DOCSLIB.ORG

Supp Material.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supp Material.Pdf SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1 (A) Growth curves of wild type, Ring1B-/-, Eed-/- and dKO ES cells. Growth curves for two independent dKO ES cell lines were recorded. (B) Quantitative expression analysis of PcG deficient ES cells. Expression of ES cell markers is largely unchanged in all PcG mutant ES cells compared to wild type ES cells. Supplemental Figure 2 (A) Western analysis of histone H3 lysine 27 mono- and di-methylation (H3K27me1 and H3K27me2), and histone H4 lysine 20 mono-methylation (H4K20me1) in wild type and Polycomb mutant ES cells (genotypes indicated). macroH2A and H2A.Z are used to control for loading. (B) Immunofluorescence staining (red) of H3K27me1 and H3K27me2 in ES cells of indicated genotype. DNA is counterstained with DAPI (blue). Supplemental Figure 3 (A) Weights of wild type, Eed-/- and Ring1B-/- teratomas in gram. (B) Table showing the number of performed ES cell injections and the number of teratomas obtained. (C) Teratoma formed 10 weeks after injection of dKOEedGFP ES cells into the flanks of immunodeficient mice using Matrigel as a carrier. Scale bar represents one centimeter. (D) Immunohistochemistry (brown) of dKOEedGFP teratoma sections showing expression of the endodermal marker (Troma1) and the ectodermal marker (GFAP). Supplemental Figure 4 (A) Immunofluorescence analysis of Nestin positive NS cells formed by Eed-/- and Eed-/- Ring1B-/fl ES cells in defined culture conditions. (B) PCR strategy used to distinguish deleted from 1lox Ring1B allele. Supplemental Figure 5 (A) Embryoid bodies generated from wild type, dKO and dKOEedGFP ES cells on day 6 and day 14 after aggregation are shown. Scale bars represent 1mm. (B) RT-PCR expression analysis of the pluripotency marker Oct4 and differentiation markers Afp, Foxa2, and p16 in embryoid bodies generated from wild type, Eed deficient, dKO and dKOEedGFP ES cells. Results from undifferentiated ES cells and embryoid body cultures on days 11 and 15 of differentiation are shown. Actin is used to control for equal loading. Supplemental Figure 6 Brightfield (left) and fluorescence microscopy images (right) of blastocysts injected with GFP expressing wild type and dKO ES cells. Contribution of the ES cells to the inner cell mass is observed by the GFP signal (green, right). Not injected blastocysts are shown as a control. Supplemental Figure 7 (A) Venn diagram showing genes that are upregulated (> 2 fold; p<0.05) in Eed-/-, Ring1B-/- and dKO ES cells compared to wt. (B) Venn diagram showing upregulated genes in all genotypes (> 2 fold; p<0.05) that have previously been reported as PcG targets (Ku et al. 2008). (C) Volcano plots showing the global transcriptional changes in Eed-/-, Ring1B-/- and dKO vs. wild type ES cells. All genes present on the Affymetrix GeneChip 430.2 array were plotted. Each circle represents one gene. The log fold change in the indicated genotype versus wild type is represented on the x-axis. The y-axis shows the log10 of the p value. A p value of 0.05 and a fold change of 2 are indicated by grey lines. (D) Volcano plots showing changes in gene expression of bivalent PcG target genes in indicated genotypes versus wild type. Each circle represents one PcG target gene. The log fold change in the indicated geneotype versus wild type is represented on the x-axis. The y-axis shows the log10 of the p value. A p value of 0.05 and a fold change of 2 are indicated by grey lines. Bivalent genes are preferentially upregulated in PcG mutant ES cells and only few genes show downregulation. The shift to upregulation is most pronounced in dKO ES cells. However, derepression is only weak for the majority of PcG targets in all PcG mutants. (E) Recently it