Benign Familial Infantile Seizures and Paroxysmal

Total Page:16

File Type:pdf, Size:1020Kb

Load more

CORRESPONDENCE als with isolated BFIS, 6 patients with pure PKD, 3 with RESEARCH LETTER both BFIS and PKD, and 1 nonmanifesting carrier (Figure). Genotyping of these pedigrees showed 4 in- dependent haplotypes, suggesting that this mutation arose from recurrent mutational events. Two Faces of the Same Coin: These results confirm that PRRT2 mutations cause PKD Benign Familial Infantile Seizures and ICPC in multi-ethnic populations including Ger- and Paroxysmal Kinesigenic Dyskinesia man, Turkish, and Russian. Most importantly, they pro- Caused by PRRT2 Mutations vide further evidence that the 2 apparently clinically dis- tinct syndromes of BFIS and PKD can be allelic conditions, huzo Kure, the first to describe paroxysmal ki- and they can both be caused by the same mutation in nesigenic dyskinesia (PKD) in a Japanese jour- PRRT2. nal in 1892,1 would have been pleased to learn There has been debate about whether paroxysmal dys- S 1,4 that the gene for this condition has now been identi- kinesias have an epileptic origin. It is notable that in fied.2,3 Paroxysmal kinesigenic dyskinesia is the most com- PKD, ictal and interictal changes are typically absent on mon paroxysmal movement disorder, presenting with electroencephalogram.1,4 However, the confirmation that brief episodes of dystonic, choreatic, or ballistic, and some- PKD and BFIS can have a shared genetic cause lends sup- times bizarre, involuntary movements triggered by sud- port to the concept that the pathophysiological mecha- den movement with onset in childhood or adoles- nism underlying PKD may be subcortical epileptogenic cence.4 Owing to its unusual semiology, PKD is often discharges, possibly originating from the basal ganglia. misdiagnosed as a psychogenic disorder. However, it is The molecular pathway may involve synaptic regula- easily treatable with low doses of anticonvulsants.4 No- tion via interactions with the SNAP25 protein, ulti- tably, PKD has been clinically and genetically linked to mately leading to neuronal hyperexcitability.6 a variety of heterogeneous and, at first sight, unrelated These findings are of interest to a broad range of cli- conditions. This includes benign familial infantile sei- nicians who may encounter patients presenting with in- zures (BFIS); the syndrome of rolandic epilepsy, parox- fantile convulsions or PKD. Paroxysmal kinesigenic dys- ysmal exercise–induced dyskinesia, and writer’s cramp; kinesia should be suspected in families with a child with and even the trait of wet ear wax (cerumen).1,4 Indeed, BFIS and vice versa. There is now evidence to suggest the co-occurrence of BFIS and PKD in families has re- that a simple genetic test (sequencing of the small PRRT2 sulted in the identification of another illness, infantile con- gene) may replace laborious and expensive diagnostic in- vulsions and paroxysmal choreo-athetosis (ICPC).1,4 vestigations in these patients. The finding of PRRT2 mu- Benign familial infantile seizures may be one of the most tations in families with isolated BFIS without co- common forms of epilepsy that develop in the first 2 years occurring PKD has been a recent development, further of life and is characterized by nonfebrile convulsions with expanding the phenotypic spectrum.7 onset at between 3 and 12 months of age.5 Seizures are fo- cal, with or without secondary generalization, occurring Alexander Schmidt, MD in clusters and often resulting in cyanosis. The disorder Kishore R. Kumar, MBBS, FRACP leads to considerable anxiety among parents and doctors Katharina Redyk, MD who are unfamiliar with it, but it also responds reliably to Anne Gru¨newald, PhD carbamazepine and has a benign prognosis.5 Matthias Leben, MD Mutations in the proline-rich transmembrane pro- Alexander Mu¨nchau, MD tein 2 (PRRT2) gene, which is located within the previ- Carolyn M. Sue, MBBS, FRACP, PhD ously linked region on chromosome 16, have been iden- Johann Hagenah, MD tified as the cause of PKD and ICPC.2,3,6 Hans Hartmann, MD We screened the entire PRRT2 gene for mutations in Katja Lohmann, PhD 3 families with ICPC and 1 family with PKD—3 of Ger- Hans-Ju¨rgen Christen, MD