Morphological and Molecular Identification of Microcystin

toxins

Article Morphological and Molecular Identiﬁcation of Microcystin-Producing Cyanobacteria in Nine Shallow Bulgarian Water Bodies

Mariana Radkova 1, Katerina Stefanova 1, Blagoy Uzunov 2,* , Georg Gärtner 3 and Maya Stoyneva-Gärtner 2 1 AgroBio Institute, Bulgarian Agricultural Academy, BG-1164 Sofia, Bulgaria; [email protected] (M.R.); [email protected] (K.S.) 2 Faculty of Biology, Department of Botany, Sofia University, BG-1164 Sofia, Bulgaria; [email protected] 3 Institute of Botany, Innsbruck University, A-6020 Innsbruck, Austria; [email protected] * Correspondence: buzunov@uni-sofia.bg

Received: 6 November 2019; Accepted: 6 January 2020; Published: 8 January 2020

Abstract: The paper presents results from the first application of polyphasic approach in studies of field samples from Bulgaria. This approach, which combined the conventional light microscopy (LM) and molecular-genetic methods (based on PCR amplified fragments of microcystin synthetase gene mcyE), revealed that almost all microcystin-producers in the studied eutrophic waterbodies belong to the genus Microcystis. During the molecular identification of toxin-producing strains by use of HEPF × HEPR pair of primers, we obtained 57 sequences, 56 of which formed 28 strains of Microcystis, spread in six clusters of the phylogenetic tree. By LM, seven Microcystis morphospecies were identified (M. aeruginosa, M. botrys, M. flos-aquae, M. natans, M. novacekii, M. smithii, and M. wesenbergii). They showed significant morphological variability and contributed from <1% to 98% to the total biomass. All data support the earlier opinions that taxonomic revision of Microcystis is needed, proved the presence of toxigenic strains in M. aeruginosa and M. wesenbergii, and suppose their existence in M. natans. Our results demonstrated also that genetic sequencing, and the use of HEPF HEPR pair × in particular, can efficiently serve in water quality monitoring for identifying the potential risk from microcystins, even in cases of low amounts of Microcystis in the water.

Keywords: cyanoprokaryotes; cyanotoxins; nodularins; phytoplankton; polyphasic approach

Key Contribution: The paper presents results from the first application of polyphasic approach in studies of field phytoplankton samples from Bulgarian water bodies. Besides demonstrating the significant morphological variability of the genus Microcystis combined with a complex genetic pool of 56 mcyDNA sequences, we confirmed the well-known presence of toxin-producing strains in M. aeruginosa, proved the presence of toxigenic strains in M. wesenbergii and supposed their existence in M. natans.

1. Introduction Some hazardous toxigenic species from the phylum Cyanoprokaryota/Cyanobacteria (known also as blue-green algae) can form harmful algal blooms commonly abbreviated as CyanoHABs. The increasing and widespread concern regarding the serious threat which these algae and their toxins (cyanotoxins) pose to human and animal health is consistent with the recent growth in interest on the topic [1]. In Bulgaria, from 120 water bodies (WBs) investigated during the period 2000–2015, cyanoprokaryotic blooms were recorded in 14 WBs, and in 16 WBs cyanotoxins (mostly microcystins—MCs, but also nodularins—NODs and saxitoxins—SXTs) were found [2,3]. In a more

Toxins 2020, 12, 39; doi:10.3390/toxins12010039 www.mdpi.com/journal/toxins Toxins 2020, 12, 39 2 of 24 recent study, conducted in 2018, a CyanoHab with MCs was detected in one more Bulgarian inland reservoir, namely Sinyata Reka [4]. From the samples with detected cyanotoxins in the period 2000–2015, 44 cyanoprokaryotes were determined by light microscopy (LM) [2]. However, it is widely known that the traditional LM identification of some bloom causative species remains problematic because of the unresolved taxonomy of certain cyanoprokaryote genera. The phenotypic flexibility of some standard diagnostic features in the taxonomy of cyanoprokaryotes—including the shape and structure of colonies, presence/absence of gas vesicles, akinetes, or heterocytes [5–8]—has promoted the parallel use of both morphological and molecular phylogenetic data in a common polyphasic approach [9–11]. This approach includes different molecular techniques and is increasingly employed for the analysis of environmental samples (e.g., [12–19]). However, the assignment of taxa to sequences is often a challenge in molecular-based classification methods applied to environmental samples [19,20]. For early detection of potentially toxigenic cyanobacteria and cyanotoxins, rapid, reliable, and economically effective molecular approaches based on a PCR (polymerase chain reaction) targeting genes involved in the biosynthesis of cyanotoxins have been developed in the past 15 years [21]. Cyanotoxins which include the group of potent hepatotoxins—MCs and NODs—are produced through non-ribosomal peptide synthesis and exhibit biosynthetic routes that shared many similarities [22]. For MCs in particular, the large enzyme complex involved in their production is encoded by a cluster of 10 genes, called microcystin synthetase genes (mcyA-J)[22], from which the NOD gene cluster (nda cluster) arose [23]. The identification of MC-producing species and strains through amplifications of six of these genes (mcy A-E) became most commonly applied [21,24]. Due to the absence of mcy genes in non-toxigenic species or strains, standard PCR with relevant mcy-specific primers provides a quick qualitative tool to discriminate between potentially toxic and nontoxic algae in the water monitoring and general ecological studies [21,25,26]. To get information about actual toxin concentrations through molecular tools, efforts were made to correlate cyanotoxin biosynthesis gene abundance with cyanotoxin occurrence and concentrations (for details see [27]). Up to now, these tools were most successful for MCs and NODs [27] and for the estimation of cyanotoxin gene abundance in field populations, a quantitative PCR (qPCR, or real-time PCR) was developed [21]. Early detection of toxic cyanobacteria by real-time PCR was already successfully applied in Bulgaria [28] but was not combined with LM studies. Therefore, the aim of the present paper is to compare the results from recent LM observations and PCR-based molecular identification of MC- and NOD-producing cyanoprokaryotes in field samples from nine shallow WBs of Bulgaria. Both MCs (together with their close NODs) and WBs were chosen according to the results from previous research, which indicated the threat of CyanoHabs [2,3]. Considering the most common ways of potential exposure of humans to cyanotoxins through consumption of unsuitably treated drinking water, through recreational activities, or through consumption of fish, mollusks and crayfish (e.g., [27,29,30]), it has to be underlined that all chosen WBs are used for recreation and sport fishing, and four of them are dams for water supply and irrigation [2,31]. The results obtained during the study indicated the MC risk on studied WBs caused by the presence of 28 MC-producing strains of the genus Microcystis, seven species of which were confirmed by LM. The data obtained from the combination of conventional microscopic studies with PCR-sequencing: (1) proved the presence of toxic strains in M. wesenbergii; (2) allowed strongly to suppose their existence in M. natans; (3) confirmed the well-known presence of toxigenic strains in M. aeruginosa; (4) showed the significant morphological variability of Microcystis colonies with many transitional colonies, and, in combination with the complex genetic pool, supported the earlier opinions that taxonomic revision of the genus is needed, and (5) once more demonstrated that genetic sequencing, and the use of HEPF × HEPR pair of primers in particular, can efficiently serve in water quality monitoring for identifying the potential risk from MCs, even in cases of low amounts of Microcystis in the water. When considering the results obtained by other methods from the study of the same WBs in the same period [4], we share the widely accepted opinion that until a unique method is adopted, a combination of different approaches is more desirable, and even needed, in the studies of CyanoHABs. Toxins 2020, 12, 39 3 of 24

2. Results

2.1. Phytoplankton Species Composition Obtained by Light Microscopy (LM) In total, more than 240 species from different taxonomic groups were identified using LM in the phytoplankton of all studied WBs, and the reliably determined cyanoprokaryotes comprised 68, or 28% of all taxa. They belonged to 30 genera from four orders (Chroococcales, Synechococcales, Oscillatoriales, and Nostocales). The highest number of cyanoprokaryotes was found in the coastal lakes Vaya (43) and Durankulak (22), followed by the coastal reservoirs Mandra (9), Poroy (8), Aheloy (3), and inland reservoir Sinyata Reka (2) and coastal lake Uzungeren (1). Cyanoprokaryotes were not found in the coastal lakes Shabla and Ezerets. Considering the provided below results from the PCR analysis, which showed the presence of MC-producers, but lack of NOD-producers, we would like to underline the absence in the processed samples of its main producer—the heterocytous filamentous genus Nodularia Mertens (e.g., [22]). Hereafter only the LM data obtained on the coccoid genus Microcystis Kützing ex Lemmermann will be presented with a note that species from its morphologically close genera Aphanocapsa Nägeli, Coelomoron Buell, Coelosphaerium Nägeli, and Pannus Hickel were also determined in the processed slides. Using traditional morphological diagnostic features [32–38], we identified seven species of Microcystis: M. aeruginosa (Kützing) Kützing, M. botrys Teiling, M. flos-aquae (Wittrock) Kirchner, M. natans Lemmermann ex Skuja, M. novacekii (Komárek) Compère, M. smithii Komárek et Anagnostidis, and M. wesenbergii (Komárek) Komárek in Kondratieva 1964. In addition, in some of the samples we found separate Microcystis cells from disintegrated colonies, which did not allow their correct and reliable identification using classical taxonomic criteria. Within most identified species, a significant morphological variation was observed, sometimes showing transitional features with other species, or even genera. The differences in the distribution of Microcystis species by WBs and sites are shown in Table1. Their quantitative role was very low, <1% of the total phytoplankton biomass except their high contribution (99.8%) in the small inland reservoir Sinyata Reka.