was reported that PcG target promoters can be classified into two subgroups (Ku et al. 2008). One group is also bound by the PRC1 component Ring1B whereas the other is marked by PRC2 only. To test if a functional difference exists between the PRC1 bound and not bound bivalent genes, we investigated if PRC1 bound bivalent genes are more likely to be derepressed (> 2 fold; p<0.05) in PcG deficient ES cells than PRC2 only bound genes. Indeed we found Ring1B positive bivalent genes to be preferentially derepressed in Eed-/-, Ring1B-/- and dKO ES cells. This indicates that silencing of Ring1B positive bivalent genes is more sensitive to loss of PcG proteins than silencing of PRC2 only bound bivalent genes. Unexpectedly, in Ring1B deficient ES cells, genes that were reported to be bound only by the PRC2 complex do also show a higher propensity to be upregulated. This can possibly be explained by Ring1B binding below the threshold used by Ku et al. in their study. (F) The presence of pluripotency associated TFs or (G) core regulators of pluripotency (Oct4, Nanog and Sox2) on PcG target genes has only a minor influence on derepression upon disruption of the PcG system (Kim et al. 2008; Ku et al. 2008). Supplemental Figure 8 Virtually all PcG targets and most H3K4me3 bound genes have CpG rich (hiCpG) promoters (Mikkelsen et al. 2007; Ku et al. 2008). Promoters showing an intermediate (inCpG) or low (loCpG) CpG level are depleted for both H3K27me3 and H3K4me3. Overall, genes derepressed in Ring1B-/-, Eed-/- or dKO ES cells are randomly distributed in all three CpG classes. As expected, derepressed Polycomb target genes do almost exclusively have high CpG class promoters. Derepressed non PcG target genes are depleted for high CpG class promoters and show a stronger enrichment of intermediate and low CpG promoters in all three PcG knockout ES cell lines. Supplemental Figure 9 (A) Endogenous retroelements were derepressed in dKO ES cells and the fold changes compared to wild type ES cells from Affymetrix analysis are plotted. (B) Northern analysis showing that repression of IAPs can be re-established by expression of an EedGFP fusion protein in dKO ES cells. (C) Chromatin immunoprecipitation analysis showing H3K27me3 enrichment on MLV elements in wild type, Eed deficient and Ring1B deficient ES cells. SUPPLEMENTAL FIGURES A 8 wild type Eed-/- Ring1B-/- 6 dKO 1 dKO 2 4 million cells 2 0 0123days B 200 regulation of pluripotency factors Eed-/- Ring1B-/- dKO 1 150 dKO2 100 50 % expression of wild type 0 Rex1 Klf4 Nanog Oct4 Leeb et al., Supplemental Figure 1 A -/- EedGFP -/- wt Eed Ring1B dKO dKO H3K27me1 H3K27me2 H4K20me1 macroH2A H2A.Z B Dapi H3K27me1 Dapi H3K27me2 wt * Eed-/- dKO * dKOEedGFP Leeb et al., Supplemental Figure 2 AB Teratoma weights 4 3 2 1 0 wt Eed-/- Ring1B-/- C D dKOEedGFP dKOEedGFP Troma1 GFAP Leeb et al., Supplemental Figure 3 A Eed-/- Eed-/- Ring1B-/fl Nestin / DAPI B wild type allele (3kb) SA pA minus allele (500bp) ATG pCMV-HYTK floxed allele (6kb) conditional to minus allele (300bp) Leeb et al., Supplemental Figure 4 A wt dKOdKO EedGFP d6 d14 B wt Eed-/- dKOdKO EedGFP ES EB d11 EB d15 ES EB d11 EB d15 ES EB d11 EB d15 ES EB d11 EB d15 Oct Afp Foxa2 p16 Actin Leeb et al., Supplemental Figure 5 injected cell type brightfield GFP wt dKO not injected Leeb et al., Supplemental Figure 6 A Eed-/- (1151) B Eed-/- (476) Ring1B-/- (814) 261 76 48 220 15 Ring1B-/- (279) 192 376 466 28 170 193 43 1005 329 dKO (2017) dKO (757) C all genes on array D log fold change Ring1B-/- vs wt log fold change Eed-/- vs wt log fold change dKO vs wt bivalent genes log fold change Ring1B-/- vs wt log fold change Eed-/- vs wt log fold change dKO vs wt E 40 all genes on array PRC2 only 30 PRC1&PRC2 bound all bivalent 20 10 0 % of genes derepressed in group in derepressed genes of % Ring1B-/- Eed-/- dKO F G bivalent bivalent 30 pluri TF bound 30 core pluri TF bound and bivalent 25 and bivalent 25 pluri TF core pluri TF 20 20 15 15 10 10 5 5 0 0 Ring1B-/- Eed-/- dKO Ring1B-/- Eed-/- dKO % derepressed genes in group % derepressed genes in group Leeb et al., Supplemental Figure 7 Derepression in different CpG classes 100 100 100 loCpG inCpG 80 80 80 hiCpG 60 60 60 40 40 40 20 20 20 % of all derepressed genes 0 0 0 % of derepressed PcG target genes % of derepressed PcG target expected Ring1B-/- Eed-/- dKO expected Ring1B-/- Eed-/- dKO genes % of derepressed non-target expected Ring1B-/- Eed-/- dKO Leeb et al., Supplemental Figure 8 A B Derepression of endogenous retroelements 30 Ring1B-/- Eed-/- Eed-/- Eed-/- Ring1B-/fl dKO dKO EedGFP wild type 20 dKO Ring1B-/- IAP 10 fold change Gapd 0 IAP RLTR33 ORR1A1 RLTR4 MMVL30 C Lef1 120 Bmp2 MLV gag Gapdh 120 120 120 100 100 100 100 mock 80 80 80 80 H3K27me3 60 60 60 60 40 40 40 % H3 40 20 20 20 20 0 0 0 0 -/- -/- -/- -/- wt Eed-/- Ring1B-/- wt Eed Ring1B wt Eed Ring1B wt Eed-/- Ring1B-/- Leeb et al., Supplemental Figure 9 SUPPLEMENTAL TABLES Supplemental Table 1 The 100 most upregulated genes and PcG target genes with a p-value smaller than 0.05 in PcG mutant ES cells are listed with fold change (fc) compared to wild type ES cells. Leeb et al. Supplemental Table 1 all genes PcG target genes Ring1B-/- vs wt Eed-/- vs wt dKO vs wt Ring1B-/- vs wt Eed-/- vs wt dKO vs wt Entrez GeneID Annotation fc Entrez GeneID Annotation fc Entrez GeneID Annotation fc Entrez GeneID Annotation fc Entrez GeneID Annotation fc Entrez GeneID Annotation fc 21426 Tcfec; transcription factor EC 129.33 12309 S100g; S100 calcium bind 150.58 22139 Ttr; transthyretin 330.83 22771 Zic1; zinc finger protein of the c 79.57 83555 Tex13; testis expressed gen 50.52 83555 Tex13; testis expressed gen 72.93 12309 S100g; S100 calcium binding p 80.04 21426 Tcfec; transcription factor 81.71 12309 S100g; S100 calcium binding 259.16 15423 Hoxc4; homeo box C4 41.81 15423 Hoxc4; homeo box C4 39.17 20671
Load more

Recommended publications
  • TBXA2R Rsnps, Transcriptional Factor Binding Sites and Asthma in Asians
    Open Journal of Pediatrics, 2014, 4, 148-161 Published Online June 2014 in SciRes. http://www.scirp.org/journal/ojped http://dx.doi.org/10.4236/ojped.2014.42021 TBXA2R rSNPs, Transcriptional Factor Binding Sites and Asthma in Asians Norman E. Buroker Department of Pediatrics, University of Washington, Seattle, USA Email: [email protected] Received 25 January 2014; revised 20 February 2014; accepted 27 February 2014 Copyright © 2014 by author and Scientific Research Publishing Inc. This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/ Abstract Four regulatory single nucleotide polymorphisms (rSNPs) (rs2238631, rs2238632, rs2238633 and rs2238634) in intron one, two rSNPs (rs1131882 and rs4523) in exon 3 and one rSNP (rs5756) in the 3’UTR of the thromboxane A2 receptor (TBXA2R) gene have been associated with childhood- onset asthma in Asians. These rSNP alleles alter the DNA landscape for potential transcriptional factors (TFs) to attach resulting in changes in transcriptional factor binding sites (TFBS). These TFBS changes are examined with respect to asthma which has been found to be significantly asso- ciated with the rSNPs. Keywords TBXA2R, rSNPs, TFBS, Asthma 1. Introduction Asthma is a chronic inflammatory condition of the airways characterized by recurrent episodes of reversible air- way obstruction and increased bronchial hyper-responsiveness which results from the interactions between gen- es and environmental factors [1]-[3]. Asthma causes episodes of wheeze, cough, and shortness of breath [4]. Re- cent studies indicate that the genetic factors of childhood-onset asthma differ from those of adult-onset asthma [3] [5].