man and 1 of Turkish-Russian descent. Neuropediatri- Christine Klein, MD cians reviewed the patients, and the diagnoses of PKD and BFIS were based on established criteria.4,5 All af- Accepted for Publication: February 1, 2012. fected members had typical features of PKD and/or BFIS Author Affiliations: Section of Clinical and Molecular and were identified with the previously reported hetero- Neurogenetics, Department of Neurology, University of zygous truncating c.649dupC (p.R217PX8) muta- Lu¨ beck, Lu¨ beck, (Drs Schmidt, Kumar, Redyk, tion.2,3,6 Notably, this mutation was found in 3 individu- Gru¨ newald, Hagenah, Lohmann, and Klein), Children’s ARCH NEUROL / VOL 69 (NO. 5), MAY 2012 WWW.ARCHNEUROL.COM 668 ©2012 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/30/2021 A B Control C C C C G A G T L-5826 C C C C S R R K c.649duplC L-5826 L-6120 L-6191 na/10/52 L-5827 na/8/61 L-6119 na/9/46 D16S403 8 3 3 4 8 2 2 6 8 6 D16S769 2 3 3 3 1 3 4 2 1 2 D16S3093 6 6 6 5 1 1 6 6 1 2 D16S3022 2 2 2 2 1 2 3 2 1 6 PRRT2 m w w w m w w w m w D16S3396 4 4 1 5 1 5 8 2 1 5 D16S2623 5 3 4 3 5 5 5 5 5 5 D16S419 9 5 12 8 10 3 3 4 10 3 D16S3253 4 5 6 4 5 5 3 5 5 5 D16S2624 3 3 2 3 3 3 2 4 3 4 L-5828 L-5825 L-5829 L-6121 8/9/20 8/na/7 8/6/7 5/9/27 3 3 8 4 8 4 8 2 2 3 2 3 2 3 1 4 6 5 6 5 6 5 1 6 2 2 2 2 2 2 1 3 m w m w m w m w 4 1 4 5 4 1 1 8 5 4 5 3 5 4 5 5 9 12 9 8 9 12 10 4 4 6 4 4 4 6 5 5 3 2 3 3 3 2 3 4 C D L-1906 na/9/76 3 8 2 1 L-5929 L-5932 2 4 1 2 m w 1 3 L-1864 3 6 7 7 5 6 na/12/50 3 4 2 1 4 10 5 2 6 2 4 5 2 1 2 4 2 3 w w m w 3 6 1 1 4 5 2 3 2 3 5 4 2 1 4 11 9 14 1 1 5 3 5 5 m w 2 4 3 3 1 4 5 5 4 9 4 6 L-5930 L-5931 L-5928 2 2 4/na/7 4/na/6 na/11/13 Control C C C C G A G T 7 3 7 3 7 4 L-5930 2 3 2 3 2 3 C C C C S R R K 6 5 6 5 6 6 2 2 2 2 2 2 BFIS m w m w m w PKD c.649duplC 4 1 4 1 4 5 5 2 5 2 5 5 9 4 9 4 9 8 5 5 5 5 5 6 3 2 3 2 3 3 Figure. Pedigrees of families with benign familial infantile seizures (BFIS) and paroxysmal kinesigenic dyskinesia (PKD) in families of German origin (A, B, and D) and Turkish-Russian descent (C). Examples of electropherograms illustrating the heterozygous c.649duplC mutation (m) in 1 patient with isolated BFIS and 1 with PKD are given in the inserts. As comparison, a wild-type sequence (w) of a control individual is shown. Circles indicate females; squares, males; and dot mark, an unaffected carrier. The mutant allele is indicated by a line adjacent to the haplotype. Patients with an L-code have been genetically tested and neurologically examined. In patients with an L-code, diagnosis was based on history by family members. The following items are listed directly beneath each L-code: age at onset for BFIS (months)/age at onset for PKD (years)/current age (years). Hospital, Salzgitter (Drs Redyk and Leben), Depart- ric Kidney, Liver, and Metabolic Diseases, Hanover ment of Neurology, University Medical Center Hamburg- Medical School, (Dr Hartmann) and Children’s Hospi- Eppendorf, Hamburg (Dr Mu¨ nchau); Clinic for Pediat- tal Auf der Bult, Hanover (Dr Christen), Germany; and ARCH NEUROL / VOL 69 (NO. 5), MAY 2012 WWW.ARCHNEUROL.COM 669 ©2012 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/30/2021 Department of Neurogenetics, Kolling Institute of Medi- 1. Kato N, Sadamatsu M, Kikuchi T, Niikawa N, Fukuyama Y. Paroxysmal ki- nesigenic choreoathetosis: from first discovery in 1892 to genetic linkage with cal Research, Royal North Shore Hospital and Univer- benign familial infantile convulsions. Epilepsy Res. 2006;70(suppl 1):S174- sity of Sydney, Sydney, Australia (Drs Kumar and Sue). S184. Correspondence: Dr Klein, Department of Neurology, 2. Wang JL, Cao L, Li XH, et al. Identification of PRRT2 as the causative gene of paroxysmal kinesigenic dyskinesias. Brain. 2011;134(pt 12):3493-3501. University of Lu¨ beck, Ratzeburger Allee 160, Lu¨ beck, 3. Chen WJ, Lin Y, Xiong ZQ, et al. Exome sequencing identifies truncating mu- 23538, Germany ([email protected] tations in PRRT2 that cause paroxysmal kinesigenic dyskinesia. Nat Genet. 2011;43(12):1252-1255. .de). 4. Bhatia KP.
Recommended publications
  • PRRT2 Gene and Protein in Human: Characteristics, Evolution and Function Yinchao Li1, Shuda Chen1, Chengzhe Wang1, Peiling Wang1,Xili1 and Liemin Zhou1,2*

