Original Article Cytogenet Genome Res Published online: January 26, 2019 DOI: 10.1159/000496379 ZZ/ZW Sex Chromosomes in the Endemic Puerto Rican Leaf-Toed Gecko ( Phyllodactylus wirshingi ) a c a a, b, d Stuart V. Nielsen Juan D. Daza Brendan J. Pinto Tony Gamble a b Department of Biological Sciences, Marquette University, and Milwaukee Public Museum, Milwaukee, WI , c d Department of Biological Sciences, Sam Houston State University, Huntsville, TX , and Bell Museum of Natural History, University of Minnesota, Saint Paul, MN , USA Keywords ed sex chromosomes – but can also be used to identify which Gekkota · Lizard · Phyllodactylidae · RADseq · Reptile · chromosomes in the genome are the sex chromosomes. We Squamata here identify a ZZ/ZW sex chromosome system in P. wir- shingi . Furthermore, we show that 4 of the female-specific markers contain fragments of genes found on the avian Z Abstract and discuss homology with P. wirshingi sex chromosomes. Investigating the evolutionary processes influencing the or- © 2019 S. Karger AG, Basel igin, evolution, and turnover of vertebrate sex chromosomes requires the classification of sex chromosome systems in a great diversity of species. Among amniotes, squamates (liz- Investigating the number and directionality of transi- ards and snakes) – and gecko lizards in particular – are wor- tions among sex-determining systems is a vital prerequi- thy of additional study. Geckos possess all major vertebrate site for studying sex chromosome evolution. This in- sex-determining systems, as well as multiple transitions volves not only determining whether a species has a het- among them, yet we still lack data on the sex-determining erogametic male (XX/XY) or female (ZZ/ZW) sex systems for the vast majority of species. We here utilize re- chromosome system, but also identifying which chromo- striction-site associated DNA sequencing (RADseq) to iden- somes in the genome are the sex chromosomes. However, tify the sex chromosome system of the Puerto Rican endem- we still lack basic knowledge of sex-determining mecha- ic leaf-toed gecko (Phyllodactylidae: Phyllodactylus wir- nisms for many species [Bachtrog et al., 2014], let alone shingi ), in order to confirm a ZZ/ZW sex chromosome system the genomic homology of said sex chromosomes. Cyto- within the genus, as well as to better categorize the diversity genetic methods, like karyotyping, have long been the within this poorly characterized family. RADseq has proven principal means of identifying an organism’s sex chromo- an effective alternative to cytogenetic methods for deter- some system, yet most vertebrate species possess mor- mining whether a species has an XX/XY or ZZ/ZW sex chro- phologically indistinguishable sex chromosomes [Devlin mosome system – particularly in taxa with non-differentiat- and Nagahama, 2002; Matsubara et al., 2006; Stöck et al., © 2019 S. Karger AG, Basel Tony Gamble Department of Biological Sciences, Marquette University P.O. Box 1881 E-Mail [email protected] Milwaukee, WI 53201-1881 (USA) www.karger.com/cgr E-Mail tgamble @ geckoevolution.org Downloaded by: Iowa State University 129.186.138.35 - 1/26/2019 5:51:04 PM 2011; Gamble and Zarkower, 2014; Otto, 2014]. Further- Table 1. Phyllodactylus wirshingi samples used in this study more, such data do not address which chromosomes in ID Sex Locality the genome are the sex chromosomes in a comparative framework. However, recent advances in both cytogenet- TG2007 Male Isla de Caja de Muertos, Puerto Rico ics and DNA sequencing techniques have facilitated the TG3210 Male Bosque Estatal de Guánica, Puerto Rico identification of sex chromosomes in many additional TG3219 Male Bosque Estatal de Guánica, Puerto Rico species, spawning a renewed interest in ascertaining and TG3220 Male Bosque Estatal de Guánica, Puerto Rico TG3221 Male Bosque Estatal de Guánica, Puerto Rico classifying the sex chromosome systems of previously in- TG3223 Male Bosque Estatal de Guánica, Puerto Rico tractable taxa [Pokorná et al., 2011; Deakin et al., 2016; TG3225 Male Bosque Estatal de Guánica, Puerto Rico Gamble et al., 2017, 2018; Nielsen et al., 2018]. TG3228 Male Bosque Estatal de Guánica, Puerto Rico Even within a group as varied as squamates, the geck- TG2016a Male Bosque Estatal de Guánica, Puerto Rico a os (Squamata: Gekkota) are a stand-out clade worthy of TG3208 Male Bosque Estatal de Guánica, Puerto Rico more detailed study. Geckos are a species-rich (>1,700 TG2004 Female Isla de Caja de Muertos, Puerto Rico species [Uetz et al., 2017]), near globally distributed clade TG2008 Female Isla de Caja de Muertos, Puerto Rico of lizards, who possess all major vertebrate sex-determin- TG2009 Female Isla de Caja de Muertos, Puerto Rico TG2385 Female Bosque Estatal de Guánica, Puerto Rico ing systems, as well as multiple transitions among them TG3209 Female Bosque Estatal de Guánica, Puerto Rico [Moritz, 1990; Ezaz et al., 2009; Gamble, 2010; Gamble et TG3222 Female Bosque Estatal de Guánica, Puerto Rico al., 2015a]. The high diversity of geckos makes them