    [Show full text]
  • PARSANA-DISSERTATION-2020.Pdf
    DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks.
    [Show full text]
  • Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
    Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials: Supplemental Table 1 Abbreviations FMDV Foot and Mouth Disease Virus FMD Foot and Mouth Disease NC Non-treated Control DEGs Differentially Expressed Genes RNA-seq High-throughput Sequencing of Mrna RT-qPCR Quantitative Real-time Reverse Transcriptase PCR TCID50 50% Tissue Culture Infective Doses CPE Cytopathic Effect MOI Multiplicity of Infection DMEM Dulbecco's Modified Eagle Medium FBS Fetal Bovine Serum PBS Phosphate Buffer Saline QC Quality Control FPKM Fragments per Kilo bases per Million fragments method GO Gene Ontology KEGG Kyoto Encyclopedia of Genes and Genomes R Pearson Correlation Coefficient NFKBIA NF-kappa-B Inhibitor alpha IL6 Interleukin 6 CCL4 C-C motif Chemokine 4 CXCL2 C-X-C motif Chemokine 2 TNF Tumor Necrosis Factor VEGFA Vascular Endothelial Growth Gactor A CCL20 C-C motif Chemokine 20 CSF2 Macrophage Colony-Stimulating Factor 2 GADD45B Growth Arrest and DNA Damage Inducible 45 beta MYC Myc proto-oncogene protein FOS Proto-oncogene c-Fos MCL1 Induced myeloid leukemia cell differentiation protein Mcl-1 MAP3K14 Mitogen-activated protein kinase kinase kinase 14 IRF1 Interferon regulatory factor 1 CCL5 C-C motif chemokine 5 ZBTB3 Zinc finger and BTB domain containing 3 OTX1 Orthodenticle homeobox 1 TXNIP Thioredoxin-interacting protein ZNF180 Znc Finger Protein 180 ZNF36 Znc Finger Protein 36 ZNF182 Zinc finger protein 182 GINS3 GINS complex subunit 3 KLF15 Kruppel-like factor 15 Supplemental Table 2 Primers for Verification of RNA-seq-detected DEGs with RT-qPCR TNF F: CGACTCAGTGCCGAGATCAA R:
    [Show full text]
  • Homeobox Gene Expression Profile in Human Hematopoietic Multipotent
    Leukemia (2003) 17, 1157–1163 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu Homeobox gene expression profile in human hematopoietic multipotent stem cells and T-cell progenitors: implications for human T-cell development T Taghon1, K Thys1, M De Smedt1, F Weerkamp2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium; and 2Department of Immunology, Erasmus Medical Center, Rotterdam, The Netherlands Class I homeobox (HOX) genes comprise a large family of implicated in this transformation proces.14 The HOX-C locus transcription factors that have been implicated in normal and has been primarily implicated in lymphomas.15 malignant hematopoiesis. However, data on their expression or function during T-cell development is limited. Using degener- Hematopoietic cells are derived from stem cells that reside in ated RT-PCR and Affymetrix microarray analysis, we analyzed fetal liver (FL) in the embryo and in the adult bone marrow the expression pattern of this gene family in human multipotent (ABM), which have the unique ability to self-renew and thereby stem cells from fetal liver (FL) and adult bone marrow (ABM), provide a life-long supply of blood cells. T lymphocytes are a and in T-cell progenitors from child thymus. We show that FL specific type of hematopoietic cells that play a major role in the and ABM stem cells are similar in terms of HOX gene immune system. They develop through a well-defined order of expression, but significant differences were observed between differentiation steps in the thymus.16 Several transcription these two cell types and child thymocytes.