    PRRT2 Gene and Protein in Human: Characteristics, Evolution and Function Yinchao Li1, Shuda Chen1, Chengzhe Wang1, Peiling Wang1,Xili1 and Liemin Zhou1,2*

    Li et al. Acta Epileptologica (2021) 3:7 https://doi.org/10.1186/s42494-021-00042-4 Acta Epileptologica RESEARCH Open Access PRRT2 gene and protein in human: characteristics, evolution and function Yinchao Li1, Shuda Chen1, Chengzhe Wang1, Peiling Wang1,XiLi1 and Liemin Zhou1,2* Abstract Background: This study was designed to characterize human PRRT2 gene and protein, in order to provide theoretical reference for research on regulation of PRRT2 expression and its involvement in the pathogenesis of paroxysmal kinesigenic dyskinesia and other related diseases. Method: Biological softwares Protparam, Protscale, MHMM, SignalP 5.0, NetPhos 3.1, Swiss-Model, Promoter 2.0, AliBaba2.1 and EMBOSS were used to analyze the sequence characteristics, transcription factors of human PRRT2 and their binding sites in the promoter region of the gene, as well as the physicochemical properties, signal peptides, hydrophobicity property, transmembrane regions, protein structure, interacting proteins and functions of PRRT2 protein. Results: (1) Evolutionary analysis of PRRT2 protein showed that the human PRRT2 had closest genetic distance from Pongo abelii. (2) The human PRRT2 protein was an unstable hydrophilic protein located on the plasma membrane. (3) The forms of random coil (67.65%) and alpha helix (23.24%) constituted the main secondary structure elements of PRRT2 protein. There were also multiple potential phosphorylation sites in the protein. (4) The results of ontology analysis showed that the cellular component of PRRT2 protein was located in the plasma membrane; the molecular function of PRRT2 included syntaxin-1 binding and SH3 domain binding; the PRRT2 protein is involved in biological processes of negative regulation of soluble NSF attachment protein receptor (SNAR E) complex assembly and calcium-dependent activation of synaptic vesicle fusion.
  • PRRT2 Gene Proline Rich Transmembrane Protein 2

    PRRT2 Gene Proline Rich Transmembrane Protein 2

    PRRT2 gene proline rich transmembrane protein 2 Normal Function The PRRT2 gene provides instructions for making the proline-rich transmembrane protein 2 (PRRT2). The function of this protein is unknown, although it is thought to be involved in signaling in the brain. Studies show that it interacts with another protein called SNAP25, which is involved in signaling between nerve cells (neurons) in the brain. SNAP25 helps control the release of neurotransmitters, which are chemicals that relay signals from one neuron to another. Health Conditions Related to Genetic Changes Familial hemiplegic migraine At least two mutations in the PRRT2 gene have been identified in people with familial hemiplegic migraine. This condition is characterized by migraine headaches with a pattern of neurological symptoms known as aura. In familial hemiplegic migraine, the aura includes temporary numbness or weakness on one side of the body (hemiparesis). One PRRT2 gene mutation that is found in multiple people with familial hemiplegic migraine inserts an extra DNA building block (nucleotide) in the gene. (This change is written as 649dupC.) Both known mutations alter the blueprint used for making the protein and lead to production of an abnormally short PRRT2 protein that is quickly broken down. As a result, affected individuals have a shortage of PRRT2 protein. Researchers speculate that this shortage affects the function of the SNAP25 protein, leading to abnormal signaling between neurons, although the mechanism that causes familial hemiplegic migraine is unknown. It is thought that the changes in signaling in the brain lead to development of the severe headaches characteristic of the disorder. Familial paroxysmal kinesigenic dyskinesia More than 10 mutations in the PRRT2 gene have been found to cause a neurological disorder called familial paroxysmal kinesigenic dyskinesia.
  • Targeted Genomic Sequencing Identifies PRRT2 Mutations As A