Table 1. Distribution of Microcystis taxa in the studied Bulgarian waterbodies (WBs).

WBN and IBW SAN MA MB MF MNs MNv MS MW SS SL TCs Reservoir Sinyata Reka—SR SR1 d x x (IBW1890) SR2 d x x Vaya Lake—VA (IBW0191) VA1 x r x x x VA2 x r r x x x VA3 x r x Reservoir Mandra—MN MN1 x (IBW1720) MN3 x x Reservoir Poroy (IBW3038) x x r Durankulak Lake—DR DR1 x x x x (IBW0216) DR2 x r r r r x DR3 x r r x DR4 x r x WBN—name of the WB; IBW—number of the WB in the Inventory of Bulgarian Wetlands [31]; SAN—site abbreviation and number; MA—Microcystis aeruginosa, MB—Microcystis botrys, MF—Microcystis ﬂos-aquae, MNs—Microcystis natans, MNv—Microcystis novacekii, MS—Microcystis smithii, MW- Microcystis wesenbergii; SS—separate cells; SL—cells of Synechocystis aquatilis type; TCs—colonies with transitional morphology; d—dominance (>25% of the total biomass); x—occurrence; r—rare occurrence in single colonies (for details, see the text of the paper). Toxins 2020, 12, 39 4 of 24 Toxins 2020, 12, x FOR PEER REVIEW 4 of 23

The richest diversity of Microcystis was found in thethe coastalcoastal lakelake Durankulak.Durankulak. The six species identifiedidentified therethere represented represented 14% 14% of theof the cyanoprokaryotes cyanoprokaryotes in the in lake. the Twolake. of Two the speciesof the werespecies common were commonin all four in sampled all four sampled sites: Microcystis sites: Microcystis aeruginosa aeruginosa(Figure 1(Figurea–f) and 1a–f)M. and wesenbergii M. wesenbergii(Figure (Figure2a–f), but2a– f),occurred but occurred in different in different amounts. amounts.M. aeruginosa M. aeruginosawas well was represented well represented and generally and generally similar in itssimilar frequency, in its frequency,except in site except 3, where in site it 3, was where much it was rarer. much The rarer. morphological The morphological variability variability was significant, was significant, ranging rangingfrom almost from sphericalalmost spherical colonies colonies of more of densely more densely packed packed cells (Figure cells (Figure1a) to irregular1a) to irregular colonies colonies with withmore more spread spread cells cells (Figure (Figure1b), with1b), with smaller smaller (Figure (Figure1c) or1c) bigger or bigger cells cells (Figure (Figure1d). 1d). Only Only in in site site 3, 3, some coloniescolonies containedcontainedPseudanabaena Pseudanabaena mucicola mucicola(Naumann (Naumann & Huber-Pestalozzi)& Huber-Pestalozzi) Schwabe Schwabe (Figure (Figure1e,f). 1e,f).Microcystis Microcystis wesenbergii wesenbergii(Figure (Figure2a–f) occurred 2a–f) occurred in extremely in extremely low amounts low amounts in all of in the allsites. of the In sites. site 1In also site 1its also separate its separate cells were cells found, were and found, in site and 4 we in observedsite 4 we initialobserved and developedinitial and coloniesdeveloped with colonies morphology with morphologytransitional between transitionalM. wesenbergii between andM. wesenbergiiM. aeruginosa and, which M. aeruginosa lack the typical, which outer lack margin the typical (Figure outer2e,f). marginFew colonies (Figure of 2e,f).Microcystis Few colonies smithii wereof Microcystis found only smithii in site were 3 (Figure found3 onlya). in site 3 (Figure 3a).

Figure 1. Microcystis fromfrom didifferentﬀerent BulgarianBulgarian waterbodies: waterbodies: ( a(a,b,b))M. M. aeruginosa aeruginosafrom from Durankulak Durankulak site site 2; (2;c ,d(c),dM.) M. aeruginosa aeruginosafrom from from from Durankulak Durankulak site site 3; ( e3;,f )(eM.,f) aeruginosaM. aeruginosafrom from from from Durankulak Durankulak site 3 site with 3 withﬁlaments filaments of Pseudanabaena of Pseudanabaena mucicola. mucicola.The scaleThe scale bar equals bar equals 10 µm. 10 µm.

Typical Microcystis botrys botrys waswas very very rarely rarely found found only only in inthe the lake lake site site 2 (Figure 2 (Figure 3b),3 whereb), where we saw we alsosaw single also single colonies colonies of M. of flos-aquaeM. ﬂos-aquae (Figure(Figure 3c) and3c) M. and natansM. natans (Figure(Figure 3d). In3d). theIn same the site same 2 we site found 2 we also some initial colonies with densely packed cells (almost black from numerous gas vesicles) without pronounced margin (Figure 3e,f). Similar but even more densely packed colonies with

Toxins 2020, 12, 39 5 of 24 found also some initial colonies with densely packed cells (almost black from numerous gas vesicles) withoutToxins 2020 pronounced, 12, x FOR PEER margin REVIEW (Figure 3e,f). Similar but even more densely packed colonies with invisible5 of 23 margins were seen in the samples from site 4, some of which hosted ﬁlaments of Pseudanabaena mucicola invisible margins were seen in the samples from site 4, some of which hosted filaments of (Figure3g,h). The reliable identiﬁcation of the colonies shown on Figure3e–h, and of the separate cells Pseudanabaena mucicola (Figure 3g,h). The reliable identification of the colonies shown on Figure 3e– wash, impossibleand of the separate by conventional cells was LM.impossible by conventional LM.

FigureFigure 2. 2.Microcystis Microcystisfrom from di differentﬀerent BulgarianBulgarian waterbodies: (a (a) )M.M. wesenbergii wesenbergii fromfrom Durankulak Durankulak site site 1; 1; (b)(bM.) M. wesenbergii wesenbergiifrom from Durankulak Durankulak site site 2;2; ((cc)) M. wesenbergii fromfrom Durankulak Durankulak site site 3; 3;(d ()d M.) M. wesenbergii wesenbergii fromfrom Durankulak Durankulak site site 4;4; ((e,,f) initial and and developed developed colonies colonies with with transitional transitional morphology morphology between between M. M.wesenbergii wesenbergii andand M.M. aeruginosa aeruginosa in inDurankulak Durankulak site site 4. The 4. Thescale scale bar equals bar equals 10 µm. 10 µm.

InIn the the coastal coastal Lake Lake Vaya, weVaya, found we fourfound species four of speciesMicrocystis of (or,Microcystis 9% of all (or, lake cyanoprokaryotes).9% of all lake M.cyanoprokaryotes). aeruginosa and M. wesenbergiiM. aeruginosawere and common M. wesenbergii for all threewere sampledcommon sites.for allM. three aeruginosa sampledwas sites. relatively M. abundantaeruginosa in was site 1relatively (Figure4 abundanta) but was in rare site in1 (Figure lake sites 4a) 2but and was 3. Itsrare colonies in lake sites in site 2 and 3 could 3. Its be colonies referred toin two site types—colonies 3 could be referred with to two spread types—colonies cells (Figure wi4b)th spread and colonies cells (Figure with 4b) more and densely colonies packed with more cells (Figuredensely4c). packedM. wesenbergii cells (Figurewas 4c). rarely M. foundwesenbergii in all was three rarely sites, found where in onlyall three small sites, spherical where coloniesonly small with spherical colonies with few cells were seen (Figure 4d). In site 3, we observed young and developed few cells were seen (Figure4d). In site 3, we observed young and developed colonies with morphology colonies with morphology transitional between M. wesenbergii and M. aeruginosa, which were transitional between M. wesenbergii and M. aeruginosa, which were surrounded by ﬁne mucilage and surrounded by fine mucilage and lack the typical thick outer margin (Figure 4e,f). In addition, some lack the typical thick outer margin (Figure4e,f). In addition, some initial colonies without clearly initial colonies without clearly visible mucilage, similar to the colonies in Durankulak site 2 (Figure visible mucilage, similar to the colonies in Durankulak site 2 (Figure3e,f) were observed in Vaya sites 1 3e,f) were observed in Vaya sites 1 and 3 (Figure 4g), and undetermined colonies similar to those andfrom 3 (Figure Durankulak4g), and site undetermined 4 (Figure 3g) were colonies observed similar in to Vaya those site from 3 (Figure Durankulak 4h), sometimes site 4 (Figure with 3spreadg) were nearby separate cells of the same type. In sites 1 and 2, a few small colonies with structured mucilage

Toxins 2020, 12, 39 6 of 24 observedToxins 2020 in, 12 Vaya, x FOR site PEER 3 (Figure REVIEW4 h), sometimes with spread nearby separate cells of the same type.6 of 23 In sites 1 and 2, a few small colonies with structured mucilage were tentatively identiﬁed as M. botrys were tentatively identified as M. botrys (Figure 5a), and in site 3 a single colony was referred to M. (Figure5a), and in site 3 a single colony was referred to M. ﬂos-aquae (Figure5b). Some small colonies flos-aquae (Figure 5b). Some small colonies similar to initial M. novacekii were seen in the samples from similar to initial M. novacekii were seen in the samples from Vaya site 2, and singular dividing cells, Vaya site 2, and singular dividing cells, resembling Synechocystis aquatilis Sauvageau, were seen in resembling Synechocystis aquatilis Sauvageau, were seen in Vaya site 1. Vaya site 1.