an TG3224 Female Bosque Estatal de Guánica, Puerto Rico ideal vertebrate model to study the origins and evolution TG3226 Female Bosque Estatal de Guánica, Puerto Rico of sex chromosomes. However, huge swaths of the gecko TG3227 Female Bosque Estatal de Guánica, Puerto Rico TG2017a Female Bosque Estatal de Guánica, Puerto Rico phylogeny lack any information about sex-determining systems, and fewer than 3% of gecko species have a sex- a These samples were used for PCR validation only. determining system known with high confidence [Gam- ble et al., 2015a]. Despite this paucity of data, roughly one-half to two-thirds of all observed transitions among Table 2. PCR primers used to validate female-specific RADseq squamate sex-determining systems are in geckos [Gam- markers in Phyllodactylus wirshingi ble et al., 2015a]. Fostering an enhanced knowledge con- cerning gekkotan, and thus squamate, sex-determining Primer ID Sequence (5′→3′) Annealing systems will increase their utility as a model clade to study temperature the origins and evolution of sex-determining systems Pw84-F CAGAAGGCATGAGACTGGAGAG 57°C [Janzen and Krenz, 2004]. Therefore, a concentrated ef- Pw84-R CAAATCTCCAGGAGCAGAGTGG fort to identify sex chromosome systems in additional Pw116-F CGATTCCCTTGCCTTAATCGGT 56°C clades will serve to fill crucial gaps in our knowledge, and Pw116-R AGATTCTGACCCAGGAAGAGGA permit more comprehensive hypothesis testing. Pw186-F ACTTTCCACTAAGGTGATCCCC 56°C The Phyllodactylidae are distributed throughout the Pw186-R GGGCCAAGGACTATGACTTGAA New World, North Africa, Europe, and the Middle East. Pw187-F GACTGAGGAGGGTCTGCTCT 56°C Of the more than 135 species, only 14 have published Pw187-R GTCTTCTGGGCTCTGACTGG karyotypes and just 2 species, Phyllodactylus lanei and Thecadactylus rapicauda, exhibit evidence of heteromor- phic sex chromosomes [King, 1981; Pellegrino et al., 2004, 2005, 2010; Olmo and Signorino, 2005; Murphy et al., seq) methodology [Gamble and Zarkower, 2014], another 2009; Schmid et al., 2014]. However, in both species, the population of T. rapicauda from Trinidad and Tobago story is complex. For example, in P. lanei , different karyo- was found to also have ZZ/ZW sex chromosomes [Gam- typic formulas between sexes were indicative of a ZZ/ZW ble et al., 2015a]. In addition to ZZ/ZW sex chromosomes, sex chromosome system, yet more recent work could not a number of species in the genus Tarentola show strong replicate these findings [Castiglia et al., 2009]. Similarly in evidence of environmentally determined sex (i.e., temper- T. rapicauda , the authors conclude that sex chromosomes ature-dependent sex determination or TSD) [Nettmann are in a “nascent state of differentiation” as not all sampled and Rykena, 1985; Hielen, 1992]. Thus, there are some populations were heteromorphic. Using a recently devel- interesting inferences one can draw within this family. oped restriction-site associated DNA sequencing (RAD- First, we know very little about the diversity of sex chro- 2 Cytogenet Genome Res Nielsen/Daza/Pinto/Gamble DOI: 10.1159/000496379 Downloaded by: Iowa State University 129.186.138.35 - 1/26/2019 5:51:04 PM male female novel gene A Fig. 1. A–D PCR validation of 4 female-spe- TRABD2A cific RADseq markers in Phyllodactylus LIX1 wirshingi . A Pw84. B Pw116. C Pw186. D Px187. Primers amplified in a female- B specific manner in all examined male and female samples (see Table 1), generating a TRPM3 single (presumably W-specific) band in all but one locus, Pw186. The latter produced C both Z- and W-specific bands. Specimen ID numbers are listed below each lane. E Cytogenetic map of the Gallus gallus Z D chromosome depicting the location of 4 E genes identified by BLAST of P. wirshingi TG3220 TG3221 TG3210 TG3219 TG3223 TG3225 TG3228 TG3208 TG2007 TG2016 TG3224 TG3209 TG3222 TG3226 TG3227 TG2008 TG2009 TG2017 TG2385 female-specific RAD contigs (Table 3). mosome systems within Phyllodactylidae, and given the with high-fidelity Sbf I restriction enzyme (New England Biolabs). diversity observed in other gekkotan groups, data from Individually barcoded P1 adapters were ligated to the Sbf I cut site additional species are essential before more definitive for each sample. We pooled samples into multiple libraries, soni- cated, and size-selected into 200–500-bp fragments using magnet- conclusions can be drawn. Second, based on our limited ic beads in a PEG/NaCl buffer [Rohland and Reich, 2012]. Librar- evidence, there is at least 1 transition among sex-deter- ies were blunt-end repaired and dA-tailed before ligating a P2 mining systems within Phyllodactylidae – between TSD adapter containing unique Illumina barcodes to each pooled li- and female heterogamety. Lastly, both T. rapicauda and brary. We amplified libraries via PCR (16 cycles) with Q5 high- fidelity DNA polymerase (New England Biolabs) and cleaned/size- P. lanei possess ZZ/ZW sex chromosome systems, but are selected a second time into 250–600-bp library fragments using their sex chromosomes homologous? magnetic beads in PEG/NaCl buffer.