    Targeted Genomic Sequencing Identifies PRRT2 Mutations As A

    New loci J Med Genet: first published as 10.1136/jmedgenet-2011-100635 on 30 November 2011. Downloaded from SHORT REPORT Targeted genomic sequencing identifies PRRT2 mutations as a cause of paroxysmal kinesigenic choreoathetosis Jingyun Li,1 Xilin Zhu,1 Xin Wang,1 Wei Sun,2 Bing Feng,3 Te Du,1 Bei Sun,1 Fenghe Niu,1 Hua Wei,2 Xiaopan Wu,1 Lei Dong,1 Liping Li,2 Xingqiu Cai,4 Yuping Wang,2 Ying Liu1 < Additional figure and tables ABSTRACT characterised by recurrent and brief attacks of are published online only. To Background Paroxysmal kinesigenic choreoathetosis involuntary movement.1 Familial and sporadic view these files please visit the (PKC) is characterised by recurrent and brief attacks of cases have been described. Familial PKC usually journal online (http://jmg.bmj. com/content/49/2.toc). involuntary movement, inherited as an autosomal shows an autosomal dominant inheritance pattern dominant trait with incomplete penetrance. A PKC locus with incomplete penetrance. 1State Key Laboratory of Medical Molecular Biology, has been previously mapped to the pericentromeric We previously performed linkage and haplotype Institute of Basic Medical region of chromosome 16 (16p11.2-q12.1), but the analysis in four Chinese families (family 2 and Sciences, Chinese Academy of causative gene remains unidentified. family 4 with incomplete penetrance) with similar Medical Sciences; School of Methods/results Deep sequencing of this 30 Mb region choreoathetosis clinical symptoms, and all mapped Basic Medicine, Peking Union enriched with array capture in five affected individuals the disease locus to a region between D16S3093 and Medical College, Beijing, China 2 3 2Department of Neurology, from four Chinese PKC families detected two D16S3057 at 16p11.2-q12.1.
  • The Genetic Relationship Between Paroxysmal Movement Disorders and Epilepsy

    The Genetic Relationship Between Paroxysmal Movement Disorders and Epilepsy

    Review article pISSN 2635-909X • eISSN 2635-9103 Ann Child Neurol 2020;28(3):76-87 https://doi.org/10.26815/acn.2020.00073 The Genetic Relationship between Paroxysmal Movement Disorders and Epilepsy Hyunji Ahn, MD, Tae-Sung Ko, MD Department of Pediatrics, Asan Medical Center Children’s Hospital, University of Ulsan College of Medicine, Seoul, Korea Received: May 1, 2020 Revised: May 12, 2020 Seizures and movement disorders both involve abnormal movements and are often difficult to Accepted: May 24, 2020 distinguish due to their overlapping phenomenology and possible etiological commonalities. Par- oxysmal movement disorders, which include three paroxysmal dyskinesia syndromes (paroxysmal Corresponding author: kinesigenic dyskinesia, paroxysmal non-kinesigenic dyskinesia, paroxysmal exercise-induced dys- Tae-Sung Ko, MD kinesia), hemiplegic migraine, and episodic ataxia, are important examples of conditions where Department of Pediatrics, Asan movement disorders and seizures overlap. Recently, many articles describing genes associated Medical Center Children’s Hospital, University of Ulsan College of with paroxysmal movement disorders and epilepsy have been published, providing much infor- Medicine, 88 Olympic-ro 43-gil, mation about their molecular pathology. In this review, we summarize the main genetic disorders Songpa-gu, Seoul 05505, Korea that results in co-occurrence of epilepsy and paroxysmal movement disorders, with a presenta- Tel: +82-2-3010-3390 tion of their genetic characteristics, suspected pathogenic mechanisms, and detailed descriptions Fax: +82-2-473-3725 of paroxysmal movement disorders and seizure types. E-mail: [email protected] Keywords: Dyskinesias; Movement disorders; Seizures; Epilepsy Introduction ies, and paroxysmal dyskinesias [3,4]. Paroxysmal dyskinesias are an important disease paradigm asso- Movement disorders often arise from the basal ganglia nuclei or ciated with overlapping movement disorders and seizures [5].
  • Clinical and Genetic Overview of Paroxysmal Movement Disorders and Episodic Ataxias

