release conidia that are heterogeneous in both size and shape. Some of the elongated conidia may be abnormal phialides that are released along with the conidia (arrow) (Scale bar = 20 µm).

The aberrant conidiophores in the ΔsrgA mutant suggested that SrgA may be localized at the site of conidia production. This was confirmed by analysis of GFP-SrgA localization during sporulation. As shown in Figure 25, the GFP-SrgA fusion protein localized to a distinct spot at the apex of young developing conidiophores, which progressively expanded to include the entire vesicle in mature conidiophores. Taken together, these findings suggest that SrgA plays a role in the developmental program, presumably by maximizing the efficiency of vesicle delivery to the developing conidiophore.

Figure 25. Localization of GFP-SrgA to the conidiophore

GFP-SrgA localizes to the apex of both hyphae and conidiophores. A punctate accumulation at the tip is seen in both hyphae and the early stages of vesicle swelling (top and middle rows, respectively), but a more diffuse localization is evident in mature conidiophores (bottom row). Left column: brightfield; Middle column: GFP fluorescence; Right column: Merged image.

Section 3.3.4 Loss of SrgA Impairs Hyphal Growth All three ∆srgA isolates were growth impaired at temperatures ranging from 30°C to

45°C. However, the extent of growth inhibition was variable between strains (Figure 26). For example, isolate C grew more slowly than the other two isolates at 30°C. However, at 37°C, isolate C grew at the same rate as isolate A, and only slightly slower than isolate B. At 45°C, all three strains grew at distinctly different rates, with isolate A being the most growth impaired.

This phenotypic heterogeneity is consistent with the notion that each mutant harbors a different compensatory response to the loss of srgA, which impacts the ability of the organism to grow at different temperatures.

Figure 26. Loss of SrgA impairs hyphal growth

Equal numbers of conidia were plated on the center of a plate of solid AMM and colony diameter was measured every day during a four-day incubation period at the indicated temperatures. The experiment was performed in triplicate and the values represent the mean + SEM.

Section 3.3.5 Deletion of srgA Alters Susceptibility to ER Stress Mutations that adversely affect homeostasis of the secretory pathway are often associated with heightened sensitivity to agents that cause endoplasmic reticulum (ER) stress, such as dithiothreitol (DTT) and tunicamycin (TM) [177]. We found that loss of srgA was associated with hypersensitivity to DTT, but only in isolate C (Figure 27A). Similarly, isolates A and C were hypersensitive to TM, but isolate B was not (Figure 27B). However, all three isolates were hypersensitive to the ER stress-inducing agent brefeldin A (BFA) (Figure 28). It is likely that the shared hypersensitivity to BFA, relative to the more variable responses to DTT and TM, reflects differences in the mechanism by which each agent disrupts ER homeostasis.

DTT and TM induce generalized protein folding stress by interfering with disulfide bonds and N- linked glycosylation, respectively [177]. Thus, the divergent responses of the three ∆srgA isolates to DTT and TM may be due to the different compensatory changes that each isolate has undergone in order to mitigate the loss of SrgA function. By contrast, BFA disrupts vesicle trafficking between the ER and the Golgi [242]. Since Sec4 homologs also regulate vesicular trafficking [148], we speculate that BFA treatment in the absence of srgA is a more difficult obstacle to overcome by compensatory mechanisms because it induces a critical defect in vesicle trafficking homeostasis that is incompatible with growth.

Figure 27. Sensitivity of ∆srgA to ER stress

A: Equal numbers of conidia were added to individual wells of a 24-well plate containing liquid AMM media and the indicated concentrations of dithiothreitol (DTT). Plates were incubated at 37°C for three days, after which the mycelial biomass that was adhered to the plate surface was stained with methylene blue and photographed. B: Equal numbers of conidia were inoculated onto solid AMM media containing either the vehicle control (DMSO) or 100 µg/ml tunicamycin (TM) and incubated for three days at 37°C.

------Figure 28. Sensitivity of ∆srgA to brefeldin A

Equal numbers of conidia were inoculated onto solid AMM media containing the indicated concentrations of brefeldin A (BFA) and incubated for three days at 37°C.

Section 3.3.6 Loss of srgA Alters Virulence The virulence of each ΔsrgA isolate was tested in a Galleria mellonella infection model.

G. mellonella larvae present multiple advantages for the study of A. fumigatus pathogenesis.

Their ease of use in the laboratory provides a high through-put screening system to compare virulence of multiple fungal strains, which can be completed at a wide range of incubation temperatures, including 37°C [260]. Additionally, the larvae do not have to be immunosuppressed in order to allow initiation of an A. fumigatus infection, which allows fungal pathogenesis to be studied in the context of an intact immune system [261,262]. Finally, while there are some stains with discrepancies between murine and larval models [263], there is still a relatively strong correlation between virulence phentoypes of A. fumigatus mutant strains studied using these models [261]. As such, G. mellonella larvae are being used with increasing frequency for the study of A. fumigatus pathogenesis [262].

In this study, conidia from wt or one of the ∆srgA isolates were injected into the last pro- leg of sixth instar G. mellonella larvae and survival was monitored over five days. As shown in

Figure 29, the ΔsrgA isolate C had attenuated virulence relative to wt A. fumigatus. However, isolates A and B were statistically indistinguishable from wt, indicating there is also diversity among ΔsrgA isolates with respect to virulence-related attributes.

Figure 29. Analysis of ∆srgA virulence in an insect model of A. fumigatus infection

Groups of 12 G. mellonella larvae were infected with conidia from the indicated strains. Larvae were incubated at 37°C and mortality was monitored over a five day period. Kaplan-Meier survival curves were compared using a log-rank test, followed by a pairwise multiple comparison test (Homl-Sidak). The ∆srgA isolate C survival curve is statistically different from wt, but isolates A and B were indistinguishable from wt.

Section 3.3.7 Reproducibility of Phenotypic Heterogeneity Among ΔsrgA Isolates The discordant phenotypes observed between individual isolates of the A. fumigatus

ΔsrgA mutant suggested that the deletion of srgA selects for the acquisition of compensatory changes, such as second-site mutations. This complicates the interpretation of complementation studies, since the reconstitution of srgA into the three ΔsrgA isolates is unlikely to correct the phenotypic heterogeneity because each isolate would still harbor unknown and potentially unique mutations in related pathways. Thus, in order to confirm that the observed phenotypic diversity was indeed associated with deletion of srgA, we used an approach employed when gene reconstitution was unsuitable for other fungal mutants [264], in which a second, independently-generated ΔsrgA strain (∆srgA-2) was characterized. Similar to the original ΔsrgA strain (∆srgA-1), ΔsrgA-2 revealed colony heterogeneity (Figure 30A). Based on morphological similarities to the previous ΔsrgA-1 isolates, three ΔsrgA-2 isolates were selected (A, B, and C) and tested under in vitro growth conditions. All ΔsrgA-2 isolates were growth impaired to the same extent as the ΔsrgA-1 isolates (Figure 30B). In addition, we identified phenotypic divergence in the sensitivity of the three ΔsrgA-2 isolates to both BFA and

DTT, similar to what was observed in the ΔsrgA-1 isolates (Figure 30C and D). The observation that phenotypic heterogeneity occurs in two independently isolated ΔsrgA mutants suggests that loss of srgA is the predisposing factor for A. fumigatus to undergo additional alterations to mitigate the effects of srgA deficiency.

Figure 30. Phenotypic heterogeneity is a reproducible phenotype associated with srgA deletion

A second transformation was performed in order to obtain another, independently isolated ΔsrgA mutant (ΔsrgA-2). A: The ∆srgA-2 mutant showed the same colony heterogeneity as the original ∆srgA shown in Fig. 3. B: Three different isolates of ∆srgA-2 were spotted onto AMM and incubated at 37°C for four days. Radial growth rate was determined by measuring colony diameter after the first 24 hours of incubation. *Statistically significant by Student’s T-test (p<0.001). C: Equal numbers of conidia were inoculated onto solid AMM media containing increasing concentrations of brefeldin A (BFA) and incubated for two days at 37°C. D: Equal numbers of conidia from the three isolates of ∆srgA-2 were added to individual wells of a 24-well plate containing liquid AMM media and the indicated concentrations of dithiothreitol (DTT). Plates were incubated at 37°C for three days, after which the mycelial biomass that was adhered to the plate surface was stained with methylene blue and photographed.

Section 3.4 – Summary

In this study we deleted the A. fumigatus srgA gene, encoding a Rab GTPase homolog that is closely related to Sec4. The most striking finding was that srgA deletion was associated with phenotypic heterogeneity, which was manifested by distinct colony morphologies and variable responses to both in vitro and in vivo stress conditions.

Phenotypic variability was not observed in the corresponding mutant in A. niger, [256] suggesting fundamental differences between the two species with respect to the response to SrgA deficiency. This phenotypic variation was also not observed in the A. fumigatus parental strain used in this study, nor in other mutants that have been generated on the same genetic background [179,265,266], which implicates the loss of srgA as the predisposing factor for these diverse phenotypes. It is worth noting that the frequency of homologous targeting was very low for this gene; only two ΔsrgA mutants were identified in a screen of approximately 100 transformants from two genetic backgrounds (kuA and CBS 144.89). This is consistent with the notion that the loss of srgA creates a severe phenotypic defect, possibly lethality, which selects for suppressor mutations to compensate for the defect. We speculate that one or more such mutations have occurred within each of the ∆srgA isolates, which improves the fitness of the fungus beyond that of the original ∆srgA strain. These could be multi-copy suppressors derived from other members of the Rab GTPase family, or mutations in genes in related pathways that can partially compensate for the absence of SrgA. Unfortunately, while genetic models to identify suppressor mutations are well established in yeast, and have been previously used to discover suppressors of Rab GTPase mutants [267-274], such techniques are poorly developed in A. fumigatus. Therefore, secondary mutations that

72 may be contributing to the phenotypic heterogeneity of the ∆srgA isolates remain to be identified.

Despite the heterogeneity among ∆srgA isolates, all of them shared the same phenotype of reduced radial growth rate and abnormal conidiation. This finding is consistent with the defects in polarized growth and sporulation reported for srgA- disruption mutants in A. niger [256]. Interestingly, only one of the three A. fumigatus

ΔsrgA isolates had attenuated virulence, making it unclear whether it is the loss of srgA or associated compensatory mutations that contribute to reduced pathogenicity in this model. However, since the three isolates grow at the same rate in vitro, the observed reduction in pathogenicity is not simply due to a slower growth rate. Rather, attenuated virulence correlated more closely with stress response: the ∆srgA isolates that exhibited a superior ability to adapt to in vitro stress showed wt virulence, whereas the isolate with the least resistance to in vitro stress had attenuated virulence.

The findings from the current study demonstrate that A. fumigatus is capable of surviving without SrgA-specific functions. However, the unexpected phenotypic heterogeneity that accompanies the loss of SrgA suggests that a variety of mechanisms are triggered to compensate for the absence of SrgA, some of which may be suppressor mutations. Future studies to elucidate these compensatory changes may provide important insight into networks that support homeostasis of the secretory pathway in this important fungal pathogen.

Chapter IV: UPR

Mutation within the IreA Kinase Domain Alters in vitro Growth and Stress Responses of

Aspergillus fumigatus but Does Not Affect Virulence in an Insect Model of Invasive

Aspergillosis

Margaret V. Powers-Fletcher, Xizhi Feng, Karthik Krishnan and David S. Askew

Department of Pathology & Laboratory Medicine, University of Cincinnati College of Medicine, 231 Albert Sabin Way, Cincinnati, OH 45267-0529

Key words: A. fumigatus, IreA, kinase, UPR

Section 4.1 – Background

Concurrently with our investigation into how secretory homeostasis mechanisms such as

ERQC and vesicle transport contribute to the pathogenesis of A. fumigatus, our laboratory continued to build upon our novel finding that the UPR was required for full virulence of this important fungal pathogen. This conclusion was based on analysis of a mutant strain lacking the transcriptional regulator of the UPR, HacA (ΔhacA) [179]. For a more complete understanding of this pathway’s significance to A. fumigatus physiology and pathogenesis, we next targeted the upstream stress sensor and master regulatory of the UPR, IreA.

Ire1/IreA is a bifunctional enzyme with an ER-lumenal domain and a cytosolic region containing a protein kinase domain linked to an endoribonuclease (RNase) domain (Figure 32)

[275]. Studies in yeast show that oligomerization and trans-autophosphorylation of Ire1 in the plane of the ER membrane activates the RNase domain, which catalyzes the cytoplasmic splicing of an unconventional intron in the hac1 mRNA [173-175]. Removal of this intron results in a frame-shift that allows the translation of the master transcriptional regulator of the UPR, known as Hac1i in yeast and HacAi in A. fumigatus (i for induced) [176]. Hac1i/HacAi translocates to the nucleus and up-regulates the transcription of multiple UPR target genes, encoding proteins involved in protein folding, degradation, and vesicular transport [177,178].

Deletion of the genes encoding either of the two regulators of this pathway, Ire1 and Hac1, does not substantially impair the growth and viability of S. cerevisiae under standard laboratory conditions [178-180] suggesting that the UPR has minimal influence on yeast cell physiology as long as the organism is not under severe ER stress.

Figure 31. Schematic of Expanded Functions of IreA

Canonical UPR in S. cerevisiae: ER stress triggers a linear pathway in which activation of Ire1 through Hac1i to restore homeostasis. B) Expanded UPR in A. fumigatus: Not only does IreA act through HacAi to restore homeostasis, but also functions through HacA-independent mechanism to regulate A. fumigatus biology. Additionally, HacA functions in an IreA-independent manner, likely through activity of HacAu.

In contrast, our laboratory has recently discovered that the Ire1 homolog in A. fumigatus,

IreA, has a major role in the regulation of basal fungal physiology, even in the absence of ER stress, as well as contributing to both virulence and antifungal drug susceptibility [266].

Moreover, in contrast to the single linear UPR pathway identified in yeast, we have shown that

A. fumigatus IreA has both HacA-dependent and HacA-independent functions, that latter of which comprises the major activity of this molecule during normal filamentous growth [266].

This suggests that not only does A. fumigatus rely more heavily on the UPR than does S. cerevisiae, but also that IreA functions expand beyond the canonical IreA-HacA pathway to support the expression of virulence attributes of A. fumigatus (Figure 31) [266]. As such, we believe that the IreA-mediated UPR is a point of vulnerability within A. fumigatus physiology that could serve as a novel and effective target for potent antifungal drug therapy.

In order to better understand how the expanded functions of IreA support the pathogenesis of A. fumigatus, and subsequently identify the most effective means of inhibiting these functions, our laboratory has begun a series of mutational analyses of key domains within this master regulator. Reconstitution of a ireA strain with an IreA mutant construct in which a portion of the endoribonuclease domain had been deleted (ireA::ireA10), thus abolishing

RNase activity, partially rescued the ∆ireA phenotype; the ireA::ireA10 mutant was only attenuated in virulence in contrast to the ireA strain’s avirulence and was less susceptible to in vitro stresses as compared to ireA [266]. This data strongly suggests that IreA is contributing to virulence-related attributes of A. fumigatus through a mechanism that is independent of its

RNase activity.

The most likely candidate for this RNase-independent role is the second of IreA’s enzymatic domains, the kinase domain. The role of the IreA kinase has not been previously studied in A. fumigatus, nor in any other pathogenic filamentous fungus. However, experiments to determine the structural basis for kinase activity have been performed in both yeast and humans [162,276-280]. Although such studies have provided important insight into the molecular function of Ire1, they are unable to provide insight into mechanisms of pathogenesis in A. fumigatus, a problem that is further compounded by fundamental differences between the yeast, A. fumigatus and human UPR pathways. For example, yeast Ire1 directs a single linear

IreA-HacA pathway, A. fumigatus IreA controls at least two independent pathways, and human

Ire1α is only one of three ER stress sensors with overlapping functions [159,266]. The ability to design effective antifungal therapy against the IreA protein will require a comprehensive understanding of how this molecule influences the expression of pathogenicity in A. fumigatus.

The purpose of this final chapter was to begin to evaluate, for the first time, how modifications of the kinase domain in A. fumigatus affect the organism’s biology, virulence and antifungal drug susceptibility.

Section 4.2 – Materials and Methods

Section 4.2.1: Culture Conditions Conidia were harvested from strains grown on OSM plates (Aspergillus minimal media

(AMM) [226] containing 10 mM ammonium tartrate and osmotically stabilized with 1.2 M sorbitol). Unless otherwise noted, all experiments were conducted at 37°C.

For analysis of hyphal radial growth at different temperatures, conidia were spot-plated onto the surface of a plate containing AMM and radial growth was monitored over a five-day incubation period at 30°C, 37°C, or 45°C. The rate of radial growth was calculated as the colony diameter on day five minus the initial colony diameter after the first 24 hours of incubation divided by the incubation period. For analysis of growth under conditions of metal ion depletion,

3000 conidia/well were inoculated into a 24-well plate containing liquid AMM with the indicated concentration of EDTA and incubated at 37°C. Hyphae adhered to the bottom of the well were photographed using brightfield microscopy.

Voriconazole susceptibility was determined using the Etest antifungal susceptibility kit

(AB BIODISK) according to the manufacturer’s instructions, with the following modifications.

One million conidia were spread evenly onto the surface of a 100 mm plate of AMM agar using a glass rod. The inoculated agar surface was allowed to dry for approximately one hour before

Etest strips containing voriconazole were applied. The plates were incubated at 37°C for 48 hours. The minimal inhibitory concentration was read as the lowest drug concentrations at which the border of the elliptical inhibition zone intercepted the scale on the antifungal strip.

Section 4.2.2: Site-Directed Mutagenesis of the IreA Kinase Domain Primers used in this study are listed in Table 3. Generation of the ireAD858A mutant construct was accomplished by mutating the nucleotide sequence encoding amino acid 858, an aspartic acid, to encode a new amino acid, alanine, using the Quickchange XL site-directed mutagenesis system (Stratagene). Previously the ireA gene, including 550 bp upstream of the

ATG start site was PCR-amplified from wt genomic DNA using primers 647 and 650 and cloned into pCR-Blunt II-TOPO (Invitrogen) to generate plasmid 564. Next, p564 was used as a template for site-directed mutagenesis using mutagenic oligonucleotides 880 and 881 according to the manufacturer’s recommendations. Sequence analysis of the resulting plasmid (p633) confirmed the accuracy of the mutation. The ireA::ireAD858A (IreAD858A in text or D858A in figure legends) strain was constructed by transforming the plasmid into ireA protoplasts as previously

78 described [266]. Based on previous data from analysis of a ∆ireA::gpda-hacAi mutant, we knew the ∆ireA strain regained the ability to grow at 42°C after reconstitution of the HacAi-mediated

UPR. Based on studies in yeast, we expected the IreAD858A protein to retain its HacA-splicing capacity [277]. Therefore, we used growth at 42°C to inhibit background, untransformed ∆ireA colonies and select for positive ∆ireA::ireAD858A transformants. Successful integration of the ireAD858A expression cassette was confirmed by PCR sequencing of genomic DNA isolated from selected transformants.

