SUPPLEMENTAL FIGURE LEGENDS

Supplemental Figure 1

(A) Growth curves of wild type, Ring1B-/-, Eed-/- and dKO ES cells. Growth curves for two independent dKO ES cell lines were recorded. (B) Quantitative expression analysis of PcG deficient ES cells. Expression of ES cell markers is largely unchanged in all PcG mutant ES cells compared to wild type ES cells.

Supplemental Figure 2

(A) Western analysis of histone H3 lysine 27 mono- and di-methylation (H3K27me1 and

H3K27me2), and histone H4 lysine 20 mono-methylation (H4K20me1) in wild type and

Polycomb mutant ES cells (genotypes indicated). macroH2A and H2A.Z are used to control for loading. (B) Immunofluorescence staining (red) of H3K27me1 and H3K27me2 in ES cells of indicated genotype. DNA is counterstained with DAPI (blue).

Supplemental Figure 3

(A) Weights of wild type, Eed-/- and Ring1B-/- teratomas in gram. (B) Table showing the number of performed ES cell injections and the number of teratomas obtained. (C) Teratoma formed 10 weeks after injection of dKOEedGFP ES cells into the flanks of immunodeficient mice using Matrigel as a carrier. Scale bar represents one centimeter. (D)

Immunohistochemistry (brown) of dKOEedGFP teratoma sections showing expression of the endodermal marker (Troma1) and the ectodermal marker (GFAP).

Supplemental Figure 4

(A) Immunofluorescence analysis of Nestin positive NS cells formed by Eed-/- and

Eed-/- Ring1B-/fl ES cells in defined culture conditions. (B) PCR strategy used to distinguish deleted from 1lox Ring1B allele.

Supplemental Figure 5

(A) Embryoid bodies generated from wild type, dKO and dKOEedGFP ES cells on day 6 and day 14 after aggregation are shown. Scale bars represent 1mm. (B) RT-PCR expression analysis of the pluripotency marker Oct4 and differentiation markers Afp, Foxa2, and p16 in embryoid bodies generated from wild type, Eed deficient, dKO and dKOEedGFP ES cells.

Results from undifferentiated ES cells and embryoid body cultures on days 11 and 15 of differentiation are shown. Actin is used to control for equal loading.

Supplemental Figure 6

Brightfield (left) and fluorescence microscopy images (right) of blastocysts injected with GFP expressing wild type and dKO ES cells. Contribution of the ES cells to the inner cell mass is observed by the GFP signal (green, right). Not injected blastocysts are shown as a control.

Supplemental Figure 7

(A) Venn diagram showing genes that are upregulated (> 2 fold; p<0.05) in Eed-/-, Ring1B-/- and dKO ES cells compared to wt. (B) Venn diagram showing upregulated genes in all genotypes (> 2 fold; p<0.05) that have previously been reported as PcG targets (Ku et al.

2008). (C) Volcano plots showing the global transcriptional changes in Eed-/-, Ring1B-/- and dKO vs. wild type ES cells. All genes present on the Affymetrix GeneChip 430.2 array were plotted. Each circle represents one gene. The log fold change in the indicated genotype versus wild type is represented on the x-axis. The y-axis shows the log10 of the p value. A p value of 0.05 and a fold change of 2 are indicated by grey lines. (D) Volcano plots showing changes in gene expression of bivalent PcG target genes in indicated genotypes versus wild type. Each circle represents one PcG target gene. The log fold change in the indicated geneotype versus wild type is represented on the x-axis. The y-axis shows the log10 of the p value. A p value of

0.05 and a fold change of 2 are indicated by grey lines. Bivalent genes are preferentially upregulated in PcG mutant ES cells and only few genes show downregulation. The shift to upregulation is most pronounced in dKO ES cells. However, derepression is only weak for the majority of PcG targets in all PcG mutants. (E) Recently it was reported that PcG target promoters can be classified into two subgroups (Ku et al. 2008). One group is also bound by the PRC1 component Ring1B whereas the other is marked by PRC2 only. To test if a functional difference exists between the PRC1 bound and not bound bivalent genes, we investigated if PRC1 bound bivalent genes are more likely to be derepressed (> 2 fold; p<0.05) in PcG deficient ES cells than PRC2 only bound genes. Indeed we found Ring1B positive bivalent genes to be preferentially derepressed in Eed-/-, Ring1B-/- and dKO ES cells.

This indicates that silencing of Ring1B positive bivalent genes is more sensitive to loss of

PcG proteins than silencing of PRC2 only bound bivalent genes. Unexpectedly, in Ring1B deficient ES cells, genes that were reported to be bound only by the PRC2 complex do also show a higher propensity to be upregulated. This can possibly be explained by Ring1B binding below the threshold used by Ku et al. in their study. (F) The presence of pluripotency associated TFs or (G) core regulators of pluripotency (Oct4, Nanog and Sox2) on PcG target genes has only a minor influence on derepression upon disruption of the PcG system (Kim et al. 2008; Ku et al. 2008).

Supplemental Figure 8

Virtually all PcG targets and most H3K4me3 bound genes have CpG rich (hiCpG) promoters

(Mikkelsen et al. 2007; Ku et al. 2008). Promoters showing an intermediate (inCpG) or low (loCpG) CpG level are depleted for both H3K27me3 and H3K4me3. Overall, genes derepressed in Ring1B-/-, Eed-/- or dKO ES cells are randomly distributed in all three CpG classes. As expected, derepressed Polycomb target genes do almost exclusively have high

CpG class promoters. Derepressed non PcG target genes are depleted for high CpG class promoters and show a stronger enrichment of intermediate and low CpG promoters in all three PcG knockout ES cell lines.

Supplemental Figure 9

(A) Endogenous retroelements were derepressed in dKO ES cells and the fold changes compared to wild type ES cells from Affymetrix analysis are plotted. (B) Northern analysis showing that repression of IAPs can be re-established by expression of an EedGFP fusion protein in dKO ES cells. (C) Chromatin immunoprecipitation analysis showing H3K27me3 enrichment on MLV elements in wild type, Eed deficient and Ring1B deficient ES cells. SUPPLEMENTAL FIGURES

A

8 wild type Eed-/- Ring1B-/- 6 dKO 1 dKO 2 4 million cells 2

0 0123days

B

200 regulation of pluripotency factors Eed-/- Ring1B-/- dKO 1 150 dKO2

100

50

% expression of wild type 0 Rex1 Klf4 Nanog Oct4

Leeb et al., Supplemental Figure 1 A -/- EedGFP -/- wt Eed Ring1B dKO dKO H3K27me1

H3K27me2

H4K20me1

macroH2A

H2A.Z

B Dapi H3K27me1 Dapi H3K27me2

wt

* Eed-/-

dKO

* dKOEedGFP

Leeb et al., Supplemental Figure 2 AB

Teratoma weights 4

3

2

1

0 wt Eed-/- Ring1B-/-

C D dKOEedGFP

dKOEedGFP Troma1

GFAP

Leeb et al., Supplemental Figure 3 A Eed-/- Eed-/- Ring1B-/fl

Nestin / DAPI B

wild type allele (3kb)

SA pA minus allele (500bp)

ATG pCMV-HYTK floxed allele (6kb)

conditional to minus allele (300bp)

Leeb et al., Supplemental Figure 4 A wt dKOdKO EedGFP

d6

d14

B

wt Eed-/- dKOdKO EedGFP ES EB d11 EB d15 ES EB d11 EB d15 ES EB d11 EB d15 ES EB d11 EB d15 Oct

Afp

Foxa2

p16

Actin

Leeb et al., Supplemental Figure 5 injected cell type brightfield GFP

wt

dKO

not injected

Leeb et al., Supplemental Figure 6 A Eed-/- (1151) B Eed-/- (476) Ring1B-/- (814) 261 76 48 220 15 Ring1B-/- (279) 192 376 466 28 170 193

43

1005 329

dKO (2017) dKO (757) C all genes on array

D log fold change Ring1B-/- vs wt log fold change Eed-/- vs wt log fold change dKO vs wt bivalent genes

log fold change Ring1B-/- vs wt log fold change Eed-/- vs wt log fold change dKO vs wt E 40 all genes on array PRC2 only 30 PRC1&PRC2 bound all bivalent

20

10

0 % of genes derepressed in group in derepressed genes of % Ring1B-/- Eed-/- dKO F G

bivalent bivalent 30 pluri TF bound 30 core pluri TF bound and bivalent 25 and bivalent 25 pluri TF core pluri TF 20 20 15 15 10 10 5 5 0 0 Ring1B-/- Eed-/- dKO Ring1B-/- Eed-/- dKO % derepressed genes in group % derepressed genes in group Leeb et al., Supplemental Figure 7 Derepression in different CpG classes

100 100 100 loCpG inCpG 80 80 80 hiCpG

60 60 60

40 40 40

20 20 20 % of all derepressed genes 0 0 0 % of derepressed PcG target genes % of derepressed PcG target

expected Ring1B-/- Eed-/- dKO expected Ring1B-/- Eed-/- dKO genes % of derepressed non-target expected Ring1B-/- Eed-/- dKO

Leeb et al., Supplemental Figure 8 % H3 C 100 120 20 40 60 80 0 Derepression ofendogenousretroelements A wt fold change 10 20 30 0 Lef1 Eed -/- IAP Ring1B

RLTR33 -/-

ORR1A1 100 120 20 40 60 80 0 RLTR4 wt

MMVL30 Bmp2 Eed dKO Eed-/- Ring1B-/- -/- Ring1B -/- Leeb etal., Supplemental Figure 9 100 120 20 40 60 80 0 wt MLV gag B Eed -/- Ring1B

-/- wild type Eed-/- 100 120

20 40 60 80 Ring1B-/- 0 Eed-/- Ring1B-/fl wt dKO Gapdh dKO EedGFP Eed IAP Gapd -/- Ring1B H3K27me3 mock -/- SUPPLEMENTAL TABLES

Supplemental Table 1

The 100 most upregulated genes and PcG target genes with a p-value smaller than 0.05 in

PcG mutant ES cells are listed with fold change (fc) compared to wild type ES cells.