    Clinical and Genetic Overview of Paroxysmal Movement Disorders and Episodic Ataxias

    International Journal of Molecular Sciences Review Clinical and Genetic Overview of Paroxysmal Movement Disorders and Episodic Ataxias Giacomo Garone 1,2 , Alessandro Capuano 2 , Lorena Travaglini 3,4 , Federica Graziola 2,5 , Fabrizia Stregapede 4,6, Ginevra Zanni 3,4, Federico Vigevano 7, Enrico Bertini 3,4 and Francesco Nicita 3,4,* 1 University Hospital Pediatric Department, IRCCS Bambino Gesù Children’s Hospital, University of Rome Tor Vergata, 00165 Rome, Italy; [email protected] 2 Movement Disorders Clinic, Neurology Unit, Department of Neuroscience and Neurorehabilitation, IRCCS Bambino Gesù Children’s Hospital, 00146 Rome, Italy; [email protected] (A.C.); [email protected] (F.G.) 3 Unit of Neuromuscular and Neurodegenerative Diseases, Department of Neuroscience and Neurorehabilitation, IRCCS Bambino Gesù Children’s Hospital, 00146 Rome, Italy; [email protected] (L.T.); [email protected] (G.Z.); [email protected] (E.B.) 4 Laboratory of Molecular Medicine, IRCCS Bambino Gesù Children’s Hospital, 00146 Rome, Italy; [email protected] 5 Department of Neuroscience, University of Rome Tor Vergata, 00133 Rome, Italy 6 Department of Sciences, University of Roma Tre, 00146 Rome, Italy 7 Neurology Unit, Department of Neuroscience and Neurorehabilitation, IRCCS Bambino Gesù Children’s Hospital, 00165 Rome, Italy; [email protected] * Correspondence: [email protected]; Tel.: +0039-06-68592105 Received: 30 April 2020; Accepted: 13 May 2020; Published: 20 May 2020 Abstract: Paroxysmal movement disorders (PMDs) are rare neurological diseases typically manifesting with intermittent attacks of abnormal involuntary movements. Two main categories of PMDs are recognized based on the phenomenology: Paroxysmal dyskinesias (PxDs) are characterized by transient episodes hyperkinetic movement disorders, while attacks of cerebellar dysfunction are the hallmark of episodic ataxias (EAs).
  • Mutations in the Novel Protein PRRT2 Cause Paroxysmal Kinesigenic Dyskinesia with Infantile Convulsions

    Mutations in the Novel Protein PRRT2 Cause Paroxysmal Kinesigenic Dyskinesia with Infantile Convulsions