    [Show full text]
  • Targeting the Tryptophan Hydroxylase 2 Gene for Functional Analysis in Mice and Serotonergic Differentiation of Embryonic Stem Cells
    TARGETING THE TRYPTOPHAN HYDROXYLASE 2 GENE FOR FUNCTIONAL ANALYSIS IN MICE AND SEROTONERGIC DIFFERENTIATION OF EMBRYONIC STEM CELLS Inaugural-Dissertation to obtain the academic degree Doctor rerum naturalium (Dr. rer. nat.) submitted to the Department of Biology, Chemistry and Pharmacy of Freie Universität Berlin by Dana Kikic, M.Sc. in Molecular biology and Physiology from Nis June, 2009 The doctorate studies were performed in the research group of Prof. Michael Bader Molecular Biology of Peptide Hormones at Max-Delbrück-Center for Molecular Medicine in Berlin, Buch Mai 2005 - September 2008. 1st Reviewer: Prof. Michael Bader 2nd Reviewer: Prof. Udo Heinemann date of defence: 13. August 2009 ACKNOWLEDGMENTS Herewith, I would like to acknowledge the persons who made this thesis possible and without whom my initiation in the world of basic science research would not have the spin it has now, neither would my scientific illiteracy get the chance to eradicate. I am expressing my very personal gratitude and recognition to: Prof. Michael Bader, for an inexhaustible guidance in all the matters arising during the course of scientific work, for an instinct in defining and following the intellectual challenge and for letting me following my own, for necessary financial support, for defining the borders of reasonable and unreasonable, for an invaluable time and patience, and an amazing efficiency in supporting, motivating, reading, correcting and shaping my scientific language during the last four years. Prof. Harald Saumweber and Prof. Udo Heinemann, for taking over the academic supervision of the thesis, and for breathing in it a life outside the laboratory walls and their personal signature.
    [Show full text]
  • 1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
    Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN.
    [Show full text]
  • Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short
    bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transcriptomic analysis of native versus cultured human and mouse dorsal root ganglia focused on pharmacological targets Short title: Comparative transcriptomics of acutely dissected versus cultured DRGs Andi Wangzhou1, Lisa A. McIlvried2, Candler Paige1, Paulino Barragan-Iglesias1, Carolyn A. Guzman1, Gregory Dussor1, Pradipta R. Ray1,#, Robert W. Gereau IV2, # and Theodore J. Price1, # 1The University of Texas at Dallas, School of Behavioral and Brain Sciences and Center for Advanced Pain Studies, 800 W Campbell Rd. Richardson, TX, 75080, USA 2Washington University Pain Center and Department of Anesthesiology, Washington University School of Medicine # corresponding authors [email protected], [email protected] and [email protected] Funding: NIH grants T32DA007261 (LM); NS065926 and NS102161 (TJP); NS106953 and NS042595 (RWG). The authors declare no conflicts of interest Author Contributions Conceived of the Project: PRR, RWG IV and TJP Performed Experiments: AW, LAM, CP, PB-I Supervised Experiments: GD, RWG IV, TJP Analyzed Data: AW, LAM, CP, CAG, PRR Supervised Bioinformatics Analysis: PRR Drew Figures: AW, PRR Wrote and Edited Manuscript: AW, LAM, CP, GD, PRR, RWG IV, TJP All authors approved the final version of the manuscript. 1 bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Mary Bartlett Bunge 40
    EDITORIAL ADVISORY COMMITTEE Marina Bentivoglio Larry F. Cahill Stanley Finger Duane E. Haines Louise H. Marshall Thomas A. Woolsey Larry R. Squire (Chairperson) The History of Neuroscience in Autobiography VOLUME 4 Edited by Larry R. Squire ELSEVIER ACADEMIC PRESS Amsterdam Boston Heidelberg London New York Oxford Paris San Diego San Francisco Singapore Sydney Tokyo This book is printed on acid-free paper. (~ Copyright 9 byThe Society for Neuroscience All Rights Reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without permission in writing from the publisher. Permissions may be sought directly from Elsevier's Science & Technology