sign in sign up
<<
Home , Dalibarda, Rosaceae, Rubus, Rubus hawaiensis, Rubus macraei, Rubus strigosus

Phylogeny and Biogeography ofPacific Subgenus ldaeobatus () : Investigating the Origin ofthe Endemic Hawaiian R. macraei1

Clifford W Morden,2,4 Donald E. Gardner, 3 and Dana A. Weniger2

Abstract: The endemic Hawaiian and R. macraei (both subgenus Idaeobatus) had been thought to be closely related species until recent molecular studies demonstrated otherwise. These studies suggest that they are the products of separate colonizations to the Hawaiian Islands. Affin­ ities of R. hawaiensis to R. speaabilis of western North America were clearly confirmed. However, no clear relation to R. macraei has been published. This study was initiated to examine species of subg. Idaeobatus from the surrounding Pacific region as well as species from other subgenera to better evaluate bio­ geographic and phylogenetic affinities of R. macraei by means of chromosome analysis and molecular data using the chloroplast gene ndhF. Results show that R. macraei clusters in a clade with species of blackberries, subg. Rubus, and of these it is most closely linked to R. ursinus. Chromosomally, R. macraei is 2n = 6x = 42, a number that would be a new report for subg. ldaeobatus. How­ ever, is cornmon in subg. Rubus. Analyses indicate that R. macraei and R. hawaiensis are derived from separate colonizations from North America and that similarities between them are due to convergent evolution in the Hawaiian environment.

THE Rubus (Rosaceae) is a large and species (Jennings 1988, Iwatsubo et al. 1995, taxonomically complex assemblage of species Thompson 1997, Wagner et al. 1999). The consisting of several hundred sexual species most recent global treatment of Rubus was by to perhaps thousands of apomictic micro- Focke (1910, 1911, 1914), where the genus was divided into 12 subgenera and numer­ ous sections and series. The two largest of Focke's subgenera included the raspberries

1 This work was funded by National Biological Ser­ (subgenus Idaeobatus) and the blackberries vice Research Funding and the Department of , (subg. Rubus = Eubatus Focke). Focke origi­ University of Hawai'i at Manoa. Manuscript accepted 3 nally placed 117 species into subg. Idaeobatus, June 2002. a number that has since increased to 135 2 Department of Botany and Center for Conservation Research and Training, University of Hawai'i at Manoa, species (Thompson 1997). In subg. Rubus, the Honolulu, Hawai'i 96822. number has risen from Focke's original 132 J USGS-Biological Resources Division, Pacific Island species to approximately 400 sexual species Ecosystems Research Center, Department of Botany, and thousands of described apomictic spe­ University of Hawai'i at Manoa, Honolulu, Hawai'i cies (Jennings 1988, Iwatsubo et al. 1995). 96822. 4 Address for correspondence: 3190 Maile Way, Frequent hybridization and reproduction University of Hawai'i at Manoa, Honolulu, Hawai'i through has made the designation of 96822 (phone: 808-956-9636; fax: 808-956-3923; E-mail: distinct species difficult in this genus (Nybom cmorden@.edu). and Schaal 1990, Nybom and Hall 1991, Kraft et al. 1996). This situation is further Pacific Science (2003), vol. 57, no. 2:181-197 complicated by a large amount of phenotypic © 2003 by University of Hawai'i Press plasticity (Nybom and Schaal 1990, Nybom All rights reserved and Hall 1991, Kraft et al. 1996).

181 182 PACIFIC SCIENCE· April 2003

Two species of Rubus are endemic to the DNA (RAPD) markers to examine genetic Hawaiian Islands, R. hawaiensis and R. macraei variation among some species in two Rubus (Wagner et a1. 1999). Both species were subgenera and found that R. macraei did not placed in subg. Idaeobatus, Idaeanthi, group with other Idaeobatus species, but rather series spectabiles by Focke (1911) and share a grouped with species of subg. Rubus separate number of notable morphological features. from a cluster containing subg. Idaeobatus Both species are woody in habit, possess species. However, their analysis utilized few shredding bark, have reduced prickle con­ species of these subgenera and involved many centrations, possess compound with individuals derived from artificial crosses re­ three leaflets, that are pink to dusky sulting in inter- and intrasubgeneric hybrids. -colored, and drupelets that are dark red Further, R. hawaiensis was not included in this to purple (Wagner et a1. 1999). The high analysis to allow comparison with R. macraei. degree of morphological similarity supports Two recent studies based on sequence the hypothesis that these two species are analysis of chloroplast and nuclear DNA have closely related to one another and as a result provided insight into the phylogenetic frame­ were thought to be derived from R. spectabilis, work of this genus. Examination of the chlo­ the common salmonberry from western roplast ndhF region (Howarth et a1. 1997) has North America (Hillebrand 1888, Fosberg shown the region to possess levels ofvariation 1948, Wagner et al. 1999). The differences appropriate to address questions at the species between these two species are few compared and subgeneric levels. They examined nine with the similarities. tends species from subg. Idaeobatus including both to grow in a prostrate decumbent manner Hawaiian species as well as R. spectabilis. Their while R. hawaiensis grows upward with erect results surprisingly showed that the two Ha­ branches that may become arching. Other waiian species were not closely related to each morphological differences include the thick­ other. As suspected, R. hawaiensis clustered ness of the leaves, length of the terminal closely with R. spectabilis, but R. macraei did leaflet, and the coloration of the abaxial sur­ not group closely with any other species in faces of the leaves (Wagner et a1. 1999; subg. Idaeobatus. These findings were further C.W.M., pers. obs.). Although these species corroborated by Alice and Campbell (1999) are occasionally found growing sympatrically, in their investigation of phylogenetic rela­ no hybrids between them are known, yet tionships within Rubus using the internal natural hybrids between R. hawaiensis and the transcribed spacer (ITS) region ofthe nuclear invasive R. rosifolius (both subg. Idaeobatus) ribosomal DNA cistron. Alice and Campbell have been documented (Randell 2000). (1999) also showed that the two Hawaiian Given the wide morphological variation species are distantly related although R. mac­ found in this genus, alternative approaches raei clustered closely to a number of other have been employed to gain insight into this species of subg. Idaeobatus. Aside from a close difficult group, including paper chromatogra­ affinity with R. spectabilis, R. hawaiensis did not phy fingerprinting (Haskell and Garrie 1966), cluster with any distinct group. They found a isozyme techniques (Cousineau and Donnelly high similarity in the sequences of R. macraei 1989), and characterization of and R. ursinus, a common pigments (Jennings and Carmichael 1980). species along the North American West Nybom et a1. (1990) and Waugh et a1. (1990) Coast from northern Mexico to British Co­ first employed molecular tools to study the lumbia. Recent investigations by Alice (2002) variability in Rubus species using Southern with ITS sequences likewise showed a close hybridization analysis and DNA fingerprint­ association between R. ursinus and R. macraei. ing, respectively. However, neither method Chromosome studies have shown that provided the resolution necessary to examine the base number in Rubus is x = 7 (Graham relationships among species and subgenera of and McNicol 1995, Iwatsubo et a1. 1995, this complex genus. Graham and McNicol Hummer 1996, Thompson 1997). Although (1995) used randomly amplified polymorphic polyploidy is common, there is little evi- Rubus Systematics and Origin of R. macraei . Morden et al. 183 dence of aneuploidy in the genus. Species of MATERIALS AND METHODS subg. Idaeobatus are largely diploid (2n = 14) DNA Extraction and Sequence Analysis with occasional reports of tetraploids (2n = 28) and rarely higher numbers (Thompson Following the classification scheme of Focke 1997). Chromosome counts performed on R. (1910, 1911, 1914), 30 species of Rubus, hawaiensis have confirmed its diploid config­ mostly from the Pacific region and repre­ uration (Thompson 1995), but to date there senting five subgenera, were sampled (Table have been no counts of R. maeraei available. 1). An emphasis was placed on the subg. Subg. Rubus has a high frequency of poly­ Idaeobatus due to Focke's inclusion of both ploidy among the many species that have Hawaiian endemic species in this subgenus. been reported, and R. ursinus has counts Species were chosen for their proximity to ranging from hexaploid to dodecaploid migratory bird flight routes, chromosome (2n = 42 to 84) (Thompson 1997). number, and use in previous studies. Rubus The focus of the research reported here assamensis (subg. Malachobatus) and R. tricolor was to explore the biogeography of Rubus (subg. Dalibardastrum) were included because species in the northern Pacific region and to these species clustered close to R. maeraei in clarify relationships among these species by the ITS analysis of Alice and Campbell analyzing ndhF sequence variation. The ndhF (1999). Morgan et a1. (1994) have shown gene has recently become of interest for sys­ to be closely related to Rubus, thus F. tematic analyses and was used here to exam­ paradoxa was used for comparison. ine relationships among species of Rubus. DNA samples were obtained through collab­ Studies have shown this gene to be two to oration with other researchers or from ex­ three times more variable than rbcL and twice traction offresh material (Table 1). Total its length (Hiratsuka et a1. 1989, Sugiura DNA was extracted following the protocol 1989, Clark et a1. 1995, Olmstead and Reeves described by Doyle and Doyle (1987), with 1995, Scotland et a1. 1995, Terry et a1. 1997). a few minor modifications (Morden et a1. The ndhF gene has since been used to answer 1996). Samples were purified by cesium phylogenetic questions in both monocots and chloride density gradient centrifugation fol­ dicots (Olmstead and Sweere 1994, Clark et lowed by butanol extraction to remove the a1. 1995, Kim and Jansen 1995, Olmstead and ethidium bromide. Samples were dialyzed in Reeves 1995, Scotland et a1. 1995, Neyland four changes of TE (10 mM Tris, 1 mM and Urbatsch 1996, Smith et a1. 1997, Terry EDTA, pH 8.0), accessioned into the Hawai­ et a1. 1997) as well as previously in Rubus ian DNA Library (HPDL), and stored (Howarth et a1. 1997). at -20°C (Morden et a1. 1996, Randell and Specific aims of this study were to address Morden 1999). three questions. First, what are the closest The 3' portion of the ndhF gene (corre­ relatives of R. maeraei and from what geo­ sponding to nucleotide 1024 of tobacco ndhF graphic region did it originate? Second, what and a region downstream from the ndhF ter­ is the extent of morphological convergence minus and internal to orf3S0) was amplified that has occurred between R. hawaiensis and from each species using the polymerase chain R. maeraei? Third, how phylogenetically dis­ reaction (PCR). The 3' region of the gene tinct are the Rubus species found in disjunct has been shown to evolve more rapidly than regions ofAsia and North America, and what the 5' end (Olmstead and Sweere 1994, Clark general trends of evolutionary biogeography et a1. 1995, Kim and Jansen 1995, Neyland of Rubus throughout the Pacific are evident? and Urbatsch 1996, Howarth et a1. 1997). If these two regions of the Pacific are clearly Amplifications consisted of 100 III reactions separated biologically (i.e., no intercontinen­ with 1 x buffer, 2 mM MgCl, 0.128 mM tal dispersal), the discovery of a close rela­ dNTP, 1 ~ of each amplifying primer, 2 tionship between the Hawaiian species and a units Taq DNA polymerase (Fisher Biotech), continental species should lend substantial and ca. 50-100 ng DNA. Cocktails were ex­ evidence toward the origin of these species. posed to the following amplification con- TABLE 1 Accessions of Rubus Used in This Srudy (Chromosome Numbers, Narural Range of the Species, Source Location, and Accession Numbers in the Hawaiian Plant DNA Library [HPDL] [Morden et a!. 1996, Randall and Morden 1999])

Chromosome Species Subgenus No." Narural Range Accession No. Source Locationb HPDL

R. pa77)ifWI7lSNutt. Anoplobatus 2x W. North America Luffman 217 CCPPC 1173 R. tricolor Focke Dalibardastrum 4x China L. Alice m' 1453 R. corchorifoli!lSL. f. ldaeobatllS 2x Eastern Asia USDA-lnO.OOl NCGR 1344 R. corean/lSMiq. IdaeobatllS 2x Eastern Asia USDA 1438.01 NCGR 1339 R. elliptiCllSSmith Idaeobatus 2x Eastern Asia Howarth s.n. Hawai'i, HI 270 R. hawaiensis A. Gray IdaeobatllS 2x Hawaiian Islands Gardner s.n. Hawai'i, HI 208 R. himttllS Thunb. Idaeobatus 2x Eastern Asia 1040.001 NCGR 1340 R. idae!lSL. Idaeobatus 2x subsp. idaezlS Idaeobatus 2x Europe Luffman 213 CCPPC 1172 subsp. melanolasi!lS(Dieck) Focke Idaeobatus 2x North America Morden 1206 Utah 293 R. ikenoensisA. Leveille & Vaniot Idaeobatus 2x Japan USDA-1421.001 NCGR 1347 R. illecebroSllSFocke Idaeobatus 2x Japan USDA-1422.001 NCGR 1348 R. leucodern!isDouglas ex Torr. & Gray Idaeobatus 2x W. North America USDA-12.002 NCGR 1345 R. macraei A. Gray IdaeobatllS This srudy Hawaiian Islands Gardner s.n. Hawai'i, HI 207 Anderson s.n. , HI 1135 R. niVe!lSThunb. IdaeobatllS 2-3x Eastern Asia Morden 1212 Maui, HI 306 R. occidezztalisL. ldaeobatllS 2x E. North America L. Alice R16' 1450 R. palmatllS Thunb. IdaeobatllS 2x Japan USDA-2.001 NCGR 1346 R. phoenicolasi!lSMaxim. ldaeobatllS 2x Eastern Asia L. Alice 96-2' 1451 R. pungens Cambess. Idaeobatus 2x Eastern Asia USDA-46.002 NCGR 1349 R. rigidus Sm. Idaeobatus Unknown South Africa Morriss.n. South Africa 1207 R. rosifoli!lSSmith Idaeobatus 2x SWPacific Morden 1182 Kaua'i, HI 258 R. sachalinensisA. Leveille IdaeobatllS 4x Eastern Asia USDA-167.001 NCGR 1341 R. speetabilisPursh ldaeobatus 2x W. North America Luffman 219 CCPPC 1174 Gardner s.n. UH-Manoa 209 R. strigoS1lS(Michx.) Maxim IdaeobatllS 2x North America Luffman 186 CCPPC 1171 R. mmatran/lS Miq. Idaeobatus 2x S. Pacific and Asia USDA-1668.000 NCGR 1343 R. assamensisFocke Malachobatus 4x Eastern Asia USDA-1701' NCGR 1447 R. a/'gutus Link Rub/lS 2-3x E. North Amercia Gardner s.n. UH-Manoa 1133 R. cuneifoli!lSPursh Rubus 2-4x E. North America Morris s.n. South Africa 1206 R. !l1'Si1!!lSCham. & Schld!. Rub/lS 6, 8-12x W. North America L. Alice 47-90 Fallugia paradoxa (D. Don) End!. - 4x W. North America 7943d RSABG

n From Thompson (1997). b NCGR, USDA-ARS National Clonal Germplasm Repository, Corvallis, ; CCPPC, Canadian Clonal Plant Propagation Centre, Ontario, Canada; RSABG, Rancho Santa Ana Botanic Garden, . 'DNA samples provided by Lawrence Alice, Western Kentucky University. d DNA sample provided by Rodger Evans, University of Toronto. Flowering voucher at Royal Ontario Museum Herbarium (TRT). Rubus Systematics and Origin of R. macraei . Morden et ai. 185

TABLE 2 Primers Designed for This Study, Their Location Within the Gene, Sequence, Length, and GC Content

Relative Tobacco GC Primer Coordinates Sequence Length Content F 1417 1417-1440 TTCTATTCAATGTCTCTATGGGGT 24 9/24 F 1696 1696-1717 GGAATTCCTTTCTTCAATCAGG 22 9/22 F 1982 1982-2003 TATATGATTGGTCATATAATCG 22 6/22

Note: Primers were designed to increase amplification efficiency and to more effectively cover the area being sequenced. Primer coordinates reflect the corresponding positions in the tobacco ndhF sequence (Ohnstead et a1. 1993). ditions: one cycle of 3 min at 94°C, 1.5 min at function included in that package. Insertion/ 50°C, and 2 min at noc; 28 cycles of 1.5 min deletion events (indels) and indeterminable at 94°C, 1.5 min at 50°C, and 2 min at noc bases were coded as missing data. Neighbor with 5 sec added per cycle; and one cycle joining and parsimony analyses were per­ of 1.5 min at 94°C, 1.5 min at 50°C, and 6 formed using PAUP 4.0b8 (Swofford 1996). min at n°c. Amplification primers were the Parsimony searches were conducted with all same as those used previously for Rubus (Ho­ characters weighted equally. Starting trees warth et al. 1997). PCR products (4 Ill) were were found by random stepwise addition with visualized on 1.5% agarose gels to assure 10 replicates using the quick swapping op­ proper amplification. The remaining PCR tion on all trees. MULTREES and the TBR product was purified in Ultrafree-MC filters branch swapping algorithm was in effect (Millipore Corporation, Bedford, Massachu­ for the search. Bootstrap analyses (Felsen­ setts) using the manufacturer's specifications. stein 1985) were done with 1000 replicates Concentrations of purified products were de­ for both neighbor joining and parsimony termined using UV spectroscopy (Sambrook searches and decay analysis (Bremer 1988) for et al. 1989). parsimony searches. Biogeographic distribu­ The dideoxy sequencing method of Sanger tions among species were evaluated using et al. (1977) utilized Rubus-specific sequenc­ MacClade 3.0 (Maddison and Maddison ing primers designed for increased sequenc­ 1992). ing efficiency and to more effectively cover the area being sequenced (Table 2). Final Cytological Analysis solutions containing 50-100 ng of purified double-stranded PCR product and 3.2 pico­ The chromosome number of R. macraei was moles of primer were sequenced at the Uni­ determined from mitotic configurations in versity of Hawai'i Biotechnology/Molecular root tips that were excised and pretreated Biology Instrumentation and Training Facil­ in a saturated aqueous solution of paradi­ ity, using an ABI 373A automated sequencer chlorobenzene (PDB) for ca. 5 hr at 4°C. with Prism Dye Terminator Cycle Sequenc­ The root tips were then fixed in absolute ing Ready Reaction Kit with AmpliTaq DNA alcohol: glacial acetic acid (3: 1) at room Polymerase, FS (PE Biosystems Inc., Foster temperature for 2 hr and stored at -20°C. City, California). The computer-generated For microscopic analysis, the root tips were sequences were compared visually with the hydrolyzed in concentrated HCI: 95% EtOH resultant chromographs to verify results. (1: 1) for 5 min, rinsed in tap water, and Sequences were visually aligned and com­ squashed on a microscope slide in a drop of parisons among sequences made using the acetocarmine mixed with Hoyer's medium Wisconsin Genetics Computer Groups Se­ (Beeks 1955). Cells with well-spread, count­ quence Analysis Package. Percentage sim­ able chromosomes at metaphase morphology ilarities were calculated using the "Gap" were found in six preparations. 186 PACIFIC SCIENCE· April 2003

Amino acid seq. YYFFD * R. corea""s TATTATTTTTTTAATTAAATA------TTAAACTAAAAAAAAAAACAAAAAA-CCGGAAAA R. plloetlicolasillS TATTATTTTTTTAATTAAA-TA------TTAAACTAAAAAAAAACAAAAAAA--CCGGAAAA It lIivells T-TT-TTTTTTTAATTAAATAT------TTAACCTAAAAAAAAAAA------CCAAAAAA R. sacllaliJJellSis TATTATTTTTTTAAT~TTA------TTAAACTAAAAAAAAA------CCGGAAAA R. idaells ssp. meL TATTATTTTTTTAATTAAATTA------TTAAACTAAAAAAAAA------CCGGAAGA Rmaellsssp.uwa,s TATTATTTTTTTAATTAAACT------AAAAACTAAAAAAAAAA------CCGGAAGA RsuwosIIs TATTATTTTTTTAATTAAATTA------TTAAACTAAAAAAAAA------CCGGAAGA R. ilwlOetlsis TATTATTTTTTTAATTAAATTATT------AAATATTAAAAAAAAAA------CCGGAAAA Rkllcodermis TATTATTTTTTTAATTAAATTA------TTAAACTAAAAAAAAA------CCGGAAGA R. occitkll'alis TATTATTTTTTTAATTAAATTA------TTAAACTAAAAAAAAA------CCGGAAAA Rp,"~e"s TATTATTTTTTTAATTAAAT-A------TTAAACTAAAAAAAAAA------CCGGAAAA Ranmnalsis TATTTTTTTTTTAAA~AAATTATTAAACTA-TT-A-TTA------TTAAACTAAAAAAAAAA------CCGGAAAA Ruuowr TCTTTTTTTTTTAAA~AAATTATTAAACTAATTAAATTA------TTAAACTAAAAAAAAAA------CCGGAAAA R.lla.vmauis TATTATTTTTTAAAT~------TTAAACTAAAAAAAAAAA------CCGGAAAA R.spedabws TATTATTTTTTAAATTA------TTAAACTAAAAAAAAAAAA------CCGGAAAA R. uTsums TATTATTTATTTAATTAA-TTA------TTAAACTAAAAAAAA------CCGGAAAA R.lIIOcradO"aw) TATTATTTATTTAAT~------TTAAACTAAA-----CTAAAAAAAA-CCGGAAGA R. macrad (Hawai'i) TATTATTTATTTAAT~-TTA------TTAAACTAAA-----CTAAAAAAAA-CCGGAAGA R arg"'"s TATTATTTTTTTAAT~-TTAATAA-TTAAATTATTAAA------CTAAACTAAAAAAAACTAAAAAAAAACCGGAAGA R. clmeifolillS TATTATTTTTTTAATTAA-TTAATAA-TTAAATTATTAAA------CTAAACTAAAAAAAACTAAAAAAAAACCGGAAGA R.rigimu TATTATTTTTTTAATTAA-TTAT--AATTAAATTATTAAA------CTAAACTAAAAAAAA------CCGGAAGA R.llin"'"s TATTATATTTTTAAT~TTA------TTAAACTAAAAAAAA------CCGGAAAA R.rosifolills TATTATATTTTTAAT~-TAATTTAATTA------TTAAACAAAAA------CCGGAAGA R.illecebrosus TATTATTTTTTTAAT~TTAATTTTTATTATTTTTTTAATTAAATTATTTTATTAAACTAAAAAAAA------CCGGAAAA R.palmMIIs TATTATTTT~GTTTTTAGTTTAATTTTAGTTTAA--TAATTAAAA------AATAACTAAAAAAAAA------CCGGAAAA R. SIlmMrallllS TATTATTT~TTAATTAAATTA------TTAAACTAAAAAAAAA------CCGGAAAA Rcordlorifmuu TATTATTTTTTTAATTAAATTAAATTATTAAACTAAA------TTAAACTAAAAAAAAA------CCGGAAAA ReUqniws TATTATTTTTTTAATTAAATTA------TTAAACTAAAAAAAAA------CCGGAAGA Rparvij10rlls TATTATTTTTTTAATTAAATTA------TTAAACTAAAAAAAAAA------CCGGAAGA FaUIIginparadoxa TGTTATTTTTTCAATT~TTATTTTATTAAACTAAAAATA------TTAAACTAAAAAGAAAAAAAAAAAA-CCCGGAAA

FIGURE 1. Alignment of the terminal 18 bp and a portion of the downstream sequence of Rubus ndhF. Underscored bases are the stop codon for each species. Dashes (-) are missing bases (gaps) in the aligned sequence. Single letter abbreviations for amino acids are given on the first line corresponding to the R. coreonus DNA sequence. The arrow in the R. po/motllS sequence corresponds to the possible position of a 3-bp gap.

RESULTS revealing 141 variable sites, 41 % of which were phylogenetically informative. Sequence Analysis Although largely not used in the phyloge­ Approximately 1200 base pairs (bp) were se­ netic analysis, the sequence in the region of quenced, beginning with base 1023 (corre­ the stop codon is of evolutionary interest sponding to the tobacco sequence [Olmstead (Figure 1). All species strongly diverged after et al. 1993]) and extending beyond the stop the stop codon and seven species had muta­ codon. The resulting aligned sequence was tions at or near the stop codon. Three spe­ 1179 bp in length. The first 242 bases were cies, R. palmatus, R. assamensis, and R. tricolor, excluded from further analysis, because com­ had modifications to the synonymous stop plete sequences in this region were only codon (TAA to TAG or TGA) that did not available for half of the species. There were change the length or composition of the pro­ only six base changes shared by two or more tein. Rubus palmatus also had four other point species that were found within this region, mutations immediately preceding the stop and only three of these were informative in codon that are unique to this species. An clades that were well defined by the remain­ equally parsimonious alignment is hypothe­ der of the sequence. The region beyond the sized with a 3-bp deletion (indicated by the stop codon was omitted from most analyses arrow in Figure 1) resulting in a small gap because of frequent indels resulting in dubi­ that would shift the stop codon back one co­ ous alignment of this region. The third resi­ don position relative to the alignment given due ofthe stop codon, or this relative position here. All species of subg. R. in the alignment, was the last base included in macraei, R. rigidus, and R. rosifolius share a the phylogenetic analysis. The remaining 776 deletion of a single base pair immediately bases were used in the phylogenetic analyses, following the stop codon. Deletions of resi- Rubus Systematics and Origin of R. 11lacraei . Morden et al. 187

1 R. coreanus Id 4 24(0) I 0 R phoenicolasius Id 8 90(4) 2 1 R niveus Id 46 (1) 4 R. sachalinensis Id 2 I 0 63 (1) I 1 R. idaeus Id 70 (1) 2 R. strigosus Id 1 2 R. leucodermis Id 4 I 91 (2) 0 R. occidentalis Id 76 (2) I 2 R. pungens Id 5 1 3 I R. assamensis Mal 24 (0) 84 (2) I 2 R tricolor Dal 3 R. ikenoensis Id 8 2 R hawaiensis Id 93 (2) I 2 R spectabilis Id 0 3 R. ursinus Rub 95 (2) 0 R. macraei Id 0 4])3 R argutus Rub 3 6 89(2) 0 60 (1) 100 (6) R cuneifolius Rub 2 R. rigidus Id 2 1 R hirsutus Id 11 I 66 (1) 5 R. rosifolius Id 100(>6>1 2 19 R illecebrosus Id 33(0) 0 13 R palmatus Id I 24 (0) e 6 4 R sumatranus Id 100 (5) 4 I 6 23 99(4) R corchorifolius Id 1 R. ellipticus Id 2 R parviflorus ADO Fallugia paradoxa

FIGURE 2. Phylogenetic relations among Rubus species based on ndhF sequence divergence using Wagner parsimony. One of 788 equally most parsimonious trees of 169 steps. Consistency index was 0.894 and homoplasy index was 0.106. Numbers above branches are branch lengths; numbers below branches are bootstrap values with 1000 replications and decay values (in parentheses). Letters A, B, and C refer to clades discussed in the text. Subgenera to which species belong are labeled as follows: Ano, Anoplobatl~'; Dal, Dalibardastrum; rd, IdaeobatllS; Mal, MalachobatllS; Rub, RubzlS.

dues at or preceding the stop codon in R. the stop codon, are believed to have occurred niveus, R. hawaiensis, R. spectabilis, and one ac­ separately and have been discussed in detail cession of R. macraei from Maui caused a by Howarth et al. (1997). frame shift resulting in an alteration of the Parsimony analysis revealed 788 equally position of the stop codon in these species. most parsimonious trees of 169 steps with a The deletions in R. hawaiensis and R. spectabi­ consistency index of 0.800 (excluding unin­ lis, and that of R. macraei, although resulting formative characters) and a retention index of in a nearly identical sequence and position of 0.882 (Figure 2). The most species in 188 PACIFIC SCIENCE· April 2003 the analysis was R. parviflorus (subg. Anoplo­ varieties of R. idaeus. Alignment of the region batus) although its separation from the re­ downstream from the stop codon is much mainder of Rubus was weakly supported. more certain for these few taxa, and this re­ There were three clusters of species present, gion (all positions downstream from the stop and the relations depicted among them sug­ codon in Figure 1) was used in the further gest that subg. Idaeobatus is polyphyletic. analyses here. Neighbor joining (Figure 4) Clade "A" consists of a strongly supported and parsimony analyses gave identical results group of seven Asian species in subg. Idaeo­ that show Asian R. sachalinensis to be basal batus. The weakly supported sister group to within this clade, followed by the Euro­ clade "A" consists of two smaller clusters: pean raspberry R. idaeus, and the two North clade "B" is strongly supported and includes American taxa (R. strigosus and R. idaeus subsp. all subg. Rubus species plus R. macraei and melanolasius) forming a terminal clade. Rubus R. rigidus, and clade "C" consists of subg. idaeus is paraphyletic in this analysis, and Idaeobatus species including the cultivated the relationships among these closely related raspberry R. idaeus. Other notable species species and should be further ex­ combinations that are a part of the clade "B" plored. and "C" polytomy include a clade with R. hawaiensis and R. spectabilis as well as a clade Chromosome Number with R. assamensis (subg. Malachobatus) and R. tricolor (subg. Dalibardastrum). Although fur­ Root tip cells of R. macraei revealed 42 chro­ ther resolution of these clades was not possi­ mosomes in six separate preparations. The ble with this search, species in these clusters base chromosome number of x = 7 for Rubus are closely related and their branches are has been previously reported and apparently strongly supported. characterizes all known populations of the A strict consensus of all trees in the parsi­ genus (Graham and McNicol 1995, Iwatsubo mony search caused those clades with a decay et al. 1995, Hummer 1996, Thompson 1997). index of zero to collapse into a polytomy. All Thus, R. macraei is considered to be a three labeled clades and the other species hexaploid with 2n = 6x = 42. It would be combinations are united at this polytomy but desirable, however, to confirm the pairing remain intact. The neighbor joining tree behavior of chromosomes at meiosis. (Figure 3) was similar to that produced by parsimony. Although completely resolved, Morphological Comparison short branches in the tree are not supported, as indicated by the low or absent bootstrap The morphological differences and similar­ values. These two trees would be nearly ities of the two endemic Hawaiian Rubus identical if branches with less than 50% species and their closest continental relatives bootstrap support were collapsed. are reviewed in Table 4. Most of the charac­ The relationship between Rubus macraei teristics listed for the Hawaiian species are and R. ursinus is close, as indicated by the either identical to those of their continental high bootstrap value (95%) and nearly iden­ counterpart or are within the variability ofthe tical sequences (Table 3). It is also clear that North American species. However, there are R. rigidus, usually considered a member of a few important morphological similarities subg. Idaeobatus, has stronger affinities to between the two Hawaiian species that are other subg. Rubus species, a relationship also not found within the natural variation of the found in ITS sequences (L. Alice, pers. continental species. comm.). It is of interest to note that there is Morphological features that tend to vary more sequence divergence between R. hawai­ between the two geographic species pairs are ensis and R. spectabilis than between R. macraei hair density, color, shape, and and R. ursinus. fruit size. The concentration of trichomes A closer examination was made of "clade seen on the stems and on the adaxial and C" to clarify relationships among species and abaxial leaf surfaces of both Hawaiian Rubus Rubus Systematics and Origin of R. macraei . Morden et at. 189