    NIH Public Access Author Manuscript Cell Rep. Author manuscript; available in PMC 2012 April 25. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Cell Rep. 2012 January 26; 1(1): 2–12. doi:10.1016/j.celrep.2011.11.001. Mutations in the novel protein PRRT2 cause paroxysmal kinesigenic dyskinesia with infantile convulsions Hsien-Yang Lee1, Yong Huang1,2, Nadine Bruneau3, Patrice Roll4, Elisha D.O. Roberson5, Mark Hermann1, Emily Quinn1,2, James Maas1, Robert Edwards1, Tetsuo Ashizawa6, Betul Baykan7, Kailash Bhatia8, Susan Bressman9, Michiko K. Bruno1,10, Ewout R. Brunt11, Roberto Caraballo12, Bernard Echenne13, Natalio Fejerman12, Steve Frucht14, Christina A. Gurnett15, Edouard Hirsch16, Henry Houlden8, Joseph Jankovic17, Wei-Ling Lee18, David R. Lynch19, Shehla Mohamed20, Ulrich Müller21, Mark P. Nespeca22, David Renner23, Jacques Rochette24, Gabrielle Rudolf16, Shinji Saiki25,26, Bing-Wen Soong27, Kathryn J. Swoboda23, Sam Tucker19, Nicholas Wood8, Michael Hanna8,28, Anne Bowcock5,28, Pierre Szepetowski3,28, Ying-Hui Fu1,28, and Louis J. Ptáček1,2,28 1Department of Neurology, UCSF, San Francisco, California, 94158 2Howard Hughes Medical Institute, San Francisco, California, 94158 3Institut de Neurobiologie de la Méditerranée, INMED. Inserm U901. Université de la Méditerranée. Marseille, France 4INSERM UMR_S910, Université de la Méditerranée, Marseille, France 5Division of Human Genetics, Department of Genetics, Washington University School of Medicine, Saint Louis, MO, 63110 6Department of Neurology, University of Florida, Gainesville, Florida 32611 7Department of Neurology, Istanbul University, Millet Cad 34390 Istanbul Turkey 8Institute of Neurology, University College London, London, WC1N 3BG 9Department of Neurology, Beth Israel Medical Center, New York, New York, 10003 10Department of Neurology, The Queen’s Medical Center, Honolulu, Hawaii, 96813 11Department of Neurology, University Medical Centre Groningen, University of Groningen, The Netherlands, 9713 GZ 12Department of Neurology, Juan P.
  • A Novel PRRT2 Pathogenic Variant in a Family with Paroxysmal Kinesigenic Dyskinesia and Benign Familial Infantile Seizures

    A Novel PRRT2 Pathogenic Variant in a Family with Paroxysmal Kinesigenic Dyskinesia and Benign Familial Infantile Seizures

    Downloaded from molecularcasestudies.cshlp.org on October 5, 2021 - Published by Cold Spring Harbor Laboratory Press A novel PRRT2 pathogenic variant in a family with Paroxysmal Kinesigenic Dyskinesia and Benign Familial Infantile Seizures Jacqueline G. Lu 1,8*, Juliet Bishop 5, Sarah Cheyette 4, Igor B. Zhulin 6,7, Su Guo 1,2*, Nara Sobreira 5, Steven E. Brenner 1,3 1 Department of Bioengineering and Therapeutic Sciences, 2 Institute for Human Genetics and Programs in Biological Sciences, University of California, San Francisco, CA, USA; 3 Department of Computational Biology, University of California, Berkeley, CA, USA; 4 Palo Alto Medical Foundation, Palo Alto, CA, USA 94306; 5 McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University School of Medicine Baltimore, MD, USA; 6 Computational Sciences and Engineering Division, Oak Ridge National Laboratory, Oak Ridge, TN, USA; 7Department of Microbiology, University of Tennessee, Knoxville, TN, USA 8 Gunn High School, 780 Arastradero Rd, Palo Alto, CA 94306 * Corresponding authors: [email protected]; [email protected] Short running title: A novel pathogenic PRRT2 variant in PKD and BFIS Downloaded from molecularcasestudies.cshlp.org on October 5, 2021 - Published by Cold Spring Harbor Laboratory Press ABSTRACT Paroxysmal Kinesigenic Dyskinesia (PKD) is a rare neurological disorder characterized by recurrent attacks of dyskinetic movements without alteration of consciousness that are often triggered by the initiation of voluntary movements. Whole exome sequencing has revealed a cluster of pathogenic variants in PRRT2 (proline-rich transmembrane protein), a gene with a function in synaptic regulation that remains poorly understood. Here, we report the discovery of a novel PRRT2 pathogenic variant inherited in an autosomal dominant pattern in a family with PKD and Benign Familial Infantile Seizures (BFIS).
  • With Infantile Convulsions in a Taiwanese Cohort

    With Infantile Convulsions in a Taiwanese Cohort

    PRRT2 Mutations in Paroxysmal Kinesigenic Dyskinesia with Infantile Convulsions in a Taiwanese Cohort Yi-Chung Lee1,2,3*., Ming-Jen Lee4, Hsiang-Yu Yu1,2, Chien Chen1,2, Chang-Hung Hsu5, Kon-Ping Lin1,2, Kwong-Kum Liao1,2, Ming-Hong Chang2,6, Yi-Chu Liao2,6, Bing-Wen Soong1,2,3*. 1 Department of Neurology, Taipei Veterans General Hospital, Taipei, Taiwan, 2 Department of Neurology, National Yang-Ming University School of Medicine, Taipei, Taiwan, 3 Brain Research Center, National Yang-Ming University School of Medicine, Taipei, Taiwan, 4 Department of Neurology, National Taiwan University Hospital, Taipei, Taiwan, 5 Department of Neurology, Tri-Service General Hospital, Taipei, Taiwan, 6 Section of Neurology, Taichung Veterans General Hospital, Taichung, Taiwan Abstract Background: Mutations in the PRRT2 gene have recently been identified in patients with familial paroxysmal kinesigenic dyskinesia with infantile convulsions (PKD/IC) and patients with sporadic PKD/IC from several ethnic groups. To extend these recent genetic reports, we investigated the frequency and identities of PRRT2 mutations in a cohort of Taiwanese patients with PKD/IC. Methodology and Principal Findings: We screened all 3 coding exons of PRRT2 for mutations in 28 Taiwanese patients with PKD/IC. Among them, 13 had familial PKD/IC and 15 were apparently sporadic cases. In total, 7 disparate mutations were identified in 13 patients, including 8 familial cases and 5 apparently sporadic cases. The mutations were not present in 500 healthy controls. Four mutations were novel. One patient had a missense mutation and all other patients carried PRRT2 mutations putatively resulting in a protein truncation.
  • PRRT2 (P-13): Sc-161170

    PRRT2 (P-13): Sc-161170

    SAN TA C RUZ BI OTEC HNOL OG Y, INC . PRRT2 (P-13): sc-161170 BACKGROUND PRODUCT PRRT2 (proline-rich transmembrane protein 2) is a 340 amino acid multi-pass Each vial contains 200 µg IgG in 1.0 ml of PBS with < 0.1% sodium azide membrane protein belonging to the CD225 family. Existing as three alterna - and 0.1% gelatin. tively spliced isoforms, the gene encoding PRRT2 maps to human chromo - Blocking peptide available for competition studies, sc-161170 P, (100 µg some 16p11.2 and mouse chromosome 7 F3. Chromosome 16 encodes over peptide in 0.5 ml PBS containing < 0.1% sodium azide and 0.2% BSA). 900 genes in approximately 90 million base pairs, makes up nearly 3% of human cellular DNA and is associated with a variety of genetic disorders. APPLICATIONS The GAN gene is located on chromosome 16 and, with mutation, may lead to giant axonal neuropathy, a nervous system disorder characterized by PRRT2 (P-13) is recommended for detection of PRRT2 of mouse and increasing malfunction with growth. The rare disorder Rubinstein-Taybi syn - human origin by Western Blotting (starting dilution 1:200, dilution range drome, characterized by mental retardation and predisposition to tumor 1:100-1:1000), immunofluorescence (starting dilution 1:50, dilution range growth and white blood cell neoplasias, and Crohn's disease, a gastroin - 1:50-1:500) and solid phase ELISA (starting dilution 1:30, dilution range testinal inflammatory condition, are also associated with chromosome 16. 1:30-1:3000); non cross-reactive with PRRT1 or PRRT3. Suitable for use as control antibody for PRRT2 siRNA (h): sc-93160, PRRT2 REFERENCES siRNA (m): sc-152521, PRRT2 shRNA Plasmid (h): sc-93160-SH, PRRT2 1.
  • Regulation of Cancer Stemness in Breast Ductal Carcinoma in Situ by Vitamin D Compounds

    Regulation of Cancer Stemness in Breast Ductal Carcinoma in Situ by Vitamin D Compounds