FigureFigure 3. 3.Microcystis Microcystisfrom from di differentfferent Bulgarian Bulgarian waterbodies:waterbodies: ( (aa)) M.M. smithii smithii inin Durankulak Durankulak site site 3 (100×); 3 (100 ); × (b)(bM.) M. botrys botrysin in Durankulak Durankulak site site 2 2 (100 (100×);); ((cc)) M. flos-aquaeflos-aquae inin Durankulak Durankulak site site 2 2(100×); (100 ();d ()d M.) M. natans natans in in Durankulak site 2 (100×); (e,f) Initial ×Microcystis colonies with densely packed cells× without visible Durankulak site 2 (100 ); (e,f) Initial Microcystis colonies with densely packed cells without visible mucilage in Durankulak× site 2 (100×); (g) Undetermined Microcystis colonies with densely packed cells mucilage in Durankulak site 2 (100 ); (g) Undetermined Microcystis colonies with densely packed in Durankulak site 4 (40×); (h) Undetermined× Microcystis colonies with densely packed cells with cells in Durankulak site 4 (40 ); (h) Undetermined Microcystis colonies with densely packed cells with filaments of Pseudanabaena mucicola× on the outer mucilage margin in Durankulak site 4 (40×). The scale filaments of Pseudanabaena mucicola on the outer mucilage margin in Durankulak site 4 (40 ). The scale bar equals 10 µm. × bar equals 10 µm.

Toxins 2020, 12, 39 7 of 24 Toxins 2020, 12, x FOR PEER REVIEW 7 of 23

Figure 4. 4. MicrocystisMicrocystis fromfrom different diﬀerent Bulgarian Bulgarian waterbodies: waterbodies: (a) M. ( aaeruginosa) M. aeruginosa from Vayafrom site Vaya 1; (b site,c) M. 1; (aeruginosab,c) M. aeruginosa from Vayafrom 3; Vaya (d) 3;Small (d) Smallcolonies colonies of M. of wesenbergiiM. wesenbergii fromfrom Vaya Vaya site site 3; 3; (e (e,f,)f )Colonies Colonies with transitional morphology between M. wesenbergii and M. aeruginosa with fine ﬁne mucilage instead of hard thick margin layer;layer; ((gg)) InitialInitial colonycolony with with densely densely packed packed cells cells and and without without clearly clearly visible visible mucilage mucilage in Vayain Vaya site site 1 (100 1 (100×);); (h) ( Undeterminedh) UndeterminedMicrocystis Microcystiscolony colony with with densely densely packed packed cells incells Vaya in Vaya site 3 (40site 3). × × The(40×). scale The barscale equals bar equals 10 µm. 10 µm.

In the coastal reservoir Mandra, colonies identified as M. novacekii (Figure 5c–f) were seen in sites 1 and 3, while M. aeruginosa was rarely found only in site 3 (Figure 5g). There its cells were with the largest dimensions (7–7.5 µm) in comparison with the colonies from all other WBs, where cell diameters ranged from 3.5 to 5 (6) µm. In the samples from site 2 we did not see any colonies or cells of Microcystis. Both Microcystis species represent 22% of cyanoprokaryote taxa in the reservoir.

Toxins 2020, 12, 39 8 of 24 Toxins 2020, 12, x FOR PEER REVIEW 8 of 23

Figure 5. MicrocystisMicrocystis fromfrom different diﬀerent Bulgarian Bulgarian waterbodies: waterbodies: (a) M. (a) cf.M. botryscf. botrys in Vayain Vayasite 2 (40×); site 2 ( (40b) M.); × (flos-aquaeb) M. ﬂos-aquae in Vayain site Vaya 3 site(40×); 3 (40(c,d)); M. (c ,dnovacekii) M. novacekii from Mandrafrom Mandra site 1 site(100×); 1 (100 (e,f)); M. (e ,fnovacekii) M. novacekii from × × fromMandra Mandra site 3 site(100×); 3 (100 (g) M.); (aeruginosag) M. aeruginosa from Mandrafrom Mandra site 3 (100×); site 3 (100 (h) M.); cf. (h) novacekii M. cf. novacekii from Poroyfrom (100×); Poroy × × (100i – dividing); i – dividing cells from cells Poroy, from which Poroy, resemble which resemble SynechocystisSynechocystis aquatilis aquatilis (100×); (100(j) Single); (j) separate Single separate cells of × × cellsMicrocystis of Microcystis from Poroyfrom (100×). Poroy (100The scale). The bar scale equals bar 10 equals µm. 10 µm. × In the coastal reservoir Poroy by LM we found small initial colonies, which resembled Microcystis novacekii, but shared features with the genera Coelosphaerium and Coelomoron (e.g., small spherical cells distributed on the outer colony layer)—Figure 5h. In the same samples, we saw some separate spherical cells with gas vesicles which could be related with both Microcystis aeruginosa and M. wesenbergii due to the overlapping dimensions of 5–6 µm (Figure 5j). In addition, there were some

Toxins 2020, 12, 39 9 of 24

In the coastal reservoir Mandra, colonies identified as M. novacekii (Figure5c–f) were seen in sites 1 and 3, while M. aeruginosa was rarely found only in site 3 (Figure5g). There its cells were with the largest dimensions (7–7.5 µm) in comparison with the colonies from all other WBs, where cell diameters ranged from 3.5 to 5 (6) µm. In the samples from site 2 we did not see any colonies or cells of Microcystis. Both Microcystis species represent 22% of cyanoprokaryote taxa in the reservoir. In the coastal reservoir Poroy by LM we found small initial colonies, which resembled Microcystis novacekii, but shared features with the genera Coelosphaerium and Coelomoron (e.g., small spherical cells distributed on the outer colony layer)—Figure5h. In the same samples, we saw some separate spherical cells with gas vesicles which could be related with both Microcystis aeruginosa and M. wesenbergii due to the overlapping dimensions of 5–6 µm (Figure5j). In addition, there were some singular dividing cells, which could belong to the same two species but also strongly resembled Synechocystis aquatilis (Figure5j). According to these results, we could suppose presence of two species, which represent 25% of the cyanoprokaryote diversity in this reservoir. In the both sites of the small inland reservoir Sinyata Reka, we found almost a clear culture of well-pronounced, typical perforated and irregular colonies of Microcystis wesenbergii accompanied with many young spherical colonies and some separate cells from disintegrated colonies (with all transitions from rarely visible remnants of the hard colonial mucilage margin to completely free from mucilage single cells (Figures6a–i,7a–f and8a–d). Some of the single dividing cells, when found separately, resembled Synechocystis aquatilis and could be easily misidentified (Figure6g). In addition, we observed a few colonies without defined margin of two different types: (1) colonies which slightly resembled the irregular colonies of Microcystis aeruginosa, but were without holes (Figure8c,d); (2) spherical colonies which shared morphological features with Microcystis flos-aquae and M. novacekii (Figure8e,f). There were also clearly visible di fferences due to presence or absence of epiphytic/epigloeic bacteria on the mucilage margin (Figure6c,d), and extremely rarely Pseudanabaena mucicola was associated with the disintegrated colonial remnants (Figure6i). Toxins 2020, 12, x FOR PEER REVIEW 9 of 23 singular dividing cells, which could belong to the same two species but also strongly resembled ToxinsSynechocystis2020, 12, 39 aquatilis (Figure 5j). According to these results, we could suppose presence of10 two of 24 species, which represent 25% of the cyanoprokaryote diversity in this reservoir.

Figure 6. Microcystis wesenbergii from Sinyata Reka: ( a,b) typical colonies (40(40×),), ( (cc,,d)) typical colonies × (100×);(100 ); ( (ee––ii)) disintegrated disintegrated colonies colonies to to separate separate cells (100×) (100 ),, where where some some of of the the se separateparate dividing cells × × resemble SynechocystisSynechocystis aquatilis aquatilis(g )(g and) and some some groups groups of cells of containcells contain ﬁlaments filaments of Pseudanabaena of Pseudanabaena mucicola mucicolain the mucilage in the mucilage remnants remnants (i). The scale (i). The bar scale equals bar 10 equalsµm. 10 µm.

Toxins 2020, 12, 39 11 of 24 Toxins 2020, 12, x FOR PEER REVIEW 10 of 23

FigureFigure 7. 7. MicrocystisMicrocystis wesenbergii wesenbergii fromfrom Sinyata Sinyata Reka: Reka: Young Young spherical spherical colonies colonies (a) (40×,a) 40 (b,() 100×;b) 100 (c); × × different(c) different colonies colonies and and separate separate cell cell (40×); (40 Different); Different colonies colonies at 100× at 100 (d) without(d) without epigloeoic epigloeoic bacteria; bacteria; (e) × × with(e) with epigloeic epigloeic bacteria; bacteria; (f) (Transitionsf) Transitions during during coloni colonieses disintegration disintegration to to sma smallll colonies colonies and and different different stagesstages from from cells, cells, surrounded surrounded by by outer outer hard hard mucilage layer to completely separate cells without mucilagemucilage (100×). (100 ). The The scale scale bar bar equals equals 10 10 µm.µm. × In the both sites of the small inland reservoir Sinyata Reka, we found almost a clear culture of well-pronounced, typical perforated and irregular colonies of Microcystis wesenbergii accompanied with many young spherical colonies and some separate cells from disintegrated colonies (with all transitions from rarely visible remnants of the hard colonial mucilage margin to completely free from mucilage single cells (Figures 6a–i, 7a–f and 8a–d). Some of the single dividing cells, when found separately, resembled Synechocystis aquatilis and could be easily misidentified (Figure 6g). In addition, we observed a few colonies without defined margin of two different types: (1) colonies which slightly resembled the irregular colonies of Microcystis aeruginosa, but were without holes (Figure 8c,d); (2) spherical colonies which shared morphological features with Microcystis flos-aquae and M. novacekii (Figure 8e,f). There were also clearly visible differences due to presence or absence of epiphytic/epigloeic bacteria on the mucilage margin (Figure 6c,d), and extremely rarely Pseudanabaena mucicola was associated with the disintegrated colonial remnants (Figure 6i).