Leeb et al. Supplemental Table 1 all genes PcG target genes Ring1B-/- vs wt Eed-/- vs wt dKO vs wt Ring1B-/- vs wt Eed-/- vs wt dKO vs wt Entrez GeneID Annotation fc Entrez GeneID Annotation fc Entrez GeneID Annotation fc Entrez GeneID Annotation fc Entrez GeneID Annotation fc Entrez GeneID Annotation fc 21426 Tcfec; transcription factor EC 129.33 12309 S100g; S100 calcium bind 150.58 22139 Ttr; transthyretin 330.83 22771 Zic1; zinc finger protein of the c 79.57 83555 Tex13; testis expressed gen 50.52 83555 Tex13; testis expressed gen 72.93 12309 S100g; S100 calcium binding p 80.04 21426 Tcfec; transcription factor 81.71 12309 S100g; S100 calcium binding 259.16 15423 Hoxc4; homeo box C4 41.81 15423 Hoxc4; homeo box C4 39.17 20671 Sox17; SRY-box containing 50.07 22771 Zic1; zinc finger protein of the c 79.57 83555 Tex13; testis expressed ge 50.52 21426 Tcfec; transcription factor EC 94.47 15405 Hoxa9; homeo box A9 34.54 16869 Lhx1; LIM homeobox protein 33.21 22771 Zic1; zinc finger protein of th 43.82 15423 Hoxc4; homeo box C4 41.81 15423 Hoxc4; homeo box C4 39.17 83555 Tex13; testis expressed gene 72.93 13593 Ebf3; early B-cell factor 3 22.12 18505 Pax3; paired box gene 3 31.49 15423 Hoxc4; homeo box C4 43.06 70678 3021401C12Rik; RIKEN cDNA 39.30 16869 Lhx1; LIM homeobox prote 33.21 20755 Sprr2a; small proline-rich prote 50.56 18505 Pax3; paired box gene 3 21.87 20671 Sox17; SRY-box containing 25.58 15220 Foxq1; Forkhead box Q1 40.37 15405 Hoxa9; homeo box A9 34.54 18505 Pax3; paired box gene 3 31.49 20671 Sox17; SRY-box containing ge 50.07 19332 Rab20; RAB20, member RAS o 20.51 231440 9130213B05Rik; RIKEN cD 23.25 18505 Pax3; paired box gene 3 31.59 65969 Cubn; cubilin (intrinsic factor-co 29.90 70678 3021401C12Rik; RIKEN c 26.78 70125 2210016H18Rik; RIKEN cDNA 47.08 15430 Hoxd10; homeo box D10 16.49 22771 Zic1; zinc finger protein of th 22.98 15371 Hmx1; H6 homeo box 1 28.19 15397 Hoxa11os; homeo box A11, op 24.18 20671 Sox17; SRY-box containin 25.58 22771 Zic1; zinc finger protein of the 43.82 83555 Tex13; testis expressed gene 1 15.06 15405 Hoxa9; homeo box A9 21.28 16869 Lhx1; LIM homeobox protein 28.03 19073 Srgn; serglycin 24.09 231440 9130213B05Rik; RIKEN c 23.25 15423 Hoxc4; homeo box C4 43.06 13132 Dab2; disabled homolog 2 (Dro 14.35 27206 Nrk; Nik related kinase 20.45 17153 Mal; myelin and lymphocyte 26.28 70125 2210016H18Rik; RIKEN cDNA 23.20 22771 Zic1; zinc finger protein of 22.98 15220 Foxq1; Forkhead box Q1 40.37 20671 Sox17; SRY-box containing gen 14.19 26410 Map3k8; mitogen activated 17.21 13593 Ebf3; early B-cell factor 3 26.07 13593 Ebf3; early B-cell factor 3 22.12 15405 Hoxa9; homeo box A9 21.28 18828 Plscr2; phospholipid scrambla 38.66 15371 Hmx1; H6 homeo box 1 13.89 13082 Cyp26a1; cytochrome P450 16.12 14120 Fbp2; fructose bisphosphata 24.98 18505 Pax3; paired box gene 3 21.87 27206 Nrk; Nik related kinase 20.45 70678 3021401C12Rik; RIKEN cDNA 36.69 11819 Nr2f2; nuclear receptor subfam 13.80 15220 Foxq1; Forkhead box Q1 15.58 13380 Dkk1; dickkopf homolog 1 (X 24.64 83561 Tdrd1; tudor domain containing 21.54 65969 Cubn; cubilin (intrinsic fact 19.78 70574 Cpm; carboxypeptidase M 36.09 21384 Tbx15; T-box 15 13.65 12590 Cdx1; caudal type homeo bo 14.60 71908 Cldn23; claudin 23 23.58 19332 Rab20; RAB20, member RAS o 20.51 320047 4833444G19Rik; RIKEN c 19.35 18505 Pax3; paired box gene 3 31.59 15220 Foxq1; Forkhead box Q1 12.21 15371 Hmx1; H6 homeo box 1 13.63 27206 Nrk; Nik related kinase 22.53 329416 Nostrin; nitric oxide synthase tra 20.31 100727 Ugt2b34; UDP glucuronos 19.06 15371 Hmx1; H6 homeo box 1 28.19 15395 Hoxa10; homeo box A10 12.03 21384 Tbx15; T-box 15 13.26 231440 9130213B05Rik; RIKEN cDN 22.01 17276 Mela; Melanoma antigen 19.73 19202 Rhox6; reproductive home 17.82 16869 Lhx1; LIM homeobox protein 1 28.03 13036 Ctsh; cathepsin H 11.52 13132 Dab2; disabled homolog 2 ( 13.06 16772 Lama1; laminin, alpha 1 21.85 15430 Hoxd10; homeo box D10 16.49 19073 Srgn; serglycin 17.52 15476 Hs3st1; heparan sulfate (gluco 26.55 71712 1200002N14Rik; RIKEN cDNA 11.30 16772 Lama1; laminin, alpha 1 12.93 13082 Cyp26a1; cytochrome P450, 21.56 83555 Tex13; testis expressed gene 1 15.06 26410 Map3k8; mitogen activated 17.21 15397 Hoxa11os; homeo box A11, op 26.44 14120 Fbp2; fructose bisphosphatase 9.53 15430 Hoxd10; homeo box D10 12.71 15405 Hoxa9; homeo box A9 20.89 107753 Lgals2; lectin, galactose-binding 14.49 15476 Hs3st1; heparan sulfate (g 17.14 17153 Mal; myelin and lymphocyte pr 26.28 15433 Hoxd13; homeo box D13 9.45 12705 Cited1; Cbp/p300-interacting 12.19 26410 Map3k8; mitogen activated p 19.54 13032 Ctsc; cathepsin C 14.43 15397 Hoxa11os; homeo box A1 16.80 13593 Ebf3; early B-cell factor 3 26.07 15427 Hoxc9; homeo box C9 8.91 20312 Cx3cl1; chemokine (C-X3-C 12.16 12827 Col4a2; procollagen, type IV 19.44 13132 Dab2; disabled homolog 2 (Dro 14.35 13082 Cyp26a1; cytochrome P45 16.12 109222 Rarres1; retinoic acid receptor 25.78 24113 Vax2; ventral anterior homeobo 8.70 12826 Col4a1; procollagen, type IV 12.15 15430 Hoxd10; homeo box D10 18.74 622402 Akr1c12; aldo-keto reductase fa 14.34 11576 Afp; alpha fetoprotein 15.83 14120 Fbp2; fructose bisphosphatase 24.98 18423 Otx1; orthodenticle homolog 1 ( 8.55 19332 Rab20; RAB20, member RA 12.03 12826 Col4a1; procollagen, type IV 17.81 20671 Sox17; SRY-box containing gen 14.19 15220 Foxq1; Forkhead box Q1 15.58 13380 Dkk1; dickkopf homolog 1 (Xe 24.64 71592 Pogk; pogo transposable eleme 8.40 24113 Vax2; ventral anterior home 11.90 19332 Rab20; RAB20, member RA 17.27 15371 Hmx1; H6 homeo box 1 13.89 12590 Cdx1; caudal type homeo 14.60 217169 Tns4; tensin 4 23.93 21410 Tcf2; transcription factor 2 7.79 12156 Bmp2; bone morphogenetic 11.76 21384 Tbx15; T-box 15 17.03 11819 Nr2f2; nuclear receptor subfam 13.80 217169 Tns4; tensin 4 14.14 71908 Cldn23; claudin 23 23.58 21386 Tbx3; T-box 3 7.64 12827 Col4a2; procollagen, type IV 11.56 57246 Tbx20; T-box 20 16.79 21384 Tbx15; T-box 15 13.65 243659 Styk1; serine/threonine/tyr 14.05 27206 Nrk; Nik related kinase 22.53 16772 Lama1; laminin, alpha 1 7.62 57246 Tbx20; T-box 20 11.46 71712 1200002N14Rik; RIKEN cDN 15.37 21946 Pglyrp1; peptidoglycan recognit 12.42 622402 Akr1c12; aldo-keto reducta 14.02 11576 Afp; alpha fetoprotein 22.52 18595 Pdgfra; platelet derived growth 7.47 18423 Otx1; orthodenticle homolog 11.43 13036 Ctsh; cathepsin H 15.33 243659 Styk1; serine/threonine/tyrosine 12.34 21957 Tnnt3; troponin T3, skeleta 13.75 231440 9130213B05Rik; RIKEN cDNA 22.01 20927 Abcc8; ATP-binding cassette, s 7.43 17300 Foxc1; forkhead box C1 11.25 16002 Igf2; insulin-like growth facto 15.07 15436 Hoxd4; homeo box D4 12.28 15371 Hmx1; H6 homeo box 1 13.63 16772 Lama1; laminin, alpha 1 21.85 13380 Dkk1; dickkopf homolog 1 (Xen 7.40 13380 Dkk1; dickkopf homolog 1 (X 10.89 12705 Cited1; Cbp/p300-interacting 14.64 74129 Dmgdh; dimethylglycine dehydr 12.24 21384 Tbx15; T-box 15 13.26 13082 Cyp26a1; cytochrome P450, fa 21.56 15438 Hoxd9; homeo box D9 7.36 15427 Hoxc9; homeo box C9 10.86 11881 Arsb; arylsulfatase B 14.45 15220 Foxq1; Forkhead box Q1 12.21 13132 Dab2; disabled homolog 2 13.06 65969 Cubn; cubilin (intrinsic factor-c 20.94 15229 Foxd1; forkhead box D1 7.31 16002 Igf2; insulin-like growth facto 10.83 16939 Lor; loricrin 14.41 71089 Sep.12; septin 12 12.14 16772 Lama1; laminin, alpha 1 12.93 15405 Hoxa9; homeo box A9 20.89 12826 Col4a1; procollagen, type IV, a 7.12 22750 Zfp9; zinc finger protein 9 9.71 15427 Hoxc9; homeo box C9 14.36 15395 Hoxa10; homeo box A10 12.03 268780 Egflam; EGF-like, fibronec 12.89 67896 Ccdc80; coiled-coil domain co 20.35 83558 Tex11; testis expressed gene 1 7.10 209195 Clic6; chloride intracellular c 9.57 12394 Runx1; runt related transcrip 14.32 15476 Hs3st1; heparan sulfate (glucos 11.97 15430 Hoxd10; homeo box D10 12.71 73690 Glipr1; GLI pathogenesis-relat 19.99 224796 Clic5; chloride intracellular chan 6.69 15395 Hoxa10; homeo box A10 9.20 20312 Cx3cl1; chemokine (C-X3-C 13.76 72906 2900042A17Rik; RIKEN cDNA 11.62 78365 1500016L03Rik; RIKEN cD 12.35 100727 Ugt2b34; UDP glucuronosyltra 19.70 22066 Trpc4; transient receptor poten 6.57 27205 Podxl; podocalyxin-like 8.98 12831 Col5a1; procollagen, type V, 13.73 13036 Ctsh; cathepsin H 11.52 20724 Serpinb5; serine (or cystei 12.19 26410 Map3k8; mitogen activated pro 19.54 12827 Col4a2; procollagen, type IV, a 6.52 24059 Slco2a1; solute carrier orga 8.97 15395 Hoxa10; homeo box A10 13.47 73429 1700109F18Rik; RIKEN cDNA 11.39 12705 Cited1; Cbp/p300-interacti 12.19 12827 Col4a2; procollagen, type IV, a 19.44 14180 Fgf9; fibroblast growth factor 9 6.46 66859 Slc16a9; solute carrier famil 8.96 18186 Nrp1; neuropilin 1 13.46 71712 1200002N14Rik; RIKEN cDNA 11.30 20312 Cx3cl1; chemokine (C-X3- 12.16 15430 Hoxd10; homeo box D10 18.74 50916 Irx4; Iroquois related homeobox 6.30 15433 Hoxd13; homeo box D13 8.67 24059 Slco2a1; solute carrier organ 13.16 56746 Tex101; testis expressed gene 10.88 12826 Col4a1; procollagen, type 12.15 212326 BC035537; cDNA sequence B 18.16 20680 Sox7; SRY-box containing gene 6.21 20927 Abcc8; ATP-binding cassett 8.60 15229 Foxd1; forkhead box D1 12.93 15437 Hoxd8; homeo box D8 10.69 19332 Rab20; RAB20, member R 12.03 12826 Col4a1; procollagen, type IV, a 17.81 15404 Hoxa7; homeo box A7 6.08 71712 1200002N14Rik; RIKEN cD 8.50 18595 Pdgfra; platelet derived grow 12.90 68614 Letmd1; LETM1 domain contain 10.30 109246 Tspan9; tetraspanin 9 11.97 19332 Rab20; RAB20, member RAS 17.27 18227 Nr4a2; Nuclear receptor subfam 6.03 15426 Hoxc8; homeo box C8 8.34 20680 Sox7; SRY-box containing g 12.66 171284 Timd2; T-cell immunoglobulin a 9.97 24113 Vax2; ventral anterior hom 11.90 21384 Tbx15; T-box 15 17.03 17536 Mrg1; myeloid ecotropic viral in 5.97 24056 Sh3bp5; SH3-domain bindin 7.81 18423 Otx1; orthodenticle homolog 12.65 100042000 LOC100042000; similar to diacy 9.92 12156 Bmp2; bone morphogenet 11.76 57246 Tbx20; T-box 20 16.79 14465 Gata6; GATA binding protein 6 5.94 15376 Foxa2; forkhead box A2 7.76 20745 Spock1; sparc/osteonectin, c 12.61 72512 Tmem173; transmembrane pro 9.82 12827 Col4a2; procollagen, type 11.56 74129 Dmgdh; dimethylglycine dehyd 16.31 214763 E330016A19Rik; RIKEN cDNA 5.92 12475 Cd14; CD14 antigen 7.49 56753 Tacstd2; tumor-associated c 12.55 14120 Fbp2; fructose bisphosphatase 9.53 57246 Tbx20; T-box 20 11.46 110454 Ly6a; lymphocyte antigen 6 co 16.06 15424 Hoxc5; homeo box C5 5.92 227545 5430407P10Rik; RIKEN cD 7.47 14254 Flt1; FMS-like tyrosine kinas 12.43 15433 Hoxd13; homeo box D13 9.45 18423 Otx1; orthodenticle homolo 11.43 22361 Vnn1; vanin 1 15.57 15431 Hoxd11; homeo box D11 5.88 12394 Runx1; runt related transcrip 7.32 60527 Fads3; fatty acid desaturase 11.93 15427 Hoxc9; homeo box C9 8.91 73690 Glipr1; GLI pathogenesis-r 11.27 71712 1200002N14Rik; RIKEN cDNA 15.37 240590 Dmrt3; doublesex and mab-3 re 5.84 16668 Krt18; keratin 18 7.23 54670 Atp8b1; ATPase, class I, typ 11.75 78365 1500016L03Rik; RIKEN cDNA 8.73 17300 Foxc1; forkhead box C1 11.25 17178 Fxyd3; FXYD domain-containi 15.35 223433 BC052328; cDNA sequence BC 5.77 18595 Pdgfra; platelet derived grow 7.14 12156 Bmp2; bone morphogenetic 11.74 24113 Vax2; ventral anterior homeobo 8.70 94242 Tinagl; tubulointerstitial ne 10.96 13036 Ctsh; cathepsin H 15.33 12705 Cited1; Cbp/p300-interacting tra 5.72 15438 Hoxd9; homeo box D9 7.04 14465 Gata6; GATA binding protein 11.49 110454 Ly6a; lymphocyte antigen 6 com 8.68 13380 Dkk1; dickkopf homolog 1 10.89 16002 Igf2; insulin-like growth factor 2 15.07 11554 Adrb1; adrenergic receptor, bet 5.70 20378 Frzb; frizzled-related protein 7.01 213696 Duoxa1; dual oxidase matura 11.19 70846 