55 R. coreanus 91 R. phoenicolasius R. niveus R sachalinensis R idaeus R strigosus R ikenoensis R. leucodermis R. occidentalis R.pungens

79 R. assamensis R tricolor

45 82 R. hawaiensis R spectabilis 95 R ursinus R macraei 89 100 R. argutus 61 R cuneifolius 59 R. rigidus R hirsutus 100 '---- R. rosifolius R illecebrosus '------R palmatus 96 R sumatranus 86 '---- R corchorifolius R ellipticus R parviflorus L- Fallugia paradoxa

--0.005 changes

FIGURE 3. Phylogenetic relationships among Rubus species based on ndhF sequence divergence using neighbor joining. Numbers are bootstrap values associated with that branch based on 1000 replications.

species is greater than that seen on either of very large fruit, ranging from 2.5 to 5 cm in the closest continental ancestors. The size of length. This large size is not observed in the the fruit is another distinctive feature that sets continental species, with both species having the Hawaiian species apart from their conti­ an upper size limit of 2 cm, an entire 0.5 cm nental ancestors. Both Hawaiian species have less than the smallest Hawaiian . 190 PACIFIC SCIENCE· April 2003

TABLE 3 DISCUSSION Sequence Similarities (in Percentages) between the Two Chromosome Number and Evolutionary Origin Hawaiian Species of Rubus and Their Closest Continental Ancestors ofR. macraei Knowledge of chromosome numbers of the Species 2 3 4 world's Rubus species is of interest in many 1. R. 11lacraei 97.9 99.9 98.5 fields of study including breeding, cytotaxon­ 2. R. hawaiensis 96.3 99.0 omy, evolution, and phylogenetics (Thomp­ 3. R. ursimlS 97.2 son 1997). Although the ploidy levels in some 4. R. spectabilis species groups are quite complex, the basic

Note: The approximate average percentage similarity between chromosome number of x = 7 has been all of the species was 96.8. found consistently throughout the world's Rubus populations as well as most subfamily sensu stricto to which Rubus be­ The previous features were unique to the longs (Graham and McNicol 1995, Iwatsubo Hawaiian species, but there are other mor­ et al. 1995, Hummer 1996, Thompson 1997). phological features that may demonstrate The majority of subg. ldaeobatus species are convergence between them. Although there is diploid (79%), with some that are both dip­ little difference seen between R. hawaiensis loid and triploid (13%) or allotetraploid (6%), and R. spectabilis in the comparison of flower and two species reported to have high ploidy color, there is a large difference seen between levels (13x and 18x [Table 5]). Rubus hawai­ R. macraei and R. ursinus. Rubus macraei dis­ ensis is known to be diploid (Thompson plays dark pink to rose-colored flowers, as 1995). However, if the taxonomic placement does R. hawaiensis, thus differing from R. ur­ of R. macraei in subg. ldaeobatus is considered sinus, which has white to pale pink flowers. to be its true phylogenetic affinity, it is the This same pattern is seen in fruit shape, only hexaploid known in the subgenus. In where R. hawaiensis, R. spectabilis, and R. mac­ contrast, subg. Rubus, with which R. macraei raei all produce ovoid fruit (Jepson 1925, clusters in this study, has a diverse array of Wagner et al. 1999), contrasting with R. ursi­ chromosome numbers reported, and 75% of nus that has oblong to ovate (Jepson 1925) or the species are tetraploid or of higher ploidy conical (Munz 1974) fruit. (Thompson 1997) (Table 5).

R. coreanus 86 .....------R. niveus

79 r---- R. sachalinensis 62 ...... ------R. id. ssp. idaeus ssp. melanolasius R. strigosus ....._-- R. parviflorus L... Fallugia paradoxa

----- 0.005 changes

FIGURE 4. Phylogenetic relations among species in "clade C" with the expanded data set using neighbor joining. Numbers are bootstrap values associated with that branch based on 1000 replications. Data set also included the 70 sequence positions downstream from the predominant stop codon in Figure 1. TABLE 4 Morphological Comparisons between the Two Endemic Hawaiian Species of Rubus and Their Closest Known Ancestors (Note the Difference in Hair Density, Color, Fruit Shape, and Fruit Size [Morphological Determinations from Hedrick 1925, Jepson 1925, Abrams 1944, MullZ and Keck 1959, Munz 1974, Hickman 1993, and Wagner et al. 1999])

Trait R. hawaiensis R. macraei R. spectabitis R. ztrsinus

Habit Shrub Shrub Clambering Bark Shredding Shredding Shredding N/A Stems Erect Prostrate Erect Variable Primocanes/floricanes Similar Similar Similar Different Prickles Slender Slender Small or unarmed Straight, bristlelike Hairs Moderately dense Dense Sparse Glabrous to pubescent Hair type Pilose Tomentose Glabrous to pilose Tomentose Leaf type Trifoliate Trifoliate Trifoliate Simple, trifoliate, or pinnate Leaflet number 3 3 3 (1) 3-5 (7) Leaf thickness Thin Somewhat thick Thin Not noted Leaf shape Ovate Ovate Ovate Ovate Terminal If. length (em) 8-15 (21) 5.1-8.5 (11) 3-10 (17) (2) 5-12 Terminal If. width (em) 5-10 (15) 3-6 (9) 4-10 Almost as broad Leaf hairs (adaxial) Pilose to tomentose Sparsely pilose Glabrous to pubescent Glabrous to pubescent Leaf hairs (abaxial) Tomentose Tomentose Glabrous to pilose Glabrous to canescent Leaflet margins Irregularly serrate Irregularly serrate Irregularly serrate Irregularly serrate Leaflet lobing Weak Weak Shallow Shallow length (em) (1.3) 2.5-3.5 0.4-3 1-9 2-5 Petiole hairs Tomentose Tomentose Glabrous Tomentose Petiole prickles Occasional Occasional Usually unarmed Prickly Stipule presence Present Present Present Present Stipule shape Linear to lanceolate Linear to lanceolate Linear Linear lanceolate Stipule length (em) 1-1.8 0.8-1.5 Not noted Not noted Inflorescence Corymbose Corymbose Usually single Corymbose Flowers per inflor. 1-4 (8) 1-8 1-2 (4) 2-15 Flowers Perfect Perfect Perfect Dioecious Pedicel length (mm) 13-30 8-55 Not noted "Long" Pedicel hairs Pilose to tomentose Tomentose Glabrous Gray tomentose length (mm) 8-17 10-16 10 Not noted Sepal hairs (adaxial) Tomentose Tomentose Adpressed hairs Tomentose Sepal hairs (abaxial) Tomentose Tomentose Adpressed hairs Tomentose Sepal apex Acuminate to caudate Acuminate to caudate Long Short acuminate Petal color Dark pink to rose Dark pink to rose Reddish purple White to pale pink Petal shape Obovate Obovate Obovate to elliptic Obovate to elliptic Petal length (mm) 13-18 13-16 10-15 (20) 5-25 Fruit color Yellow or red to dark purple Dark red to dark purple Yellow or red Dark purple to black Fruit shape Ovoid Ovoid Ovoid Oblong to spheric Fruit length (em) 2.5-5 2.5-4 1.5-2 Up to 2 192 PACIFIC SCIENCE· April 2003