Toxins 2020, 12, 39 12 of 24 Toxins 2020, 12, x FOR PEER REVIEW 11 of 23

Figure 8. MicrocystisMicrocystis wesenbergii wesenbergii fromfrom Sinyata Sinyata Reka: Reka: (a,b (a) ,typicalb) typical colonies colonies and and separate separate cells cells(40×), (40 (c,d),) × (irregularc,d) irregular colonies colonies with withinvisible invisible margin, margin, transitional transitional between between M. wesenbergiiM. wesenbergii and M.and aeruginosaM. aeruginosa, and, andseparate separate cells cells (40×); (40 (e,f);) (sphericale,f) spherical colonies colonies which which shared shared morphological morphological features features with with MicrocystisMicrocystis flos- × flos-aquaeaquae andand M. novacekiiM. novacekii (40×).(40 The). Thescale scale bar equals bar equals 10 µm. 10 µm. × 2.2. Results from PCR Analysis for MicrocystinMicrocystin andand Nodularin-ProducingNodularin-Producing StrainsStrains The HEPF HEPR synthetase-gene-specific pair of primers was used to identify MC- and The HEPF ×× HEPR synthetase-gene-specific pair of primers was used to identify MC- and NOD- NOD-producingproducing genotypes genotypes in the phytoplankton in the phytoplankton samples samples from 17 fromstudied 17 sites studied of nine sites Bulgarian of nine BulgarianWBs. The WBs.amplification The amplification of the expected of the expected472 bp fragment 472 bp fragmentwas found was in foundthe samples in the samplesfrom nine from sites nine of Sinyata sites of SinyataReka, Poroy, Reka, Vaya, Poroy, Mandra, Vaya, Mandra, and Durankulak and Durankulak (Figure (Figure 9). After9). Afterthe isolation the isolation of DNA of DNA fragments fragments from fromthese thesepositive positive samples samples and andtheir their cloning cloning into into plasmid plasmid vector vector nine nine mcyDNAmcyDNA-clone-clone libraries libraries werewere constructed. TheThe sequence sequence analysis analys ofis the of totally the totally obtained obtained 57 mcyDNA 57 clonesmcyDNA resulted clones in identificationresulted in ofidentification 28 sequences ofhomologous 28 sequences with homologous the mcyE modulewith the (Figure mcyE module9). NOD (Figure sequences 9). NOD were notsequences detected. were not detected. According to the BLAST search [39], 31 (54%) from the 57 obtained sequences had 100% identity with the Genbank (abbreviated hereafter as NCBI) [40] sequences of known strains and could be affiliated to them. Other 25 (44%) showed high level homology (99% identity), and only one strain (namely, Dur 4_1—Figure 9) was more distant, showing lower identity (96%) to the known mcyE sequences. All the analyzed 57 mcyE sequences and their corresponding higher homology GenBank sequences were used in the phylogenetic assay. In the constructed phylogenetic tree six main clusters were formed (Figure 9). The combined results from GenBank search and phylogenetic analysis demonstrated that from the all 57 obtained sequences, 56 clearly belonged to the genus Microcystis, while for now, the affiliation of the single distant low homologous (96%) sequence Dur4_1 was impossible. Most of the 56 sequences (44, or 79%) were affiliated to uncultured or unidentified to

Toxins 2020, 12, x FOR PEER REVIEW 12 of 23 species level strains of the genus Microcystis and only 12 of them (21%) could be referred to the strains of two distinct species—M. aeruginosa and M. wesenbergii (Figure 9). The phylogenetic tree, constructed from the analyzed mcyE sequences and their homologous representatives from NCBI, demonstrated the complexity of the isolated sequences pool (Figure 9). This complexity reflects the relevant rich biodiversity of Microcystis strains in the studied WBs. It ranged between the highest level of 14 sequences obtained from the sites of the coastal lake Vaya and spread in four different clusters (I, III, IV, and V), and the lowest biodiversity in the inland reservoirs Sinyata Reka (with all eight sequences concentrated in cluster III). Rich diversity was found to occur also in the sequences from the coastal lake Durankulak (13), most of which were obtained from sites 1,3, and 4 and were included into the single cluster VI, while the sequences from site 2 were spread in three clusters (II, IV, and V). Nine sequences from the coastal reservoirs Poroy and Mandra were concentrated in one cluster (I) and only one sequence from both habitats was incorporated in cluster VToxins (Figure2020, 129)., 39As it was mentioned above, the sequence with the 96% homology from site Durankulak13 of 24 4, included separately in the phylogenetic tree, at present could not be assigned to any known genus.

Figure 9. Neighbor-joiningNeighbor-joining phylogenetic phylogenetic tree tree construc constructedted using using nucleotides nucleotides sequences sequences from from nine librarylibrary samples samples and and closest closest sequences sequences retrieved retrieved after after Blast search in NCBI database with indication of their their accession accession number number in in NCBI. NCBI. Bootstrap Bootstrap valu valueses are areshown shown at branch at branch points points (percentage (percentage of 1050 of 1050 resamplings). Legend: Man—Reservoir Mandra; Dur—Lake Durankulak; Vai—Lake Vaya;

Por—Reservoir Poroy; Blu—Reservoir Sinyata Reka (=Blue River). For the identical sequences (IS), obtained during this study, only one accession number received from NCBI is provided in each cluster or sub-cluster. The IS from the sites Mandra 1, Poroy, and Vaya 1–2 (cluster I) are with accession number MN417082, the IS from the sites Durankulak 1, 3, and 4 (cluster VI) are with accession number MN417107, the IS from Poroy and Vaya 1–2 (cluster V) are with accession number MN417089, and the IS from Mandra 1 and Poroy (cluster I) are with accession number MN417085.

According to the BLAST search [39], 31 (54%) from the 57 obtained sequences had 100% identity with the Genbank (abbreviated hereafter as NCBI) [40] sequences of known strains and could be affiliated to them. Other 25 (44%) showed high level homology (99% identity), and only one strain (namely, Dur 4_1—Figure9) was more distant, showing lower identity (96%) to the known mcyE sequences. All the analyzed 57 mcyE sequences and their corresponding higher homology GenBank Toxins 2020, 12, 39 14 of 24 sequences were used in the phylogenetic assay. In the constructed phylogenetic tree six main clusters were formed (Figure9). The combined results from GenBank search and phylogenetic analysis demonstrated that from the all 57 obtained sequences, 56 clearly belonged to the genus Microcystis, while for now, the affiliation of the single distant low homologous (96%) sequence Dur4_1 was impossible. Most of the 56 sequences (44, or 79%) were affiliated to uncultured or unidentified to species level strains of the genus Microcystis and only 12 of them (21%) could be referred to the strains of two distinct species—M. aeruginosa and M. wesenbergii (Figure9). The phylogenetic tree, constructed from the analyzed mcyE sequences and their homologous representatives from NCBI, demonstrated the complexity of the isolated sequences pool (Figure9). This complexity reflects the relevant rich biodiversity of Microcystis strains in the studied WBs. It ranged between the highest level of 14 sequences obtained from the sites of the coastal lake Vaya and spread in four different clusters (I, III, IV, and V), and the lowest biodiversity in the inland reservoirs Sinyata Reka (with all eight sequences concentrated in cluster III). Rich diversity was found to occur also in the sequences from the coastal lake Durankulak (13), most of which were obtained from sites 1,3, and 4 and were included into the single cluster VI, while the sequences from site 2 were spread in three clusters (II, IV, and V). Nine sequences from the coastal reservoirs Poroy and Mandra were concentrated in one cluster (I) and only one sequence from both habitats was incorporated in cluster V (Figure9). As it was mentioned above, the sequence with the 96% homology from site Durankulak 4, included separately in the phylogenetic tree, at present could not be assigned to any known genus.