4921506M07Rik; RIKEN cDNA 8.64 15427 Hoxc9; homeo box C9 10.86 19073 Srgn; serglycin 14.82 235135 Tmem45b; transmembrane pro 5.36 20361 Sema7a; sema domain, imm 6.98 21859 Timp3; tissue inhibitor of me 10.88 18423 Otx1; orthodenticle homolog 1 ( 8.55 16002 Igf2; insulin-like growth fac 10.83 22296 V1ra1; vomeronasal 1 recepto 14.77 170765 Ripply3; ripply3 homolog (zebra 5.34 60527 Fads3; fatty acid desaturase 6.80 209195 Clic6; chloride intracellular c 10.87 11576 Afp; alpha fetoprotein 8.42 17276 Mela; Melanoma antigen 10.51 12705 Cited1; Cbp/p300-interacting t 14.64 12590 Cdx1; caudal type homeo box 1 5.33 15229 Foxd1; forkhead box D1 6.77 13132 Dab2; disabled homolog 2 (D 10.45 98558 Mael; maelstrom homolog (Dros 8.41 14766 Gpr56; G protein-coupled 10.28 27384 Akr1c13; aldo-keto reductase 14.46 73333 Slc25a31; "solute carrier family 5.33 20680 Sox7; SRY-box containing g 6.76 224796 Clic5; chloride intracellular c 10.34 71592 Pogk; pogo transposable eleme 8.40 18826 Lcp1; lymphocyte cytosolic 10.28 11881 Arsb; arylsulfatase B 14.45 57246 Tbx20; T-box 20 5.29 14120 Fbp2; fructose bisphosphata 6.70 108116 Slco3a1; solute carrier organ 10.26 68338 Golt1a; golgi transport 1 homolo 8.18 319876 Cobll1; Cobl-like 1 10.26 16939 Lor; loricrin 14.41 74318 Hod; homeobox only domain 5.21 108116 Slco3a1; solute carrier orga 6.64 12153 Bmp1; bone morphogenetic 10.12 69852 Tcf23; transcription factor 23 8.14 100223 9630041G16Rik; RIKEN c 10.18 15427 Hoxc9; homeo box C9 14.36 13082 Cyp26a1; cytochrome P450, fa 5.17 14465 Gata6; GATA binding protei 6.59 171180 Syt12; synaptotagmin XII 10.00 64918 Bhmt2; betaine-homocysteine m 8.12 104384 Rhox9; reproductive home 9.75 12394 Runx1; runt related transcriptio 14.32 17762 Mapt; microtubule-associated p 5.16 54670 Atp8b1; ATPase, class I, typ 6.56 53623 Gria3; glutamate receptor, io 9.95 73690 Glipr1; GLI pathogenesis-relate 7.96 22750 Zfp9; zinc finger protein 9 9.71 67405 Nts; neurotensin 14.09 15376 Foxa2; forkhead box A2 5.09 21814 Tgfbr3; transforming growth 6.51 15433 Hoxd13; homeo box D13 9.92 268780 Egflam; EGF-like, fibronectin ty 7.91 209195 Clic6; chloride intracellular 9.57 94242 Tinagl; tubulointerstitial nephri 13.84 15939 Ier5; immediate early response 5.06 19227 Pthlh; parathyroid hormone- 6.44 15376 Foxa2; forkhead box A2 9.74 21410 Tcf2; transcription factor 2 7.79 228576 Mall; mal, T-cell differentia 9.51 20312 Cx3cl1; chemokine (C-X3-C m 13.76 66654 Tex12; testis expressed gene 1 4.99 15424 Hoxc5; homeo box C5 6.41 50766 Crim1; cysteine rich transme 9.73 21386 Tbx3; T-box 3 7.64 72512 Tmem173; transmembran 9.39 12831 Col5a1; procollagen, type V, a 13.73 13813 Eomes; eomesodermin homolo 4.89 13731 Emp2; epithelial membrane 6.30 14118 Fbn1; fibrillin 1 9.68 16772 Lama1; laminin, alpha 1 7.62 72297 B3gnt3; UDP-GlcNAc:beta 9.34 72297 B3gnt3; UDP-GlcNAc:betaGal 13.73 14463 Gata4; GATA binding protein 4 4.83 18511 Pax9; Paired box gene 9 6.25 21410 Tcf2; transcription factor 2 9.34 100552 AA675344; expressed sequenc 7.62 216019 Hkdc1; hexokinase domain 9.28 15395 Hoxa10; homeo box A10 13.47 22348 Slc32a1; solute carrier family 3 4.81 227753 Gsn; gelsolin 6.16 20429 Shox2; short stature homeob 9.32 18595 Pdgfra; platelet derived growth 7.47 15395 Hoxa10; homeo box A10 9.20 18186 Nrp1; neuropilin 1 13.46 12156 Bmp2; bone morphogenetic pro 4.81 15228 Foxg1; forkhead box G1 6.11 12475 Cd14; CD14 antigen 9.28 15408 Hoxb13; homeo box B13 7.47 15437 Hoxd8; homeo box D8 9.02 83379 Klb; klotho beta 13.44 66859 Slc16a9; solute carrier family 1 4.80 17702 Msx2; homeo box, msh-like 6.09 14421 B4galnt1; beta-1,4-N-acetyl- 9.21 105855 Nckap1l; NCK associated prote 7.46 27205 Podxl; podocalyxin-like 8.98 24059 Slco2a1; solute carrier organic 13.16 69219 Ddah1; dimethylarginine dimeth 4.77 18027 Nfia; nuclear factor I/A 6.06 230316 Megf9; multiple EGF-like-dom 9.16 20927 Abcc8; ATP-binding cassette, s 7.43 24059 Slco2a1; solute carrier org 8.97 14013 Evi1; ecotropic viral integration 13.00 12418 Cbx4; chromobox homolog 4 (D 4.76 21386 Tbx3; T-box 3 5.99 16668 Krt18; keratin 18 9.08 13380 Dkk1; dickkopf homolog 1 (Xen 7.40 66859 Slc16a9; solute carrier fam 8.96 19202 Rhox6; reproductive homeobo 12.97 15412 Hoxb4; homeo box B4 4.69 13655 Egr3; early growth response 5.97 227753 Gsn; gelsolin 8.75 15438 Hoxd9; homeo box D9 7.36 73429 1700109F18Rik; RIKEN c 8.91 15229 Foxd1; forkhead box D1 12.93 21375 Tbr1; T-box brain gene 1 4.63 19263 Ptprb; protein tyrosine phos 5.96 20378 Frzb; frizzled-related protein 8.62 15229 Foxd1; forkhead box D1 7.31 330577 1700129I04Rik; RIKEN cD 8.82 18595 Pdgfra; platelet derived growth 12.90 15228 Foxg1; forkhead box G1 4.59 57342 Parva; parvin, alpha 5.95 15438 Hoxd9; homeo box D9 8.42 83379 Klb; klotho beta 7.23 15433 Hoxd13; homeo box D13 8.67 20680 Sox7; SRY-box containing gen 12.66 237339 L3mbtl3; l(3)mbt-like 3 (Drosop 4.58 12153 Bmp1; bone morphogenetic 5.84 15424 Hoxc5; homeo box C5 8.41 20503 Slc16a7; solute carrier family 16 7.14 20927 Abcc8; ATP-binding casse 8.60 18423 Otx1; orthodenticle homolog 1 12.65 16870 Lhx2; LIM homeobox protein 2 4.56 75746 Morc4; microrchidia 4 5.78 15426 Hoxc8; homeo box C8 8.29 12826 Col4a1; procollagen, type IV, al 7.12 20459 Ptk6; PTK6 protein tyrosin 8.54 20745 Spock1; sparc/osteonectin, cw 12.61 215798 Gpr126; G protein-coupled rece 4.45 18205 Ntf3; neurotrophin 3 5.78 71592 Pogk; pogo transposable ele 8.26 83558 Tex11; testis expressed gene 1 7.10 71712 1200002N14Rik; RIKEN c 8.50 16177 Il1r1; interleukin 1 receptor, typ 12.58 14586 Gfra2; glial cell line derived neu 4.42 231510 A230097K15Rik; RIKEN cD 5.73 13731 Emp2; epithelial membrane 8.19 13070 Cyp11a1; cytochrome P450, fa 7.08 16691 Krt8; keratin 8 8.44 56753 Tacstd2; tumor-associated cal 12.55 27206 Nrk; Nik related kinase 4.39 21410 Tcf2; transcription factor 2 5.70 14066 F3; coagulation factor III 8.15 320898 A430107P09Rik; RIKEN cDNA 7.07 27494 Amot; angiomotin 8.38 12955 Cryab; crystallin, alpha B 12.53 27205 Podxl; podocalyxin-like 4.37 11819 Nr2f2; nuclear receptor subf 5.67 218820 Zfp503; zinc finger protein 50 7.85 53814 Oaz3; ornithine decarboxylase 7.06 15426 Hoxc8; homeo box C8 8.34 20708 Serpinb6b; serine (or cysteine 12.47 209448 Hoxc10; homeo box C10 4.32 108058 Camk2d; calcium/calmoduli 5.58 99887 Tmem56; transmembrane pr 7.83 27384 Akr1c13; aldo-keto reductase fa 7.03 71217 4933431I19Rik; RIKEN cD 8.31 14254 Flt1; FMS-like tyrosine kinase 12.43 17268 Meis1; myeloid ecotropic viral in 4.32 70564 5730469M10Rik; RIKEN cD 5.57 225642 Grp; gastrin releasing peptid 7.66 171168 Asah3; N-acylsphingosine amid 6.92 30937 Lmcd1; LIM and cysteine-r 8.28 60527 Fads3; fatty acid desaturase 3 11.93 15364 Hmga2; high mobility group AT 4.24 11856 Arhgap6; Rho GTPase activ 5.48 11856 Arhgap6; Rho GTPase activa 7.65 14776 Gpx2; glutathione peroxidase 2 6.89 21946 Pglyrp1; peptidoglycan rec 8.13 16691 Krt8; keratin 8 11.89 12159 Bmp4; bone morphogenetic pro 4.22 20745 Spock1; sparc/osteonectin, 5.39 13655 Egr3; early growth response 7.60 231147 Sh3tc1; SH3 domain and tetratr 6.82 381677 Vgf; VGF nerve growth fac 8.03 54670 Atp8b1; ATPase, class I, type 11.75 15426 Hoxc8; homeo box C8 4.16 22634 Plagl1; pleiomorphic adenom 5.37 14461 Gata2; GATA binding protein 7.59 69454 Clic3; chloride intracellular chan 6.77 100213 Rusc2; RUN and SH3 dom 7.94 12156 Bmp2; bone morphogenetic pr 11.74 77485 Stk31; serine threonine kinase 4.05 14254 Flt1; FMS-like tyrosine kinas 5.35 17702 Msx2; homeo box, msh-like 2 7.55 224796 Clic5; chloride intracellular chan 6.69 19124 Procr; protein C receptor, 7.83 69454 Clic3; chloride intracellular cha 11.50 105785 Kdelr3; KDEL (Lys-Asp-Glu-Leu 4.03 14701 Gng12; guanine nucleotide 5.28 226922 Kcnq5; Potassium voltage-ga 7.51 13884 Es1; esterase 1 6.69 24056 Sh3bp5; SH3-domain bind 7.81 107753 Lgals2; lectin, galactose-bindin 11.49 17919 Myo5b; myosin Vb 4.01 107587 Osr2; odd-skipped related 2 5.24 12505 Cd44; CD44 antigen 7.47 27494 Amot; angiomotin 6.69 15376 Foxa2; forkhead box A2 7.76 14465 Gata6; GATA binding protein 6 11.49 16508 Kcnd2; potassium voltage-gate 4.00 14066 F3; coagulation factor III 5.22 16777 Lamb1-1; laminin B1 subunit 7.41 22066 Trpc4; transient receptor potent 6.57 207792 BC034090; cDNA sequenc 7.72 68850 1110062M06Rik; RIKEN cDNA 11.43 75388 Boll; bol, boule-like (Drosophila 3.99 50766 Crim1; cysteine rich transme 5.09 77097 Tanc2; tetratricopeptide repe 7.39 12827 Col4a2; procollagen, type IV, al 6.52 14405 Gabrg1; gamma-aminobut 7.66 64918 Bhmt2; betaine-homocysteine 11.34 16392 Isl1; ISL1 transcription factor, L 3.98 12444 Ccnd2; cyclin D2 5.08 231510 A230097K15Rik; RIKEN cDN 7.32 66805 Tspan1; tetraspanin 1 6.46 320860 B130021B11Rik; RIKEN c 7.60 213696 Duoxa1; dual oxidase maturat 11.19 72828 2810457I06Rik; RIKEN cDNA 2 3.96 16870 Lhx2; LIM homeobox protein 5.07 21814 Tgfbr3; transforming growth 7.25 14180 Fgf9; fibroblast growth factor 9 6.46 76509 1600029D21Rik; RIKEN c 7.54 21957 Tnnt3; troponin T3, skeletal, fa 11.13 14234 Foxc2; forkhead box C2 3.95 110796 Tshz1; teashirt zinc finger fa 5.06 22634 Plagl1; pleiomorphic adenom 7.23 237310 Il22ra2; interleukin 22 receptor, 6.39 74129 Dmgdh; dimethylglycine de 7.52 102097 AI465270; expressed sequenc 10.88 30785 Cttnbp2; cortactin binding prote 3.88 69219 Ddah1; dimethylarginine dim 5.04 72828 2810457I06Rik; RIKEN cDN 7.19 216019 Hkdc1; hexokinase domain con 6.38 12475 Cd14; CD14 antigen 7.49 78365 1500016L03Rik; RIKEN cDNA 10.88 81907 Tmem108; Transmembrane pro 3.88 17919 Myo5b; myosin Vb 4.91 231503 BC062109; cDNA sequence 7.14 69836 Pla2g12b; phospholipase A2, g 6.37 227545 5430407P10Rik; RIKEN c 7.47 21859 Timp3; tissue inhibitor of meta 10.88 13392 Dlx2; distal-less homeobox 2 3.85 12418 Cbx4; chromobox homolog 4.91 22750 Zfp9; zinc finger protein 9 7.12 330450 Mlstd1; male sterility domain co 6.33 12394 Runx1; runt related transc 7.32 209195 Clic6; chloride intracellular cha 10.87 13482 Dpp4; dipeptidylpeptidase 4 3.82 14461 Gata2; GATA binding protei 4.89 22793 Zyx; zyxin 7.01 50916 Irx4; Iroquois related homeobox 6.30 71237 4933435G04Rik; RIKEN c 7.30 73241 3110080O07Rik; RIKEN cDNA 10.71 107587 Osr2; odd-skipped related 2 (D 3.80 22417 Wnt4; wingless-related MMT 4.87 23984 Pde10a; phosphodiesterase 6.96 20680 Sox7; SRY-box containing gene 6.21 17178 Fxyd3; FXYD domain-cont 7.29 14960 H2-Aa; histocompatibility 2, cla 10.67 74190 1200009I06Rik; RIKEN cDNA 1 3.79 16007 Cyr61; cysteine rich protein 4.85 170441 Slc2a10; solute carrier family 6.95 268859 A2bp1; ataxin 2 binding protein 6.12 68338 Golt1a; golgi transport 1 h 7.26 15437 Hoxd8; homeo box D8 10.62 93835 Amn; amnionless 3.79 218454 Lhfpl2; lipoma HMGIC fusio 4.85 69219 Ddah1; dimethylarginine dim 6.95 15404 Hoxa7; homeo box A7 6.08 16668 Krt18; keratin 18 7.23 13132 Dab2; disabled homolog 2 (Dr 10.45 15227 Foxf1a; forkhead box F1a 3.75 72828 2810457I06Rik; RIKEN cDN 4.83 56811 Dkk2; dickkopf homolog 2 (X 6.93 18227 Nr4a2; Nuclear receptor subfam 6.03 18595 Pdgfra; platelet derived gro 7.14 73429 1700109F18Rik; RIKEN cDNA 10.43 67155 Smarca2; SWI/SNF related, ma 3.73 171180 Syt12; synaptotagmin XII 4.82 27205 Podxl; podocalyxin-like 6.92 20724 Serpinb5; serine (or cysteine) p 6.03 11833 Aqp8; aquaporin 8 7.06 17110 Lyz; lysozyme 10.41 232146 Tmem166; transmembrane pro 3.70 16370 Irs4; insulin receptor substra 4.81 15228 Foxg1; forkhead box G1 6.87 74333 4122401K19Rik; RIKEN cDNA 6.00 110454 Ly6a; lymphocyte antigen 7.06 53603 Tslp; thymic stromal lymphopo 10.35 70564 5730469M10Rik; RIKEN cDNA 3.62 223433 BC052328; cDNA sequence 4.80 78923 4833446K15Rik; RIKEN cDN 6.84 Supplemental Table 2