Section 4.2.3: Analysis of hacA mRNA Splicing by RT-PCR To determine the level of hacA mRNA splicing in the IreAD858A mutant compared to wt A. fumigatus, equal numbers of conidia (3 x 104) were inoculated into 20ml of liquid YG and incubated overnight at 37°C with shaking (200 rpm). After overnight incubation, 1mM DTT was added to the cultures, or equal volume sdw in the untreated control, to induce hacA mRNA splicing above basal levels. Cultures were incubated for an additional hour, after which biomass from all samples was filtered through miracloth and washed using fresh YG to remove any residual DTT. The biomass was immediately dried and frozen at -20°C for storage. The biomass was then thawed, re-dried, and RNA was prepared by crushing the mycelium in liquid nitrogen and resuspending in TRI reagent LS (Molecular Research Center, Cincinnati OH). One microgram of the total RNA was reverse-transcribed with AMV reverse transcriptase using oligo-

(dT)18 primer. The first-strand cDNA was then used as a template for PCR using primers 717 and 718, which flank the unconventional intron in the hacAu sequence. The PCR products were fractionated on a 1% agarose gel and stained with ethidium bromide.

Table 3. PCR primers used in IreA kinase study

Primer Gene Sequence (5’-3’) 642 ireA GGTCTGCCTCGCGTTATTTC 647 ireA CGACGTTGTAGCTTTTCACC 651 ireA GAAGCATCTCGATCACGGTC 717 hacA TCCATTTCCCACTCCCTCA 718 hacA GGATGAATCACCGTTGAATAGG 880 ireA CGGCTGCTCATCTCTGCCTTTGGTCTATGCAAG 881 ireA CTTGCATAGACCAAAGGCAGAGATGAGCAGCCG

Section 4.2.4: Azocoll Assay Equal numbers of conidia (3 x 104) were incubated in 50ml of a salt solution + 10% FBS liquid medium for 72 hours at 37°C with shaking (200rpm). After incubation, one milliliter samples (three per strain) of supernatant were removed from the culture and microcentrifuged to remove any biomass. Fifteen microliter aliquots were taken from each sample and added to

2.4 ml of pre-washed, Azocoll beads (Azo dye-impregnated collagen) resuspended in TSA buffer. The Azocoll mixtures were incubated at 37°C for three hours with shaking (350 rpm), after which they were centrifuged for 10 minutes at 4500 rpm. Using buffer alone as a reference, absorbance at 595 nm was read using 1 ml of the Azocoll supernatant. Absorbance values were normalized according to total biomass collected from each culture, which was dried using vacuum/heat and weighed.

Section 4.2.5: G. mellonella Infection Model G. mellonella larvae in the final instar stages were obtained from Vanderhorst, Inc (St.

Marys, OH). Twelve larvae per group, weighing between 250-350 milligrams, were inoculated with conidia from either wt A. fumigatus or one of the ∆srgA isolates. Five microliters of a 0.85 x

108 conidia/ml saline suspension (4.25 x 105 conidia) was injected into the last left pro-leg of each larva using a Hamilton syringe (Hamilton Company, Nevada). A control group, made up of five larvae, received an inoculum of saline (5 μl). All larvae were placed in petri dishes and incubated in the dark at 37°C for six days. Larvae were examined daily and mortality was

80 defined as lack of movement upon physical stimulation. Survival rates were recorded using a

Kaplan-Meier survival curve and analyzed using a log-rank test, followed by a Holm-Sidak test for pairwise multiple comparisons (Sigma Stat 3.5).

Section 4.3 – Results and Discussion

Section 4.3.1: Generation of a Kinase Domain Mutant Strain Because no studies have yet been performed on the A. fumigatus IreA kinase, we used data from S. cerevisiae as a rational foundation for targeted mutagenesis of the IreA kinase domain. The DFG (Asp-Phenyl-Gly) motif is a conserved sequence found within the activation loop of many kinases (Figure 32) [281]. It is thought to play an important role in regulating kinase activity, largely due to its involvement in ATP and Mg2+ binding within the kinase pocket

[277]; as a result, the DFG motif is often the target for kinase inhibitors [282-285]. Recent studies in yeast have demonstrated that modifying this motif can uncouple the Ire1 kinase activity from the activation of the RNase domain, thus providing a unique opportunity to evaluate kinase activity independently of RNase activity [277]. To determine the effect of the corresponding mutation in IreA on A. fumigatus biology and virulence, we used site-directed mutagenesis to replace the aspartic acid residue of the conserved DFG kinase motif within the activation segment of IreA with an alanine residue (IreA-D858A), as described in the Materials and Methods section. Based on yeast Ire1 crystal structure, it is thought that this mutation, due to the vast difference in charge and steric hindrance associated with aspartate and alanine, disrupts the conformation of the deep pocket within the kinase activation loop [277].

Figure 32. Sequence comparison of Ire homologs

Top - Schematic of the predicted domains of IreA: signal peptide (SP), lumenal domain, transmembrane domain (TM), kinase domain, and kinase extension nuclease (KEN) domain.

Bottom – Multiple sequence alignment of the protein kinase and KEN domains of Ire1 sequences:

Tree = Trichoderma reesei Afum = A. fumigatus Aory = Aspergillus oryzae Hsap = Homo sapiens Scer = S. cerevisiae

The predicted KEN domain is underlined; the 10 amino acid deletion in the ireA∆10 mutant is indicated by the asterisk and the conserved DFG motif in the kinase domain is indicated with a red star.

Adapted from: Feng X, Krishnan K, Richie DL, Aimanianda V, Hartl L, et al. (2011) HacA-Independent Functions of the ER Stress Sensor IreA Synergize with the Canonical UPR to Influence Virulence Traits in Aspergillus fumigatus. PLoS Pathog 7(10): e1002330. Doi:10.1371/journal.ppat.1002330. (S1)

The ireAD858A construct, driven by its native promoter, was ectopically introduced into a previously generated ∆ireA strain [266] in order to determine if the mutant IreA protein could complement the severe ∆ireA in vitro phenotypes and loss of virulence. Successful integration of the ireAD858A gene (∆ireA::ireAD858A, referred to as IreAD858A in text or D858A in figure legends) was verified by PCR using primers within the left (primer 642) and right (primer 651) flanking regions of the gene, producing an approximate 2.8 kb band corresponding to the phleo deletion cassette of the ΔireA background and an approximate 4.8 kb band corresponding to the inserted ireAD858A (data not shown).

Section 4.3.2: The Endoribonuclease Domain of IreA Remains Active, Despite Mutation within the DFG Kinase Motif In S. cerevisiae, mutation of the conserved DFG kinase motif does not inhibit hac1 mRNA splicing, indicating that the endoribonuclease domain remains active in this mutant protein [277]. To determine how this same mutation in A. fumigatus IreA affects regulation of the endoribonuclease, we analyzed hacA mRNA splicing under basal and acute ER stress conditions. Similar to wt, we observed splicing of hacA mRNA in the IreAD858A mutant under both conditions, indicating functional RNase activity despite mutation within the kinase domain

(Figure 33). These results are critical to the analysis of this mutant’s phenotype, as any observed defects are likely due to disruption of the kinase domain rather than an impaired ability to activate the HacAi-mediated arm of the UPR.

Figure 33. HacA splicing in IreAD858A mutant

The hacA mRNA was amplified by RT-PCR using primers that span the 20 nucleotide unconventional intron and PCR products were separated 1% agarose gel stained with ethidium bromide. Two bands corresponding to hacAu and hacAi can be observed in both wt and the IreAD858A mutant under basal growth conditions and after treatment with DTT, demonstrating the endoribonuclease of IreA remains active despite mutation within the kinase domain.

Section 4.3.3: Mutation within the DFG Kinase Motif Reduces A. fumigatus Radial Growth and Impairs Conidiation at 45°C Complete loss of IreA results in severely attenuated growth of A. fumigatus within its optimal growth temperature of 37°C to 42°C; in fact, IreA is required for A. fumigatus growth at temperatures of 42°C and above [266]. This strongly suggests that IreA plays a key role in regulating the response to thermal stress of this highly thermotolerant organism. Interestingly, we found that while complementation of ∆ireA with IreAD858A largely rescued the thermotolerance of this strain, the IreAD858A mutant still grew at slightly slower radial growth rates compared to wt on both rich (YG) and minimal (AMM) media at 37°C and above (Figure 34A and data not shown). Moreover, we observed a severe conidiation defect in the IreAD858A mutant at 45°C (Figure 34B), suggesting that mutating the DFG kinase motif negatively affects IreA’s contribution to normal physiological functions at higher temperatures and implicates the IreA kinase in the regulatory processes required for the thermotolerance of A. fumigatus.

Figure 34. Temperature sensitive radial growth and conidiation of the IreAD858A mutant

A) Equal numbers of conidia were spot-plated onto solid AMM and incubated for four days at the indicated temperature. The radial growth rate of the IreAD858A is slightly reduced at temperatures of 37°C and higher compared to wt. B) Conidiation of the IreAD858A mutant is similar to wt at 37°C, but becomes substantially reduced under thermal stress (45°C).

A. B.

14 12 wt D858A

10 8 6

(mm/day) 4

2 Radial Radial GrowthRate 0 30 37 45 Temperature (°C)

The observed reduction in radial growth rate of the IreAD858A mutant contrasts the apparent lack of defect in the corresponding yeast mutant under basal laboratory conditions

[277]. Similar to our laboratory’s previous finding that A. fumigatus relies more heavily on the

UPR than yeast for normal growth, this suggest that a fully functional IreA kinase is in fact required for optimal growth of A. fumigatus under basal conditions whereas it is dispensable for yeast under similar conditions. We speculate that filamentous growth requires a greater dependence on IreA’s maintenance of secretory homeostasis, which is in part mediated by its kinase domain.

Section 4.3.4: Increased Collagenase Secretion in the IreAD858A Mutant Previously, our laboratory demonstrated that the UPR is required for regulation of the secretome [179]. To determine how mutation within the IreA kinase affected this regulation, we used an azocoll assay (Materials and Methods) as an indicator of secretory activity.

Surprisingly, we found an approximate two-fold increase in collagenase activity within the culture supernatant of the IreAD858A mutant as compared to wt (Figure 35). It is possible that this

85 increased activity is specific to collagenase and that mutation of the IreA kinase domain causes a dysregulation of collagenase secretion. However, it is more likely that this increased activity is representative of a more global dysregulation and that the secretion of multiple hydrolytic enzymes has been altered. We have observed such wide-spread affects in other UPR mutants, including the clxA mutant described in Chapter II of this dissertation, in which proteolytic activity profiles of culture supernatants indicated increased secretion of multiple protease by the mutant as compared to wt [286]. We reasoned that loss of quality control regulation within the

ER resulted in dysregulation of protein flux; it is possible that mutating the kinase domain of IreA results in similar loss of ER quality control and regulation. However, in a manner that is also similar to the clxA mutant, despite the IreAD858A mutant’s increased activity within the azocoll assay there were no additional defects of the mutant compared to wt when grown on skim milk agar or mouse lung tissue, suggesting that any alterations in secretion are not substantial enough to affect growth of the fungus on polymeric substrates.

Figure 35. Expression of the IreAD858A mutation increases secretion of collagenase

Conidia from the indicated strains were 0.7 inoculated in liquid cultures of AMM containing fetal bovine serum as the 0.6 sole carbon/nitrogen source. After incubation for 72 h at 37°C, the 0.5

collagenolytic activity of the culture supernatants was quantified using the 0.4 wt Azocoll assay, as described in D858A

Materials and Methods. The 0.3 Biomass) experiment was performed in triplicate 0.2 and the values represent the mean

A520/g (dry weight) ± SEM. The 0.1 Abs 520nm (Adjusted for (Adjusted Abs 520nm A520/g for the IreAD858A mutant is statistically different from wt by 0 Student’s t test (p < 0.01).

Section 4.3.5: Mutation with the DFG Motif Does Not Alter A. fumigatus Sensitivity to Acute ER Stress As the only ER stress sensor currently identified in filamentous fungi, it is not surprisingly that loss of IreA increases A. fumigatus sensitivity to acute ER stress conditions [266].

Interestingly, however, mutating the DFG motif within the kinase domain had no observable negative impact on A. fumigatus response to ER stress. Rather, the IreAD858A mutant grew similar to wt under all concentrations of tunicamycin (Tm), dithiolthreitol (DTT), and brefeldin A

(BFA) tested (data not shown). All of these compounds are known to induce acute ER stress, albeit through different mechanisms: Tm, by inhibiting N-linked glycosylation, impairs folding of glycoproteins within the ER [177]; DTT, as a reducing agent, disrupts the disulfide bonds required for obtaining and maintaining the proper folding state [177]; and BFA, as an inhibitor of

ER-Golgi vesicle transport, is thought to disrupt ER homeostasis by impairing both the clearance of properly folded proteins from the ER and the retro-grade recovery of folding machinery back to the ER [242]. Because of the extreme detriment any of these compounds could have on ER homeostasis, it is likely that there is overlapping support from all arms of the

UPR in order to maintain growth in their presence. Therefore, we speculate that the HacAi- mediated arm of the UPR (Refer to Figure 31) is able to compensate for any disruption in IreA kinase-mediated functions caused by the IreAD858A mutation. Consistent with this hypothesis, previous work in our laboratory has shown that over-expression of HacAi is able to rescue the growth of the ireA mutant under acute ER stress conditions [266].

Section 4.3.6: Increased Growth of the IreAD858A Mutant under Metal Ion Starvation Conditions The ∆ireA mutant had increased sensitivity to iron starvation, thought to be due to IreA’s role in transcriptional regulation of genes involved in siderophore-mediated iron acquisition and reductive iron assimilation [266]. However, the IreAD858A mutant grew similar to wt despite the presence of BPS, an iron-specific chelator, at concentrations more than three times the level used to completely inhibit the growth of ∆ireA (data not shown). To determine how IreAD858A mutant responded to a more global metal ion starvation condition, we next incubated the mutant and wt strain in liquid AMM containing increasing concentrations of the cation chelator, ethylene diamine tetraacetic acid (EDTA). Surprisingly, we found that the IreAD858A mutant actually grew

87 more than wt under increasing concentrations of EDTA (Figure 36). However, similar to what has been observed in other secretory mutants when grown under cation-depleted conditions

[286], the IreAD858A mutant grew with thick, club-like hyphae (Figure 36), suggesting that polarized growth was in fact impaired in this mutant under these conditions.

Figure 36. Mutation within the IreA kinase domain promotes growth in cation-depleted medium

Equal numbers of conidia from the indicated strains were inoculated into individual wells containing liquid AMM with the indicated concentration of EDTA and incubated at 37°C for four days.

Disruption of metal ion homeostasis can have multiple effects on the cell. Previously, our laboratory identified metal ion homeostasis and autophagy as interconnected components of fungal physiology. Disruption of autophagy due to loss of the key regulatory component, atg1, makes A. fumigatus hypersensitive to stress caused by the metal ion chelator, EDTA [227].

Interestingly, with the IreAD858A mutant, we observed the opposite phenotype. One possible explanation is that this mutation within the IreA kinase domain results in dysregulation or upregulation of autophagy in A. fumigatus. There is precedence for a regulatory role of IreA in autophagy, as both the mammalian and plant homologs of IreA have been shown to regulate their respective autophagy pathways. In fact, in both of these systems, Ire1’s contribution to autophagy regulation appears to be mediated by the kinase domain, independently of

XBP1/Hac1 splicing [287-289]. It is possible that the IreA kinase plays a similar role in regulating autophagy and that the IreAD858A mutation has altered its regulatory capacity, thus altering the organism’s response to conditions that require a functional autophagic response.

Section 4.3.7: The IreAD858A Mutant Displays Increased Resistance to Voriconazole One of the most striking, and clinically relevant, phenotypes of the ∆ireA mutant is its increased susceptibility to all three major classes of antifungal drugs [266]. To determine how mutations within the kinase domain might affect this susceptibility, we determined the minimal inhibitory concentration (MIC) of representative polyenes, azoles, and echinocandins for the

IreAD858A mutant using an Etest method. Surprisingly, while the MIC of amphotericin B and caspofungin remained unchanged between wt and the IreAD858A mutant, complementation of the

∆ireA mutant with IreAD858A actually increased its resistance to voriconazole to slightly beyond that of wt (Figure 37). While it is unlikely that this slight increase in resistance would have clinical significance, it suggests that mutation within the kinase domain of IreA does alter the organism’s response to this drug, which further emphasizes a role for IreA, and its kinase in particular, in antifungal response mechanisms.

Figure 37. The IreAD858A mutant shows slightly increased resistance to voriconazole

Voriconazole sensitivity was determined using the Etest method. Etest strips containing voriconazole were applied to AMM plates inoculated with equal amounts of conidia. The plates were incubated at 37°C for 48 hours. The lowest drug concentrations at which the border of the elliptical zone of inhibition intercepted the scale on the antifungal strip (MIC) was two-fold higher for the IreAD858A mutant. The experiment was repeated three times with similar results.

Slightly increased resistance to voriconazole has also been observed in other A. fumigatus UPR mutants, specifically the ∆hrdA mutant [265]. HrdA, an ubiquitin E3 ligase, is an important functional component of the ER-associated degradation (ERAD) complex responsible for ubiquitinating misfolded proteins and targeting for them for degradation by the proteasome.

One of the client proteins degraded through this pathway is HMG-CoA reductase. As a negative feedback loop for the regulation of sterol and membrane biosynthesis, HMG-CoA reductase is targeted for degradation through ERAD when sterols begin to accumulate within the cell [290].

In the context of diminished ERAD function, specifically loss of HrdA, HMG-CoA reductase degradation decreases, artificially pushing intermediates through the sterol biosynthetic pathway despite sufficient cellular sterol levels [291]. We speculated that this increased flux through the ergosterol biosynthesis pathway primes the mutant strain to be slightly more resistant to drugs targeting this pathway. Interestingly, the similarly increased resistance to voriconazole of the

IreAD858A mutant suggests that the alteration of the DFG kinase motif results in a similar

90 dysregulation within the pathway. Consistent with this hypothesis, our laboratory previously reported the increased expression of mRNAs encoding genes upstream of squalene in the ergosterol biosynthesis pathway in the ireA mutant, including that of HMG-CoA reductase

[266]. While this could be due to compensatory up-regulation, it was not observed in the hacA mutant, suggesting that the phenotype is mediated by IreA in a HacA-independent manner.