Rights Department in Oxford, UK: phone: (+44) 1865 843830, fax: (+44) 1865 853333, e-mail: [email protected]. You may also complete your request on-line via the Elsevier homepage (http://elsevier.com), by selecting "Customer Support" and then "Obtaining Permissions." Academic Press An imprint of Elsevier 525 B Street, Suite 1900, San Diego, California 92101-4495, USA http ://www.academicpress.com Academic Press 84 Theobald's Road, London WC 1X 8RR, UK http://www.academicpress.com Library of Congress Catalog Card Number: 2003 111249 International Standard Book Number: 0-12-660246-8 PRINTED IN THE UNITED STATES OF AMERICA 04 05 06 07 08 9 8 7 6 5 4 3 2 1 Contents Per Andersen 2 Mary Bartlett Bunge 40 Jan Bures 74 Jean Pierre G. Changeux 116 William Maxwell (Max) Cowan 144 John E. Dowling 210 Oleh Hornykiewicz 240 Andrew F.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Supp Table 1.Pdf
    Upregulated genes in Hdac8 null cranial neural crest cells fold change Gene Symbol Gene Title 134.39 Stmn4 stathmin-like 4 46.05 Lhx1 LIM homeobox protein 1 31.45 Lect2 leukocyte cell-derived chemotaxin 2 31.09 Zfp108 zinc finger protein 108 27.74 0710007G10Rik RIKEN cDNA 0710007G10 gene 26.31 1700019O17Rik RIKEN cDNA 1700019O17 gene 25.72 Cyb561 Cytochrome b-561 25.35 Tsc22d1 TSC22 domain family, member 1 25.27 4921513I08Rik RIKEN cDNA 4921513I08 gene 24.58 Ofa oncofetal antigen 24.47 B230112I24Rik RIKEN cDNA B230112I24 gene 23.86 Uty ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome 22.84 D8Ertd268e DNA segment, Chr 8, ERATO Doi 268, expressed 19.78 Dag1 Dystroglycan 1 19.74 Pkn1 protein kinase N1 18.64 Cts8 cathepsin 8 18.23 1500012D20Rik RIKEN cDNA 1500012D20 gene 18.09 Slc43a2 solute carrier family 43, member 2 17.17 Pcm1 Pericentriolar material 1 17.17 Prg2 proteoglycan 2, bone marrow 17.11 LOC671579 hypothetical protein LOC671579 17.11 Slco1a5 solute carrier organic anion transporter family, member 1a5 17.02 Fbxl7 F-box and leucine-rich repeat protein 7 17.02 Kcns2 K+ voltage-gated channel, subfamily S, 2 16.93 AW493845 Expressed sequence AW493845 16.12 1600014K23Rik RIKEN cDNA 1600014K23 gene 15.71 Cst8 cystatin 8 (cystatin-related epididymal spermatogenic) 15.68 4922502D21Rik RIKEN cDNA 4922502D21 gene 15.32 2810011L19Rik RIKEN cDNA 2810011L19 gene 15.08 Btbd9 BTB (POZ) domain containing 9 14.77 Hoxa11os homeo box A11, opposite strand transcript 14.74 Obp1a odorant binding protein Ia 14.72 ORF28 open reading
    [Show full text]
  • Regulation Of
    Sede Amministrativa: Università degli Studi di Padova Dipartimento di Istologia, Microbiologia e Biotecnologie Mediche SCUOLA DI DOTTORATO DI RICERCA IN BIOSCIENZE INDIRIZZO GENETICA CICLO XXIII EXPRESSION AND FUNCTIONAL ROLE OF EMILIN-3, A PECULIAR MEMBER OF THE EMILIN/MULTIMERIN FAMILY Direttore della Scuola : Ch.mo Prof. Giuseppe Zanotti Coordinatore d’indirizzo: Ch.mo Prof. Paolo Bonaldo Supervisore :Ch.mo Prof. Paolo Bonaldo Dottorando : Alvise Schiavinato 1 2 THESIS CONTENTS ABSTRACT ________________________________________________________________________________________ 5 ABSTRACT (ITALIANO)__________________________________________________________________________ 6 INTRODUCTION__________________________________________________________________________________ 7 THE EXTRACELLULAR MATRIX_____________________________________________________________________ 7 REGULATION OF TGF−Β SIGNALING BY THE EXTRACELLULAR MATRIX______________________________ 9 EMILIN-1________________________________________________________________________________________11 THE EMILIN/MULTIMERIN FAMILY ______________________________________________________________12 THE EMILIN/MULTIMERIN FAMILY IN ZEBRAFISH ________________________________________________13 STRUCTURE AND FUNCTION OF THE NOTOCHORD _________________________________________________14 AIM OF THE RESEARCH ______________________________________________________________________16 MATERIALS AND METHODS__________________________________________________________________ 17 ANIMALS ________________________________________________________________________________________17
    [Show full text]