3. Discussion The taxonomic results obtained by LM during this study corroborate the HPLC data on the phytoplankton composition of the studied WBs and chemically detected cyanotoxins [4]. The results from conducted molecular-genetic analysis are also in general accordance with data on cyanotoxins, except the lack of MCs over the detection limit of the methods used in Poroy, Vaya, and Mandra [4], and recent discovery of toxigenic mcy sequences in these WBs. The finding of toxigenic sequences in the samples where MCs were not detected by standard methods is not unusual and can be explained with the quite low Microcystis amounts found there by LM, with the temporal character of mcy gene expression patterns (e.g., [41]) and other factors that condition the toxin production, including the growth phase of the populations [42]. The lack of NODs in the checked WBs [4] is also in accordance with the negative PCR signal for NOD-producing genes obtained in this study and the absence of its causative agents, Nodularia species [22], in the phytoplankton samples processed by LM. We note these results also considering the previous broad distribution of different species of Nodularia in coastal Bulgarian waterbodies and the former mass development of N. spumigena in Vaya (for details see [3]). Microcystis represents one of the most proliferative bloom-forming genera, reported from more than 108 countries and on all continents [38,43,44]. From the 11 Microcystis morphospecies, distinguishable by LM and accepted as distributed in Europe [36,37], we found 7 in the studied WBs (Table1, Figures1–8). Out of those seven WBs, three Microcystis morphospecies—namely Microcystis natans, M. smithii, and M. botrys—are more common in northern parts of Europe and in large clear lakes, while M. aeruginosa, M. flos-aquae, M. novacekii, and M. wesenbergii are more widely distributed and common in mesotrophic and eutrophic WBs, where they often form water blooms or participate in them [36]. In our study, the first three species (M. natans, M. smithii, and M. botrys) were rarely found and always in low abundance, which allows tentatively to suggest their alien character for the investigated WBs and Bulgaria. M. natans and M. botrys were rarely found in the country, the first in the reservoir Pchelina and in the lake Vaya [45], and the second in the reservoir Mandra [46], but this is the first report of M. smithii for Bulgaria. Generally, both LM and molecular genetic approaches demonstrated presence of Microcystis in five of the WBs and confirmed the uneven distribution of its clones and toxigenic representatives in the studied sites. The species of the genus were not found by both LM and PCR-based methods in four of the WBs—namely lakes Uzungeren, Shabla, Ezerets, and in the reservoir Aheloy, as well as in the site Toxins 2020, 12, 39 15 of 24

2 of the reservoir Mandra. In the other five studied WBs, 56 clones of Microcystis were identified as spread in six clusters according to their homology with mcyE-based sequences (Figure9). The fact that only 12 (21%) of the sequences were affiliated to the strains of distinct species (M. aeruginosa and M. wesenbergii) provided a great challenge to assign all obtained toxigenic genotypes to certain Microcystis taxa. On the one hand, the low number of affiliations was due to the recent general low availability of genomic sequences from cyanobacteria when compared to other prokaryotes [47]. In the same time, five of the NCBI sequences used in the obtained phylogenetic tree (Figure9) were based on metagenomic data (genetic material recovered directly from uncultured organisms from environmental samples—[48]). Despite the increased application of these data in modern studies based on the common difficulties, or even impossibility, to culture some cyanobacteria [47], their use in identification work is problematic because of the lack of morphological descriptions for most of the sequenced uncultured strains. The same is the case of most axenic strains with fixed sequences, registered in the NCBI and used for obtaining the phylogenetic tree. Another important factor to note is the general problem of lost value of some phylogenetic constructions caused by using sequences from strains which have not passed taxonomic revision and yet have incorrect or arbitrary names [10]. Despite considering all these possible problems and needed caution in interpretations, at present, according to the comparison of our results obtained by both methods, it is possible to suppose that:

(1) Cluster I contains mainly strains identical to Microcystis sp. Kot12/08-3 (NCBI:txid1402958), which are similar in LM to Microcystis novacekii, from which the best morphologically expressed features of the colonies were found in the reservoir Mandra (Figure5c–f); (2) Because of the finding of Microcystis natans only in Durankulak site 2 (Figure3d) cluster II most probably comprises its two strains which are close to Microcystis sp. Brat 12/07-7 (NCBI:txid1402954) and uncultured cyanobacterium (AB638245.1); (3) Cluster III contained a group of seven strains of typical Microcystis wesenbergii (identical with Microcystis sp. Brat12/07-2, NCBI:txid1402949), some of which are capable of easy dissolving to separate cells accompanied with some morphological transitions to Microcystis aeruginosa during the disintegration of the colonies (Figure4e,f) and four other groups of strains with disputable from genetic point of view affiliation despite the fact that by LM similar strains of M. wesenbergii were seen in the reservoir Sinyata Reka and in the lakes Durankulak (site 2) and Vaya (sites 1 and 2); (4) Cluster IV contained two groups of strains: (a) a strain of Microcystis wesenbergii (100% identical to Microcystis wesenbergii NIES-107, NCBI:txid315483) with sharp, hard and well-pronounced margin of the colonies, which easily defragment to small spherical initial colonies in the lake Vaya (Figure4d); (b) strains from Vaya site 3 and Durankulak site 2 (the last similar to Uncultured cyanobacterium AB638231), for which it is possible to suppose close affiliation to Microcystis aeruginosa from cluster VI according to their genetic distances but which could not be clearly separated by LM; (5) Cluster V comprises generally of morphologically different strains of Microcystis aeruginosa with a sub-cluster of clones distributed in Vaya 1–2 and Poroy, the colonies of which are easily disintegrating in separate cells, often dividing in twos, which strongly resemble Synechocystis aquatilis and are impossible to be reliably ascertained to M. wesenbergii or M. aeruginosa but obviously are genetically close to uncultured Microcystis sp. clone BS12/06-10; another close sub-cluster is formed by strains found in Mandra 1, Durankulak 2, and Vaya 3 and identical with to Microcystis aeruginosa (AB032549.2) and uncultured Microcystis sp. clone Vi12/07-2, which could not be clearly separated by LM; (6) Cluster VI contains the most typical but strongly variable Microcystis aeruginosa strains, which were found mainly in the lake Durankulak (Figure1a–f) and were identical to Microcystis aeruginosa FCY-26 (NCBI:txid1150859). Toxins 2020, 12, 39 16 of 24

At present, we cannot assign to any cluster the morphologically identified Microcystis smithii, found only in site 3 of the lake Durankulak (Figure3a; Table1), and cannot link the last separate sequence from Durankulak site 4 (Dur4_1 on Figure9) to a certain morphological strain. The most clearly morphologically different colonies found in Durankulak site 4 (Figure3g,h) had similarities with some colonies found in Vaya site 3 (Figure4h) but their sequences did not group in any common cluster on Figure9. The same lack of common phylogenetic grouping could be outlined for Microcystis botrys, which was found in Durankulak site 2 and Vaya sites 1 and 2 (Figures3b and5a), as well as for M. flos-aquae which was found in Durankulak site 2 and Vaya site 3 (Figures3c and5b). The distribution of sequences in the obtained phylogenetic tree did not match completely with their geographic distribution in coastal and inland parts of the country, and this result is in accordance with the earlier demonstrated lack of clear biogeographical pattern in the variability of sequenced Microcystis aeruginosa genomes [49]. The different spread of Microcystis morphospecies in the studied WBs (Table1) corroborates previous data on the distribution of the cyanoprokaryotes in the country [ 2,3]. Despite the general accordance in all the results, we have to note that there was not complete coincidence of data obtained by both applied methods since we found seven morphospecies of Microcystis, but six clusters based on PCR. Moreover, in one case (namely Mandra site 3) by LM we clearly identified the presence of two Microcystis species (M. aeruginosa and M. novacekii—Table1) but the samples from the same site gave a negative PCR-signal. PCR data also did not indicate presence of M. wesenbergii in the site Durankulak 4, where it was found in typical colonies with hard outer mucilage margin and therefore inevitably determined by LM (Figure2d). The same were the mentioned above cases of rare findings by LM of M. botrys and M. flos-aquae, which we could not assign to any cluster of the phylogenetic tree. The explanation for these discrepancies could be found in the extremely low quantities of the Microcystis colonies in the relevant sites observed by LM and in the eventual presence of non-toxic strains. It is possible to suggest the same reasons for not obtaining a clear PCR-signal for M. smithii, which was identified by LM in Durankulak site 3 (Figure3a). Considering this result, it is well to remember that 16S rRNA gene sequences of five strains of M. smithii isolated from Lake Dishui, China, intermixed with strains of other morphospecies [50]. Finally, we have to note that the reliable LM identification of morphologically typical Microcystis wesenbergii in the reservoir Sinyata Reka (Figure9) was not inevitably confirmed by PCR-data because of the lacking morphological description of Microcystis sp. Brat 12/07-7 (NCBI:txid1402949). All the results obtained in this study support the idea of rich intrageneric diversity with many transitions in the colonial morphology in the genus Microcystis. This is in accordance with the earlier accent on the taxonomic problems in LM identification of Microcystis caused by the variability of colonies with overlapping of the limits usually accepted for a particular morphospecies [37,38,51], as well as with the recent hypothesis that all Microcystis morphospecies are may be different morphotypes of just one genetically consistent species and their phenotypic plasticity is caused by environmental variables [8]. Considering also the earlier works on M. aaeruginosa, M. smithii, M. novacekii, and M. wesenbergii, based on 16S rRNA, or 16S rRNA–23S rRNA ITS and cpcBA-IGB regions which suggested monophyletic identity, or demonstrated lack of differences among morphospecies or showed their intermixed phylogenetic positions [50,52–54], we support the opinion that taxonomic revision of Microcystis is needed. When discussing the differences in the results obtained by different methods, we have to underline also that mcyE sequences proved the presence of MC-producing Microcystis strains in Poroy, Vaya, and Mandra, where MCs were not detected by conventional methods [4] but Microcystis colonies were identified by LM. Once more this result shows the efficiency of the PCR-based method in cases of low abundance of toxigenic strains. Therefore, we can underline the sensitivity of molecular methods for identifying of MCs, but in the same time, based on all our results, we support the broadly shared opinion that until a single unique method is adopted, a combination of different approaches is more desirable, or even necessary in studies of CyanoHABs. Toxins 2020, 12, 39 17 of 24