Combined with this data, the results from the current study suggest that the IreA kinase contributes to the negative regulation of HMG-CoA reductase and that mutation in the DFG kinase motif alters IreA’s ability to act in this capacity.

Section 4.3.8: Mutation within the DFG Motif Does Not Decrease A. fumigatus Virulence in an Insect Model of IA IreA is required for virulence of A. fumigatus in an animal model of invasive aspergillosis

[266]. To determine the role the DFG kinase motif plays in IreA’s contribution to A. fumigatus pathogenic potential, we compared the virulence of the IreA mutant strains using an insect model of IA. Similar to what was observed in a murine model, the virulence of the ∆ireA strain was severely attenuated in G. mellonella. In sharp contrast, the IreAD858A mutant was equally virulent as wt (Figure 38). Similar to its response to acute ER stress, it is likely that multiple arms of the UPR provide overlapping support for virulence; defects in one arm can be compensated by up-regulation of another arm. Therefore it is possible that any disruption caused by the mutation within the kinase domain is not detrimental enough to affect IreA’s overall contribution to pathogenicity. Again, consistent with this hypothesis, we have shown that overexpression of HacAi fully rescues the virulence of the ireA strain in a murine model of invasive aspergillosis [266].

Figure 38. Analysis of IreAD858A virulence in an insect model of A. fumigatus infection

Groups of 10 G. mellonella larvae were infected with conidia from the indicated strains. Larvae were incubated at 37°C and mortality was monitored over a seven day period. Kaplan-Meier survival curves were compared using a log-rank test, followed by a pairwise multiple comparison test (Homl-Sidak). The ΔireA survival curve is statistically different from wt, but the IreAD858A mutant is indistinguishable from wt.

100 90 80

70 60 saline 50 wt 40

Survival Survival (%) delta-ireAΔireA 30 D858A 20 10 0 0 2 4 6 8 DPI

Section 4.4 – Summary

In this study, we generated a mutant version of IreA, in which the conserved DFG motif within the activation loop of the kinase domain had been altered, and ectopically expressed it in an ∆ireA background (∆ireA::ireAD858A, referred to as IreAD858A). Interestingly, while the IreAD858A mutant responded in a similar manner as wt to many in vitro stress conditions, there were key differences observed in the mutant. Mutation within the kinase domain resulted in slightly decreased radial growth rates and impaired conidiation at higher temperatures. Interestingly, the

IreAD858A mutant was more resistant to metal ion chelation, as well as displaying slight but consistent increased resistance to voriconazole. Because the mutant protein retains its endoribonuclease activity, as determined by hacA mRNA splicing capacity, it is likely that these changes in in vitro phenotype are due to the alteration of the kinase domain, independent of its role in regulating the RNase domain.

Importantly, we found that complementation with the IreAD858A construct fully recovered the virulence of the ireA strain, demonstrating that this mutation does not cause sufficient disruption of the UPR to decrease its pathogenic potential. It is likely that the HacA-dependent arm of the UPR is able to compensate for any disruptions in IreA-dependent UPR functions that this kinase mutation may have caused. This information is vital for future anti-IreA drug development studies, as it suggests that the most potent IreA-targeting antifungal drugs will be ones that disrupt all arms of the UPR by inhibiting both the kinase and RNase domain activities.

The goal of such dual targeting would be to prevent compensation by active arms of the UPR, thus alleviating potential resistance mechanisms. Future studies will be dedicated to continuing to learn about the regulatory mechanisms and function of IreA to better understand its contribution to fungal pathogenesis and facilitate future UPR-targeting antifungal drug design.

Chapter V: Discussion and Future

Directions

Section 5.1 – Summary

The work presented in this thesis is the first to demonstrate that A. fumigatus is able to survive targeted deletion of the key secretory homeostasis components calnexin, a lectin chaperone involved in the first stages of glycoprotein ERQC, and SrgA, a mediator of distal vesicle transport. Additionally, this thesis contributes novel data to the field of medical mycology supporting a role for the IreA kinase in regulating A. fumigatus biology independently of its endoribonuclease activity. Combined, these findings provide us with important insight into the robust and complex nature of the physiological characteristics contributing to the growth and virulence of this dangerous opportunistic fungal pathogen.

ΔSection 5.2 – Maintenance of Secretory Homeostasis is a Pathogenic

Determinant of Aspergillus fumigatus

Our current understanding of the microbial determinants of A. fumigatus pathogenesis suggests that this is an emergent property which cannot be broken down into individual components [292]. Instead, A. fumigatus pathogenesis is a complex and multifactorial attribute that relies on the coordinated activity of multiple gene products to support virulence [81,293].

Furthermore, the majority of molecules shown to contribute to pathogenesis appear to have dual-use purposes, meaning they have developed to support growth within the natural ecological niche of decaying vegetation but serve an additional function of supporting virulence of this opportunistic pathogen [88]. The data presented in this thesis, combined with additional reports from our laboratory, suggest that maintenance of secretory homeostasis is a pathogenic determinant of A. fumigatus. Specifically, it suggests that there is significant redundancy in the pathways that support secretory homeostasis and that the UPR likely serves as a broad- spectrum compensatory mechanism, which allows it to fulfill the dual functions of contributing to both in vitro stress responses and virulence.

Section 5.2.1 The UPR is a Broad-Spectrum Compensatory Response to Homeostasis Perturbations Based on the key roles calnexin and SrgA play in ERQC and distal vesicle transport respectively, it is surprising that A. fumigatus remains viable despite their absence. However, we do not think that this suggests that these proteins, and the pathways to which they contribute, are unimportant to A. fumigatus. Rather, we speculate that this cellular robustness, or the ability to maintain pathway function despite genetic disruption, indicates a highly developed secretory homeostasis network upon which A. fumigatus relies. Such a network would compensate for loss of individual components within the secretory pathway, allowing for maintenance of growth and viability under normal conditions.

Recently, using the model fungal organism S. cerevisiae, Thibault et. al. proposed that the UPR functions as such a broad-spectrum compensatory mechanism. By screening S. cerevisiae mutant libraries, researchers identified 4,900 mutant genes that were synthetically lethal with UPR mutation [294]. This finding was significant for the field, as it demonstrated that a vast number of “non-essential” genes would be essential if not for the compensatory effect of

UPR activation [294]. We speculate that the UPR plays a similar role in A. fumigatus and is, at least in part, responsible for the sustained viability of the ΔclxA and ΔsrgA mutants. Consistent with this hypothesis, we detected statistically increased levels of bipA mRNA (indicating UPR activation) in ΔclxA and ΔsrgA mutants without applying exogenous ER stress, suggesting that deletion of these proteins triggers UPR compensatory action and that this action is sufficient to support growth and viability under basal conditions (Figure 39).

Figure 39. Up-regulation of the UPR in ERQC and Vesicle Transport Mutants

RNA was extracted from cultures of the indicated A. fumigatus strains after an 6 overnight incubation in YG at 37°C (200 rpm). Reverse transcription of RNA and the qPCR reaction to determine bipA 5

transcript levels were performed as

previously described [193], and Ct values

4 were obtained using Smart Cycler mRNA) software (v 2.0). The relative changes in

bipA 3 gene expression were calculated with the ( comparative Ct method, using tubulin as 2 the endogenous control and KuA wt as the reference sample. Data represent the average of three samples ± standard 1 FoldChange deviation. Using a Student’s t-test, the difference between KuA wt and ΔsrgA C is 0 statistically significant (p < 0.005), as is the KuA wt ΔsrgA C H237 wt ΔclxA difference between H237 wt and ΔclxA (p < 0.05).

Similarly, related work in our laboratory investigating a role for protein degradation in the biology and virulence of A. fumigatus revealed that the UPR also supports growth after loss of key ER-associated degradation (ERAD) components. Combined disruption of both the UPR and

ERAD via gene deletion caused more severe in vitro growth defects than either single mutant alone. Furthermore, the double UPR/ERAD mutant was avirulent in an animal model of invasive aspergillosis, in contrast to the wt-like virulence of the ERAD mutant and the attenuated virulence of the UPR mutant (ΔhacA). Together these data suggest that these two pathways coordinate to support the pathogenesis of A. fumigatus, with the UPR playing a more influential role in maintaining homeostasis [201].

Section 5.2.2 The UPR and its Regulators Have Expanded Functions in A. fumigatus Part of what allows the UPR to play such an influential role in maintaining homeostasis in A. fumigatus is the expanded functions of its regulators compared to the model organism, S. cerevisiae. Unlike the yeast UPR mutants, which display limited in vitro growth defects, disruption of the UPR in A. fumigatus resulted in severely impaired growth [179,266].

Interestingly, however, the ΔireA and ΔhacA mutants of A. fumigatus did not phenocopy each other as they did in S. cerevisiae. The ΔireA displayed a much more severe growth defect under

97 both basal and stress conditions in vitro than did the ΔhacA mutant. Furthermore, the ΔireA was avirulent in an animal model of invasive aspergillosis while the ΔhacA was only attenuated in virulence compared to wt. Combined, these data demonstrate an IreA-dependent, HacA- independent contribution of the UPR to fungal pathogenesis [266].

The expansion of the functions of IreA is evident not only in the increased reliance of A. fumigatus on this pathway for its biology and virulence, but also in the analysis of the UPR transcriptome. In contrast to the 243 genes regulated in an IreA/HacA-dependent manner or the

148 genes regulated by HacA alone, transcriptional profiles revealed a specific role for IreA in the differential regulation of over 1,000 genes [266]. This suggests that, at a minimum, IreA alone orchestrates over 10% of the A. fumigatus genome. This expansive reach of IreA- dependent transcriptional regulation allows the UPR to play an active role in modulating multiple cellular processes, including not only protein folding, transport, and degradation, but also lipid metabolism, oxidative phosphorylation, steroid biosynthesis and amino acid metabolism [266].

Section 5.2.3 Revised Model for Maintenance of Secretory Homeostasis in A. fumigatus Based on this evidence for a more central role of the UPR in regulating and maintaining secretory homeostasis as a broad-spectrum compensatory mechanism, we propose a revision to the original model of maintenance of secretory homoeostasis described in the introduction to this thesis (Figure 40). Rather than being simply made up of three key factors (folding, transport, and degradation), we posit that maintenance of secretory homeostasis relies on the much more complicated network of processes regulated by the UPR, and IreA in particular. Within its central regulatory role, the UPR not only serves as an inducible response to conditions of extreme secretory stress, but also as an orchestrator of the fine-tuned balance of secretory capacity and demand under basal growth conditions.

Figure 40. Schematic of Revised Secretory Homeostasis Model

Rather than a simple balance of folding, vesicle transport, and degradation (top panel), the processes supporting secretory homeostasis are likely a much more complex network of physiological pathways (middle panel). At the center of this network are the regulators of the UPR, which contribute both fine-tuning operations under basal conditions and inducible adaptive responses under conditions of extreme stress in order to maintain and restore homeostasis, respectively. The UPR is able to serve as this broad-spectrum orchestrator of homeostasis because of its role in the regulation of multiple cellular process, not just folding, transport, and degradation (bottom panel). ------

------

UPR fine-tuning, as well as the breadth of processes involved in maintaining homeostasis, allows for compensation for small perturbations in individual hubs, such as deletion of calnexin

(protein folding) or SrgA (vesicle transport). Therefore, under basal conditions, any observable defect in growth is limited, if not completely absent. However, when these deletions are combined with additional stress for which those specific effectors are required for optimal adaptive responses, the defect is amplified and exceeds the capacity for UPR compensation and results in impaired growth (Figure 41). Consistent with this model, the data presented in

Chapters II and III of this thesis demonstrate that up-regulation of the UPR was not sufficient to compensate for loss of calnexin or SrgA under all in vitro conditions. The ΔclxA mutant was hypersensitive to conditions of thermal, starvation, metal ion, and acute ER stress while the

ΔsrgA isolates were all hypersensitive to thermal stress and vesicle transport disruption, suggesting that these key factors were required for homeostasis under these specific stress conditions.

In this model, in contrast to disruption of a functional hub of the homeostasis network, deletion of a master regulator would weaken the entire network even without exogenously applied stress; any additional strain on the network would thus become lethal to the organism

(Figure 41). Consistent with this idea, deletion of hacA or ireA is much more detrimental to the growth of A. fumigatus under basal and stress conditions than deletion of either clxA or srgA alone.

100

Figure 41. Schematic of Disruption of Secretory Homeostasis

Disruption of a single component of the secretory homeostasis network (represented by a single white pie-piece), such as ERQC through the deletion of calnexin, may not necessarily be detrimental to overall cell growth and viability under basal conditions because the rest of the network can compensate for its loss. Only when this disruption is combined with an external stress for which that particular component is required, such as unfolded protein stress caused by exposure to DTT or high temperatures, does the defect in homeostasis become amplified enough to result in any impairment of fungal growth.

In contrast, if a regulatory hub of the network such as IreA is eliminated, the entire network is weakened, even under basal conditions. This defect, combined with almost any other type of stress throughout the network, then becomes lethal.

101

Section 5.2.4 The UPR is a Dual-Use Virulence Attribute The broad-spectrum nature of UPR regulation also allows this pathway to be a dual-use virulence attribute of A. fumigatus. Researchers have found that molecules involved in multiple physiological pathways, including thermotolerance, cell wall homeostasis, nutrient sensing and acquisition, and general cell signaling contribute to A. fumigatus pathogenesis [2,81]. The extent to which individual components of the secretory homeostasis network contribute to these physiological pathways appears to correlate with their role in virulence. The data presented in

Chapters II and III of this thesis show that the ERQC component, calnexin, and vesicle transport mediator, SrgA, are only required for a fraction of these virulence-related attributes which parallels their largely dispensable nature for pathogenicity. Similarly, mutation within the IreA kinase was not sufficient to impair the majority of these virulence-related traits. In contrast, loss of the UPR master regulator IreA, which negatively impacts all secretory homeostasis arms, results in significant defects in all physiological pathways that have been shown to be related to

A. fumigatus pathogenesis [266]. These severe in vitro defects of the ΔireA mutant correlate with a substantial, if not complete, reduction in virulence in both an animal and insect model of invasive aspergillosis [266]. Therefore, while calnexin, SrgA, and possibly IreA kinase-specific functions have likely evolved to help the fungus adapt to specific stress conditions encountered within its ecological niche, the UPR as a whole provides cellular robustness that supports both in vitro and in vivo stress responses, thus serving as a dual-use virulence attribute of A. fumigatus (Figure 42).

102

Figure 42. The UPR is a dual-use virulence attribute of A. fumigatus

Many of the genes shown to be involved in pathogenesis of A. fumigatus encode products that contribute to normal physiological processes such as cell wall homeostasis, thermal tolerance, and signaling and regulation that are thought to improve the fitness of the fungus in its natural ecological niche. Interestingly, the contribution of individual secretory pathway and homeostasis components to these biological processes appears to correlate with pathogenesis. Both calnexin and SrgA are required for only a fraction of the in vitro growth attributes that have been shown to contribute to pathogenesis, and both of these molecules are largely dispensable for virulence. In sharp contrast, the master regulator of the UPR, IreA, is required for the majority of these pathogenesis-related attributes and is essential for virulence of A. fumigatus. This strongly suggests that while individual components of the secretory pathway, such as calnexin and SrgA, are only required for growth under very specific ecological conditions, overall maintenance of secretory homeostasis by the UPR serves as a dual-use virulence attribute supporting both in vitro and in vivo growth.

103

Section 5.2.5 The UPR Could Be a Novel and Potent Antifungal Drug Target Because of its role as a broad-spectrum compensatory mechanism that contributes to virulence, disrupting the UPR could serve as both a novel and potent antifungal strategy. In particular, we posit that the master regulator of the UPR, IreA, serves as an excellent antifungal drug target for multiple reasons. To support this argument, in the following section we address some of the most common questions that are generated in response to identifying novel antifungal drug targets.

Is the target essential for fungal pathogenesis?

Our laboratory has demonstrated that the IreA-mediated UPR is essential for pathogenesis and antifungal resistance of A. fumigatus [266]. However, the importance of the

UPR to fungal pathogenesis is not limited to this organism. Instead, a fully functional UPR, and

IreA homologs in particular, have also been shown to be required for the virulence of all fungal pathogens in which this pathway has been studied, including C. neoformans [203] and A. brassicicola [264]. Combined, this data suggests a central role for this pathway in fungal pathogenesis and provides strong evidence for the potential utility of UPR-targeting compounds as a broad-spectrum antifungal drug therapy.

What is the potential for drug inhibition of the target?

IreA contains two enzymatic domains, a kinase and endoribonuclease, both of which could serve as targets for inhibitory drugs. Kinase inhibitors have gained favored in recent years because of their potential utility for anticancer [295,296], autoimmune [297,298], and pulmonary hypertension [299] therapy. As such, there has been an influx of efforts by pharmaceutical industries to expand the pool of kinase inhibitors in the drug development pipeline [300]. This holds great significance for future UPR-targeting endeavors, as these libraries of kinase inhibitors could be screened for their IreA-inhibiting capacity.

Not only does the IreA kinase present a suitable drug target, but there is also great potential for the discovery of IreA endoribonuclease inhibitors. In fact, small molecules that

104 target and inhibit one or both of these domains in the human homolog, Ire1α, have already been identified and are in development [301-304]. For example, in their 2012 study, Wang et al. evaluated two classes of established kinase inhibitors for their effects on Ire1α. They showed that while representatives from both classes inhibited the transautophosphorylation of Ire1α, the known type I inhibitor APY29 [305] activated the endoribonuclease, while a compound referred to by the authors as “3,” which was identified through a screen of known type II inhibitors, also disabled the RNase activity [306]. This study was the first to identify a compound with the ability block both enzymatic functions of Ire1α in vitro and in vivo [306].

In a separate study, which used a cell-based reporter gene, high-throughput chemical library screen, Papandreou et al. identified STF-083010, a compound that blocks the Ire1α endoribonuclease without affecting its kinase activity. These inhibitory effects were observed in vitro, using both RPMI 8226 human multiple myeloma (MM) cells and a cell-free system, as well as in vivo using a transgenic mouse model harboring an XBP1-luciferase reporter gene.

Importantly, this study demonstrated that this Ire1α inhibitor was selectively cytotoxic to MM cells compared to normal host immune cells ex vivo and inhibited the growth of MM tumor xenografts [304].

Similarly, Mimura et al. demonstrated the effectiveness of MKC-3946, a potent and soluble Ire1α inhibitor derived from one identified in a screen of 220,000 individual compounds using a cytosolic fragment of human Ire1α and a mini-XBP1 stem-loop RNA as a substrate

[301], at targeting MM cells. This compound not only triggered growth inhibition in MM cell lines, but also did so without toxicity to normal mononuclear cells [307]. Furthermore, MKC-3946 inhibited XBP1 splicing in vivo and significantly reduced tumor growth in an animal model of

MM. Studies such as these provide not only a strong preclinical framework for future clinical trials for UPR-targeting anticancer therapies [307], but also a multitude of compounds that could be screened as potential IreA inhibitors for future antifungal applications.

Does conservation of the target in humans limit the potential for antifungal drug therapy?

105

The human homolog, Ire1α, and IreA share approximately 40% identity, with the highest homology in the cytoplasmic region where the kinase and endoribonuclease domains are located. Homology between fungal and human proteins does not, however, preclude the potential for species-specific targeting. For example, x-ray crystallography revealed unexpected differences in the substrate and product binding sites between human and C. neoformans farnesyltransferase homologs that were considered prime targets for inhibitor development, despite extensive conservation between the two proteins [308]. Preliminary sequence analyses have already begun to identify such differences in Ire1 homologs, such as a fungal-specific loop adjacent to the kinase activation segment that is not present in Ire1α, suggesting that structural differences are present that may facilitate specific drug targeting with limited cross-reactivity.

Even if such fungal-specific targeting of IreA is not possible, the presence of Ire1 homologs in both fungi and humans does not rule out the possibility that this pathway could serve as an effective antifungal target. As described in the introduction, humans have a more complex UPR, involving at least three sensors with overlapping functions [172]. Therefore, even if complete fungal-specificity of future IreA-targeting compounds cannot be achieved, current evidence indicates that redundancy between the three ER stress response pathways would protect against loss of Ire1α function [309]. For example, although a mouse Ire1 knockout is a developmental lethal, this is due to an extraembryonic defect in the placenta. A conditional knockout of Ire1 in the embryo is viable, showing only a mild phenotype of reduced insulin and immunoglobulin levels [310,311]. Furthermore, the successful development of Ire1α inhibitors for anticancer therapy, as described above, not only provides potential compounds that could be modified for antifungal use, but also demonstrates a proof-of-principle for the tolerability of Ire1- targeted UPR inhibition in animal models [181,301,302,304,312,313]. Although Ire1α is identical in the cancer target and its normal counterpart, it is the increased dependency of the cancer on the UPR that confers specificity. We posit that similar increased dependency of A. fumigatus on the UPR would lend itself to similar physiological specificity of IreA-targeting antifungal drugs.

106

Is there a potential for synergy with other antifungal drugs?

IreA is essential for the viability of A. fumigatus and C. neoformans in the presence of current antifungal drugs [179,203,266]. This suggests that combining UPR inhibition with these drugs could increase the efficacy of these compounds, thus reducing the required dosage and subsequently limiting the potential for host toxicity and the emergence of fungal resistance. This potential synergism is not limited to current antifungals, however, but could apply to emerging antifungals as well. For example, members a new class of antifungal compounds currently in the drug development pipeline have been shown to cause acute ER stress by inhibiting GPI-anchor synthesis [314-316]. Using a genetic proof-of-principle, researchers have demonstrated that disruption of the UPR significantly increases the antifungal potency of this class of compounds

[314].

This method of combining ER stress-aggravators (ERSA), or drugs that cause or intensify ER stress [317], with UPR-targeting therapies has been successful as an anticancer strategy in preclinical trials; after combining Ire1α inhibition with a low-dose of the proteasome

(ERAD) inhibitor bortezomib, Mimura et al. observed significantly enhanced in vitro cytotoxicity and in vivo tumor growth inhibition. Additionally, they documented prolonged survival of mice

(RPMI 8226 xenograft model of human multiple myeloma) treated with combination therapy compared to the negative control or low-dose bortezomib alone [307]. Similar combination therapy using UPR-targeting compounds with known antifungal ERSA, such as GPI-anchor synthesis inhibitors, could be an effective treatment option for fungal infections. Moreover, our data suggesting a role for the UPR as a broad-spectrum compensation for diverse biochemical dysfunctions in A. fumigatus raises the possibility that IreA drug targeting could enhance the potency of multiple drugs not previously considered antifungals, such as bortezomib, and thus expand the realm of drug susceptibility beyond the standard antifungal drug classes.

107

Section 5.3 – Future Studies and Directions

Because of the potential for UPR-targeting to be an effective antifungal therapy, future investigation of mechanisms for IreA/HacA inhibition may provide novel strategies for antifungal drug development. However, research should not be limited to these regulatory hubs of the

UPR; understanding the linkages and networks that are involved in secretory homeostasis could provide novel targets to avoid the possibility of emerging resistance to any future UPR-targeting compounds.

Section 5.3.1 Understanding the Regulatory and Functional Components of the Fungal UPR There is still much to learn about the network that supports secretory homeostasis in A. fumigatus, including defining the breadth of UPR compensation, the mechanisms through which the UPR supports pathogenesis, as well as how the UPR interacts with other pathways to support overall cellular homeostasis, growth and virulence of A. fumigatus.

Determine the Breadth of UPR Compensation in A. fumigatus:

As emphasized above, the UPR contributes to the fungal response to both currently used [179,266] and emerging [314] antifungal drugs, high-lighting the potential for effective combination therapy to improve patient outcomes. Furthermore, if the UPR truly serves as a broad-spectrum compensatory mechanism in A. fumigatus, it is likely that it supports fungal growth in the presence of multiple stressors. Understanding and defining the breadth of this compensation may reveal novel drugs that have not previously been considered antifungal agents but have fungistatic or fungicidal effects when combined with UPR disruption.

Determine if the functional hubs of the UPR are inter-connected to maintain secretory homeostasis:

Are calcium and ER homeostasis mechanisms linked by calnexin?

Our data suggest that calnexin is required for growth of A. fumigatus under conditions of acute ER stress. We speculated that this requirement is due to calnexin’s contribution to ER

108 homeostasis as a chaperone, facilitating the proper folding of glycosylated polypeptides within the ER.It is possible, however, that calnexin provides additional support for maintaining ER homeostasis under stress conditions. For example, data in higher eukaryotes have implicated calnexin as a regulatory component of calcium homeostasis to relieve ER stress [318].

Maintenance of calcium homeostasis has already been shown to play an important role in pathogenesis of A. fumigatus, with the master regulator calcineurin holding great potential as a possible antifungal target. Uncovering possible links between ER and calcium homeostasis may identify ways in which these two important pathways may be dually targeted to reduce virulence.

In higher eukaryotes, phosphorylation of calnexin allows this transmembrane chaperone to negatively regulate the activity of a sarco-endoplasmic reticulum calcium ATPase (SERCA) pump. Under conditions of ER stress, calnexin is dephosphorylated by the phosphatase calcineurin, which disrupts calnexin’s association with and inhibition of the SERCA pump. This release of inhibition allows the SERCA to pump calcium into the ER to contribute to the overall restoration of ER homeostasis [318]. As both calcineurin and SERCA pump homologs are present in A. fumigatus, it is intriguing to speculate that calnexin plays an additional role in supporting ER homeostasis through its regulatory action on ER calcium homeostasis. Although the data presented in this thesis demonstrate that calnexin is dispensable for virulence, the proposed role for calnexin in SERCA regulation is inhibition of pump activity. Therefore, while negative regulation of the pump may be dispensable, the activity of the pump itself may contribute to ER homeostasis and pathogenesis. In fact, the SERCA homolog in A. fumigatus is differentially regulated at the transcript level under conditions of ER stress, suggesting a role for this pump in maintenance of secretory homeostasis [266]. Furthermore, in other fungi, such as

C. neoformans, the SERCA pump homolog has been shown to be essential for virulence [319].

Therefore, the SERCA pump homolog in A. fumigatus may hold similar importance to this fungal pathogen. It is possible that combination therapy using SERCA pump inhibitors, which are

109 currently used in anticancer therapy [317], in conjunction with UPR inhibitors may have fungicidal effects.

What is the mechanism behind the ΔclxA mutant’s resistance to 2DG?

Currently, we are unable to provide a rational explanation for the increased growth of the

ΔclxA mutant on 0.1% 2DG at 30°C as compared to the stunted growth of wt A. fumigatus. The phenotype suggests that, in wt, this condition signals the organism to stop growing and that deletion of calnexin results in either loss of this negative signal or gain of a positive signal to promote continued growth. It is possible that this dysregulation is due to a failure to attenuate translation, in which the presence of 2DG creates a stress to which A. fumigatus responds by reducing translation but loss of calnexin impairs its ability to do so. Such effects of 2DG have been reported previously in higher eukaryotes [320], but calnexin has yet to be implicated in this process.

Recently, 2DG was introduced as a potential anticancer drug due to its ability to induce

ER stress. Using 2DG at concentrations that can be achieved in human plasma without causing significant side effects, researchers were able to show that this compound preferentially inhibits cancer growth [320]; perhaps 2DG could be used in a similar manner to inhibit invasive fungal growth. Understanding potential mechanisms of resistance that the fungus might employ could be important for future therapeutic interventions with this compound.

Do secretion-related GTPases contribute to ER homeostasis in A. fumigatus?

The data obtained using the ΔsrgA mutant suggest that vesicle-mediated transport is a complex and important pathway to the growth, and perhaps virulence, of A. fumigatus.

Therefore, it would be pertinent to extend our studies to include the other secretion-related

GTPase homologs in A. fumigatus. Most intriguing is SrgB, a homolog to Ypt1, which is thought to facilitate transport of vesicles directly from the ER [321]. Unlike srgA, data suggest that srgB is essential in the closely related species, A. niger [256]. Additionally, recent reports demonstrate that Ypt1 homologs play an important role in maintenance of secretory

110 homeostasis through regulation of hac1 mRNA localization [322,323]. Therefore, mutational analysis of srgB in A. fumigatus may provide insight into the role of vesicle trafficking, as well as the regulation of the UPR in this fungal pathogen.

Determine the mechanism by which IreA contributes to pathogenesis independently of hacA mRNA splicing:

It is clear from this thesis, combined with the broader data obtained from our laboratory’s research, that IreA plays an important role in regulating the stress responses of A. fumigatus.

Our data suggest that mutations within the kinase domain alter this regulation. Therefore, there is great precedence for continuing to expand our understanding of the mechanisms involved in regulating the IreA-mediated UPR.

How do the enzymatic domains of IreA regulate its contribution to A. fumigatus physiology?

Using analysis of hacA mRNA splicing as an indirect measure of endoribonuclease activity, we have shown that the RNase function of the IreAD858A mutant remains intact.

However, analysis of kinase activity of the mutant has yet to be tested. Determining the kinase activity of the IreAD858A mutant, or any additional IreA kinase mutant constructs, will improve our understanding of this protein and could be used for future drug design and discovery. If we find, for example, that the kinase domain of the IreAD858A mutant protein is inactive, this would suggest that kinase activity is dispensable for virulence in an insect model of IA and that effective IreA-targeting to reduce pathogenesis may require a drug that inhibits both the RNase and kinase domains. In contrast, if the kinase domain cannot be uncoupled from endoribonuclease activity in IreA, as can be done in yeast Ire1 [277], this would suggest that there is a substantial difference between the regulatory mechanisms of IreA as compared to

Ire1 that must be understood.

Continued study of the dual-enzyme function of IreA will also be important in order to determine if this protein contributes to A. fumigatus physiology in a non-enzymatic manner. As a transmembrane protein, with both ER lumenal and cytosolic domains, it is possible that IreA

111 serves as a scaffold promoting and facilitating other key protein-protein interactions. Expression of an IreA mutant that is lacking both its kinase and endoribonuclease activities, but maintaining its structural integrity, would provide key information pertaining to these possible non-enzymatic functions.

Does IreA interact with other proteins to regulate homeostasis and promote pathogenesis?

If the kinase domain of IreA contributes to IreA’s role in A. fumigatus physiology independently of its endoribonuclease activity (HacA splicing), it is likely that autophosphorylation is not its only kinase function. Instead, it is possible that IreA interacts with other proteins within the cytoplasm, either regulating their activity via phosphorylation or by acting as a scaffold for other protein-protein interactions. There is significant precedence for such interactions, as Ire homologs in other organisms have been shown to have multiple interacting partners [324]. Identifying proteins that interact with IreA in A. fumigatus may provide clues to the mechanisms behind IreA’s role in fungal pathogenesis, as well as additional targets within the pathway that could be inhibited to reduce virulence.

What is the mechanism behind IreA regulation of sterol biosynthesis?

The increased voriconazole resistance of the IreAD858A strain suggests that ergosterol biosynthesis is dysregulated by mutation within the kinase domain. Consistent with this hypothesis, transcriptional profiling of the ΔhacA and ΔireA mutants uncovered a HacA- independent, IreA-dependent differential regulation of genes involved in this pathway. A better understanding of IreA’s role in sterol biosynthesis could reveal potential resistance mechanisms to currently used antifungal drugs that target the ergosterol biosynthesis pathway.

Section 5.3.2 Clinical Application Our laboratory was the first to show that the UPR contributed to the virulence of a fungal pathogen [179]. As such, it is essential that we continue breaking ground and advancing the field’s appreciation for the role of the UPR in fungal pathogenesis. To do this, key questions must be addressed:

112

Determine the temporal and spatial localization of UPR activation during A. fumigatus growth and infection:

Is UPR activation preferentially localized to certain zones or compartments of A. fumigatus hyphae?

Current studies describing the transcriptome of the A. fumigatus UPR have been completed using mature mycelia. This approach, while justified based on the need for sufficient biomass, provides data that have been averaged for the entire colony rather than individual sections. However, multiple studies have shown that individual zones of a colony behave differently at both the transcriptome and secretome levels [117,325,326], suggesting that homeostasis pathways may also be localized in their function and importance. Variations in where and when stress is perceived and an adaptive response is enacted could have significant implications for use of UPR-targeting drugs for IA therapy. For example, it is possible that the

UPR is most heavily utilized at the remodeling hyphal tips and, therefore, active fungal growth would be required for such anti-UPR therapy to be effective. Identifying the localization of UPR activation within the growing fungal colony could provide important information for timing and effectiveness of UPR-targeting antifungal therapy.

At which stage of infection is the UPR required for pathogenesis?

Similar to spatial localization of UPR activation, determining the infection stage(s) at which UPR activation is required for pathogenesis could improve the effectiveness of UPR- targeting antifungal therapy. Our current data supporting a role for IreA and the UPR in the virulence of A. fumigatus have been obtained using a genetic proof-of-principle approach in which the fungus lacks a functional UPR from the time of conidial packaging through infection.

While use of this model has implicated the UPR in overall fungal pathogenesis, it does not allow differentiation between stages of infections for which the UPR is required. It is possible that

UPR support is most influential during the initial stages of infection, when germination of conidia occurs; use of UPR-targeting antifungal therapies would thus be most effective as a prophylactic

113 strategy. In contrast, the UPR may be required at later stages of infection after mature hyphae have formed. If this is the case, then UPR-targeting antifungal treatment after a diagnosis of IA would still be effective. Therefore, to better define the optimal window of therapy, future studies aimed a defining the timeline for UPR support of A. fumigatus virulence should be completed.

Identify UPR-targeting compounds that reproduce the A. fumigatus ΔireA genetic proof-of- principle:

Our laboratory’s published data suggest that IreA would make a strong candidate as a novel and effective drug target for antifungal therapy [266]. Therefore, as we continue to improve our understanding of the mechanisms and breadth of IreA function in A. fumigatus, we must concurrently be exploring options for anti-IreA drug development. This development should be approached bi-directionally, from the perspective of both rationally designed drug development and screening of current libraries of potential inhibitors.

How can we rationally design IreA-targeting antifungal compounds?

Structural studies of both yeast and human Ire1 homologs have identified key differences between these two related proteins [173,305,327,328]. Based on sequence homology alone, we are unable to determine which structure A. fumigatus IreA would most closely resemble. Without this information, we are unable to predict which enzymatic domains and faces would be accessible for drug targeting. Therefore, in order to complete rational drug design, it is essential that crystal structures of IreA be generated and analyzed.

Are currently available kinase inhibitors or UPR-targeting compounds effective against A. fumigatus?

As these structural studies are completed, drug screens should also be conducted to identify potential IreA-targeting compounds. Fortunately, there has been a recent influx of resources into the development of kinase inhibitors [295,296,329]. Moreover, because of the role of the UPR in chronic and metabolic diseases, multiple Ire1 inhibitors have also gained

114 favor in the drug-development pipeline [301-304]. Screening these compounds against A. fumigatus could significantly advance our efforts to identify an inhibitor of the fungal UPR.

Section 5.4 – Conclusions

Much of the mutational analysis targeted at disrupting A. fumigatus pathogenesis has resulted in only small declines in virulence unless the targeted gene product was involved in the regulation of multiple activities required for fungal adaptation and growth [81]. The work presented in this thesis suggests the same is true for the role of secretory pathway and homeostasis mechanisms in supporting pathogenesis; targeted disruptions of individual components such as calnexin, SrgA, or the IreA kinase results in moderate in vitro growth defects with little impact on virulence. In contrast, deletion of the master regulator the UPR, which we speculate serves as a broad-spectrum compensatory mechanism to support secretory and cellular homeostasis, causes severe in vitro growth defects and complete loss of virulence.

Continued investigation into the mechanisms supporting the UPR’s role in growth and virulence of A. fumigatus could have significant implications for the development of novel antifungal strategies for invasive aspergillosis.

115

APPENDIX

Virulence-Related Genes in A. fumigatus (Adapted from [81]; full citation at end of table)

Contribution to Contribution Environmental Gene Physiological Pathogenesis- Effect of to Fitness (Gene Product) Function Related Activity Deletion Pathogenesis pksP/alb1 (Polyketide DHN-melanin ROS, phagocytosis Hypovirulent synthetase) biosynthesis; cAMP and complement signal transduction binding protection; Protection immunosuppression against cat1/catB and cat2/katG H2O2 degradation ROS protection Double mutant composting- (Mycelial catalase) hypovirulent Protection related pes1 (nonribosomal Peptide synthesis; ROS protection Hypovirulent against oxidative stress peptide synthase) stress resistance Immune tmpL Intracellular redox ROS protection Hypovirulent Response homeostasis pld (phospholipase D) Phagocytosis Hypovirulent protection gel2 (Glucanosyl- Elongation of β-(1-3)- Cell-wall assembly Hypovirulent transferase) glucan and morphogenesis chsG (chitin synthase Synthesis of chitin Cell-wall assembly Hypovirulent class III) and morphogenesis afpigA (N-acetyl- Synthesis of chitin Cell-wall assembly Hypovirulent Cell Wall glucosaminyl- and morphogenesis Cell Wall Homeostasis transferase catalytic Homeostasis subunit) glfA (UDP-gal-mutase) Synthesis of Cell-wall assembly Hypovirulent galactofuran and morphogenesis kre2/afmnt1 (α-1,2- Glycosylation of Cell wall assembly Hypovirulent mannosyltransferase) protein; necessary for and morphogenesis growth at 48°C; cell wall integrity orlA (trehalose 6- Trehalose Cell wall Avirulent phosphate biosynthesis homeostasis phosphatase) pathway afmkk2 (CWI signaling Cell Wall Integrity Cell wall homeostasis Hypovirulent kinase) Pathway srbA (related with Ergosterol Hypoxia response Avirulent SREBP) biosynthesis; maintenance of cell Response to polarity Protection Hypoxia dscA and dscC (Golgi Ergosterol Hypoxia response Avirulent/Hypovirulent against E3 ligase complex biosynthesis; hypoxia Hypoxia components) adaptation cycA (cytochrome C) Mitochondrial Hypoxia response Hypovirulent respiration alp/asp f 13, orycine Protein degradation Tissue Hypovirulent (alkaline serine (elastin, collagen, destruction/invasion protease, Elastase) fibrinogen and casein) sidA (L-ornithine First common step Iron acquisition Avirulent hydroxylase) of synthesis of siderophores sidC Synthesis of Intracellular iron Hypovirulent ferrocrocin and storage hydroxyferricrocin sidD Synthesis of Extracellular iron Hypovirulent fusarinine C and acquisition triacetylfusarinine C sidF Synthesis of Extracellular iron Hypovirulent fusarinine C and acquisition triacetylfusarinine C sidG Synthesis of Extracellular iron Hypovirulent Nutrient triacetylfusarinine C acquisition Nutrient Acquisition sidI Hypovirulent Acquisition sidH Hypovirulent

hapX Transcriptional Iron acquisition Hypovirulent

regulation for iron

acquisition

argEF (acetylglutamate Mitochondrial Iron acquisition Hypovirulent

kinase/acetylglutamyl- ornithine production

phosphate-reductase) (siderophore

116

biosynthesis) zafA (zinc-responsive Induction of zrfC Zinc acquisition Avirulent transcriptional and asp f 2 activator) expression in zinc- limiting media acuM (zinc cluster Governs reductive Iron acquisition Hypovirulent transcription factor) iron assimilation and siderophore- mediated iron uptake rhbA (GTPase, Ras- Nutrient sensing Nitrogen acquisition Hypovirulent related protein) Nutrient cpcA (transcriptional Putative amino acid Nitrogen acquisition Hypovirulent Nutrient Acquisition activator) biosynthetic pathway Acquisition (cont.) regulator (cont.) mcsA (methylcitrate Hypovirulent synthase) lysF (homoaconitase) Lysine biosynthesis Amino acid Hypovirulent biosynthesis and growth hcsA (homocitrate First enzyme of α- Amino acid Hypovirulent synthase) aminoadipate biosynthesis and pathway (lysine growth biosynthesis) AfIlv3A and ilv3B Branched-chain Branched-chain Hypovirulent (dihydroxyacid amino acid synthesis amino acid synthesis dehydratase) pyrG (orotidine-5’- Pyrimidine DNA biosynthesis Avirulent phosphate biosynthesis and growth decarboxylase) pabaA (p- Folate biosynthesis Folate biosynthesis Avirulent aminobenzoic acid and growth synthase) kre2/afmnt1 (α-1,2- Necessary for growth Cell-wall assembly Hypovirulent Thermal mannosyltransferase) at 48°C and morphogenesis Thermal Tolerance Cell wall integrity Tolerance cgrA (nucleolar protein) Ribosome biogenesis Growth at 37°C Hypovirulent at 37°C alp/asp f 13, orycine Protein degradation Tissue Hypovirulent Nutrient (alkaline serine (elastin, collagen, destruction/invasion; Allergens Acquisition protease, elastase) fibrinogen, and Type I casein) hypersensitivity gliP (nonribosomal Gliotoxin Hypovirulent peptide synthetase) biosynthesis Microbial laeA (nuclear protein, Regulation of Production in Hypovirulent Toxins Competition Arg and His methyl- secondary infections? transferases homology) metabolism and 10% genome expression gpaB (G protein α cAMP signal Hypovirulent subunit) transduction, stimulator of adenylate cyclase pkaC1 (cAMP- cAMP signal Hypovirulent dependent PKA transduction catalytic subunit) pkaR (PKA regulatory cAMP signal Hypovirulent subunit) transduction fos1 (histidine kinase) Stress response Hypovirulent cpcA/gcn4p Putative amino acid Nitrogen acquisition Hypovirulent Signaling and (Transcriptional biosynthetic pathway Signaling and Regulation Activator) regulator Regulation ( Nutrient calA/cnaA (calcineurin Septum formation, Stress response Hypovirulent ( Nutrient sensing and catalytic subunit A) conidiophore sensing and acquisition, development acquisition, morphogenesis, crzA (zinc finger Ca2+-Mn2+ Stress response Hypovirulent morphogenesis, cellular transcription factor) tolerance cellular homeostasis) gprC and gprD (putative Stress signals via Adaptation stress Hypovirulent homeostasis) G protein-coupled modulation of the signaling receptors) calcineurin pathway pmcA (calcium Ca2+-Mn2+ Stress response Hypovirulent transporter) tolerance rasB (GTPase) Germination and Hypovirulent growth rates rhbA (GTPase, Ras- Nutrient sensing Nitrogen acquisition Hypovirulent related protein) medA Adherence, biofilm Host interactions Hypovirulent formation (adherence to pulmonary epithelial cells, endothelial cells

117

and fibronectin) hacA Transcriptional Stress Response Hypovirulent (homolog to yeast hac1) regulator of UPR ireA Master regulator of Stress Response Avirulent (homolog to yeast Ire1) UPR sebA (transcription Stress tolerance Nutrient acquisition Hypovirulent factor) pathways and stress response srbA (related with Ergosterol Azole resistance Avirulent SREBPd, homolog to biosynthesis; Sre1) maintenance of cell polarity

Adapted from: Abad A, Fernandez-Molina JV, Bikandi J, Ramirez A, Margareto J, et al. (2010) What makes Aspergillus fumigatus a successful pathogen? Genes and molecules involved in invasive aspergillosis. Rev Iberoam Micol 27: 155-182.

118

REFERENCES

1. De Pauw B, Walsh TJ, Donnelly JP, Stevens DA, Edwards JE, et al. (2008) Revised definitions of invasive fungal disease from the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG) Consensus Group. Clin Infect Dis 46: 1813-1821. 2. Zaas AKaA, B D (2009) Invasive Pulmonary Aspergillosis. In: Latge JaSW, editor. Aspergillus fumigatus and aspergillosis. Washington, D.C.: ASM Press. pp. xviii, 568 p., 512 p. of plates. 3. Greene RE, Shibuya K, Ando T (2009) Histology and Radiology. In: Latge JP, Steinbach WJ, editors. Aspergillus fumigatus and aspergillosis. Washington, DC: ASM Press. pp. xviii, 568 p., 512 p. of plates. 4. Filler SG, Sheppard DC (2006) Fungal invasion of normally non-phagocytic host cells. PLoS Pathog 2: e129. 5. Kamai Y, Chiang LY, Lopes Bezerra LM, Doedt T, Lossinsky AS, et al. (2006) Interactions of Aspergillus fumigatus with vascular endothelial cells. Med Mycol 44 Suppl 1: S115-117. 6. Murray PR, Baron EJ (2007) Manual of clinical microbiology. Washington, D.C.: ASM Press. 7. Verweij PE (2009) Galactomannan and Anti-Aspergillus Antibody Detection for the Diagnosis of Invasive Aspergillosis; Latge JP, Steinbach WJ, editors. Washington, DC: ASM Press. xviii, 568 p., 512 p. of plates p. 8. White PL, Barnes RA (2009) Aspergillus PCR; Latge JP, Steinbach WJ, editors. Washington, DC: ASM Press. xviii, 568 p., 512 p. of plates p. 9. Walsh TJ, Anaissie EJ, Denning DW, Herbrecht R, Kontoyiannis DP, et al. (2008) Treatment of aspergillosis: clinical practice guidelines of the Infectious Diseases Society of America. Clin Infect Dis 46: 327-360. 10. Groll AH, Walsh TJ (2009) Antifungal Polyenes; Latge JP, Steinbach WJ, editors. Washington, DC: ASM Press. xviii, 568 p., 512 p. of plates p. 11. Gale EF (1974) The release of potassium ions from Candida albicans in the presence of polyene antibiotics. J Gen Microbiol 80: 451-465. 12. Herbrecht R, Nivoix Y (2009) Azoles; Latge JP, Steinbach WJ, editors. Washington, DC: ASM Press. xviii, 568 p., 512 p. of plates p. 13. Henrici AT (1939) An Endotoxin from Aspergillus fumigatus. J Immunol 36: 319-338. 14. Ferreira ME, Colombo AL, Paulsen I, Ren Q, Wortman J, et al. (2005) The ergosterol biosynthesis pathway, transporter genes, and azole resistance in Aspergillus fumigatus. Med Mycol 43 Suppl 1: S313-319. 15. Hu W, Sillaots S, Lemieux S, Davison J, Kauffman S, et al. (2007) Essential gene identification and drug target prioritization in Aspergillus fumigatus. . PLoS Pathogens 3: e24. 16. Mouyna I, Henry C, Doering TL, Latge JP (2004) Gene silencing with RNA interference in the human pathogenic fungus Aspergillus fumigatus. FEMS Microbiol Lett 237: 317-324. 17. Latge J-P (1999) Aspergillus fumigatus and aspergillosis. Clinical Microbiology Reviews 12: 310-350. 18. Maertens J, Maertens V (2009) Echinocandins in the Treatment of Aspergillosis; Latge JP, Steinbach WJ, editors. Washington, DC: ASM Press. xviii, 568 p., 512 p. of plates p. 19. Talbot GH, Bradley J, Edwards JE, Jr., Gilbert D, Scheld M, et al. (2006) Bad bugs need drugs: an update on the development pipeline from the Antimicrobial Availability Task Force of the Infectious Diseases Society of America. Clin Infect Dis 42: 657-668. 20. Casadevall A, Pirofski L (1999) Host-pathogen interactions: redefining the basic concepts of virulence and pathogenicity. Infect Immun 67: 3703-3713.

119

21. Mackenzie DWR (1988) Aspergillus in Man. In: VandenBossche H, Mackenzie DWR, Cauwenbergh G, editors. Aspergillus and Aspergillosis. New York: Plenum Press. pp. 1- 8. 22. Marr KA, Patterson T, Denning D (2002) Aspergillosis. Pathogenesis, clinical manifestations, and therapy. Infect Dis Clin N Am 16: 875-894. 23. Warnock DW (2007) Trends in the epidemiology of invasive fungal infections. Nihon Ishinkin Gakkai Zasshi 48: 1-12. 24. Schmidt A, Schmidt DI (1999) J. B. Georg W. Fresenius and the Description of the Species Aspergillus fumigatus. In: Brakhage AA, Jahn B, Schmidt A, editors. Aspergillus fumigatus Biology, Clinical Aspects and Molecular Approaches to Pathogenicity. Basel: Karger. pp. 1-4. 25. Samson RA, Pitt JI, Division NATOSA (1985) Advances in penicillium and aspergillus systematics: Plenum Press. 26. Raper KB, Fennell DI (1965) The genus Aspergillus: Williams & Wilkins. 27. Haines J (1995) Aspergillus in compost: Straw man or fatal flaw? BioCycle. 28. Tekaia F, Latge JP (2005) Aspergillus fumigatus: saprophyte or pathogen? Curr Opin Microbiol 8: 385-392. 29. Rhodes JC (2006) Aspergillus fumigatus: growth and virulence. Med Mycol 44 Suppl 1: S77- 81. 30. Kwon-Chung KJ, Sugui JA (2009) Sexual reproduction in Aspergillus species of medical or economical importance: why so fastidious? Trends Microbiol 17: 481-487. 31. Malloch DaRFC (1972) Trichocomataceae: ascomycetes with Aspergillus, Paecilomyces and Penicillium imperfect states. Can J Bot 50: 2613-2628. 32. Taylor JW (2011) One Fungus = One Name: DNA and fungal nomenclature twenty years after PCR. IMA Fungus 2: 113-120. 33. McNeill J, Barrie F, Buck W, Demoulin V, Greuter W, et al. (2012) International Code of Nomenclature for algae, fungi, and plants (Melbourne Code): Koeltz Scientific Books. 34. Lee SC, Ni M, Li W, Shertz C, Heitman J (2010) The evolution of sex: a perspective from the fungal kingdom. Microbiol Mol Biol Rev 74: 298-340. 35. O'Gorman CM, Fuller H, Dyer PS (2009) Discovery of a sexual cycle in the opportunistic fungal pathogen Aspergillus fumigatus. Nature 457: 471-474. 36. Hospenthal DR, Kwon-Chung KJ, Bennett JE (1998) Concentrations of airborne Aspergillus compared to the incidence of invasive aspergillosis: lack of correlation. Med Mycol 36: 165-168. 37. Schmitt HJ, Blevins A, Sobeck K, Armstrong D (1990) Aspergillus species from hospital air and from patients. Mycoses 33: 539-541. 38. Park SJ, Mehrad B (2009) Innate immunity to Aspergillus species. Clin Microbiol Rev 22: 535-551. 39. Schaffner A, Douglas H, Braude A (1982) Selective protection against conidia by mononuclear and against mycelia by polymorphonuclear phagocytes in resistance to Aspergillus. J Clin Invest 69: 617-631. 40. Bonnett CR, Cornish EJ, Harmsen AG, Burritt JB (2006) Early neutrophil recruitment and aggregation in the murine lung inhibit germination of Aspergillus fumigatus conidia. Infect Immun 74: 6528-6539. 41. Ibrahim-Granet O, Philippe B, Boleti H, Boisvieux-Ulrich E, Grenet D, et al. (2003) Phagocytosis and intracellular fate of Aspergillus fumigatus conidia in alveolar macrophages. Infect Immun 71: 891-903. 42. Mehrad B, Strieter RM, Moore TA, Tsai WC, Lira SA, et al. (1999) CXC chemokine receptor- 2 ligands are necessary components of neutrophil-mediated host defense in invasive pulmonary aspergillosis. J Immunol 163: 6086-6094.

120

43. Mehrad B, Wiekowski M, Morrison BE, Chen SC, Coronel EC, et al. (2002) Transient lung- specific expression of the chemokine KC improves outcome in invasive aspergillosis. Am J Respir Crit Care Med 166: 1263-1268. 44. Morrison BE, Park SJ, Mooney JM, Mehrad B (2003) Chemokine-mediated recruitment of NK cells is a critical host defense mechanism in invasive aspergillosis. J Clin Invest 112: 1862-1870. 45. Park SJ, Wiekowski MT, Lira SA, Mehrad B (2006) Neutrophils regulate airway responses in a model of fungal allergic airways disease. J Immunol 176: 2538-2545. 46. Phadke AP, Akangire G, Park SJ, Lira SA, Mehrad B (2007) The role of CC chemokine receptor 6 in host defense in a model of invasive pulmonary aspergillosis. Am J Respir Crit Care Med 175: 1165-1172. 47. Casadevall A, Pirofski L (2003) The damage-response framework of microbial pathogenesis. Nature Rev Microbiol 1: 17-24. 48. Moss RB, Steinbach WJ (2009) Allergic Bronchopulmonary Aspergillosis. In: Latge JaSW, editor. Aspergillus fumigatus and aspergillosis. Washington, DC: ASM Press. pp. xviii, 568 p., 512 p. of plates. 49. Soubani AO, Chandrasekar PH (2002) The clinical spectrum of pulmonary aspergillosis. Chest 121: 1988-1999. 50. Rhodes JCaDSA (2010) Aspergillus fumigatus. In: Borkovich KaDE, editor. Cellular and Molecular Biology of Filamentous Fungi. 51. Richardson MD, Kokki M (2003) Aspergillus. In: Anaissie EJ, McGinnis MR, Pfaller MA, editors. Clinical Mycology. Philadelphia: Churchill Livingstone. pp. 273-296. 52. Cornillet A, Camus C, Nimubona S, Gandemer V, Tattevin P, et al. (2006) Comparison of epidemiological, clinical, and biological features of invasive aspergillosis in neutropenic and non-neutropenic patients: a 6-year survey. Clin Infect Dis 43: 577-584. 53. Gavalda J, Roman A (2007) [Infection in lung transplantation]. Enferm Infecc Microbiol Clin 25: 639-649; quiz 650. 54. Burgos A, Zaoutis T, Dvorak C, Hoffman J, Knapp K, et al. (2008) Pediatric invasive aspergillosis: a multiyear retrospective analysis of 139 contemporary cases. Pediatrics 121: e1286-e1294. 55. Upton A, Kirby KA, Carpenter P, Boeckh M, Marr KA (2007) Invasive aspergillosis following hematopoietic cell transplantation: outcomes and prognostic factors associated with mortality. Clin Infect Dis 44: 531-540. 56. (!!! INVALID CITATION !!!). 57. Groll AH, Shah PM, Mentzel C, Schneider M, Just-Nuebling G, et al. (1996) Trends in the postmortem epidemiology of invasive fungal infections at a university hospital. J Infect 33: 23-32. 58. Vandewoude KH, Blot SI, Depuydt P, Benoit D, Temmerman W, et al. (2006) Clinical relevance of Aspergillus isolation from respiratory tract samples in critically ill patients. Crit Care 10: R31. 59. Almyroudis NG, Holland SM, Segal BH (2005) Invasive aspergillosis in primary immunodeficiencies. Med Mycol 43 Suppl 1: S247-259. 60. Antachopoulos C, Walsh TJ, Roilides E (2007) Fungal infections in primary immunodeficiencies. Eur J Pediatr 166: 1099-1117. 61. Kontoyiannis DP, Bodey GP (2002) Invasive aspergillosis in 2002: an update. Eur J Clin Microbiol Infect Dis 21: 161-172. 62. Meersseman W, Lagrou L, Maertens J, VanWijngaerden E (2007) Invasive aspergillosis in the intensive care unit. Clin Infect Dis 45: 205-216. 63. Munoz P, Guinea J, Bouza E (2006) Update on invasive aspergillosis: clinical and diagnostic aspects. Clin Microbiol Infect 12(Suppl 7): 24-39.

121

64. Gupta AO, Singh N (2011) Immune reconstitution syndrome and fungal infections. Curr Opin Infect Dis 24: 527-533. 65. Bodey G, Bueltmann B, Duguid W, Gibbs D, Hanak H, et al. (1992) Fungal infection in cancer patients: an international autopsy survey. Eur J Clin Microbiol Infect Dis 11: 99- 109. 66. Cagatay AA, Cosnan F, Karadeniz A, Besisik SK, Ozsut H, et al. (2008) The clinical and pharmacoeconomic analysis of invasive aspergillosis in adult patients with haematological diseases. Mycoses 51: 328-335. 67. Talbot GH, Bradley J, J E Edwards J, Gilbert D, Scheld M, et al. (2006) Bad bugs need drugs: an update on the development pipeline from the Antimicrobial Availability Task Force of the Infectious Diseases Society of America. Clin Infect Dis 42: 657-668. 68. Wingard J, Ribaud P, Schlamm H, Herbrecht R (2008) Changes in causes of death over time after treatment for invasive aspergillosis. Cancer 112: 2309-2312. 69. Ascioglu S, Rex JH, de Pauw B, Bennett JE, Bille J, et al. (2002) Defining opportunistic invasive fungal infections in immunocompromised patients with cancer and hematopoietic stem cell transplants: an international consensus. Clin Infect Dis 34: 7-14. 70. Marr KA, Carter RA, Boeckh M, Martin P, Corey L (2002) Invasive aspergillosis in allogeneic stem cell transplant recipients: changes in epidemiology and risk factors. Blood 100: 4358-4366. 71. Brakhage AA, Langfelder K (2002) Menacing mold: the molecular biology of Aspergillus fumigatus. Annu Rev Microbiol 56: 433-455. 72. Lewis RE (2011) Current concepts in antifungal pharmacology. Mayo Clin Proc 86: 805-817. 73. Wilson LS, Reyes CM, Stolpman M, Speckman J, Allen K, et al. (2002) The direct cost and incidence of systemic fungal infections. Value in Health 1: 26-34. 74. Brown SP, Cornforth DM, Mideo N (2012) Evolution of virulence in opportunistic pathogens: generalism, plasticity, and control. Trends Microbiol 20: 336-342. 75. Trucksis M, Galen JE, Michalski J, Fasano A, Kaper JB (1993) Accessory cholera enterotoxin (Ace), the third toxin of a Vibrio cholerae virulence cassette. Proc Natl Acad Sci U S A 90: 5267-5271. 76. Dramsi S, Bourdichon F, Cabanes D, Lecuit M, Fsihi H, et al. (2004) FbpA, a novel multifunctional Listeria monocytogenes virulence factor. Mol Microbiol 53: 639-649. 77. Latge JP (2001) The pathobiology of Aspergillus fumigatus. Trends Microbiol 9: 382-389. 78. Rementeria A, Lopez-Molina N, Ludwig A, Vivanco AB, Bikandi J, et al. (2005) Genes and molecules involved in Aspergillus fumigatus virulence. Rev Iberoam Micol 22: 1-23. 79. Ronning CM, Fedorova ND, Bowyer P, Coulson R, Goldman G, et al. (2005) Genomics of Aspergillus fumigatus. Rev Iberoam Micol 22: 223-228. 80. Weigt SS, Copeland CA, Derhovanessian A, Shino MY, Davis WA, et al. (2013) Colonization with small conidia Aspergillus species is associated with bronchiolitis obliterans syndrome: a two-center validation study. Am J Transplant 13: 919-927. 81. Abad A, Fernandez-Molina JV, Bikandi J, Ramirez A, Margareto J, et al. (2010) What makes Aspergillus fumigatus a successful pathogen? Genes and molecules involved in invasive aspergillosis. Rev Iberoam Micol 27: 155-182. 82. Beffa T, Staib F, Lott Fischer J, Lyon PF, Gumowski P, et al. (1998) Mycological control and surveillance of biological waste and compost. Med Mycol 36 Suppl 1: 137-145. 83. Ryckeboer J, Mergaert J, Coosemans J, Deprins K, Swings J (2003) Microbiological aspects of biowaste during composting in a monitored compost bin. J Appl Microbiol 94: 127- 137. 84. Paul A, Hackbarth S, Vogt RD, Roder B, Burnison BK, et al. (2004) Photogeneration of singlet oxygen by humic substances: comparison of humic substances of aquatic and terrestrial origin. Photochem Photobiol Sci 3: 273-280.

122

85. Ehrenshaft M, Jenns AE, Chung KR, Daub ME (1998) SOR1, a gene required for photosensitizer and singlet oxygen resistance in Cercospora fungi, is highly conserved in divergent organisms. Mol Cell 1: 603-609. 86. Cooperband L (2002) The Art and Science of Composting: A Resource for Farmers and Compost Producers. University of Wisconsin-Madison. Center for Integrated Agricultural Systems. 87. Wang W, Wang X, Liu J, Ishii M, Igarashi Y, et al. (2007) Effect of oxygen concentration on the composting process and maturity. Compost science & utilization 15: 184-190. 88. Askew DS (2008) Aspergillus fumigatus: virulence genes in a street-smart mold. Curr Opin Microbiol 11: 331-337. 89. Mylonakis E, Casadevall A, Ausubel FM (2007) Exploiting amoeboid and non-vertebrate animal model systems to study the virulence of human pathogenic fungi. PLoS Pathog 3: e101. 90. Wagener J, Echtenacher B, Rohde M, Kotz A, Krappmann S, et al. (2008) The putative alpha-1,2-mannosyltransferase AfMnt1 of the opportunistic fungal pathogen Aspergillus fumigatus is required for cell wall stability and full virulence. Eukaryot Cell 7: 1661-1673. 91. Bhabhra R, Askew DS (2005) Thermotolerance and virulence of Aspergillus fumigatus: role of the fungal nucleolus. Med Mycol 43 Suppl 1: S87-93. 92. Bhabhra R, Miley MD, Mylonakis E, Boettner D, Fortwendel J, et al. (2004) Disruption of the Aspergillus fumigatus gene encoding nucleolar protein CgrA impairs thermotolerant growth and reduces virulence. Infect Immun 72: 4731-4740. 93. Paris S, Wysong D, Debeaupuis J-P, Shibuya K, Philippe B, et al. (2003) Catalases of Aspergillus fumigatus. Infect Immun 71: 3551-3562. 94. Frealle E, Aliouat-Denis CM, Delhaes L, Hot D, Dei-Cas E (2013) Transcriptomic insights into the oxidative response of stress-exposed Aspergillus fumigatus. Curr Pharm Des 19: 3713-3737. 95. Fang FC (2011) Antimicrobial actions of reactive oxygen species. MBio 2. 96. Henriet S, Verweij PE, Holland SM, Warris A (2013) Invasive fungal infections in patients with chronic granulomatous disease. Adv Exp Med Biol 764: 27-55. 97. Grahl N, Shepardson KM, Chung D, Cramer RA (2012) Hypoxia and fungal pathogenesis: to air or not to air? Eukaryot Cell 11: 560-570. 98. Willger SD, Puttikamonkul S, Kim KH, Burritt JB, Grahl N, et al. (2008) A sterol-regulatory element binding protein is required for cell polarity, hypoxia adaptation, azole drug resistance, and virulence in Aspergillus fumigatus. PLoS Pathog 4: e1000200. 99. Weinberg ED (1999) The role of iron in protozoan and fungal infectious diseases. J Eukaryot Microbiol 46: 231-238. 100. Weiss G (2002) Iron and immunity: a double-edged sword. Eur J Clin Invest 32 Suppl 1: 70-78. 101. Tapiero H, Tew KD (2003) Trace elements in human physiology and pathology: zinc and metallothioneins. Biomed Pharmacother 57: 399-411. 102. McDonagh A, Fedorova ND, Crabtree J, Yu Y, Kim S, et al. (2008) Sub-telomere directed gene expression during initiation of invasive aspergillosis. PLoS Pathog 4: e1000154. 103. Jaton-Ogay K, Paris S, Huerre M, Quadroni M, Falchetto R, et al. (1994) Cloning and disruption of the gene encoding an extracellular metalloprotease of Aspergillus fumigatus. Mol Microbiol 14: 917-928. 104. Reichard U, Cole GT, Hill TW, Ruchel R, Monod M (2000) Molecular characterization and influence on fungal development of ALP2, a novel serine protease from Aspergillus fumigatus. Int J Med Microbiol 290: 549-558. 105. Tang CM, Cohen J, Krausz T, VanNoorden S, Holden DW (1993) The alkaline protease of Aspergillus fumigatus is not a virulence factor in two murine models of invasive pulmonary aspergillosis. Infect Immun 61: 1650-1656.

123

106. Panepinto JC, Oliver BG, Fortwendel JR, Smith DL, Askew DS, et al. (2003) Deletion of the Aspergillus fumigatus gene encoding the Ras-related protein RhbA reduces virulence in a model of Invasive pulmonary aspergillosis. Infect Immun 71: 2819-2826. 107. Krappmann S, Bignell EM, Reichard U, Rogers T, Haynes K, et al. (2004) The Aspergillus fumigatus transcriptional activator CpcA contributes significantly to the virulence of this fungal pathogen. Mol Microbiol 52: 785-799. 108. Hissen AH, Wan AN, Warwas ML, Pinto LJ, Moore MM (2005) The Aspergillus fumigatus siderophore biosynthetic gene sidA, encoding L-ornithine N5-oxygenase, is required for virulence. Infect Immun 73: 5493-5503. 109. Schrettl M, Bignell E, Kragl C, Joechl C, Rogers T, et al. (2004) Siderophore biosynthesis but not reductive iron assimilation is essential for Aspergillus fumigatus virulence. J Exp Med 200. 110. Schrettl M, Bignell E, Kragl C, Sabiha Y, Loss O, et al. (2007) Distinct roles for intra- and extracellular siderophores during Aspergillus fumigatus infection. PLoS Pathog 3: 1195- 1207. 111. Moreno MA, Ibrahim-Granet O, Vicentefranqueira R, Amich J, Ave P, et al. (2007) The regulation of zinc homeostasis by the ZafA transcriptional activator is essential for Aspergillus fumigatus virulence. Mol Microbiol 64: 1182-1197. 112. Conesa A, Punt PJ, van Luijk N, van den Hondel CA (2001) The secretion pathway in filamentous fungi: a biotechnological view. Fungal Genet Biol 33: 155-171. 113. Burgoyne RD (1988) Yeast mutants illuminate the secretory pathway. Trends Biochem Sci 13: 241-242. 114. Penalva MA, Galindo A, Abenza JF, Pinar M, Calcagno-Pizarelli AM, et al. (2012) Searching for gold beyond mitosis: Mining intracellular membrane traffic in Aspergillus nidulans. Cell Logist 2: 2-14. 115. Hubbard MA, Kaminskyj SG (2008) Rapid tip-directed movement of Golgi equivalents in growing Aspergillus nidulans hyphae suggests a mechanism for delivery of growth- related materials. Microbiology 154: 1544-1553. 116. Saloheimo M, Pakula TM (2012) The cargo and the transport system: secreted proteins and protein secretion in Trichoderma reesei (Hypocrea jecorina). Microbiology 158: 46- 57. 117. Maruyama J, Kitamoto K (2007) Differential distribution of the endoplasmic reticulum network in filamentous fungi. FEMS Microbiol Lett 272: 1-7. 118. Read ND (2011) Exocytosis and growth do not occur only at hyphal tips. Mol Microbiol 81: 4-7. 119. Taheri-Talesh N, Horio T, Araujo-Bazan L, Dou X, Espeso EA, et al. (2008) The tip growth apparatus of Aspergillus nidulans. Mol Biol Cell 19: 1439-1449. 120. Sudbery P (2011) Fluorescent proteins illuminate the structure and function of the hyphal tip apparatus. Fungal Genet Biol 48: 849-857. 121. Riquelme M, Yarden O, Bartnicki-Garcia S, Bowman B, Castro-Longoria E, et al. (2011) Architecture and development of the Neurospora crassa hypha -- a model cell for polarized growth. Fungal Biol 115: 446-474. 122. Arkowitz RA, Bassilana M (2011) Polarized growth in fungi: symmetry breaking and hyphal formation. Semin Cell Dev Biol 22: 806-815. 123. Berka RM, Kodama KH, Rey MW, Wilson LJ, Ward M (1991) The development of Aspergillus niger var. awamori as a host for the expression and secretion of heterologous gene products. Biochem Soc Trans 19: 681-685. 124. Finkelstein DB (1987) Improvement of enzyme production in Aspergillus. Antonie Van Leeuwenhoek 53: 349-352.

124

125. Lu X, Sun J, Nimtz M, Wissing J, Zeng AP, et al. (2010) The intra- and extracellular proteome of Aspergillus niger growing on defined medium with xylose or maltose as carbon substrate. Microb Cell Fact 9: 23. 126. Nierman WC, Pain A, Anderson MJ, Wortman JR, Kim HS, et al. (2005) Genomic sequence of the pathogenic and allergenic filamentous fungus Aspergillus fumigatus. Nature 438: 1151-1156. 127. Robson GD, Huang J, Wortman J, Archer DB (2005) A preliminary analysis of the process of protein secretion and the diversity of putative secreted hydrolases encoded in Aspergillus fumigatus: insights from the genome. Med Mycol 43 Suppl 1: S41-47. 128. Machida M, Asai K, Sano M, Tanaka T, Kumagai T, et al. (2005) Genome sequencing and analysis of Aspergillus oryzae. Nature 438: 1157-1161. 129. Nierman WC, Pain A, Anderson MJ, Wortman JR, Kim HS, et al. (2005) Genomic sequence of the pathogenic and allergenic filamentous fungus Aspergillus fumigatus. Nature 438: 1151-1156. 130. Wosten HA, Moukha SM, Sietsma JH, Wessels JG (1991) Localization of growth and secretion of proteins in Aspergillus niger. J Gen Microbiol 137: 2017-2023. 131. Moukha SM, Wosten HA, Asther M, Wessels JG (1993) In situ localization of the secretion of lignin peroxidases in colonies of Phanerochaete chrysosporium using a sandwiched mode of culture. J Gen Microbiol 139: 969-978. 132. Momany M (2002) Polarity in filamentous fungi: establishment, maintenance and new axes. Curr Opin Microbiol 5: 580-585. 133. Steinberg G (2007) Hyphal growth: a tale of motors, lipids, and the Spitzenkorper. Eukaryot Cell 6: 351-360. 134. Cyr DMDH. Protein quality control - linking the unfolded protein response to disease; 2009 23 October 2009. EMBO reports. pp. 1206-1210. 135. Anelli T, Sitia R (2008) Protein quality control in the early secretory pathway. Embo J 27: 315-327. 136. Helenius A, Aebi M (2004) Roles of N-linked glycans in the endoplasmic reticulum. Annu Rev Biochem 73: 1019-1049. 137. Caramelo JJ, Parodi AJ (2008) Getting in and out from calnexin/calreticulin cycles. J Biol Chem 283: 10221-10225. 138. Tabas I, Kornfeld S (1982) N-asparagine-linked oligosaccharides: processing. Methods Enzymol 83: 416-429. 139. Hammond C, Braakman I, Helenius A (1994) Role of N-linked oligosaccharide recognition, glucose trimming, and calnexin in glycoprotein folding and quality control. Proc Natl Acad Sci U S A 91: 913-917. 140. Ihara Y, Cohen-Doyle MF, Saito Y, Williams DB (1999) Calnexin discriminates between protein conformational states and functions as a molecular chaperone in vitro. Mol Cell 4: 331-341. 141. Parodi AJ (2000) Protein glucosylation and its role in protein folding. Annu Rev Biochem 69: 69-93. 142. De Pourcq K, De Schutter K, Callewaert N Engineering of glycosylation in yeast and other fungi: current state and perspectives. Appl Microbiol Biotechnol 87: 1617-1631. 143. Kruszewska JS, Perlinska-Lenart U, Gorka-Niec W, Orlowski J, Zembek P, et al. (2008) Alterations in protein secretion caused by metabolic engineering of glycosylation pathways in fungi. Acta Biochim Pol 55: 447-456. 144. Peberdy JF (1994) Protein secretion in filamentous fungi--trying to understand a highly productive black box. Trends Biotechnol 12: 50-57. 145. Helenius A, Trombetta ES, Hebert DN, Simons JF (1997) Calnexin, calreticulin and the folding of glycoproteins. Trends in Cell Biology 7: 193-200.

125

146. Ragnini-Wilson A (1999) How to get to the right place at the right time: Rab/Ypt small GTPases and vesicle transport. Protoplasma 209: 19-27. 147. Sitia R, Braakman I (2003) Quality control in the endoplasmic reticulum protein factory. Nature 426: 891-894. 148. Salminen A, Novick PJ (1987) A ras-like protein is required for a post-Golgi event in yeast secretion. Cell 49: 527-538. 149. Brodsky JL (2012) Cleaning up: ER-associated degradation to the rescue. Cell 151: 1163- 1167. 150. Banerjee S, Vishwanath P, Cui J, Kelleher DJ, Gilmore R, et al. (2007) The evolution of N- glycan-dependent endoplasmic reticulum quality control factors for glycoprotein folding and degradation. Proc Natl Acad Sci U S A 104: 11676-11681. 151. Meusser B, Hirsch C, Jarosch E, Sommer T (2005) ERAD: the long road to destruction. Nat Cell Biol 7: 766-772. 152. Matsumoto R, Akama K, Rakwal R, Iwahashi H (2005) The stress response against denatured proteins in the deletion of cytosolic chaperones SSA1/2 is different from heat- shock response in Saccharomyces cerevisiae. BMC Genomics 6: 141. 153. Kasuya T, Nakajima H, Kitamoto K (1999) Cloning and characterization of the bipA gene encoding ER chaperone BiP from Aspergillus oryzae. J Biosci Bioeng 88: 472-478. 154. Holtz WA, Turetzky JM, Jong YJ, O'Malley KL (2006) Oxidative stress-triggered unfolded protein response is upstream of intrinsic cell death evoked by parkinsonian mimetics. J Neurochem 99: 54-69. 155. Yan M, Shen J, Person MD, Kuang X, Lynn WS, et al. (2008) Endoplasmic reticulum stress and unfolded protein response in Atm-deficient thymocytes and thymic lymphoma cells are attributable to oxidative stress. Neoplasia 10: 160-167. 156. Feldman DE, Chauhan V, Koong AC (2005) The unfolded protein response: a novel component of the hypoxic stress response in tumors. Mol Cancer Res 3: 597-605. 157. Koumenis C (2006) ER stress, hypoxia tolerance and tumor progression. Curr Mol Med 6: 55-69. 158. Romisch K (2004) A cure for traffic jams: small molecule chaperones in the endoplasmic reticulum. Traffic 5: 815-820. 159. Malhotra JD, Kaufman RJ (2007) The endoplasmic reticulum and the unfolded protein response. Semin Cell Dev Biol 18: 716-731. 160. Hetz C (2012) The unfolded protein response: controlling cell fate decisions under ER stress and beyond. Nat Rev Mol Cell Biol 13: 89-102. 161. Kaufman RJ, Scheuner D, Schroder M, Shen X, Lee K, et al. (2002) The unfolded protein response in nutrient sensing and differentiation. Nat Rev Mol Cell Biol 3: 411-421. 162. Papa FR, Zhang C, Shokat K, Walter P (2003) Bypassing a kinase activity with an ATP- competitive drug. Science 302: 1533-1537. 163. Shamu CE, Walter P (1996) Oligomerization and phosphorylation of the Ire1p kinase during intracellular signaling from the endoplasmic reticulum to the nucleus. EMBO J 15: 3028-3039. 164. Lee K, Tirasophon W, Shen X, Michalak M, Prywes R, et al. (2002) IRE1-mediated unconventional mRNA splicing and S2P-mediated ATF6 cleavage merge to regulate XBP1 in signaling the unfolded protein response. Genes Dev 16: 452-466. 165. Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K (2001) XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 107: 881-891. 166. Chakrabarti A, Chen AW, Varner JD (2011) A review of the mammalian unfolded protein response. Biotechnol Bioeng 108: 2777-2793.

126

167. Lu PD, Harding HP, Ron D (2004) Translation reinitiation at alternative open reading frames regulates gene expression in an integrated stress response. J Cell Biol 167: 27- 33. 168. Chen X, Shen J, Prywes R (2002) The luminal domain of ATF6 senses endoplasmic reticulum (ER) stress and causes translocation of ATF6 from the ER to the Golgi. J Biol Chem 277: 13045-13052. 169. Haze K, Yoshida H, Yanagi H, Yura T, Mori K (1999) Mammalian transcription factor ATF6 is synthesized as a transmembrane protein and activated by proteolysis in response to endoplasmic reticulum stress. Mol Biol Cell 10: 3787-3799. 170. Shen J, Prywes R (2004) Dependence of site-2 protease cleavage of ATF6 on prior site-1 protease digestion is determined by the size of the luminal domain of ATF6. J Biol Chem 279: 43046-43051. 171. Ye J, Rawson RB, Komuro R, Chen X, Dave UP, et al. (2000) ER stress induces cleavage of membrane-bound ATF6 by the same proteases that process SREBPs. Mol Cell 6: 1355-1364. 172. Mori K (2009) Signalling pathways in the unfolded protein response: development from yeast to mammals. J Biochem 146: 743-750. 173. Li H, Korennykh AV, Behrman SL, Walter P (2010) Mammalian endoplasmic reticulum stress sensor IRE1 signals by dynamic clustering. Proc Natl Acad Sci U S A 107: 16113- 16118. 174. Mori K, Ma W, Gething MJ, Sambrook J (1993) A transmembrane protein with a cdc2+/CDC28-related kinase activity is required for signaling from the ER to the nucleus. Cell 74: 743-756. 175. Cox JS, Shamu CE, Walter P (1993) Transcriptional induction of genes encoding endoplasmic reticulum resident proteins requires a transmembrane protein kinase. Cell 73: 1197-1206. 176. Cox JS, Walter P (1996) A novel mechanism for regulating activity of a transcription factor that controls the unfolded protein response. Cell 87: 391-404. 177. Back SH, Schroder M, Lee K, Zhang K, Kaufman RJ (2005) ER stress signaling by regulated splicing: IRE1/HAC1/XBP1. Methods 35: 395-416. 178. Travers KJ, Patil CK, Wodicka L, Lockhart DJ, Weissman JS, et al. (2000) Functional and genomic analyses reveal an essential coordination between the unfolded protein response and ER-associated degradation. Cell 101: 249-258. 179. Richie DL, Hartl L, Aimanianda V, Winters MS, Fuller KK, et al. (2009) A role for the unfolded protein response (UPR) in virulence and antifungal susceptibility in Aspergillus fumigatus. PLoS Pathog 5: e1000258. 180. Chang HJ, Jesch SA, Gaspar ML, Henry SA (2004) Role of the unfolded protein response pathway in secretory stress and regulation of INO1 expression in Saccharomyces cerevisiae. Genetics 168: 1899-1913. 181. Backer MV, Backer JM, Chinnaiyan P (2011) Targeting the unfolded protein response in cancer therapy. Methods Enzymol 491: 37-56. 182. Koong AC, Chauhan V, Romero-Ramirez L (2006) Targeting XBP-1 as a novel anti-cancer strategy. Cancer Biol Ther 5: 756-759. 183. Ozdemir T, Nar R, Kilinc V, Alacam H, Salis O, et al. (2012) Ouabain targets the unfolded protein response for selective killing of HepG2 cells during glucose deprivation. Cancer Biother Radiopharm 27: 457-463. 184. Vincenz L, Jager R, O'Dwyer M, Samali A (2013) Endoplasmic Reticulum Stress and the Unfolded Protein Response: Targeting the Achilles Heel of Multiple Myeloma. Mol Cancer Ther. 185. Wang G, Yang ZQ, Zhang K (2010) Endoplasmic reticulum stress response in cancer: molecular mechanism and therapeutic potential. Am J Transl Res 2: 65-74.

127

186. Teicher BA, Ara G, Herbst R, Palombella VJ, Adams J (1999) The proteasome inhibitor PS-341 in cancer therapy. Clin Cancer Res 5: 2638-2645. 187. Zhang J, Wu P, Hu Y (2013) Clinical and marketed proteasome inhibitors for cancer treatment. Curr Med Chem 20: 2537-2551. 188. White-Gilbertson S, Hua Y, Liu B (2013) The role of endoplasmic reticulum stress in maintaining and targeting multiple myeloma: a double-edged sword of adaptation and apoptosis. Frontiers in Genetics 4. 189. Reichard U, Buttner S, Eiffert H, Staib F, Ruchel R (1990) Purification and characterisation of an extracellular serine proteinase from Aspergillus fumigatus and its detection in tissue. J Med Microbiol 33: 243-251. 190. Reichard U, Eiffert H, Ruchel R (1994) Purification and characterization of an extracellular aspartic proteinase from Aspergillus fumigatus. J Med Vet Mycol 32: 427-436. 191. Moutaouakil M, Monod M, Prevost MC, Bouchara JP, Paris S, et al. (1993) Identification of the 33-kDa alkaline protease of Aspergillus fumigatus in vitro and in vivo. J Med Microbiol 39: 393-399. 192. Denning DW, Stevens DA (1990) Antifungal and surgical treatment of invasive aspergillosis: review of 2,121 published cases. Rev Infect Dis 12: 1147-1201. 193. Graf A, Gasser B, Dragosits M, Sauer M, Leparc GG, et al. (2008) Novel insights into the unfolded protein response using Pichia pastoris specific DNA microarrays. BMC Genomics 9: 390. 194. Guillemette T, van Peij N, Goosen T, Lanthaler K, Robson GD, et al. (2007) Genomic analysis of the secretion stress response in the enzyme-producing cell factory Aspergillus niger. BMC Genomics 8: 158. 195. Jacobs DI, Olsthoorn MM, Maillet I, Akeroyd M, Breestraat S, et al. (2009) Effective lead selection for improved protein production in Aspergillus niger based on integrated genomics. Fungal Genet Biol 46 Suppl 1: S141-152. 196. Jorgensen TR, Goosen T, Hondel CA, Ram AF, Iversen JJ (2009) Transcriptomic comparison of Aspergillus niger growing on two different sugars reveals coordinated regulation of the secretory pathway. BMC Genomics 10: 44. 197. Makarow M, Hanninen AL, Suntio T, Bastos RN (2006) Production of heterologous proteins in yeast with the aid of the Hsp150delta carrier. Methods Mol Biol 313: 333-343. 198. Mattanovich D, Gasser B, Hohenblum H, Sauer M (2004) Stress in recombinant protein producing yeasts. J Biotechnol 113: 121-135. 199. Smith JD, Robinson AS (2002) Overexpression of an archaeal protein in yeast: secretion bottleneck at the ER. Biotechnol Bioeng 79: 713-723. 200. Gasser B, Saloheimo M, Rinas U, Dragosits M, Rodriguez-Carmona E, et al. (2008) Protein folding and conformational stress in microbial cells producing recombinant proteins: a host comparative overview. Microb Cell Fact 7: 11. 201. Richie DL, Feng X, Hartl L, Aimanianda V, Krishnan K, et al. (2011) The virulence of the opportunistic fungal pathogen Aspergillus fumigatus requires cooperation between the endoplasmic reticulum-associated degradation pathway (ERAD) and the unfolded protein response (UPR). Virulence 2: 12-21. 202. Joubert A, Simoneau P, Campion C, Bataille-Simoneau N, Iacomi-Vasilescu B, et al. (2011) Impact of the unfolded protein response on the pathogenicity of the necrotrophic fungus Alternaria brassicicola. Mol Microbiol. 203. Cheon SA, Jung KW, Chen YL, Heitman J, Bahn YS, et al. (2011) Unique evolution of the UPR pathway with a novel bZIP transcription factor, Hxl1, for controlling pathogenicity of Cryptococcus neoformans. PLoS Pathog 7: e1002177. 204. Miyazaki T, Nakayama H, Nagayoshi Y, Kakeya H, Kohno S (2013) Dissection of Ire1 functions reveals stress response mechanisms uniquely evolved in Candida glabrata. PLoS Pathog 9: e1003160.

128

205. Wimalasena TT, Enjalbert B, Guillemette T, Plumridge A, Budge S, et al. (2008) Impact of the unfolded protein response upon genome-wide expression patterns, and the role of Hac1 in the polarized growth, of Candida albicans. Fungal Genet Biol 45: 1235-1247. 206. Yi M, Chi MH, Khang CH, Park SY, Kang S, et al. (2009) The ER chaperone LHS1 is involved in asexual development and rice infection by the blast fungus Magnaporthe oryzae. Plant Cell 21: 681-695. 207. Craven RA, Egerton M, Stirling CJ (1996) A novel Hsp70 of the yeast ER lumen is required for the efficient translocation of a number of protein precursors. EMBO J 15: 2640-2650. 208. Tyson JR, Stirling CJ (2000) LHS1 and SIL1 provide a lumenal function that is essential for protein translocation into the endoplasmic reticulum. EMBO J 19: 6440-6452. 209. Kimura S, Maruyama J, Watanabe T, Ito Y, Arioka M, et al. In vivo imaging of endoplasmic reticulum and distribution of mutant alpha-amylase in Aspergillus oryzae. Fungal Genet Biol 47: 1044-1054. 210. Parlati F, Dominguez M, Bergeron JJ, Thomas DY (1995) Saccharomyces cerevisiae CNE1 encodes an endoplasmic reticulum (ER) membrane protein with sequence similarity to calnexin and calreticulin and functions as a constituent of the ER quality control apparatus. J Biol Chem 270: 244-253. 211. Wang H, Entwistle J, Morlon E, Archer DB, Peberdy JF, et al. (2003) Isolation and characterisation of a calnexin homologue, clxA, from Aspergillus niger. Mol Genet Genomics 268: 684-691. 212. Parlati F, Dignard D, Bergeron JJ, Thomas DY (1995) The calnexin homologue cnx1+ in Schizosaccharomyces pombe, is an essential gene which can be complemented by its soluble ER domain. Embo J 14: 3064-3072. 213. Labriola C, Cazzulo JJ, Parodi AJ (1995) Retention of glucose units added by the UDP- GLC:glycoprotein glucosyltransferase delays exit of glycoproteins from the endoplasmic reticulum. J Cell Biol 130: 771-779. 214. D'Alessio C, Fernandez F, Trombetta ES, Parodi AJ (1999) Genetic evidence for the heterodimeric structure of glucosidase II. The effect of disrupting the subunit-encoding genes on glycoprotein folding. J Biol Chem 274: 25899-25905. 215. Branza-Nichita N, Petrescu AJ, Dwek RA, Wormald MR, Platt FM, et al. (1999) Tyrosinase folding and copper loading in vivo: a crucial role for calnexin and alpha-glucosidase II. Biochem Biophys Res Commun 261: 720-725. 216. Zhang JX, Braakman I, Matlack KE, Helenius A (1997) Quality control in the secretory pathway: the role of calreticulin, calnexin and BiP in the retention of glycoproteins with C-terminal truncations. Mol Biol Cell 8: 1943-1954. 217. Mora-Montes HM, Bates S, Netea MG, Diaz-Jimenez DF, Lopez-Romero E, et al. (2007) Endoplasmic reticulum alpha-glycosidases of Candida albicans are required for N glycosylation, cell wall integrity, and normal host-fungus interaction. Eukaryot Cell 6: 2184-2193. 218. Bruckmann A, Kunkel W, Hartl A, Wetzker R, Eck R (2000) A phosphatidylinositol 3-kinase of Candida albicans influences adhesion, filamentous growth and virulence. Microbiology 146 ( Pt 11): 2755-2764. 219. Franke K, Nguyen M, Hartl A, Dahse HM, Vogl G, et al. (2006) The vesicle transport protein Vac1p is required for virulence of Candida albicans. Microbiology 152: 3111- 3121. 220. Dou X, Wang Q, Qi Z, Song W, Wang W, et al. (2011) MoVam7, a conserved SNARE involved in vacuole assembly, is required for growth, endocytosis, ROS accumulation, and pathogenesis of Magnaporthe oryzae. PLoS One 6: e16439. 221. Song W, Dou X, Qi Z, Wang Q, Zhang X, et al. (2010) R-SNARE homolog MoSec22 is required for conidiogenesis, cell wall integrity, and pathogenesis of Magnaporthe oryzae. PLoS One 5: e13193.

129

222. Rutkevich LA, Williams DB (2011) Participation of lectin chaperones and thiol oxidoreductases in protein folding within the endoplasmic reticulum. Curr Opin Cell Biol 23: 157-166. 223. (1997) Calnexin, calreticulin and the folding of glycoproteins. Trends Cell Biol 7: 193-200. 224. Xu X, Azakami H, Kato A (2004) P-domain and lectin site are involved in the chaperone function of Saccharomyces cerevisiae calnexin homologue. FEBS Lett 570: 155-160. 225. Jannatipour M, Rokeach LA (1995) The Schizosaccharomyces pombe homologue of the chaperone calnexin is essential for viability. J Biol Chem 270: 4845-4853. 226. Cove DJ (1966) The induction and repression of nitrate reductase in the fungus Aspergillus nidulans. Biochim Biophys Acta 113: 51-56. 227. Richie DL, Fuller KK, Fortwendel J, Miley MD, McCarthy JW, et al. (2007) Unexpected link between metal ion deficiency and autophagy in Aspergillus fumigatus. Eukaryot Cell 6: 2437-2447. 228. Catlett N, Lee B, Yoder O, Turgeon B (2002) Split-marker recombination for efficient targeted deletion of Fungal genes. Fungal Genet Newsl 50: 9-11. 229. Watson DS, Feng X, Askew DS, Jambunathan K, Kodukula K, et al. (2011) Substrate Specifity Profiling of the Aspergillus fumigatus Proteolytic Secretome Reveals Consensus Motifs with Predominance of Ile/Leu and Phe/Tyr. PLoS One 6: e21001. 230. King JY, Ferrara R, Tabibiazar R, Spin JM, Chen MM, et al. (2005) Pathway analysis of coronary atherosclerosis. Physiol Genomics 23: 103-118. 231. Kimura S, Maruyama J, Watanabe T, Ito Y, Arioka M, et al. (2010) In vivo imaging of endoplasmic reticulum and distribution of mutant alpha-amylase in Aspergillus oryzae. Fungal Genet Biol 47: 1044-1054. 232. Arima H, Kinoshita T, Ibrahim HR, Azakami H, Kato A (1998) Enhanced secretion of hydrophobic peptide fused lysozyme by the introduction of N-glycosylation signal and the disruption of calnexin gene in Saccharomyces cerevisiae. FEBS Lett 440: 89-92. 233. Hajjar F, Beauregard PB, Rokeach LA (2007) The 160 N-terminal residues of calnexin define a novel region supporting viability in Schizosaccharomyces pombe. Yeast 24: 89- 103. 234. Song Y, Azakami H, Shamima B, He J, Kato A (2002) Different effects of calnexin deletion in Saccharomyces cerevisiae on the secretion of two glycosylated amyloidogenic lysozymes. FEBS Lett 512: 213-217. 235. Marechal A, Tanguay PL, Callejo M, Guerin R, Boileau G, et al. (2004) Cell viability and secretion of active proteins in Schizosaccharomyces pombe do not require the chaperone function of calnexin. Biochem J 380: 441-448. 236. Chen KS, Lin YS, Yang SS (2007) Application of thermotolerant microorganisms for biofertilizer preparation. J Microbiol Immunol Infect 40: 462-473. 237. Chang YC, Tsai HF, Karos M, Kwon-Chung KJ (2004) THTA, a thermotolerance gene of Aspergillus fumigatus. Fungal Genet Biol 41: 888-896. 238. Shahinian S, Dijkgraaf GJ, Sdicu AM, Thomas DY, Jakob CA, et al. (1998) Involvement of protein N-glycosyl chain glucosylation and processing in the biosynthesis of cell wall beta-1,6-glucan of Saccharomyces cerevisiae. Genetics 149: 843-856. 239. Ghosh K, Dill K Cellular proteomes have broad distributions of protein stability. Biophys J 99: 3996-4002. 240. Guillemette T, van Peij NN, Goosen T, Lanthaler K, Robson GD, et al. (2007) Genomic analysis of the secretion stress response in the enzyme-producing cell factory Aspergillus niger. BMC Genomics 8: 158. 241. Kokame K, Agarwala KL, Kato H, Miyata T (2000) Herp, a new ubiquitin-like membrane protein induced by endoplasmic reticulum stress. J Biol Chem 275: 32846-32853. 242. Nebenfuhr A, Ritzenthaler C, Robinson DG (2002) Brefeldin A: deciphering an enigmatic inhibitor of secretion. Plant Physiol 130: 1102-1108.

130

243. Fleck CB, Schobel F, Brock M (2011) Nutrient acquisition by pathogenic fungi: nutrient availability, pathway regulation, and differences in substrate utilization. Int J Med Microbiol 301: 400-407. 244. Inoue Y, Klionsky DJ (2010) Regulation of macroautophagy in Saccharomyces cerevisiae. Semin Cell Dev Biol 21: 664-670. 245. Geschwind JF, Georgiades CS, Ko YH, Pedersen PL (2004) Recently elucidated energy catabolism pathways provide opportunities for novel treatments in hepatocellular carcinoma. Expert Rev Anticancer Ther 4: 449-457. 246. Schrettl M, Beckmann N, Varga J, Heinekamp T, Jacobsen ID, et al. (2010) HapX- mediated adaption to iron starvation is crucial for virulence of Aspergillus fumigatus. PLoS Pathog 6. 247. Ellis CD, Wang F, MacDiarmid CW, Clark S, Lyons T, et al. (2004) Zinc and the Msc2 zinc transporter protein are required for endoplasmic reticulum function. J Cell Biol 166: 325- 335. 248. Nguyen QB, Kadotani N, Kasahara S, Tosa Y, Mayama S, et al. (2008) Systematic functional analysis of calcium-signalling proteins in the genome of the rice-blast fungus, Magnaporthe oryzae, using a high-throughput RNA-silencing system. Mol Microbiol 68: 1348-1365. 249. Kabcenell AK, Goud B, Northup JK, Novick PJ (1990) Binding and hydrolysis of guanine nucleotides by Sec4p, a yeast protein involved in the regulation of vesicular traffic. J Biol Chem 265: 9366-9372. 250. Haubruck H, Engelke U, Mertins P, Gallwitz D (1990) Structural and functional analysis of ypt2, an essential ras-related gene in the fission yeast Schizosaccharomyces pombe encoding a Sec4 protein homologue. EMBO J 9: 1957-1962. 251. Craighead MW, Bowden S, Watson R, Armstrong J (1993) Function of the ypt2 gene in the exocytic pathway of Schizosaccharomyces pombe. Mol Biol Cell 4: 1069-1076. 252. Yoneda A, Doering TL (2006) A eukaryotic capsular polysaccharide is synthesized intracellularly and secreted via exocytosis. Mol Biol Cell 17: 5131-5140. 253. Monteoliva L, Sanchez M, Pla J, Gil C, Nombela C (1996) Cloning of Candida albicans SEC14 gene homologue coding for a putative essential function. Yeast 12: 1097-1105. 254. Siriputthaiwan P, Jauneau A, Herbert C, Garcin D, Dumas B (2005) Functional analysis of CLPT1, a Rab/GTPase required for protein secretion and pathogenesis in the plant fungal pathogen Colletotrichum lindemuthianum. J Cell Sci 118: 323-329. 255. Segal BH (2009) Aspergillosis. N Engl J Med 360: 1870-1884. 256. Punt PJ, Seiboth B, Weenink XO, van Zeijl C, Lenders M, et al. (2001) Identification and characterization of a family of secretion-related small GTPase-encoding genes from the filamentous fungus Aspergillus niger: a putative SEC4 homologue is not essential for growth. Mol Microbiol 41: 513-525. 257. Catlett NL, Lee B-N, Yoder OC, Turgeon BG (2002) Split-marker recombination for efficient targeted deletion of fungal genes. Fungal Genet News 50: 9-11. 258. Jiang SY, Ramachandran S (2006) Comparative and evolutionary analysis of genes encoding small GTPases and their activating proteins in eukaryotic genomes. Physiol Genomics 24: 235-251. 259. Calero G, Gupta P, Nonato MC, Tandel S, Biehl ER, et al. (2003) The crystal structure of palmitoyl protein thioesterase-2 (PPT2) reveals the basis for divergent substrate specificities of the two lysosomal thioesterases, PPT1 and PPT2. J Biol Chem 278: 37957-37964. 260. Cook SM, McArthur JD (2013) Developing Galleria mellonella as a model host for human pathogens. Virulence 4: 350-353.

131

261. Slater JL, Gregson L, Denning DW, Warn PA (2011) Pathogenicity of Aspergillus fumigatus mutants assessed in Galleria mellonella matches that in mice. Med Mycol 49 Suppl 1: S107-113. 262. Mylonakis E (2008) Galleria mellonella and the study of fungal pathogenesis: making the case for another genetically tractable model host. Mycopathologia 165: 1-3. 263. Jackson JC, Higgins LA, Lin X (2009) Conidiation color mutants of Aspergillus fumigatus are highly pathogenic to the heterologous insect host Galleria mellonella. PLoS One 4: e4224. 264. Joubert A, Simoneau P, Campion C, Bataille-Simoneau N, Iacomi-Vasilescu B, et al. (2011) Impact of the unfolded protein response on the pathogenicity of the necrotrophic fungus Alternaria brassicicola. Mol Microbiol 79: 1305-1324. 265. Krishnan K, Feng X, Powers-Fletcher MV, Bick G, Richie DL, et al. (2013) Effects of a defective endoplasmic reticulum-associated degradation (ERAD) pathway on the stress response, virulence and antifungal drug susceptibility of the mold pathogen Aspergillus fumigatus. Eukaryot Cell. 266. Feng X, Krishnan K, Richie DL, Aimanianda V, Hartl L, et al. (2011) HacA-independent functions of the ER stress sensor IreA synergize with the canonical UPR to influence virulence traits in Aspergillus fumigatus. PLoS Pathog 7: e1002330. 267. Yoo JS, Grabowski R, Xing L, Trepte HH, Schmitt HD, et al. (1999) Functional implications of genetic interactions between genes encoding small GTPases involved in vesicular transport in yeast. Mol Gen Genet 261: 80-91. 268. Gerassimenko OG (1994) Yeast ts secretory mutation rgs1 is suppressed by the SEC4 gene of Saccharomyces cerevisiae. Curr Genet 25: 178-179. 269. Ortiz D, Medkova M, Walch-Solimena C, Novick P (2002) Ypt32 recruits the Sec4p guanine nucleotide exchange factor, Sec2p, to secretory vesicles; evidence for a Rab cascade in yeast. J Cell Biol 157: 1005-1015. 270. Li B, Warner JR (1996) Mutation of the Rab6 homologue of Saccharomyces cerevisiae, YPT6, inhibits both early Golgi function and ribosome biosynthesis. J Biol Chem 271: 16813-16819. 271. Sapperstein SK, Lupashin VV, Schmitt HD, Waters MG (1996) Assembly of the ER to Golgi SNARE complex requires Uso1p. J Cell Biol 132: 755-767. 272. Frigieri MC, Joao Luiz MV, Apponi LH, Zanelli CF, Valentini SR (2008) Synthetic lethality between eIF5A and Ypt1 reveals a connection between translation and the secretory pathway in yeast. Mol Genet Genomics 280: 211-221. 273. Yamamoto K, Jigami Y (2002) Mutation of TRS130, which encodes a component of the TRAPP II complex, activates transcription of OCH1 in Saccharomyces cerevisiae. Curr Genet 42: 85-93. 274. Georgiev A, Leipus A, Olsson I, Berrez JM, Mutvei A (2008) Characterization of MYR1, a dosage suppressor of YPT6 and RIC1 deficient mutants. Curr Genet 53: 235-247. 275. Sidrauski C, Walter P (1997) The transmembrane kinase Ire1p is a site-specific endonuclease that initiates mRNA splicing in the unfolded protein response. Cell 90: 1031-1039. 276. Rubio C, Pincus D, Korennykh A, Schuck S, El-Samad H, et al. (2011) Homeostatic adaptation to endoplasmic reticulum stress depends on Ire1 kinase activity. J Cell Biol 193: 171-184. 277. Chawla A, Chakrabarti S, Ghosh G, Niwa M (2011) Attenuation of yeast UPR is essential for survival and is mediated by IRE1 kinase. J Cell Biol 193: 41-50. 278. Poothong J, Sopha P, Kaufman RJ, Tirasophon W (2010) Domain compatibility in Ire1 kinase is critical for the unfolded protein response. FEBS Lett 584: 3203-3208.

132

279. Bouchecareilh M, Higa A, Fribourg S, Moenner M, Chevet E (2011) Peptides derived from the bifunctional kinase/RNase enzyme IRE1alpha modulate IRE1alpha activity and protect cells from endoplasmic reticulum stress. Faseb J 25: 3115-3129. 280. Han D, Lerner AG, Vande Walle L, Upton JP, Xu W, et al. (2009) IRE1alpha kinase activation modes control alternate endoribonuclease outputs to determine divergent cell fates. Cell 138: 562-575. 281. Kannan N, Neuwald AF (2005) Did protein kinase regulatory mechanisms evolve through elaboration of a simple structural component? J Mol Biol 351: 956-972. 282. Angiolini M (2011) Targeting the DFG-in kinase conformation: a new trend emerging from a patent analysis. Future Med Chem 3: 309-337. 283. Grossi V, Liuzzi M, Murzilli S, Martelli N, Napoli A, et al. (2012) Sorafenib inhibits p38alpha activity in colorectal cancer cells and synergizes with the DFG-in inhibitor SB202190 to increase apoptotic response. Cancer Biol Ther 13: 1471-1481. 284. Peng YH, Shiao HY, Tu CH, Liu PM, Hsu JT, et al. (2013) Protein Kinase Inhibitor Design by Targeting the Asp-Phe-Gly (DFG) Motif: The Role of the DFG Motif in the Design of Epidermal Growth Factor Receptor Inhibitors. J Med Chem 56: 3889-3903. 285. Simard JR, Rauh D (2012) Fluorescence labels in kinases: a high-throughput kinase binding assay for the identification of DFG-out binding ligands. Methods Mol Biol 800: 95-117. 286. Powers-Fletcher MV, Jambunathan K, Brewer JL, Krishnan K, Feng X, et al. (2011) Impact of the Lectin Chaperone Calnexin on the Stress Response, Virulence and Proteolytic Secretome of the Fungal Pathogen Aspergillus fumigatus. PLoS One 6: e28865. 287. Howell SH (2013) Endoplasmic reticulum stress responses in plants. Annu Rev Plant Biol 64: 477-499. 288. Liu Y, Bassham DC (2013) Degradation of the endoplasmic reticulum by autophagy in plants. Autophagy 9: 622-623. 289. Lee H, Noh JY, Oh Y, Kim Y, Chang JW, et al. (2012) IRE1 plays an essential role in ER stress-mediated aggregation of mutant huntingtin via the inhibition of autophagy flux. Hum Mol Genet 21: 101-114. 290. Gardner RG, Shearer AG, Hampton RY (2001) In vivo action of the HRD ubiquitin ligase complex: mechanisms of endoplasmic reticulum quality control and sterol regulation. Mol Cell Biol 21: 4276-4291. 291. Loertscher J, Larson LL, Matson CK, Parrish ML, Felthauser A, et al. (2006) Endoplasmic reticulum-associated degradation is required for cold adaptation and regulation of sterol biosynthesis in the yeast Saccharomyces cerevisiae. Eukaryot Cell 5: 712-722. 292. Casadevall A, Fang FC, Pirofski LA (2011) Microbial virulence as an emergent property: consequences and opportunities. PLoS Pathog 7: e1002136. 293. Rhodes JCaDSA (2008) Aspergillus fumigatus. 294. Thibault G, Ismail N, Ng DT (2011) The unfolded protein response supports cellular robustness as a broad-spectrum compensatory pathway. Proc Natl Acad Sci U S A 108: 20597-20602. 295. Zhang J, Yang PL, Gray NS (2009) Targeting cancer with small molecule kinase inhibitors. Nat Rev Cancer 9: 28-39. 296. Chahrour O, Cairns D, Omran Z (2012) Small molecule kinase inhibitors as anti-cancer therapeutics. Mini Rev Med Chem 12: 399-411. 297. O'Shea JJ, Kontzias A, Yamaoka K, Tanaka Y, Laurence A (2013) Janus kinase inhibitors in autoimmune diseases. Ann Rheum Dis 72 Suppl 2: ii111-115. 298. Yazici Y, Steiger B (2012) Kinase inhibitors for the treatment of rheumatoid arthritis. Bull NYU Hosp Jt Dis 70: 204-207. 299. Mucke H (2013) The role of imatinib in the treatment of pulmonary hypertension. Drugs Today (Barc) 49: 203-211.

133

300. Cohen P (2002) Protein kinases--the major drug targets of the twenty-first century? Nat Rev Drug Discov 1: 309-315. 301. Volkmann K, Lucas JL, Vuga D, Wang X, Brumm D, et al. (2011) Potent and selective inhibitors of the inositol-requiring enzyme 1 endoribonuclease. J Biol Chem 286: 12743- 12755. 302. Ri M, Tashiro E, Oikawa D, Shinjo S, Tokuda M, et al. (2012) Identification of Toyocamycin, an agent cytotoxic for multiple myeloma cells, as a potent inhibitor of ER stress-induced XBP1 mRNA splicing. Blood Cancer J 2: e79. 303. Cross BC, Bond PJ, Sadowski PG, Jha BK, Zak J, et al. (2012) The molecular basis for selective inhibition of unconventional mRNA splicing by an IRE1-binding small molecule. Proc Natl Acad Sci U S A 109: E869-878. 304. Papandreou I, Denko NC, Olson M, Van Melckebeke H, Lust S, et al. (2011) Identification of an Ire1alpha endonuclease specific inhibitor with cytotoxic activity against human multiple myeloma. Blood 117: 1311-1314. 305. Korennykh AV, Egea PF, Korostelev AA, Finer-Moore J, Zhang C, et al. (2009) The unfolded protein response signals through high-order assembly of Ire1. Nature 457: 687- 693. 306. Wang L, Perera BG, Hari SB, Bhhatarai B, Backes BJ, et al. (2012) Divergent allosteric control of the IRE1alpha endoribonuclease using kinase inhibitors. Nat Chem Biol 8: 982-989. 307. Mimura N, Fulciniti M, Gorgun G, Tai YT, Cirstea D, et al. (2012) Blockade of XBP1 splicing by inhibition of IRE1alpha is a promising therapeutic option in multiple myeloma. Blood 119: 5772-5781. 308. Hast MA, Nichols CB, Armstrong SM, Kelly SM, Hellinga HW, et al. (2011) Structures of Cryptococcus neoformans protein farnesyltransferase reveal strategies for developing inhibitors that target fungal pathogens. J Biol Chem 286: 35149-35162. 309. Walter P, Ron D (2011) The unfolded protein response: from stress pathway to homeostatic regulation. Science 334: 1081-1086. 310. Iwawaki T, Akai R, Kohno K (2010) IRE1alpha disruption causes histological abnormality of exocrine tissues, increase of blood glucose level, and decrease of serum immunoglobulin level. PLoS One 5: e13052. 311. Iwawaki T, Akai R, Yamanaka S, Kohno K (2009) Function of IRE1 alpha in the placenta is essential for placental development and embryonic viability. Proc Natl Acad Sci U S A 106: 16657-16662. 312. Healy SJ, Gorman AM, Mousavi-Shafaei P, Gupta S, Samali A (2009) Targeting the endoplasmic reticulum-stress response as an anticancer strategy. Eur J Pharmacol 625: 234-246. 313. Kraskiewicz H, FitzGerald U (2012) InterfERing with endoplasmic reticulum stress. Trends Pharmacol Sci 33: 53-63. 314. McLellan CA, Whitesell L, King OD, Lancaster AK, Mazitschek R, et al. (2012) Inhibiting GPI anchor biosynthesis in fungi stresses the endoplasmic reticulum and enhances immunogenicity. ACS Chem Biol 7: 1520-1528. 315. Hata K, Horii T, Miyazaki M, Watanabe NA, Okubo M, et al. (2011) Efficacy of oral E1210, a new broad-spectrum antifungal with a novel mechanism of action, in murine models of candidiasis, aspergillosis, and fusariosis. Antimicrob Agents Chemother 55: 4543-4551. 316. Miyazaki M, Horii T, Hata K, Watanabe NA, Nakamoto K, et al. (2011) In vitro activity of E1210, a novel antifungal, against clinically important yeasts and molds. Antimicrob Agents Chemother 55: 4652-4658. 317. Schonthal AH (2013) Pharmacological targeting of endoplasmic reticulum stress signaling in cancer. Biochem Pharmacol 85: 653-666.

134

318. Bollo M, Paredes RM, Holstein D, Zheleznova N, Camacho P, et al. (2010) Calcineurin interacts with PERK and dephosphorylates calnexin to relieve ER stress in mammals and frogs. PLoS One 5: e11925. 319. Fan W, Idnurm A, Breger J, Mylonakis E, Heitman J (2007) Eca1, a sarcoplasmic/endoplasmic reticulum Ca2+-ATPase, is involved in stress tolerance and virulence in Cryptococcus neoformans. Infect Immun 75: 3394-3405. 320. Liu H, Kurtoglu M, Cao Y, Xi H, Kumar R, et al. (2013) Conversion of 2-deoxyglucose- induced growth inhibition to cell death in normoxic tumor cells. Cancer Chemother Pharmacol. 321. Segev N, Mulholland J, Botstein D (1988) The yeast GTP-binding YPT1 protein and a mammalian counterpart are associated with the secretion machinery. Cell 52: 915-924. 322. Tsvetanova NG (2013) The secretory pathway in control of endoplasmic reticulum homeostasis. Small GTPases 4: 28-33. 323. Tsvetanova NG, Riordan DP, Brown PO (2012) The yeast Rab GTPase Ypt1 modulates unfolded protein response dynamics by regulating the stability of HAC1 RNA. PLoS Genet 8: e1002862. 324. Hetz C, Glimcher LH (2009) Fine-tuning of the unfolded protein response: Assembling the IRE1alpha interactome. Mol Cell 35: 551-561. 325. Fiddy C, Trinci AP (1976) Mitosis, septation, branching and the duplication cycle in Aspergillus nidulans. J Gen Microbiol 97: 169-184. 326. Vinck A, de Bekker C, Ossin A, Ohm RA, de Vries RP, et al. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies. Environ Microbiol. 327. Zhou J, Liu CY, Back SH, Clark RL, Peisach D, et al. (2006) The crystal structure of human IRE1 luminal domain reveals a conserved dimerization interface required for activation of the unfolded protein response. Proc Natl Acad Sci U S A 103: 14343-14348. 328. Ali MM, Bagratuni T, Davenport EL, Nowak PR, Silva-Santisteban MC, et al. (2011) Structure of the Ire1 autophosphorylation complex and implications for the unfolded protein response. EMBO J 30: 894-905. 329. Grant SK (2009) Therapeutic protein kinase inhibitors. Cell Mol Life Sci 66: 1163-1177.

135