The 100 most down regulated genes and PcG target genes with a p-value smaller than 0.05 in

PcG mutant ES cells are listed with fold change (fc) compared to wild type ES cells.

Leeb et al. Supplemental Table 2 all genes PcG target genes Ring1B-/- vs wt Eed-/- vs wt dKO vs wt Ring1B-/- vs wt Eed-/- vs wt dKO vs wt Entrez GeneID Annotation fc Entrez GeneID Annotation fc Entrez GeneID Annotation fc Entrez GeneID Annotation fc Entrez GeneID Annotation fc Entrez GeneID Annotation fc 17263 Gtl2; GTL2, imprinted maternally expressed untranslate 72.10 13626 Eed; embryonic ectoderm development 37.98 14675 Gna14; guanine nucleotide binding protein, alpha 14 42.84 14169 Fgf14; fibroblast growth factor 14 10.17 18508 Pax6; paired box gene 6 9.98 14675 Gna14; guanine nucleotide binding prote 42.84 373070 Mirg; miRNA containing gene 33.77 78887 Sfi1; Sfi1 homolog, spindle assembly associated (ye 17.46 78887 Sfi1; Sfi1 homolog, spindle assembly associated (yeast) 27.05 20564 Slit3; slit homolog 3 (Drosophila) 9.01 14675 Gna14; guanine nucleotide binding protei 6.85 237868 A830091I15Rik; RIKEN cDNA A830091I 10.93 320085 B830012L14Rik; RIKEN cDNA B830012L14 gene 27.53 17263 Gtl2; GTL2, imprinted maternally expressed untrans 16.51 105398 9330199F22Rik; RIKEN cDNA 9330199F22 gene 26.73 16552 Kif12; kinesin family member 12 7.10 320127 Dgki; diacylglycerol kinase, iota 6.75 16994 Ltb; lymphotoxin B 5.96 231098 Dnajc5g; DnaJ (Hsp40) homolog, subfamily C, member 18.62 75745 Rian; RNA imprinted and accumulated in nucleus 15.57 13626 Eed; embryonic ectoderm development 20.96 66864 Clec14a; C-type lectin domain family 14, m 6.32 21417 Zeb1; zinc finger E-box binding homeobox 6.08 216881 Wscd1; WSC domain containing 1 5.94 17294 Mest; mesoderm specific transcript 17.12 236219 Tcstv3; 2-cell-stage, variable group, member 3 15.19 14164 Fgf1; fibroblast growth factor 1 19.98 260408 BC107230; cDNA sequence BC107230 5.81 20672 Sox18; SRY-box containing gene 18 6.00 20358 Sema6a; sema domain, transmembrane 5.74 75745 Rian; RNA imprinted and accumulated in nucleus 17.05 231098 Dnajc5g; DnaJ (Hsp40) homolog, subfamily C, mem 14.87 234395 Ushbp1; Usher syndrome 1C binding protein 1 19.56 217371 Rab40b; Rab40b, member RAS oncogene 5.73 14169 Fgf14; fibroblast growth factor 14 5.13 17863 Myb; myeloblastosis oncogene 4.95 268482 A830036E02Rik; RIKEN cDNA A830036E02 gene 14.86 234395 Ushbp1; Usher syndrome 1C binding protein 1 14.58 77836 Mlana; melan-A 17.66 14765 Gpr50; G-protein-coupled receptor 50 5.35 16994 Ltb; lymphotoxin B 5.03 211232 Cpne9; copine family member IX 4.90 13526 Adam24; a disintegrin and metallopeptidase domain 24 11.21 373070 Mirg; miRNA containing gene 13.60 17294 Mest; mesoderm specific transcript 16.56 216881 Wscd1; WSC domain containing 1 5.09 12829 Col4a4; procollagen, type IV, alpha 4 4.76 257882 Olfr1344; olfactory receptor 1344 4.72 76217 Jakmip2; janus kinase and microtubule interacting prote 10.83 18545 Pcp2; Purkinje cell protein 2 (L7) 11.84 14171 Fgf17; fibroblast growth factor 17 15.68 320840 Negr1; neuronal growth regulator 1 5.09 15208 Hes5; hairy and enhancer of split 5 (Droso 4.61 381813 Prmt8; protein arginine N-methyltransfer 4.72 14169 Fgf14; fibroblast growth factor 14 10.17 18802 Plcd4; phospholipase C, delta 4 11.49 14936 Gys1; glycogen synthase 1, muscle 13.61 57765 Tbx21; T-box 21 4.85 13590 Lefty1; left right determination factor 1 4.59 14025 Bcl11a; B-cell CLL/lymphoma 11A (zinc 4.46 53901 Rcan2; regulator of calcineurin 2 9.07 72484 2610300M13Rik; RIKEN cDNA 2610300M13 gene 11.29 69707 Iqcg; IQ motif containing G 13.46 14675 Gna14; guanine nucleotide binding protein, 4.81 239857 Cadm2; cell adhesion molecule 2 4.30 329154 Ankrd44; ankyrin repeat domain 44 4.16 20564 Slit3; slit homolog 3 (Drosophila) 9.01 14164 Fgf1; fibroblast growth factor 1 11.02 108101 BC032204; cDNA sequence BC032204 13.34 19157 Pscd1; pleckstrin homology, Sec7 and coile 4.71 19277 Ptpro; protein tyrosine phosphatase, rece 3.87 15162 Hck; hemopoietic cell kinase 4.13 17246 Mdm2; transformed mouse 3T3 cell double minute 2 8.59 108655 Foxp1; forkhead box P1 10.74 14910 Gt(ROSA)26Sor; gene trap ROSA 26, Philippe Soriano 12.66 22141 Tub; tubby candidate gene 4.59 64705 Dpys; dihydropyrimidinase 3.77 64705 Dpys; dihydropyrimidinase 4.11 245610 Nxf3; nuclear RNA export factor 3 8.17 70879 4921511E18Rik; RIKEN cDNA 4921511E18 gene 10.64 18682 Phkg1; phosphorylase kinase gamma 1 12.50 237868 A830091I15Rik; RIKEN cDNA A830091I15 4.53 68428 Steap3; STEAP family member 3 3.59 18508 Pax6; paired box gene 6 4.10 108655 Foxp1; forkhead box P1 8.04 18508 Pax6; paired box gene 6 9.98 68507 Ppfia4; protein tyrosine phosphatase, receptor type, f poly 12.42 239857 Cadm2; cell adhesion molecule 2 4.36 269784 Cntn4; contactin 4 3.46 22239 Ugt8a; UDP galactosyltransferase 8A 4.08 209294 Csta; cystatin A 7.93 319530 Zfp750; zinc finger protein 750 9.54 17916 Myo1f; myosin IF 10.93 76459 Car12; carbonic anyhydrase 12 4.21 72147 Zbtb46; zinc finger and BTB domain conta 3.34 14115 Fbln2; Fibulin 2 3.96 22290 Uty; Ubiquitously transcribed tetratricopeptide repeat ge 7.85 76218 6430710C18Rik; RIKEN cDNA 6430710C18 gene 9.25 237868 A830091I15Rik; RIKEN cDNA A830091I15 gene 10.93 12307 Calb1; calbindin-28K 4.18 14427 Galr1; galanin receptor 1 3.26 243923 Rgs9bp; regulator of G-protein signalling 3.94 14559 Gdf1; growth differentiation factor 1 7.77 99055 AI662476; expressed sequence AI662476 8.75 407790 Ndufa4l2; NADH dehydrogenase (ubiquinone) 1 alpha su 10.43 13590 Lefty1; left right determination factor 1 4.13 72978 Cnih3; cornichon homolog 3 (Drosophila) 3.26 171209 Accn3; amiloride-sensitive cation channe 3.92 26900 Ddx3y; DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-l 7.75 18111 Nnat; neuronatin 8.12 74407 Ttc25; tetratricopeptide repeat domain 25 10.28 497097 Xkr4; X Kell blood group precursor related f 4.13 12942 Pcdha11; protocadherin alpha 11 3.17 19157 Pscd1; pleckstrin homology, Sec7 and co 3.70 68678 Smtnl1; smoothelin-like 1 7.68 17339 Mip; major intrinsic protein of eye lens fiber 8.09 19712 Rest; RE1-silencing transcription factor 9.89 22342 Lin7b; lin-7 homolog B (C. elegans) 4.11 14403 Gabrd; gamma-aminobutyric acid (GABA- 3.02 50523 Lats2; large tumor suppressor 2 3.69 242891 Gm443; gene model 443, (NCBI) 7.67 207565 Camkk2; calcium/calmodulin-dependent protein kina 8.08 79455 Pdcl2; phosducin-like 2 9.71 239827 Pigz; phosphatidylinositol glycan anchor bio 4.03 14395 Gabra2; gamma-aminobutyric acid (GABA 3.02 12142 Prdm1; PR domain containing 1, with ZN 3.28 16534 Kcnn4; potassium intermediate/small conductance calc 7.27 76059 5830442K09Rik; RIKEN cDNA 5830442K09 gene 7.36 71137 Rfx4; regulatory factor X, 4 (influences HLA class II expre 9.53 20672 Sox18; SRY-box containing gene 18 4.01 20451 St8sia3; ST8 alpha-N-acetyl-neuraminide 2.95 64242 Ngb; neuroglobin 3.00 216164 Dos; downstream of Stk11 7.25 71140 4933413I22Rik; RIKEN cDNA 4933413I22 gene 7.23 56615 Mgst1; microsomal glutathione S-transferase 1 9.51 213469 Lgi3; leucine-rich repeat LGI family, membe 3.98 103967 Dnm3; dynamin 3 2.92 14633 Gli2; GLI-Kruppel family member GLI2 2.99 14164 Fgf1; fibroblast growth factor 1 7.21 71872 Aox4; aldehyde oxidase 4 7.16 99055 AI662476; expressed sequence AI662476 9.48 13003 Vcan; versican 3.90 13003 Vcan; versican 2.88 242022 Frem2; Fras1 related extracellular matrix 2.99 16552 Kif12; kinesin family member 12 7.10 14675 Gna14; guanine nucleotide binding protein, alpha 14 6.85 55993 Msh4; mutS homolog 4 (E. coli) 9.39 16994 Ltb; lymphotoxin B 3.89 22141 Tub; tubby candidate gene 2.83 226518 Nmnat2; nicotinamide nucleotide adenyly 2.98 230793 Ahdc1; AT hook, DNA binding motif, containing 1 6.92 75357 4930557J02Rik; RIKEN cDNA 4930557J02 gene 6.75 17263 Gtl2; GTL2, imprinted maternally expressed untranslated 9.36 76850 Eif2c4; eukaryotic translation initiation facto 3.85 16913 Psmb8; proteasome (prosome, macropain 2.83 14388 Gab1; growth factor receptor bound prot 2.91 73094 Sgip1; SH3-domain GRB2-like (endophilin) interacting p 6.80 320127 Dgki; diacylglycerol kinase, iota 6.75 373070 Mirg; miRNA containing gene 9.12 18508 Pax6; paired box gene 6 3.76 14585 Gfra1; glial cell line derived neurotrophic f 2.78 57915 Tbc1d1; TBC1 domain family, member 1 2.91 79455 Pdcl2; phosducin-like 2 6.77 110876 Scn2a1; sodium channel, voltage-gated, type II, alp 6.68 18111 Nnat; neuronatin 9.10 16560 Kif1a; kinesin family member 1A 3.54 14417 Gad2; glutamic acid decarboxylase 2 2.69 15485 Hsd17b1; hydroxysteroid (17-beta) dehy 2.90 66864 Clec14a; C-type lectin domain family 14, member a 6.32 16988 Lst1; leukocyte specific transcript 1 6.64 75692 2310073E15Rik; RIKEN cDNA 2310073E15 gene 8.91 20358 Sema6a; sema domain, transmembrane do 3.29 57265 Fzd2; frizzled homolog 2 (Drosophila) 2.61 238323 Rps6kl1; ribosomal protein S6 kinase-lik 2.89 18816 Serpinf2; serine (or cysteine) peptidase inhibitor, clade 6.21 78822 5830411K21Rik; RIKEN cDNA 5830411K21 gene 6.63 73239 3110054G05Rik; RIKEN cDNA 3110054G05 gene 8.90 269642 Nat8l; N-acetyltransferase 8-like 3.27 19157 Pscd1; pleckstrin homology, Sec7 and co 2.59 14580 Gfap; glial fibrillary acidic protein 2.86 74405 Efhc2; EF-hand domain (C-terminal) containing 2 6.21 18012 Neurod1; neurogenic differentiation 1 6.57 212516 BC060267; cDNA sequence BC060267 8.74 18751 Prkcb1; protein kinase C, beta 1 3.22 13591 Ebf1; early B-cell factor 1 2.58 216991 Centa2; centaurin, alpha 2 2.84 269846 Tcrb-V13; T-cell receptor beta, variable 13 6.15 407797 BC030308; cDNA sequence BC030308 6.46 73094 Sgip1; SH3-domain GRB2-like (endophilin) interacting pro 8.74 103967 Dnm3; dynamin 3 3.22 80883 Ntng1; netrin G1 2.55 232975 Atp1a3; ATPase, Na+/K+ transporting, a 2.84 20274 Scn9a; sodium channel, voltage-gated, type IX, alpha 6.09 73239 3110054G05Rik; RIKEN cDNA 3110054G05 gene 6.37 78286 5330421F07Rik; RIKEN cDNA 5330421F07 gene 8.72 21417 Zeb1; zinc finger E-box binding homeobox 3.17 94089 Trim7; tripartite motif protein 7 2.54 107227 Macrod1; MACRO domain containing 1 2.81 626123 9130004C02Rik; RIKEN cDNA 9130004C02 gene 5.94 103814 AI662270; expressed sequence AI662270 6.34 18041 Nfs1; nitrogen fixation gene 1 (S. cerevisiae) 8.55 71310 Tbc1d9; TBC1 domain family, member 9 3.16 74596 Cds1; CDP-diacylglycerol synthase 1 2.53 214048 Larp2; La ribonucleoprotein domain fami 2.77 68867 Rnf122; ring finger protein 122 5.87 12991 Csn2; casein beta 6.26 97775 D930048N14Rik; RIKEN cDNA D930048N14 gene 8.53 20349 Sema3e; sema domain, immunoglobulin do 3.12 17391 Mmp24; matrix metallopeptidase 24 2.53 16764 Aff3; AF4/FMR2 family, member 3 2.67 260408 BC107230; cDNA sequence BC107230 5.81 23859 Dlg2; discs, large homolog 2 (Drosophila) 6.16 20667 Sox12; SRY-box containing gene 12 8.32 20348 Sema3c; sema domain, immunoglobulin do 3.05 101744 C330005M16Rik; RIKEN cDNA C330005 2.45 18162 Npr3; natriuretic peptide receptor 3 2.62 171543 Bmf; Bcl2 modifying factor 5.78 329906 C030014L02; hypothetical protein C030014L02 6.16 66776 4933439C20Rik; RIKEN cDNA 4933439C20 gene 8.26 15162 Hck; hemopoietic cell kinase 2.95 12824 Col2a1; procollagen, type II, alpha 1 2.41 213469 Lgi3; leucine-rich repeat LGI family, mem 2.49 208079 A530053G22Rik; RIKEN cDNA A530053G22 gene 5.76 69397 1700019A02Rik; RIKEN cDNA 1700019A02 gene 6.10 26970 Pla2g2e; phospholipase A2, group IIE 8.18 224024 Scarf2; scavenger receptor class F, membe 2.93 15162 Hck; hemopoietic cell kinase 2.35 100129 Gpr153; G protein-coupled receptor 153 2.47 217371 Rab40b; Rab40b, member RAS oncogene family 5.73 69861 2010003K11Rik; RIKEN cDNA 2010003K11 gene 6.08 19206 Ptch1; Patched homolog 1 7.92 23923 Aadat; aminoadipate aminotransferase 2.80 226610 C030014K22Rik; RIKEN cDNA C030014K 2.33 29857 Mapk12; mitogen-activated protein kinas 2.46 18012 Neurod1; neurogenic differentiation 1 5.73 21417 Zeb1; zinc finger E-box binding homeobox 1 6.08 330890 Piwil4; piwi-like homolog 4 (Drosophila) 7.80 329154 Ankrd44; ankyrin repeat domain 44 2.79 329154 Ankrd44; ankyrin repeat domain 44 2.32 14585 Gfra1; glial cell line derived neurotrophic 2.43 226251 Ablim1; actin-binding LIM protein 1 5.63 67340 1700052I22Rik; RIKEN cDNA 1700052I22 gene 6.02 80720 Pbx4; pre-B-cell leukemia transcription factor 4 7.75 13446 Doc2a; double C2, alpha 2.78 20349 Sema3e; sema domain, immunoglobulin d 2.32 19395 Rasgrp2; RAS, guanyl releasing protein 2.41 78887 Sfi1; Sfi1 homolog, spindle assembly associated (yeast 5.46 20672 Sox18; SRY-box containing gene 18 6.00 56069 Il17b; interleukin 17B 7.71 14585 Gfra1; glial cell line derived neurotrophic fa 2.76 17863 Myb; myeloblastosis oncogene 2.29 211147 AK162044; cDNA sequence AK162044 2.39 97243 Ard1b; ARD1 homolog B (S. cerevisiae) 5.37 71338 5430420C16Rik; RIKEN cDNA 5430420C16 gene 5.97 672498 LOC672498; hypothetical LOC672498 7.53 18549 Pcsk2; proprotein convertase subtilisin/kexi 2.76 16180 Il1rap; interleukin 1 receptor accessory pr 2.28 14924 Magi1; membrane associated guanylate 2.37 21687 Tek; endothelial-specific receptor tyrosine kinase 5.37 16412 Itgb1; integrin beta 1 (fibronectin receptor beta) 5.95 75745 Rian; RNA imprinted and accumulated in nucleus 7.40 242022 Frem2; Fras1 related extracellular matrix pr 2.74 11622 Ahr; aryl-hydrocarbon receptor 2.26 140709 Emid2; EMI domain containing 2 2.37 14765 Gpr50; G-protein-coupled receptor 50 5.35 330355 Dnahc6; dynein, axonemal, heavy chain 6 5.95 67392 4833420G17Rik; RIKEN cDNA 4833420G17 gene 7.39 232975 Atp1a3; ATPase, Na+/K+ transporting, alph 2.72 66873 1200009O22Rik; RIKEN cDNA 1200009O 2.25 277973 Slc9a5; solute carrier family 9 (sodium/hy 2.35 277468 Slc39a12; solute carrier family 39 (zinc transporter), me 5.33 17246 Mdm2; transformed mouse 3T3 cell double minute 2 5.74 66793 Efcab1; EF hand calcium binding domain 1 7.17 14465 Gata6; GATA binding protein 6 2.69 230576 Ttc22; tetratricopeptide repeat domain 22 2.23 272031 E130309F12Rik; RIKEN cDNA E130309 2.34 74898 4930456K20Rik; RIKEN cDNA 4930456K20 gene 5.25 69690 2310057B04Rik; RIKEN cDNA 2310057B04 gene 5.71 100045988 LOC100045988; similar to OPR 7.10 216991 Centa2; centaurin, alpha 2 2.65 140577 Ankrd6; ankyrin repeat domain 6 2.19 14451 Gas1; growth arrest specific 1 2.31 70084 2300004M11Rik; RIKEN cDNA 2300004M11 gene 5.16 58203 Zbp1; Z-DNA binding protein 1 5.65 21366 Slc6a6; solute carrier family 6 (neurotransmitter transport 7.08 18671 Abcb1a; ATP-binding cassette, sub-family B 2.61 17172 Ascl1; achaete-scute complex homolog-lik 2.18 320560 D030011O10Rik; RIKEN cDNA D030011 2.28 94179 Krt23; keratin 23 5.14 18012 Neurod1; neurogenic differentiation 1 5.64 26896 Med14; mediator complex subunit 14 7.06 108100 Baiap2; brain-specific angiogenesis inhibito 2.55 67874 Rprm; reprimo, TP53 dependent G2 arres 2.16 140577 Ankrd6; ankyrin repeat domain 6 2.20 11474 Actn3; actinin alpha 3 5.14 103358 AU022077; expressed sequence AU022077 5.63 109225 Ms4a7; membrane-spanning 4-domains, subfamily A, me 6.98 208869 Dock3; dedicator of cyto-kinesis 3 2.52 216049 Zfp365; zinc finger protein 365 2.14 94219 Cnnm2; cyclin M2 2.19 216881 Wscd1; WSC domain containing 1 5.09 104936 AU017263; expressed sequence AU017263 5.59 399595 6430514M23Rik; RIKEN cDNA 6430514M23 gene 6.91 52882 Rgs7bp; regulator of G-protein signalling 7 2.52 242022 Frem2; Fras1 related extracellular matrix 2.13 78283 Mtap7d2; MAP7 domain containing 2 2.19 320840 Negr1; neuronal growth regulator 1 5.09 21334 Tac2; tachykinin 2 5.58 108655 Foxp1; forkhead box P1 6.85 269784 Cntn4; contactin 4 2.50 17967 Ncam1; neural cell adhesion molecule 1 2.12 432628 Gm1964; gene model 1964, (NCBI) 2.16 72014 1500005I02Rik; RIKEN cDNA 1500005I02 gene 5.07 52662 D18Ertd653e; DNA segment, Chr 18, ERATO Doi 6 5.52 14555 Gpd1; glycerol-3-phosphate dehydrogenase 1 (soluble) 6.75 54712 Plxnc1; plexin C1 2.48 23920 Insrr; insulin receptor-related receptor 2.09 58208 Bcl11b; B-cell leukemia/lymphoma 11B 2.15 52662 D18Ertd653e; DNA segment, Chr 18, ERATO Doi 653, 5.06 19266 Ptprd; protein tyrosine phosphatase, receptor type, 5.51 105425 B930053N05Rik; RIKEN cDNA B930053N05 gene 6.74 12569 Cdk5r1; cyclin-dependent kinase 5, regulat 2.48 93961 B3galt5; UDP-Gal:betaGlcNAc beta 1,3-g 2.08 19337 Rab33a; RAB33A, member of RAS onco 2.14 16663 Krt13; keratin 13 5.03 70785 Dennd1c; DENN/MADD domain containing 1C 5.46 14469 Gbp2; guanylate nucleotide binding protein 2 6.69 12942 Pcdha11; protocadherin alpha 11 2.43 237465 Ccdc38; coiled-coil domain containing 38 2.08 13841 Epha7; Eph receptor A7 2.14 20345 Selplg; selectin, platelet (p-selectin) ligand 5.03 67058 2810428J06Rik; RIKEN cDNA 2810428J06 gene 5.37 320000 C630016I17Rik; RIKEN cDNA C630016I17 gene 6.68 19277 Ptpro; protein tyrosine phosphatase, recept 2.41 11496 Adam22; a disintegrin and metallopeptid 2.11 105989 AU045094; expressed sequence AU045094 4.99 116852 Akr1c20; aldo-keto reductase family 1, member C20 5.36 16656 Hivep3; human immunodeficiency virus type I enhancer b 6.59 17967 Ncam1; neural cell adhesion molecule 1 2.40 20349 Sema3e; sema domain, immunoglobulin 2.09 74269 1700063H04Rik; RIKEN cDNA 1700063H04 gene 4.96 233649 Cnga4; cyclic nucleotide gated channel alpha 4 5.31 50789 Fbxl3; F-box and leucine-rich repeat protein 3 6.54 58887 Repin1; replication initiator 1 2.39 18212 Ntrk2; neurotrophic tyrosine kinase, rece 2.07 70831 4733401H21Rik; RIKEN cDNA 4733401H21 gene 4.96 68527 1110017I16Rik; RIKEN cDNA 1110017I16 gene 5.28 72991 2900075N08Rik; RIKEN cDNA 2900075N08 gene 6.54 13508 Dscam; Down syndrome cell adhesion mole 2.38 382034 Gse1; genetic suppressor element 1 2.04 97136 C77438; expressed sequence C77438 4.94 223666 D15Wsu169e; DNA segment, Chr 15, Wayne State 5.20 21423 Tcfe2a; transcription factor E2a 6.52 103149 Upb1; ureidopropionase, beta 2.38 12286 Cacna1a; calcium channel, voltage-depe 2.04 57765 Tbx21; T-box 21 4.85 433719 OTTMUSG00000001246; Predicted gene, OTTMUS 5.18 75600 Calml4; calmodulin-like 4 6.49 320405 Cadps2; Ca2+-dependent activator protein 2.37 57340 Jph3; junctophilin 3 2.03 103503 BB001228; expressed sequence BB001228 4.84 14169 Fgf14; fibroblast growth factor 14 5.13 97928 C85363; expressed sequence C85363 6.40 227325 Dner; delta/notch-like EGF-related receptor 2.36 116837 Rims1; regulating synaptic membrane ex 2.01 14675 Gna14; guanine nucleotide binding protein, alpha 14 4.81 378466 ENSMUSG00000057924; Predicted gene, ENSMUS 5.06 17878 Myf6; myogenic factor 6 6.39 116837 Rims1; regulating synaptic membrane exoc 2.35 56741 Nope; neighbor of Punc E11 2.01 117160 Ttyh2; tweety homolog 2 (Drosophila) 4.72 16994 Ltb; lymphotoxin B 5.03 72215 1700001P01Rik; RIKEN cDNA 1700001P01 gene 6.37 15485 Hsd17b1; hydroxysteroid (17-beta) dehydro 2.33 216049 Zfp365; zinc finger protein 365 2.00 20607 Sstr3; somatostatin receptor 3 4.71 16663 Krt13; keratin 13 4.96 72897 2900006B11Rik; RIKEN cDNA 2900006B11 gene 6.36 24084 Tekt2; tektin 2 2.33 56508 Rapgef4; Rap guanine nucleotide excha 2.00 19157 Pscd1; pleckstrin homology, Sec7 and coiled-coil doma 4.71 270035 Letm2; leucine zipper-EF-hand containing transmem 4.94 74076 4933406C10Rik; RIKEN cDNA 4933406C10 gene 6.36 18760 Prkcm; Protein kinase C, mu 2.32 68152 5830415L20Rik; RIKEN cDNA 5830415L20 gene 4.70 68991 Ssu72; Ssu72 RNA polymerase II CTD phosphatase 4.93 110876 Scn2a1; sodium channel, voltage-gated, type II, alpha 1 6.34 50931 Il27ra; interleukin 27 receptor, alpha 2.30 22141 Tub; tubby candidate gene 4.59 208666 Diras1; DIRAS family, GTP-binding RAS-like 1 4.93 433766 Trim63; tripartite motif-containing 63 6.28 13841 Epha7; Eph receptor A7 2.30 13114 Cyp3a16; cytochrome P450, family 3, subfamily a, poly 4.54 26365 Ceacam1; CEA-related cell adhesion molecule 1 4.87 208666 Diras1; DIRAS family, GTP-binding RAS-like 1 6.27 381813 Prmt8; protein arginine N-methyltransferase 2.29 71682 Wdr27; WD repeat domain 27 4.54 20274 Scn9a; sodium channel, voltage-gated, type IX, alph 4.84 20904 Strm; striamin 6.21 56741 Nope; neighbor of Punc E11 2.27 77836 Mlana; melan-A 4.53 103012 6720401G13Rik; RIKEN cDNA 6720401G13 gene 4.84 58198 Sall1; sal-like 1 (Drosophila) 6.17 14417 Gad2; glutamic acid decarboxylase 2 2.26 237868 A830091I15Rik; RIKEN cDNA A830091I15 gene 4.53 18125 Nos1; nitric oxide synthase 1, neuronal 4.83 75083 Usp50; ubiquitin specific peptidase 50 6.14 319387 Lphn3; latrophilin 3 2.26 11770 Fabp4; fatty acid binding protein 4, adipocyte 4.46 17227 Mcpt4; mast cell protease 4 4.83 223262 Timm8a2; translocase of inner mitochondrial membrane 8 6.13 57265 Fzd2; frizzled homolog 2 (Drosophila) 2.24 328795 Ubash3a; ubiquitin associated and SH3 domain contain 4.40 74269 1700063H04Rik; RIKEN cDNA 1700063H04 gene 4.77 11634 Aire; autoimmune regulator (autoimmune polyendocrinop 6.09 72147 Zbtb46; zinc finger and BTB domain contain 2.17 12994 Csn3; casein kappa 4.37 12829 Col4a4; procollagen, type IV, alpha 4 4.76 102085 AI451606; expressed sequence AI451606 6.06 67557 Larp6; La ribonucleoprotein domain family, 2.15 239857 Cadm2; cell adhesion molecule 2 4.36 105398 9330199F22Rik; RIKEN cDNA 9330199F22 gene 4.75 338535 E030013I19Rik; RIKEN cDNA E030013I19 gene 6.01 16979 Lrrn1; leucine rich repeat protein 1, neurona 2.12 399595 6430514M23Rik; RIKEN cDNA 6430514M23 gene 4.35 97928 C85363; expressed sequence C85363 4.75 18012 Neurod1; neurogenic differentiation 1 5.97 19876 Robo1; roundabout homolog 1 (Drosophila) 2.12 93874 Pcdhb3; protocadherin beta 3 4.33 78288 5330421F21Rik; RIKEN cDNA 5330421F21 gene 4.72 16994 Ltb; lymphotoxin B 5.96 235505 Cd109; CD109 antigen 2.11 76459 Car12; carbonic anyhydrase 12 4.21 52711 D11Ertd729e; DNA segment, Chr 11, ERATO Doi 7 4.71 216881 Wscd1; WSC domain containing 1 5.94 19242 Ptn; pleiotrophin 2.11 12307 Calb1; calbindin-28K 4.18 333307 Trim75; tripartite motif-containing 75 4.71 52480 D7Ertd715e; DNA segment, Chr 7, ERATO Doi 715, expr 5.94 65079 Rtn4r; reticulon 4 receptor 2.10 55963 Slc1a4; solute carrier family 1 (glutamate/neutral amino 4.18 672498 LOC672498; hypothetical LOC672498 4.71 68867 Rnf122; ring finger protein 122 5.90 13649 Egfr; epidermal growth factor receptor 2.08 22619 Siae; sialic acid acetylesterase 4.18 12530 Cdc25a; cell division cycle 25 homolog A (S. pombe 4.69 66211 Rpl3l; ribosomal protein L3-like 5.88 19088 Prkar2b; protein kinase, cAMP dependent r 2.07 13590 Lefty1; left right determination factor 1 4.13 109225 Ms4a7; membrane-spanning 4-domains, subfamily A 4.61 320352 E230002P03Rik; RIKEN cDNA E230002P03 gene 5.86 17863 Myb; myeloblastosis oncogene 2.06 497097 Xkr4; X Kell blood group precursor related family memb 4.13 15208 Hes5; hairy and enhancer of split 5 (Drosophila) 4.61 54158 Copg2as2; coatomer protein complex, subunit gamma 2, 5.85 13388 Dll1; delta-like 1 (Drosophila) 2.04 22342 Lin7b; lin-7 homolog B (C. elegans) 4.11 14171 Fgf17; fibroblast growth factor 17 4.60 228858 Gdap1l1; ganglioside-induced differentiation-associated p 5.80 19337 Rab33a; RAB33A, member of RAS oncoge 2.04 67578 4930424G05Rik; RIKEN cDNA 4930424G05 gene 4.08 13590 Lefty1; left right determination factor 1 4.59 103268 2410017P07Rik; RIKEN cDNA 2410017P07 gene 5.79 14119 Fbn2; fibrillin 2 2.01 66441 2010012C16Rik; RIKEN cDNA 2010012C16 gene 4.08 399595 6430514M23Rik; RIKEN cDNA 6430514M23 gene 4.57 320635 Cyb5r2; cytochrome b5 reductase 2 5.76 241263 Gpr158; G protein-coupled receptor 158 2.00 16656 Hivep3; human immunodeficiency virus type I enhancer 4.07 107526 Gimap4; GTPase, IMAP family member 4 4.57 16534 Kcnn4; potassium intermediate/small conductance calcium 5.75 235472 Prtg; protogenin homolog (Gallus gallus) 4.07 71860 Wdr16; WD repeat domain 16 4.56 20358 Sema6a; sema domain, transmembrane domain (TM), an 5.74 67410 4930449I24Rik; RIKEN cDNA 4930449I24 gene 4.05 76413 1700016D06Rik; RIKEN cDNA 1700016D06 gene 4.55 381411 Gm1967; gene model 1967, (NCBI) 5.73 239827 Pigz; phosphatidylinositol glycan anchor biosynthesis, c 4.03 72986 2900078E11Rik; RIKEN cDNA 2900078E11 gene 4.54 52711 D11Ertd729e; DNA segment, Chr 11, ERATO Doi 729, ex 5.72 13666 Eif2ak3; eukaryotic translation initiation factor 2 alpha k 4.02 20607 Sstr3; somatostatin receptor 3 4.48 53868 Rab25; RAB25, member RAS oncogene family 5.70 20672 Sox18; SRY-box containing gene 18 4.01 17916 Myo1f; myosin IF 4.44 103784 Wdr92; WD repeat domain 92 5.66 52711 D11Ertd729e; DNA segment, Chr 11, ERATO Doi 729, 3.99 77481 C030048H21Rik; RIKEN cDNA C030048H21 gene 4.44 228421 Kif18a; kinesin family member 18A 5.65 213469 Lgi3; leucine-rich repeat LGI family, member 3 3.98 16866 Lhb; luteinizing hormone beta 4.40 17425 Foxk1; forkhead box K1 5.63 55993 Msh4; mutS homolog 4 (E. coli) 3.93 66399 Tsfm; Ts translation elongation factor, mitochondria 4.39 108655 Foxp1; forkhead box P1 5.61 58243 Nap1l5; nucleosome assembly protein 1-like 5 3.92 68553 1110001D15Rik; RIKEN cDNA 1110001D15 gene 4.36 18778 Pla2g1b; phospholipase A2, group IB, pancreas 5.57 76024 5830431A10Rik; RIKEN cDNA 5830431A10 gene 3.91 68606 Ppm1f; protein phosphatase 1F (PP2C domain cont 4.36 380713 Scarf1; scavenger receptor class F, member 1 5.48 71321 4933440J02Rik; RIKEN cDNA 4933440J02 gene 3.91 170938 Zfp617; Zinc finger protein 617 4.30 78751 Zc3h6; zinc finger CCCH type containing 6 5.45 13003 Vcan; versican 3.90 239857 Cadm2; cell adhesion molecule 2 4.30 66720 Klhl10; kelch-like 10 (Drosophila) 5.35 16994 Ltb; lymphotoxin B 3.89 50789 Fbxl3; F-box and leucine-rich repeat protein 3 4.27 234311 BC013672; cDNA sequence BC013672 5.34 Supplementl Table 3

List of PCR primer sequences used in this study.

primer 5'-sequence-3' Afp FW CTTCCCTCATCCTCCTGCTAC Afp RV ACAAACTGGGTAAAGGTGATGG Arg2 FW AGAAGCTGGCTTGCTGAAGA Arg2 RV AGGGATCATCTTGTGGGACA Arg2 promoter FW CGCTCGCCTAGTGAAGCATC Arg2 promoter RV CAGGAACATGATTGGCAGGG beta acin RV ACGCACGATTTCCCTCTCAGC beta actin FW GGCCCAGAGCAAGAGAGGTATCC Bmp2 promoter FW CCGATCACCTCTCTTCCTCA Bmp2 promoter RV CTGGGCTTCTGTTGCTTTTC Brachury FW CCAACCTATGCGGACAATTCATCTGC Brachury RV GTGTAATGTGCAGGGGAGCCTCGAA Cdkn2a p16 FW GCCCAACGCCCCGAACTCTT Cdkn2a p16 RV GCACCACCAGCGTGTCCAGG Chr6:72,811,719-72,811,833 FW CCCCTTTCTGAAGCACTCTG Chr6:72,811,719-72,811,833 RV TAAGGCGTCATTTCCCAAAG Dkk1 FW CTCATCAATTCCAACGCGATCA Dkk1 RV GCCCTCATAGAGAACTCCCG Dlk1 FW CGGGAAATTCTGCGAAATAG Dlk1 RV TGTGCAGGAGCATTCGTACT Dlk1 promoter FW AGACTTGCGCTAAGCGGGC Dlk1 promoter RV TCTTTGGCTAGACGGGTACCTG Foxa2 (real time) FW CCCTACGCCAACATGAACTCG Foxa2 (real time) RV GTTCTGCCGGTAGAAAGGGA Foxa2 (RT PCR) FW CCCTACGCCAACATGAACTCG Foxa2 (RT PCR) RV GTTCTGCCGGTAGAAAGGGA Foxa2 promoter FW TGAAACACCGAGGCCCTC Foxa2 promoter RV TCAGTCCTCTTTCTGGCTACCC Gapdh promoter FW AGCATCCCTAGACCCGTACAGT Gapdh promoter RV GGGTTCCTATAAATACGGACTGC Gata4 FW TCGTAATGCCGAGGGTGAGC Gata4 RV TGGCCTGCGATGTCTGAGTG Gata6 FW TTGCTCCGGTAACAGCAGTG Gata6 RV GTGGTCGCTTGTGTAGAAGGA Hoxa1 promoter FW TCACTGAGTGATTGGATCCTGC Hoxa1 promoter RV GGAGGAAGTGAGAAAGTTGGCAC Hoxa5 promoter FW ACAACTTTATTTCCCCGGCTTTG Hoxa5 promoter RV AACCGACCCCAACCTCTACAC Hoxd11 FW ACACCAAGTACCAGATCCGC Hoxd11 RV AGTGAGGTTGAGCATCCGAG Hoxd11 promoter FW TAAGGACATTTCTCTCCATGGCG Hoxd11 promoter RV TGGGCCAGGATCAACTAAGC Hoxd13 FW CCCATTTTTGGAAATCATCC Hoxd13 RV TGGTGTAAGGCACCCTTTTC Hoxd13 promoter FW AAAAACAACGGTTGCGGAGATG Hoxd13 promoter RV GACCCAGGAGTTGACTTTGCAG IAP probe FW CCCAGTTGGGTTGTGAAAGAAAACT IAP probe RV TTTACTAGTTAGGCACAGCGGAGGC Klf4 FW GTGCCCCGACTAACCGTTG Klf4 RV GTCGTTGAACTCCTCGGTCT Lef1 promoter FW ATCAGTCATCCCGAAGAGGA Lef1 promoter RV AGCTGCCCACTCACCTCAT MLV 5'LTR FW CAGGATATCGGTGGTCAAGC MLV 5'LTR RV TTCCGCTTTATCTGAGAACC MLV Env 8021 RV CCTCAAACCACCCTTGTCC MLV Env FW CATGGCAAAGCTAAGAGAAAGG MLV Gag FW GTACCATCCTGAGGCCATCC MLV Gag RV AGTCTAACCTTGCAGCACTGG MLV Pol FW TCAGAGATGGCTGACTGAGG MLV Pol RV ATCCAGAGGCGACAGAAGC MLV Pro FW TCACCTTCCTGGTAGATACTGG MLV Pro RV AGGCAGACTTGTCACTTAGGG MLV probe FW CCCCTGCAAGTGCTGACCCTAA MLV probe RV CCATCACAGTCTCTTTTCTGGCCTC MLV Provirus 36 FW AGCTCGACTGCCAACAAGG MLV Provirus 36 RV GGTTCCATGCGTTTCAGC Nanog (real time) FW TCTTCCTGGTCCCCACAGTTT Nanog (real time) RV GCAAGAATAGTTCTCGGGATGAA Nanog (RT PCR) FW GGCTGCCTCTCCTCGCCCTT Nanog (RT PCR) RV CCACTGGTGCTGAGCCCTTCTGA Nrp1 FW CCGGAACCCTACCAGAGAA Nrp1 RV CCCCATCAATTACTTCCACG Nrp1 promoter FW CTAAATGACAGGATGCAGGCGAC Nrp1 promoter RV AGAAAATCCTCAGCGGGTCTTG Oct4 (real time) FW GGCTTCAGACTTCGCCTCC Oct4 (real time) RV AACCTGAGGTCCACAGTATGC Oct4 (RT PCR) FW GGCGTTCTCTTTGGAAAGGTGTTC Oct4 (RT PCR) RV CTCGAACCACATCCTTCTCT Oct4 promoter FW CAAGTTGGCGTGGAGACTTT Oct4 promoter RV TTGGTTCCACCTTCTCCAAC Olig2 promoter FW GCCTGACGCTACAGTGACAA Olig2 promoter RV GGCTAATTCCGCTCAATGAA chr8:44819737-44819752 (p300) FW CTTGGGTGAAAGGACAGAGGAAGGTCGAG chr8:44819737-44819752 (p300) RV ATAAAATCAGGGCTCTTAGGAGGTGAACAC real Wnt5a FW ACGCTTCGCTTGAATTCCT real Wnt5a RV CCGGGCTTAATATTCCAATG Rex1 FW CCCTCGACAGACTGACCCTAA Rex1 RV TCGGGGCTAATCTCACTTTCAT ribosomal protein L32 FW GGCTTTTCGGTTCTTAGAGGA ribosomal protein L32 RV TTCCTGGTCCACAATGTCAA Ring1B check deletion FW TGCTCCTTTTTGATGGAAC Ring1B check deletion RV CAACCCACTCACCATCACAC Sox7 FW GGGTCTCTTCTGGGACAGTG Sox7 RV GGATGAGAGGAAACGTCTGG Wnt5a promoter FW AATGAAAGGACAAAATTTGGCG Wnt5a promoter RV GGACCACAGAACAATCAGGCAC Zic1 FW CTTTTCCCTGCCCGTTTC Zic1 RV CTCGAACTCGCACTTGAAGG SUPPLEMENTAL REFERENCES

Kim, J., Chu, J., Shen, X., Wang, J., and Orkin, S.H. 2008. An extended transcriptional

network for pluripotency of embryonic stem cells. Cell 132(6): 1049-1061.

Ku, M., Koche, R.P., Rheinbay, E., Mendenhall, E.M., Endoh, M., Mikkelsen, T.S., Presser,

A., Nusbaum, C., Xie, X., Chi, A.S., Adli, M., Kasif, S., Ptaszek, L.M., Cowan, C.A.,

Lander, E.S., Koseki, H., and Bernstein, B.E. 2008. Genomewide Analysis of PRC1

and PRC2 Occupancy Identifies Two Classes of Bivalent Domains. PLoS Genet 4(10):

e1000242.

Mikkelsen, T.S., Ku, M., Jaffe, D.B., Issac, B., Lieberman, E., Giannoukos, G., Alvarez, P.,

Brockman, W., Kim, T.K., Koche, R.P., Lee, W., Mendenhall, E., O'Donovan, A.,

Presser, A., Russ, C., Xie, X., Meissner, A., Wernig, M., Jaenisch, R., Nusbaum, C.,

Lander, E.S., and Bernstein, B.E. 2007. Genome-wide maps of chromatin state in

pluripotent and lineage-committed cells. Nature 448(7153): 553-560.