TABLES Ploidy Levels of the 11 Currently Accepted Subgenera of the Genus Rubus

Species in Species Subgenus Subgenus Counted Ploidy Levels

Anaplobatus 6 4 2x Chamaebatus 6 3 2x (1), 6x (2) Chamar: 1 1 6x Comaropsis 2 1 4x Cylactis 16 10 2x (6), 2x & 3x (1), 2x & 4x (2), 4x (1) 5 2 2x Dalibardastrum 12 3 4x (2), 6x (1) ldaeobatus 135 70 2x (55), 2x & 3x (9), 4x (4), 13x (1), 18x (1) Malachobatus 127 40 4x (27), 6x (5), 8x (6), 14x (2) Micranthobatus 12 5 4x Orobatus 18 6 6x (6) Rubus 100s to 1000s 312 2x (20%), 3x (5%), 4x (60%), 5x (3%), 6x (5%), 7x (1 %), 8x (2%), 9x (2%), lOx (1 %), llx (1 %), 12x (2%)

Note: Number of species, or percentage thereof, for given ploidy levels are in parentheses. Data extracted from Thompson (1997).

The hexaploid nature of R. maeraei re­ this hypothesized hybridization and subse­ ported here is relevant to the assessment of quent polyploidization. It is likely that the the relationship of R. maeraei and R. ursinus. original hybrid polyploid dispersed to and is thought to be of hybrid ori­ colonized the Hawaiian Islands and eventu­ gin, with chromosome numbers ranging from ally evolved into what is now recognized as R. hexaploid to dodecaploid. Darrow (1955) maeraei. Whether this original colonist was in considered it to be the result of a cross be­ fact R. ursinus or an extinct predecessor of R. tween species of subgenera Rubus and Idaeo­ ursinus is unknown. An alternative scenario is bams, although others (Brown 1943, Jennings that R. maeraei evolved as a new species in 1995) did not consider subg. Idaeobatus spe­ North America, dispersed to Hawai'i, and cies to be involved in its formation. Sequence then became extinct in North America. analysis indicates that there is i.."lcongruence However, this is a less parsimonious explana­ in the placement of these species. Phyloge­ tion and does not seem as likely. Alternatives netic analysis using the nuclear ribosomal that suggest that the hybrid precursor to R. RNA ITS placed R. ursinus and R. maeraei maeraei and R. ursinus occurred in the Ha­ with other species of subg. Idaeobatus (R. leu­ waiian Islands and then recolonized North codermis and R. occidentalis [Alice and Camp­ America are unfounded. bell 1999, Alice 2002]). However, results of this study demonstrate that R. ursinus and R. Biogeography ofthe Included Rubus Species maeraei are closely related to other members of subg. Rubus and distantly related to R. leu­ The well-defined clade comprising seven codermis and R. occidentalis. These findings Asian Idaeobatus species (Figure 5) suggests support the hypothesis that R. ursinus is of that, in general, there are few dispersal events hybrid origin between subgenera Idaeobatus connecting the populations ofNorth America and Rubus. and Asia. It has long been thought that birds The close genetic affinity of R. maeraei to carried seeds of colonizing species in their R. ursinus (similarly high ploidy level and high digestive tract to the Hawaiian Islands after sequence identity of both ITS and ndhF) fruit consumption (Carlquist 1974), and this suggests that these species may have de­ is the likely vector for the genus worldwide. scended from a common ancestor following No bird flight paths link the North American Rubus Systematics and Origin of R. macraei . Morden et al. 193

R. coreanus R. phoenicolasius R. niveus R. sachalinensis R. id. ssp. idaeus R. id. ssp. melanolasius R. strigosus R. ikenoensis __ *+ R. leucodermis *i$.~ R. occidentalis R. pungens R. assamensis R. tricolor ,~:~~ R. hawaiensis R. spectabilis R. ursinus A'M<~ R. macraei R. argutus R. cuneifolius R. rigidus R. hirsutus R. rosifolius Region ofOrigin R. illecebrosus CJ Asia R. palmatus 1>1 Africa R. sumatranus ~ NarthAmenca. R. corchorifolius .. Europe R. ellipticus _ Hawaii R. parviflorus ~ Outgroup Fallugia paradoxa

FIGURE 5. Biogeographic relations among species. Tree configuration is that of the neighbor joining analyses (Figures 3 and 4). Asterisks indicate those nodes for which bootstrap values were ;;::75%. and Asian continents, although flight paths and Williams 1988, Johnson et al. 1989, between both continents and oceanic islands, Gwinner 1990). The results of this study including the Hawaiian Islands, are known strongly point toward North America as (Berger 1972, Kloeckner et al. 1982, Williams the likely point of origin for both Hawaiian 194 PACIFIC SCIENCE· April 2003