The current applied approach that combines two different methods for the study of cyanobacterial blooms has the benefit of relating the presence of the toxigenic mcyE genes to the different morphospecies confirmed by LM. Toxic strains are world-wide known for M. aeruginosa and have been found in M. botrys, M. flos-aquae, and M. novacekii [55], while according to our knowledge they have not been reported for M. natans, and data on M. wesenbergii remain disputable (e.g., [2,36,38,56–58]). In Bulgaria, M. wesenbergii occurred among the most spread cyanoprokaryotes, and similarly to M. aeruginosa, M. flos-aquae, and M. natans it was found in the samples containing toxins [2]. Moreover, M. wesenbergii was the most often recorded species in the toxic samples found in the country during the analyzed 15-year period [2]. The results from the genetic analysis carried in this study together with our LM data, allowed strongly to suppose the relation of the toxic strains in cluster III (Figure9) with the nuisance bloom with MCs detected in the reservoir Sinyata Reka [4] and formed by morphologically identified dominant M. wesenbergii (Figures6–8), di fferent from the only published with a sequence M. wesenbergii strain NIES-107. The results from cluster IV proved the presence of another toxic M. wesenbergii strain in Vaya sites 1 and 2, which is similar to the abovementioned strain NIES-107. In addition, data obtained in this study allow us to suppose the existence of toxic strains of M. natans, which in our opinion is represented in cluster II. This suggestion finds support in a previous publication on Bulgarian WBs, according to which M. natans was found among the algal dominants during three CyanoHABs with MCs in the lake Vaya and in the reservoirs Pchelina and Bistritsa [45]. As it could be seen from Figure9, and as it could be expected from all earlier data on Microcystis toxicity cited above [55], most of the M. aeruginosa strains found during the study were toxic. However, we did not find evidence for presence of toxic strains containing mcyE genes of Microcystis botrys, M. flos-aquae, and M. smithii strains and for now were not able to resolve their identification based on the used HEPF x HEPR pair of primers.

4. Conclusions The results obtained from application of the polyphasic approach in this particular study allowed us to state the presence of toxic Microcystis strains in five from the nine studied shallow WBs of Bulgaria, in some of which both blooms and MCs have been confirmed by other methods [4]. Moreover, using the polyphasic approach, we confirmed the well-known presence of toxic M. aeruginosa strains, proved the presence of toxigenic strains in M. wesenbergii and supposed their existence in M. natans. The general accordance in the results allows to confirm the idea that genetic sequencing, and the HEPF HEPR pair × of primers in particular, can efficiently serve in water monitoring, employing a cultivation-independent approach even in cases of low abundance of toxigenic strains. We demonstrated also that until a single unique method is adopted, a combination of different approaches is more desirable, or even necessary in studies of CyanoHABs. However, the affiliation of most of the isolated mycE strains to genus level due to unclassified species sequences, suggested that the currently available cyanobacterial genomic sequence data are still insufficient to resolve fully the species phylogenetic identification of the isolated mcy pool sequences with covering the whole range of mcyE diversity and toxicity. Our results also strongly support the need for taxonomic revision of the genus Microcystis.

5. Materials and Methods

5.1. Sites and Sampling The study was carried out in a single campaign from 21–25 June 2018 in nine shallow WBs situated in Central and Eastern Bulgaria (Figure 10, Table2). Detailed descriptions on the morphometry, hydrology, historical development, usage, conservational status, and biodiversity of each of the WBs are provided in the Inventory of Bulgarian wetlands and their biodiversity [31]. Therefore, in Table2 this unique inventory number of each WB from this database (IBWXXXX) is provided. Toxins 2020, 12, 39 18 of 24 Toxins 2020, 12, x FOR PEER REVIEW 17 of 23

Figure 10. Map of Bulgaria showing the sampling sites (modified (modiﬁed after http://www.ginkgomaps.comhttp://www.ginkgomaps.com and Google Maps, accessedaccessed 66 November 2019).2019).

TheTable sampling 2. Sampling was sites preceded and their by sending environmental a drone para (DJImeters Mavic with Pro, types Shenzhen, of found Guangdong, cyanotoxins China, Model:Bulgarian M1P GL200A) waterbodies supplied (WBs) in with the period a photo 21–25 camera June 2018 to observe (after [4]). and document the whole WB and eventualWBN and hotIBW spots SAN with Date visible Alt diff Latitudeerences in Longitude the color asWT indicators pH SD of CND cyanoblooms. TDS DO The TP spots TN /areas CT ofRes. diff Sinyataerent color were chosen for sampling or, in case of visible water homogeneity, the sites from our previousReka studiesSR1 21.06.18 were repeated317 42°28.1480’ for each24°42.217 WB (for 27.4 details 9.72 see0.5 [4]). 470 Therefore, 305 9.36 the25 number4.8 MCs of sampling(IBW1890) sites (provided in Table2) in each water body varied from 1 to 4. All the chosen 17 sites SR2 21.06.18 317 42°28.1473’ 24°42.2175 26.7 9.36 0.6 468 306 9,21 27 4.3 wereL. reachedVaya by inflatable boats with one or two places, with motor and oars, used according to VA1 22.06.18 −2 42°30.5940’ 27°22.075 26.9 9.65 0.25 2588 1682 12.51 13 5,4 CYN the(IBW0191) site circumstances. The site coordinates, altitude, water temperature, pH, water hardness (TDS), oxygen contentVA2 (DO), 22.06.18 and conductivity 0 42°28.4540’ were 27°25.482 measured 28.28 in situ 8.86 by 0.25 Aquameter 1183 768 AM-200 11.94 and11 Aquaprobe3.7

AP-2000 from AquareadVA3 23.06.18 water 6 monitoring42°29.1850’ instruments,27°26.531 23.7 2012 9.5 Aquaread 0.25 1024 Ltd 665 (Broadstairs, 7.01 12 UK).4.6 Total Res. Mandra nitrogen (TN) andMN1 phosphorus 23.06.18 12 (TP)42°24.0463’ were measured27°26.1120’ ex25.88 situ using8.28 0.4 Aqualytic 649 421AL410 6.81 Photometer 3 3.0 from (IBW1720) ® AQUALYTIC MN2, Dortmund, 23.06.18 Germany.13 42°24.0670’ The water27°19.1310’ transparency 26.2 8.2 was 0.2 measured 663 461 using 5.89 Secchi 6 4.0 disk. CYN All results, togetherMN3 with 23.06.18 detailed 9 data 42 26.1420’ on cyanotoxins 27°26.5860’ found 24.9 were 8.48 published 0.3 639 [4]. 415 7.91 4 3.3 L. Uzungeren PhytoplanktonUZ samples23.06.18 for7 taxonomic42°26.1782’ 27°27.1998’ identification 25.9 and8.06 for 0.4 molecular-genetic 14.38 9351 7.83 studies 5 2.8 (each in a volume(IBW0710) of 0.5 L) were collected from the water surface (0–20 cm). The phytoplankton samples Res. Poroy PR 24.06.18 41 42°43.0190’ 27°37.3160’ 25.10 8.33 1.2 762 495 9.45 1 2.8 were(IBW3038) fixedimmediately with 2% formalin and thus transported to the lab, where they were further proceededRes. Aheloy by sedimentation method. The samples for PCR-studies were filtered in some hours after AH 24.06.18 144 42°42.8230’ 27°30.9740’ 25.4 8.51 1.10 614 399 8.92 1 4.1 collection(IBW3032) and the obtained filters were transported to the lab in sterile plastic tubes in a box with L. Ezerets dry ice. EZ 25.06.18 −2 43°35.2770’ 28°33.2290’ 26.4 8.35 TTB 1084 0 9.94 0.5 5.3 (IBW0233) L. Shabla SH 25.06.18 −2 43°33.8180’ 28°34.1860’ 27.1 8.46 TTB 1087 0706 9.97 0.1 5.1 (IBW0219) L. Durankulak DR1 25.06.18 6 43°40.3240’ 28°32.0470’ 24.03 8.54 1 1111 722 7.35 21 2.8 (IBW0216) DR2 25.06.18 6 43°40.3340’ 28°32.0220’ 24.7 8.21 1 1094 711 7.79 20 4.0 MCs MCs, DR3 25.06.18 4 43°40.5300’ 28°32.9930’ 24.6 8.49 1 1075 698 6.19 24 3.9 SXT

Toxins 2020, 12, 39 19 of 24

Table 2. Sampling sites and their environmental parameters with types of found cyanotoxins Bulgarian waterbodies (WBs) in the period 21–25 June 2018 (after [4]).

WBN and IBW SAN Date Alt Latitude Longitude WT pH SD CND TDS DO TP TN CT Res. Sinyata Reka SR1 21.06.18317 42◦28.1480’ 24◦42.217 27.4 9.72 0.5 470 305 9.36 25 4.8 MCs (IBW1890)

SR2 21.06.18317 42◦28.1473’ 24◦42.2175 26.7 9.36 0.6 468 306 9,21 27 4.3 L. Vaya VA1 22.06.18 2 42 30.5940’ 27 22.075 26.9 9.65 0.25 2588 1682 12.51 13 5,4 CYN (IBW0191) − ◦ ◦

VA2 22.06.18 0 42◦28.4540’ 27◦25.482 28.28 8.86 0.25 1183 768 11.94 11 3.7

VA3 23.06.18 6 42◦29.1850’ 27◦26.531 23.7 9.5 0.25 1024 665 7.01 12 4.6 Res. Mandra MN1 23.06.18 12 42 24.0463’ 27 26.1120’ 25.88 8.28 0.4 649 421 6.81 3 3.0 (IBW1720) ◦ ◦

MN2 23.06.18 13 42◦24.0670’ 27◦19.1310’ 26.2 8.2 0.2 663 461 5.89 6 4.0 CYN

MN3 23.06.18 9 42 26.1420’ 27◦26.5860’ 24.9 8.48 0.3 639 415 7.91 4 3.3 L. Uzungeren UZ 23.06.18 7 42 26.1782’ 27 27.1998’ 25.9 8.06 0.4 14.38 9351 7.83 5 2.8 (IBW0710) ◦ ◦ Res. Poroy PR 24.06.18 41 42 43.0190’ 27 37.3160’ 25.10 8.33 1.2 762 495 9.45 1 2.8 (IBW3038) ◦ ◦ Res. Aheloy AH 24.06.18144 42 42.8230’ 27 30.9740’ 25.4 8.51 1.10 614 399 8.92 1 4.1 (IBW3032) ◦ ◦ L. Ezerets EZ 25.06.18 2 43 35.2770’ 28 33.2290’ 26.4 8.35 TTB 1084 0 9.94 0.5 5.3 (IBW0233) − ◦ ◦ L. Shabla SH 25.06.18 2 43 33.8180’ 28 34.1860’ 27.1 8.46 TTB 1087 0706 9.97 0.1 5.1 (IBW0219) − ◦ ◦ L. Durankulak DR1 25.06.18 6 43 40.3240’ 28 32.0470’ 24.03 8.54 1 1111 722 7.35 21 2.8 (IBW0216) ◦ ◦

DR2 25.06.18 6 43◦40.3340’ 28◦32.0220’ 24.7 8.21 1 1094 711 7.79 20 4.0 MCs MCs, DR3 25.06.18 4 43 40.5300’ 28 32.9930’ 24.6 8.49 1 1075 698 6.19 24 3.9 ◦ ◦ SXT

DR4 25.06.18 3 43◦40.6950’ 28◦32.6000’ 26.5 8.53 1 1087 706 9.6 20 3.2 WBN—name of the water body; IBW—number in the Inventory of Bulgarian Wetlands [31]; Res—reservoir; L—lake; SAN—site abbreviation and number; Alt—altitude; WT—water temperature (◦C), SD—Secchi depth (m); TTB—total 1 transparent to bottom; CND—conductivity (µS); TDS—total dissolved solids (µg L− ); DO—oxygen concentration 1 1 1 (mg L− ); TP—total phosphorus (mg L− ); TN—total nitrogen (mg L− ); CT—cyanotoxins, MCs—microcystins, CYN—cylindrospermopsin, SXT—saxitoxins.

5.2. Phytoplankton Identification by Conventional Light Microscopy (LM) In the lab, the microscopic work was done mainly under magnification 100 and immersion × on 52 non-permanent slides on Motic BA 4000 microscope with camera Moticam 2000, and later on 22 non-permanent slides on Motic B1 microscope with camera Moticam 2.0 mp. Both cameras were supplied by Motic Images 2 Plus software program. Taxonomic identification of cyanoprokaryotes followed the standard European taxonomic literature [32–36,59] with updates from AlgaeBase [60], CyanoDB [61] and relevant modern taxonomic papers. Traditional morphological features for distinguishing Microcystis ‘species’ include the colony form, mucilage structure, cell diameter, density and organization of cells within the colony, facultative or obligatory occurrence of aerotopes, and the term ‘morphospecies’ has become widely used for species recognized on such morphological criteria (e.g., [32–38]). Quantitative contribution of the different species to the biomass was estimated using the Thoma-counting chamber and method of the stereometrical approximations [2,62].

5.3. Molecular Studies The molecular study was conducted by sequence analysis of PCR amplified fragments of toxic microcystin synthase gene mcyE. As already mentioned, this targeted gene belong to the gene clusters involved in the biosynthesis of MCs (mcyA-E), which are widely used due to their usefulness for the early detection of potentially toxic cells even when the toxin concentrations are too low to be Toxins 2020, 12, 39 20 of 24 detected [21]. Due to lack of universal primers (e.g., [26,63]), for this study, the mcyE gene was chosen out of the other potentially usable mcy genes because of its reliable biomarker character for detection of MC-producing cyanoprokaryotes and its strong indicator properties for identifying of potential risk from MCs, even in water bodies comprising mixed assemblages of toxic and non-toxic cyanobacteria (e.g., [64–69]). Moreover, the similarity between MCs and NODs biosynthesis pathways [22,23] enabled the development of molecular detection methods for identifying all the main producers of MCs and NODs in environmental samples based on mcyE-gene and the orthologous nodularin synthetase gene F(ndaF) sequences with specific detection of the mcyE/ndaF gene pairs [65,70,71]. The application of primers specific to mcyE genes showed advantages in toxigenicity typing [72] especially after the amplified aminotransferase (AMT) domain of mcyE using HEP primers revealed that PCR amplification and hepatotoxin production was 100% correlated [65]. A few hours after collection, the samples for molecular-genetic analysis were filtered true 45 µm cellulose filters Whatman NC45 ST/Sterile EO. In the lab, the total DNA was isolated from the filters following the protocol of Sigma Genomic DNA Purification Mini Kit (Sigma). DNA was amplified using primer combination HEPF (50TTTGGGGTTAACTTTTTTGGGCAT AGTC-3 ) HEPR (5 AATTCTTGAGGCTGTAAATCGGGTTT-3 )[65]. The PCR amplification was 0 × 0 0 performed in a 25 µL volume containing 10 pmol primers; 0.16 mM dNTP’s; 1.25 units Taq polymerase, 0.75 mM MgCI and 10 PCR buffer supplied by FastStart High Fidelity PCR System (Roche, Basel, 2 × Switzerland). The amplification of DNA was done in a thermal cycler QB-96 (Qianta Biotech, Byfleet, Surrey, UK) under the following PCR conditions: denaturation at 95 ◦C for 5 min, 35 cycles of denaturation (30 s at 95 ◦C), annealing at 57 ◦C for 30 s, extension at 72 ◦C for 40 s, and a final extension at 72 ◦C for 5 min. The resulting PCR products were purified using Sigma Gel GenElute Gel Extraction Kit (Sigma, St. Louis, MO, USA), following the manufacturer’s instructions. The amplification products obtained were subsequently cloned using with CloneJET PCR Cloning Kit (Thermo Scientific, Waltham, MA, USA). Recombinant plasmids were isolated using Sigma Plasmid Miniprep Kit. For each site or WB between 6 and 10 clones were selected and sequenced by Macrogen Inc (Seol, Korea). The obtained sequences were processed with Vector NTI 11.5 software and used for BLAST search [39] in the NCBI data base [40]. All the 28 sequences obtained during this study were submitted to NCBI [40] and the accession numbers from MN417081 to MN417108 were received. The phylogenetic tree was constructed by Neighbor-joining method applying Mega 6.06 software [73]. In the resultant tree, the accession numbers of the strains are shown in brackets, while in the text the taxonomic identification number in NCBI is indicated in accordance with the requirements of NCBI [40].

Author Contributions: Conceptualization, M.S.-G. and B.U.; Formal analysis and investigation of molecular genetic data, M.R. and K.S.; Investigation by LM (light microscopy)—M.S.-G., B.U., and G.G.; Resources, B.U. and M.S.-G.; Writing—Original draft preparation, M.R. and K.S.; Writing—Review and editing, M.S.-G., B.U., and G.G.; Funding acquisition—B.U., M.S.-G., M.R., and G.G.; Project administration, M.S.-G. and B.U. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by Scientific Research Fund of the Ministry of education and science of Bulgaria, grant number DN-13-9/17.12.2017 and KP-06-OPR06/2/18.12.2018. Acknowledgments: The authors would like to acknowledge the European Cooperation in Science and Technology, COST Action ES 1105 ‘CYANOCOST—Cyanobacterial blooms and toxins in water resources: Occurrence, impacts, and management’ for adding value to this paper through networking and knowledge sharing with European experts and researchers in the field. Our thankfulness goes to both unknown reviewers who helped to improve the manuscript. Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the study, in the collection, analyses, interpretation of data, in the writing of the manuscript, and in the decision to publish the results. Toxins 2020, 12, 39 21 of 24

References

1. Svirˇcev, Z.; Lalić,D.; Savić,G.B.; Tokodi, N.; Backović,D.D.; Chen, L.; Meriluoto, J.; Codd, G.A. Global geographical and historical overview of cyanotoxin distribution and cyanobacterial poisonings. Arch. Toxicol. 2019, 93, 2429–2481. [CrossRef][PubMed] 2. Stoyneva-Gärtner, M.P.; Descy, J.-P.; Latli, A.; Uzunov, B.; Pavlova, V.; Bratanova, Z.L.; Babica, P.; Maršálek, B.; Meriluoto, J.; Spoof, L. Assessment of cyanoprokaryote blooms and of cyanotoxins in Bulgaria in a 15-years period (2000–2015). Adv. Oceanogr. Limnol. 2017, 8, 131–152. [CrossRef] 3. Descy, J.-P.; Stoyneva-Gärtner, M.P.; Uzunov, B.A.; Dimitrova, P.H.; Pavlova, V.T.; Gärtner, G. Studies on cyanoprokaryotes of the water bodies along the Bulgarian Black Sea Coast (1890–2017): A review, with special reference to new, rare and harmful taxa. Acta Zool. Bulg. 2018, 11, 43–52. 4. Stoyneva-Gärtner, M.P.; Uzunov, B.A.; Descy, J.-P.; Gärtner, G.; Draganova, P.H.; Borisova, C.I.; Pavlova, V.; Mitreva, M. Pilot application of drone-observations and pigment marker detection by HPLC in the studies of CyanoHABs in Bulgarian inland waters. Mar. Freshw. Res. 2019.[CrossRef] 5. Gkelis, S.; Rajaniemi, P.; Vardaka, E.; Moustaka-Gouni, M.; Lanaras, T.; Sivonen, K. Limnothrix redekei (Van Goor) Meffert (Cyanobacteria) strains from Lake Kastoria, Greece form a separate phylogenetic group. Microb. Ecol. 2005, 49, 176–182. [CrossRef][PubMed] 6. Rajaniemi-Wacklin, P.; Rantala, A.; Mugnai, M.A.; Turicchia, S.; Ventura, S.; Komárková, J.; Lepistö, L.; Sivonen, K. Correspodence between phylogeny and morphology of Snowella spp. and Woronichinia naegeliana, cyanobacteria commonly occurring in lakes. J. Phycol. 2006, 42, 226–232. [CrossRef] 7. Moustaka-Gouni, M.; Kormas, K.A.; Vardaka, E.; Katsiapi, M.; Gkelis, S. Raphidiopsis mediterranea Skuja represents non-heterocytous life-cycle stages of Cylindrospermopsis raciborskii (Woloszynska) Seenayya et Subba Raju in Lake Kastoria (Greece), its type locality: Evidence by morphological and phylogenetic analysis. Harmful Algae 2009, 8, 864–872. [CrossRef] 8. Xiao, M.; Li, M.; Reynolds, C.S. Colony formation in the cyanobacterium Microcystis. Biol. Rev. 2018, 93, 1399–1420. [CrossRef] 9. Komárek, J.; Kaštovsky, J.; Mareš, J.; Johansen, J.R. Taxonomic classification of cyanoprokaryotes (cyanobacterial genera) 2014, using a polyphasic approach. Preslia 2014, 86, 295–335. 10. Komárek, J. A polyphasic approach for the taxonomy of cyanobacteria: Principles and applications. Eur. J. Phycol. 2016, 51, 346–353. [CrossRef] 11. Komárek, J. Several problems of the polyphasic approach in the modern cyanobacterial system. Hydrobiologia 2018, 811, 7–17. [CrossRef] 12. Mankiewicz-Boczek, J.; Izydorczyk, K.; Romanowska-Duda, Z.; Jurczak, T.; Stefaniak, K.; Kokocinski, M. Detection and monitoring toxigenicity of cyanobacteria by application of molecular methods. Environ. Toxicol. 2006, 21, 380–387. [CrossRef][PubMed] 13. Saker, M.L.; Vale, M.; Kramer, D.; Vasconcelos, V.M. Molecular techniques for the early warning of toxic cyanobacteria blooms in fresh water lakes and rivers. Appl. Microbiol. Biotechnol. 2007, 75, 441–449. [CrossRef][PubMed] 14. Li, R.; Wilhelm, S.W.; Carmichael, W.W.; Watanabe, M.M. Polyphasic characterization of water bloom forming Raphidiopsis species (Cyanobacteria) from central China. Harmful Algae 2008, 7, 146–153. [CrossRef] 15. Valério, E.; Chambel, L.; Paulino, S.; Faria, N.; Pereira, P.; Tenreiro, R. Molecular identification, typing and traceability of cyanobacteria from freshwater reservoirs. Microbiology 2009, 155, 642–656. [CrossRef] 16. Kormas, K.A.; Gkelis, S.; Vardaka, E.; Moustaka-Gouni, M. Morphological and molecular analysis of bloom-forming Cyanobacteria in two eutrophic, shallow Mediterranean lakes. Limnologica 2010, 41, 167–173. [CrossRef] 17. Lymperopoulou, D.S.; Kormas, K.A.; Moustaka-Gouni, M.; Karagouni, A.D. Diversity of cyanobacterial phylotypes in a Mediterranean drinking water reservoir (Marathonas, Greece). Environ. Monit. Assess. 2011, 173, 155–165. [CrossRef] 18. Kobos, J.; Błaszczyk, A.; Hohlfeld, N.; Toruńska-Sitarz,A.; Krakowiak, A.; Hebel, A.; Sutryk, K.; Grabowska, M.; Toporowska, M.; Kokociński,M.; et al. Cyanobacteria and cyanotoxins in Polish freshwater bodies. Oceanol. Hydrobiol. Stud. 2013, 42, 358–378. [CrossRef] Toxins 2020, 12, 39 22 of 24

19. Rott, E.; Pentecost, A.; Mareš, J. Introduction: Recent developments in cyanobacterial research with special reference to aquatic habitats, molecular ecology and phylogenetic taxonomy. Hydrobiologia 2018, 811, 1–6. [CrossRef] 20. Ramos, V.M.C.; Castelo-Branco, R.; Leão, P.N.; Martins, J.; Carvalhal-Gomes, S.; Sobrinho da Silva, F.; Mendonça Filho, J.G.; Vasconcelos, V.M. Cyanobacterial diversity in microbial mats from the hypersaline lagoon system of Araruama, Brazil: An In-depth polyphasic study. Front. Microbiol. 2017, 8, 1233. [CrossRef] 21. Humbert, J.-F. Molecular Tools for the Detection of Toxigenic Cyanobacteria in Natural Ecosystems. In Handbook of Cyanobacterial Monitoring and Cyanotoxin Analysis; Meriluoto, J., Spoof, L., Codd, J., Eds.; John Wiley & Sons, Ltd.: Chichester, UK, 2017; pp. 280–283. [CrossRef] 22. Catherine, A.; Bernard, C.; Spoof, L.; Bruno, M. Microcystins and nodularins. In Handbook of Cyanobacterial Monitoring and Cyanotoxin Analysis; Meriluoto, J., Spoof, L., Codd, J., Eds.; John Wiley & Sons, Ltd.: Chichester, UK, 2017; pp. 109–126. [CrossRef] 23. Moffitt, M.C.; Neilan, B.A. Characterization of the nodularin synthetase gene cluster and proposed theory of the evolution of cyanobacterial hepatotoxins. Appl. Environ. Microb. 2004, 70, 6353–6362. [CrossRef] [PubMed] 24. Pearson, L.; Mihali, T.; Moffitt, M.; Kellmann, R.; Neilan, B. On the chemistry, toxicology and genetics of the cyanobacterial toxins, microcystin, nodularin, saxitoxin and cylindrospermopsin. Mar. Drugs 2010, 8, 1650–1680. [CrossRef][PubMed] 25. Ouellette, A.J.A.; Wilhelm, S.W. Toxic cyanobacteria: The evolving molecular toolbox. Front. Ecol. Environ. 2003, 1, 359–366. [CrossRef] 26. Mbukwa, E.A.; Boussiba, S.; Wepener, V.; Leu, S.; Kaye, Y.; Msagati, T.A.M.; Mamba, B.B. PCR amplification and DNA sequence of mcyA gene: The distribution profile of a toxigenic Microcystis aeruginosa in the Hartbeespoort Dam, South Africa. J. Water Health 2013, 11, 563–572. [CrossRef][PubMed] 27. Meriluoto, J.; Blaha, L.; Bojadzija, G.; Bormans, M.; Brient, L.; Codd, G.A.; Drobac, D.; Faassen, E.J.; Fastner, J.; Anastasia, H.; et al. 2017. Toxic cyanobacteria and cyanotoxins in European waters-recent progress achieved through the CYANOCOST Action and challenges for further research. Adv. Oceanogr. Limnol. 2017, 8. [CrossRef] 28. Ilieva, V.; Kondeva-Burdina, M.; Pavlova, V.; Bratanova, Z.; Danchev, N.; Georgieva, T.Z. Real-time PCR monitoring of toxic Cyanobacteria in Bulgarian water samples. Proceedings of Annual University Scientific Conference, Vasil Levski National Military University, Veliko Turnovo, Bulgaria, 20–21 October 2016; Publishing Complex of Vasil Levski National Military University: Veliko Turnovo, Bulgaria, 2016; pp. 241–249. 29. Merel, S.; Walker, D.; Chicana, R.; Snyder, S.; Baurès, E.; Thomas, O. State of knowledge and concerns on cyanobacterial blooms and cyanotoxins. Environ. Int. 2013, 59, 303–327. [CrossRef] 30. Ibelings, B.W.; Backerb, L.C.; Kardinaal, W.E.A.; Chorus, I. Current approaches to cyanotoxin risk assessment and risk management around the globe. Harmful Algae 2015, 49, 63–74. [CrossRef] 31. Michev, T.; Stoyneva, M. (Eds.) Inventory of Bulgarian Wetlands and Their Biodiversity; Elsi-M: Sofia, Bulgaria, 2007. 32. Geitler, L. Cyanophyceae. In Kryptogamen-Flora von Deutschland, Österreich und der Schweiz, 2nd ed.; Rabenhorst, L., Ed.; Akademische Verlagsgesellschaft: Leipzig, Germany, 1931; Volume 14, pp. 289–672. 33. Geitler, L. Schizophyta: Klasse Schizophyceae. In Die Natürlichen Pflanzenfamilien, Sweite Auflage; Engler, A., Prantl, K., Eds.; Wilhelm Engelmann: Leipzig, Germany, 1942; Volume 1b, pp. 1–232. 34. Gollerbakh, M.M.; Kossinskaya, E.K.; Polyanskiy, V.I. Manual of Freshwater Algae of the USSR. