Zootaxa 3796 (1): 062–080 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2014 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.3796.1.3 http://zoobank.org/urn:lsid:zoobank.org:pub:4874CD6C-C834-4639-AB74-8E15739A0E6D Delimiting the distribution range of Indirana leithii (Boulenger, 1888) (Anura: Ranixalidae), an endemic threatened anuran of the Western Ghats, based on molecular and morphological analysis NIKHIL MODAK1, ANAND PADHYE2,5 & NEELESH DAHANUKAR3,4 1Department of Biodiversity, MES’ Abasaheb Garware College, Karve Road, Pune 411004, Maharashtra, India 2Department of Zoology, MES’ Abasaheb Garware College, Karve Road, Pune 411004, Maharashtra, India 3Indian Institute of Science Education and Research (IISER), G1 Block, Dr. Homi Bhabha Road, Pashan, Pune 411008, Maharahtra, India 4Systematics, Ecology and Conservation Laboratory, Zoo Outreach Organization (ZOO), 96 Kumudham Nagar, Vilankurichi Road, Coimbatore, Tamil Nadu 641 035, India 5Correspondeing author. E-mail: [email protected] Abstract Indirana leithii (Boulenger, 1888) (Anura: Ranixalidae) is a frog species endemic to the Western Ghats and is categorized as Vulnerable according to IUCN red list. This species is currently considered to be widespread over the entire Western Ghats. Our study based on molecular data (using DNA sequence fragments of the mitochondrial 12S rRNA and 16S rRNA genes and the nuclear rhodopsin gene), morphological analysis of topotypic material as well as material collected from a wide range within the northern Western Ghats, suggests that the species has instead a restricted range in the state of Ma- harashtra. Specimens identified as I. leithii from the southern Western Ghats as well as from outside the Western Ghats probably belong to hitherto undescribed species. To facilitate future studies in understanding the nature of this species complex and provide better means for identification and delimitation of species we provide molecular, morphological and osteological characters of I. leithii from topotyic material. Key words: Vulnerable, Molecular phylogeny, species complex Introduction Indirana leithii was described as Rana leithii by Boulenger (1888) from a single female specimen collected at Matheran (18.98°N; 73.27°E; 772 mASL), northern Western Ghats, India. After several taxonomic revisions (Kirtisinghe 1958; Dubois 1986; 1987a; 1987b; Laurent 1986) and molecular evidence (Roelants et al. 2004) I. leithii is now included in a Western Ghats endemic and monogeneric family Ranixalidae Dubois, 1987. Because of the restricted and fragmented distribution and severe decline in the quality of the habitat, the species is currently assessed as Vulnerable in IUCN Redlist (Biju et al. 2004). According to current knowledge, the species Indirana leithii is supposed to occur in Gujarat (Daniel & Shull 1964), Maharashtra (Boulenger 1888; McCann 1932; Chari & Daniel 1953; Abdulali & Daniel 1954; Sekar 1992; Padhye & Mahabaleshwarkar 2001; Dahanukar & Padhye 2005; Katwate et al. 2013); Andhra Pradesh (Srinivasulu et al. 2007; Srinivasuslu & Das 2008); Karnataka (Krishnamurthy & Katre 1993; Krishnamurthy 2003; Nair et al. 2012a) and Kerala (Radhakrishanan 1996; Nair et al. 2012a). However, Biju et al. (2004) have doubted the presence of I. leithii from localities other than the Western Ghats of Maharashtra. In the current communication, based on the study of topotypic material and material collected from a wide range within the northern Western Ghats, we show that Indirana leithii is restricted to the Western Ghats parts of Maharashtra and that DNA sequence considered as I. leithii from southern India are genetically divergent. We provide molecular and morphological evidences to restrict species distributional boundaries for I. leithii and also provide an osteological study of the topotypic material so as to facilitate future studies in understanding the nature of this species complex and provide better means for identification and delimitation of the species. 62 Accepted by M. Vences: 17 Mar. 2014; published: 16 May 2014 Materials and methods Study sites and specimen collection. Surveys were conducted at various places from Anjaneri to Amboli in Western Ghats of Maharashtra. The specimens morphologically resembling the original description of Indirana leithii were studied from thirteen different populations from non protected areas at Anjaneri, Ratangad, Harishchandragad, Matheran, Visapur fort, Tamhini, Sinhagad, Helwak, Shirota, Koynanagar, Amba ghat, Anuskura ghat and Gaganbawda in Western Ghats of Maharashtra. Twenty eight specimens from ten localities (Anjaneri, Ratangad, Harishchandragad, Matheran, Visapur Fort, Tamhini, Koynanagar, Amba ghat, Anuskura ghat and Gaganbawda) were collected for molecular analysis, osteology and sexing. Additional specimens were released in the same habitat after morphometric measurements done in the field. We adhered to IUCN (2008) guidelines for research involving species at risk of extinction. Collected specimens are deposited in the museum collection of Bombay Natural History Society (BNHS), Wildlife Information Liaison Development (WILD), Zoological Survey of India, Western Regional Centre (ZSI-WRC) and Abasahab Garware College Zoology Research Laboratory (AGCZRL), India. Comparative study of museum specimens. Apart from the study of fresh collections we also studied specimens of I. leithii and other related species of Indirana from the museum collection of BNHS. Details of all the comparative material are provided in Appendix A. Morphometric data collection and analysis. Morphometric measurements of I. leithii were obtained for 11 females and 16 males collected during the survey, 26 unsexed live specimens which were released at the same location after study and 32 museum specimens from the collection of BNHS. Morphological characters were measured using a digital calliper to the nearest 0.1 mm. Measurements were taken for the following characters : SVL (snout to vent length), HL (head length-from behind the tympanum to the tip of snout), HW (head width- between the posterior borders of tympanums), SL (snout length-from anterior orbital border to the tip of a snout), EL (eye length-between anterior and posterior orbital borders), UEW (maximum upper eyelid width), TyL (tympanum length-horizontal length of a tympanum), SNL (snout to nostril length), ENL (eye to nostril length- distance between the anterior orbital border and the centre of a nostril), TEL (tympanum to eye length-distance between the posterior orbital border and anterior border of tympanum), INL (inter narial distance-distance between two nostrils), IOL (inter orbital distance-minimum distance between two eyelids), FAL (forelimb length-addition of lengths of humerus, radio-ulna, and palm), F1-F4 (finger 1 to finger 4 length from the base of inner meta tarsal tubercle), F3D (finger 3 disc width), F3W (finger 3 width at the base of a disc), THL (thigh length), TL (tibia length), FOL (foot length-from tibio-tarsal articulation to the tip of a fourth toe), T1-T5 (toe 1 to toe 5 length), T4D (toe 4 disc width), T4W (toe 4 width at the base of a disc). We performed Principal Component Analysis (PCA) on log transformed morphometric data of 16 males and 11 females to understand any gender difference in morphology of Indirana leithii. PCA was performed using the freeware PAST (Hammer et al. 2001). Osteology. The osteology of a single female specimen (AGCZRL-Amphibia-200; SVL = 32.6 mm) from Matheran was studied following the methods of Dingerkus & Uhler (1977). DNA extraction, PCR, sequencing and Phylogenetic analysis. Fourteen specimens (BNHS5590, BNHS5591, WILD-013-AMP-173 to 178, AGCZRL-Amphibia-112, 113, 192, 193, 195, 199) were used for molecular work. Genomic DNA was extracted from thigh muscle tissue. The tissue was digested at 55°C using STE buffer (50mM Tris-HCl, 20 mM EDTA and 50 µl of 10%SDS) with 10µl of 20mg/ml Proteinase K. RNase treatment was given for 2 hours at 37°C. Final extraction process was done using phenol-chloroform method. Polymerase Chain Reaction was performed for amplification of two mitochondrial genes (12S and 16S) and one nuclear gene rho (exon 1) (Table 1). PCR reaction was performed in a 25µl reaction volume containing 5µl of template DNA (~200ng), 2.5µl of 10X reaction buffer (100 mM Tris pH 9.0, 500 mM KCl, 15 mM MgCl2, 0.1% Gelatin), 2µl of 25mM MgCl2, 1µl of 10mM dNTPs, 1µl of each primer, 1µl Taq polymerase and 16.5µl nuclease free water. The thermal profile was 10 minutes at 95°C, and 35 cycles of 1 minute at 94°C, 1 minute at respective annealing temperature for 12S, 16S and rho (Table 1) and 2 min at 72°C, followed by extension of 10 min at 72°C. Amplified DNA fragments were purified using the ‘Promega Wizard Gel and PCR clean up’ system and sequenced. The purified PCR products were sequenced using ABI prism 3730 sequencer (Applied Biosystems, USA) and Big dye terminator sequencing kit (ABI Prism, USA). Sequences were analyzed by BLAST tool (Altschul et al. 1990). These sequences have been deposited in GenBank under the accession numbers (Appendix B). DISTRIBUTION RANGE OF MATHERAN LEAPING FROG Zootaxa 3796 (1) © 2014 Magnolia Press · 63 TABLE 1. Primers used for molecular study along with melting temperature (Tm) and annealing temperatures (Ta). Primer Sequence Tm (°C) Ta (°C) Reference 12SF AAACTGGGATTAGATACCCCACTAT 55.1 56 Simon et al. (1994) 12SR GAGGGTGACGGGCGGTGTGT 64.8 16SF CGCCTGTTTATCAAAAACAT 49.2 50 Palumbi et al. (1991)