    Author Manuscript Published OnlineFirst on May 28, 2020; DOI: 10.1158/1940-6207.CAPR-19-0566 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Analysis of the Transcriptome: Regulation of Cancer Stemness in Breast Ductal Carcinoma In Situ by Vitamin D Compounds Naing Lin Shan1, Audrey Minden1,5, Philip Furmanski1,5, Min Ji Bak1, Li Cai2,5, Roman Wernyj1, Davit Sargsyan3, David Cheng3, Renyi Wu3, Hsiao-Chen D. Kuo3, Shanyi N. Li3, Mingzhu Fang4, Hubert Maehr1, Ah-Ng Kong3,5, Nanjoo Suh1,5 1Department of Chemical Biology, Ernest Mario School of Pharmacy; 2Department of Biomedical Engineering, School of Engineering; 3Department of Pharmaceutics, Ernest Mario School of Pharmacy; 4Environmental and Occupational Health Sciences Institute and School of Public Health, 5Rutgers Cancer Institute of New Jersey, New Brunswick; Rutgers, The State University of New Jersey, NJ, USA Running title: Regulation of cancer stemness by vitamin D compounds Key words: Breast cancer, cancer stemness, gene expression, DCIS, vitamin D compounds Financial Support: This research was supported by the National Institutes of Health grant R01 AT007036, R01 AT009152, ES005022, Charles and Johanna Busch Memorial Fund at Rutgers University and the New Jersey Health Foundation. Corresponding author: Dr. Nanjoo Suh, Department of Chemical Biology, Ernest Mario School of Pharmacy, Rutgers, The State University of New Jersey, 164 Frelinghuysen Road, Piscataway, New Jersey 08854. Tel: 848-445-8030, Fax: 732-445-0687; e-mail: [email protected] Disclosure of Conflict of Interest: “The authors declare no potential conflicts of interest” 1 Downloaded from cancerpreventionresearch.aacrjournals.org on September 27, 2021.
  • Association of a Synonymous SCN1B Variant Affecting Splicing Efficiency with Benign Familial Infantile Epilepsy (BFIE)

    Association of a Synonymous SCN1B Variant Affecting Splicing Efficiency with Benign Familial Infantile Epilepsy (BFIE)

    Association of a synonymous SCN1B variant affecting splicing efficiency with Benign Familial Infantile Epilepsy (BFIE) 1 1 3 4 Sunay Usluer , Melek Aslı Kayserili *, Aslı Gündoğdu Eken2, Uluc Yiş , Costin Leu **, Janine 2 Altmüller4, Holger Thiele4, Peter Nuernberg4, Thomas Sander4, S. Hande Çağlayan 1 Formerly affiliated with the Department of Molecular Biology and Genetics, Boğaziçi University, Istanbul, Turkey 2 Department of Molecular Biology and Genetics, Bogazici University, Istanbul, Turkey 3 Department of Pediatrics, Division of Child Neurology, Dokuz Eylül University School of Medicine, İzmir, Turkey 4 Cologne Center for Genomics, University of Cologne, Cologne, Germany *Present address: Max Planck Institute of Molecular Cell Biology and Genetics, Dresden, Germany ** Present address: NIHR University College London Hospitals Biomedical Research Centre, Department of Clinical and Experimental Epilepsy, UCL Institute of Neurology, London, United Kingdom Corresponding author: Server Hande Çağlayan, Ph.D., Department of Molecular Biology and Genetics, Boğaziçi University, İstanbul, Turkey Tel: +90 -212 359 6881 Fax: +90 -212 287 2468 Email: [email protected] Key Words: Benign Familial Infantile Seizures, SCN1B, PRRT2, splice variant, minigene reporter assay Abbreviations: BIS: Benign Infantile Seizures BFIC/BFIS: Benign Familial Infantile Convulsions/ Seizures BFIE: Benign Familial Infantile Epilepsy WES: Whole Exome Sequencing AD: Autosomal Dominant SCN1B: Voltage Gated Sodium Channel Beta 1 ABSTRACT Benign familial infantile epilepsy (BFIE) is clinically characterized by clusters of brief partial seizures progressing to secondarily generalized seizures with onset at the age of 3-7 months and with favorable outcome. PRRT2 mutations are the most common cause of BFIE, and found in about 80% of BFIE families. In this study, we analyzed a large multiplex BFIE family by linkage and whole exome sequencing (WES) analyses.
  • Primepcr™Assay Validation Report

    Primepcr™Assay Validation Report

    PrimePCR™Assay Validation Report Gene Information Gene Name Protein RGD1564195 Gene Symbol Prrt2 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.51543 Ensembl Gene ID ENSRNOG00000029366 Entrez Gene ID 361651 Assay Information Unique Assay ID qRnoCED0001711 Assay Type SYBR® Green Detected Coding Transcript(s) ENSRNOT00000049044 Amplicon Context Sequence TGCGGAGGTGCAGAGTACAATTTAGATGTTCAGGGAGGCGTCCAGAAGTGCAGA GGGGTTTTCAGAGTGCAGGACTAGGGGGGTCAAGAGGCAGGAGGGGAGATCT Amplicon Length (bp) 76 Chromosome Location 1:205432616-205432721 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 100 R2 0.9996 cDNA Cq 26.24 cDNA Tm (Celsius) 81.5 gDNA Cq 26.1 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Prrt2, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.