endemics. It is important to note that the are subjected to similar environmental con­ ranges of the continental Rubus species do straints in their sympatric distribution, the not necessarily overlap with a migrant bird features linking them are likely due to mor­ route, though there are frequent sightings phological convergence. each year of North American birds not It is interesting that R. hawaiensis displays usually found in the Islands (Conant et al. more sequence divergence from R. spectabilis 1991). than R. macraei does from R. ursinus. How­ The origin of the widespread genus Rubus ever, the morphological differences between has been speculated to be western North R. macraei and R. ursinus seem to be greater America or far eastern Asia (Alice and Camp­ than those of the other pair. The ndhF bell 1999), although the center of diversity of chloroplast gene is likely not affected by the the genus is in Southwest China (Lu 1983, environmental pressures that were responsi­ Gu et al. 1993). An Asian origin is also con­ ble for the changes in the features of the sistent with results in this study for R. idaeus, flowers, fruits, and pubescence. Since coloni­ an economically important raspberry, and its zation in the Hawaiian Islands, morphological close relatives R. sachalinensis and R. strigosus. evolution has undoubtedly taken place at a and R. sachalinensis were both much higher rate than has molecular evo­ previously classified as subspecies of R. idaeus lution in the chloroplast. A conservative esti­ by Focke (1910, 1911, 1914) and have since mate of chloroplast rates of change is 1.0 x been elevated to species rank. The Asian 10-9 synonymous substitutions per site per species (R. sachalinensis) was basal to these year (Wolfe et al. 1987) or 1 base change per species in the clade, and the North American 1000 sites over the past one million years. As taxa (R. idaeus subsp. melanolasius and R. stri­ such, few changes should be anticipated be­ gosus) were most derived. This distribution is tween the Hawaiian species and their North consistent with the hypothesis that this lin­ American counterparts. Greater sequence di­ eage originated in Asia with a R. sachalinensis­ vergence between R. hawaiensis and R. specta­ like ancestor that migrated across the conti­ bilis suggests that R. hawaiensis is a much nent to Europe before colonizing North earlier colonist to the islands than is R. mac­ America. This broadly dispersed species that raei. This is borne out also by the broader is found throughout the Northern Hemi­ distribution of R. hawaiensis (Kaua'i, Maui, sphere is most closely related to an Asian and Hawai'i) than R. macraei (Maui and Ha­ group of Idaeobatus species (Figure 5), sug­ wai'i) in the island chain. A further caveat of gesting an Asian origin for this economically this is that the R. hawaiensis colonist likely important species. arrived at an older island such as Kaua'i (5.1 million years old) before Maui (1.3 mil­ Extent ofConvergence between the Hawaiian lion years old) or Hawai'i (0.43 million years Species old) were formed and later dispersed to the younger islands (island ages from Carson and The comparison of a large set of commonly Clague 1995), whereas the R. macraei pro­ noted morphological features of the two Ha­ genitor colonized Hawai'i or Maui. waiian Rubus species and their continental ancestors reveals a small number of features Conclusions in the Hawaiian species that are not seen within the natural variation of the mainland In this study we were able to answer four species. These features include hair density, important questions on the origin and evolu­ flower color, fruit shape, and fruit size, all tion of the Hawaiian endemic raspberries, R. of which may be directly related to the sur­ macraei in particular. First, both Hawaiian vivability or reproductive success of the colo­ endemic species, R. macraei and R. hawaiensis, nist in a new environment. Because these are derived from separate colonists originat­ distinctive morphological characters are simi­ ing from western North America, and these lar in both Hawaiian species and the species colonists are of apparent different phyloge- Rubus Systematics and Origin of R. macraei . Morden et at. 195 netic affinities. Second, there has been a clear ribosomal DNA internal transcribed tremendous degree of morphological conver­ spacer region sequences. Am. J. Bot. gence that has taken place between these 86:81-97. two species such that each has characters Beeks, R. M. 1955. Improvement in the markedly different from those of their conti­ squash technique for plant chromosomes. nental ancestors. Until recently (Wagner et Aliso 3: 131-134. al. 1999), this has been interpreted as evi­ Berger, A. J. 1972. Hawaiian birdlife. Uni­ dence for a very close relationship between versity of Hawai'i Press, Honolulu. these species. Third, genetic differences be­ Bremer, K. 1988. The limits of amino acid tween each species and their closest conti­ sequence data in angiosperm phylogenetic nental ancestor suggest that R. hawaiensis reconstruction. Evolution 42:795-803. colonized the archipelago long before R. Brown, S. W. 1943. The origin and nature of macraei. Fourth, because of the polyploid na­ variability in the Pacific coast blackberries ture of R. macraei, it is likely derived from a (Rubus ursinus Cham. et Schlecht. and R. polyploid species not unlike R. ursinus. We lemurum sp. nov.). Am. J. Bot. 30:686-697. speculate that it is allopolyploid in origin Carlquist, S. 1974. Island biology. Columbia (hybridization with subsequent doubling of University Press, New York. the chromosomes that has probably oc­ Carson, H. L., and D. A. Clague. 1995. Ge­ curred twice). The origin of R. ursinus has ology and biogeography of the Hawaiian also been questioned, and it may be of hybrid Islands. Pages 14-29 in W. L. Wagner and origin between subgenera Idaeobatus and Ru­ V. A. Funk, eds. Hawaiian biogeography: bus (Alice 2002), but this hypothesis as well as Evolution on a hot spot archipelago. additional evidence regarding the parentage Smithsonian Institution Press, Washing­ of R. macraei needs further study. ton, D.C. Clark, L. G., W. Zhang, and J. F. Wendel. 1995. A phylogeny of the grass family ACKNOWLEDGMENTS (Poaceae) based on ndhF sequence data. We thank Lawrence Alice and Rodger Evans Syst. Bot. 20:436-460. for providing DNA samples, Margie Luffman Conant, S., R. Clapp, L. Hiruki, and B. Choy. (Canadian Clonal Plant Propagation Centre) 1991. A new tern (Sterna) breeding record and Kim Hummer (USDA-ARS National for Hawaii. Pac. Sci. 45:348-354. Clonal Germplasm Repository) for providing Cousineau, J. c., and D. J. Donnelly. 1989. fresh tissue samples of various Rubus species, Identification of raspberry in vivo and Gerry Carr for assistance with cytological using isoenzyme analysis. HortScience work. Thanks also to Lawrence Alice for 24:490-492. access to unpublished data and helpful sug­ Darrow, G. M. 1955. Blackberry-raspberry gestions, and Candace Felling and Alison hybrids. J. Hered. 46:67-71. Sherwood for helpful comments on the Doyle, J. J., and J. L. Doyle. 1987. A rapid manuscript. DNA isolation procedure for small quan­ tities of fresh leaf tissue. Phytochem. Bull. 19:11-15. Literature Cited Felsenstein, J. 1985. Confidence limits on Abrams, L. 1944. Illustrated flora of the phylogenies: An approach using the boot­ Pacific states , Oregon, and strap. Evolution 39:783-791. California. Stanford University Press, Focke, W. O. 1910. Species Ruborum mono­ Stanford, California. graphiae generis Rubi prodromus. Bibl. Alice, L. 2002. Evolutionary relationships in Bot. 17:1-120. Rubus (Rosaceae) based on molecular data. ---. 1911. Species Ruborum mono­ Acta Hortic. (The Hague) 585:79-83. graphiae generis Rubi prodromus. Bibl. Alice, L., and C. S. Campbell. 1999. Phy­ Bot. 17:121-223. logeny of Rubus (Rosaceae) based on nu- ---. 1914. Species Ruborum mono- 196 PACIFIC SCIENCE· April 2003

graphiae generis Rubi prodromus. Bibl. Weber. 1995. Chromosome numbers of Bot. 17:1-274. European blackberries (Rubus subg. Rubus, Fosberg, F. R 1948. Derivation of the flora Rosaceae). Plant Syst. Evol. 198:143-149. of the Hawaiian Islands. Pages 107-119 in Jennings, D. L. 1988. Raspberries and black­ E. C. Zimmerman, ed. Insects of Hawaii. : Their breeding, diseases and Vol. 1. University of Hawai'i Press, Ho­ growth. Academic Press, London. nolulu. ---. 1995. Raspberries and blackberries­ Graham, J., and R J. McNicol. 1995. An Rubus (Rosaceae). Pages 429-434 in J. examination of the ability of RAPD Smartt and N. W. Simmonds, eds. Evolu­ markers to determine the relationships tion of crop . 2nd ed. Longman Sci­ within and between Rubus species. Theor. entific and Technical, New York. Appl. Genet. 90: 1128-1132. Jennings, D. L., and E. Carmichael. 1980. Gu, Y., C. M. Zhao, W. Jin, and W. L. Li. Anthocyanin variation in the genus Rubus 1993. Evaluation of Rubus germplasm L. New Phytol. 84:503-513. resources in China. Acta Hortic. (The Jepson, W. L. 192 5. A manual of the flower­ Hague) 352:317-324. ing plants of California. University of Gwinner, E. 1990. Bird migration: Physiol­ California Press, Berkeley. ogy and ecophysiology. Springer-Verlag, Johnson, O. W., M. L. Morton, P. L. Bruner, Berlin. and P. M. Johnson. 1989. Fat cyclicity, Haskell, G., and J. B. Garrie. 1966. Finger­ predicted migratory flight ranges, and fea­ printing raspberry cultivars by empirical tures of wintering behavior in Pacific paper chromatography. J. Sci. Food Agric. golden-plovers. Condor 91: 156-177. 17:189-192. Kim, K. J., and R K. Jansen. 1995. ndhF se­ Hedrick, U. P. 192 5. The small fruits ofNew quence evolution and the major clades in York. J. B. Lyon Co., Albany, New York. the sunflower family. Proc. Natl. Acad. Hickman, J. C. 1993. The Jepson manual of Sci. U.S.A. 92:10379-10383. higher plants of California. University of Kloeckner, P. D., J. M. Williams, and T. C. California Press, Berkeley. Williams. 1982. Radar and visual obser­ Hillebrand, W. 1888. Flora of the Hawaiian vations of transpacific migrants. 'Elepaio Islands: A description oftheir phanerogams 42:77-80. and vascular cryptogams. Carl Winter, Kraft, T., H. Nybom, and G. Werlemark. University-Bookseller, Heidelberg. 1996. DNA fingerprint variation in some Hiratsuka, J., S. Hiroaki, R Whittier, T. blackberry species (Rubus subg. Rubus, Ros­ Ishibashi, M. Sakamoto, M. Mori, Y aceae). Plant. Syst. Evol. 199:93-108. Kondo, Y. Honji, C. Sun, B. Meng, Y Li, Lu, L.-T. 1983. A study on the genus Rubus A. Kanno, Y Nishizawa, A. Hirai, K. Shi­ of China. Acta Phytotaxon. Sin. 21:13-25. nozaki, and M. Sugiura. 1989. The com­ Maddison, W. P., and D. R Maddison. 1992. plete sequence of the rice (Oryza sativa) MacClade: Analysis of phylogeny and chloroplast genome: Intermolecular re­ character evolution. Sinauer Associates, combination between distinct tRNA genes Sunderland, Massachusetts. accounts for a major plasmid DNA inver­ Morden, C. W., V. Caraway, and T. J. sion during evolution ofcereals. Mol. Gen. Motley. 1996. Development of a DNA Genet. 217:185-194. library for native Hawaiian plants. Pac. Howarth, D. G., D. E. Gardner, and C. W. Sci. 50:324-335. Morden. 1997. Phylogeny of Rubus sub­ Morgan, D. R, D. E., Soltis, and K. R Rob­ genus Idaeobatus (Rosaceae) and its im­ ertson. 1994. Systematic and evolutionary plications toward colonization of the implications of rbcL sequence variation in Hawaiian Islands. Syst. Bot. 22:433-441. Rosaceae. Am. J. Bot. 81 :890-903. Hummer, K. E. 1996. Rubus diversity. Hort­ Munz, P. A. 1974. A flora of southern Cali­ Science 31:182-183. fornia. University of California Press, Iwatsubo, Y, N. Naruhashi, and H. E. Berkeley. Rubus Systematics and Origin of R. macraei . Morden et al. 197

Munz, P. A., and D. D. Keck. 1959. A Cali­ naring inhibitors. Proc. Natl. Acad. Sci. fornia flora. University of California Press, U.S.A. 74:5463-5467. Berkeley. Scotland, R W.,]. A. Sweere, P. A. Reeves, Neyland, R, and L. E. Urbatsch. 1996. Phy­ and R G. Olmstead. 1995. Higher level logeny of subfamily Epidendroideae (Or­ systematics of Acanthaceae determined by chidaceae) inferred from ndhF chloroplast chloroplast DNA sequences. Am. ]. Bot. gene sequences. Am.]. Bot. 83:1195-1206. 82:266-275. Nybom, H., and H. K. Hall. 1991. Mini­ Smith,]. F.,]. C. Wolfram, K. D. Brown, C. DNA"fingerprints" can distinguish L. Carroll, and D. S. Denton. 1997. Tribal Rubus cultivars and estimate their degree of relationships in the Gesneriaceae: Evi­ relatedness. Euphytica 53:107-114. dence from DNA sequences of the chlo­ Nybom, H., and B. A. Schaal. 1990. DNA roplast gene ndhF. Ann. Mo. Bot. Gard. "fingerprints" reveal genotypic distribu­ 84:50-66. tions in natural populations of blackberries Sugiura, M. 1989. The chloroplast chromo­ and raspberries (Rubus, Rosaceae). Am. ]. somes in land plants. Annu. Rev. Cell BioI. Bot. 77 :883-888. 5:51-70. Nybom, H., S. H. Rogstad, and B. A. Schaal. Swofford, D. L. 1996. Phylogenetic analysis 1990. Genetic variation detected by use using parsimony (and other methods). Si­ of the M13 "DNA fingerprint" probe nauer Associates, Sunderland, Massachu­ in , , and Rubus (Rosaceae). setts. Theor. Appl. Genet. 79:153-156. Terry, R G., G. K. Brown, and R G. Olm­ Olmstead, R G., and P. A. Reeves. 1995. stead. 1997. Examination of subfamilial Evidence for the of the Scro­ phylogeny in Bromeliaceae using compar­ phulariaceae based on cWoroplast rbcL and ative sequencing of the locus ndhF. ndhF sequences. Ann. Mo. Bot. Gard. Am.]. Bot. 84:664-670. 82:176-193. Thompson, M. M. 1995. Chromosome num­ Olmstead, R G., and ]. A. Sweere. 1994. bers ofRubus species at the National Clon­ Combining data in phylogenetic system­ al Germplasm Repository. HortScience atics: An empirical approach using three 30:1447-1452. molecular data sets in the Solanaceae. Syst. ---. 1997. Survey of chromosome num­ BioI. 43:467-481. bers in Rubus (Rosaceae: Rosoideae). Ann. Olmstead, R G., ]. A. Sweere, and K. H. Mo. Bot. Gard. 84:128-164. Wolfe. 1993. Ninety extra nucleotides in Wagner, W. L., D. R Herbst, and S. H. ndhF gene of tobacco chloroplast DNA: A Sohmer. 1999. Manual of the flowering summary of revisions to the 1986 genome plants of Hawai'i. Rev. ed. University of sequence. Plant Mol. BioI. 22:1191-1193. Hawai'i Press and Bishop Museum Press, Randell, R A. 2000. Hybridization between Honolulu. naturalized and endemic Rubus (Rosaceae) Waugh, R, W. T. G. Van De Ven, M. S. species in Hawai'i. M.S. thesis, University Phillips, and W. Powell. 1990. Chloroplast of Hawai'i at Manoa, Honolulu. DNA diversity in the genus Rubus (Rosa­ Randell, R A., and C. W. Morden. 1999. ceae) revealed by southern hybridization. Hawaiian plant DNA library II: Endemic, Plant. Syst. Evol. 172 :65-75. indigenous, and introduced species. Pac. Williams, T. c., and]. M. Williams. 1988. Sci. 53:401-417. Radar and visual observations of autum­ Sambrook, J., E. F. Fritsch, and R Maniatis. nal (southward) shorebird migrations of 1989. Molecular cloning: A laboratory Guam. Auk 105:460-466. manual. 2nd ed. Cold Spring Harbor Wolfe, K. H., W. H. Li, and P. M. Sharp. Laboratory Press, Cold Spring Harbor, 1987. Rates of nucleotide substitution vary New York. greatly among plant mitochondrial, chlo­ Sanger, F., S. Necklen, and A. R Coulson. roplast, and nuclear DNAs. Proc. Natl. 1977. DNA sequencing with chain termi- Acad. Sci. U.S.A. 84:9054-9058.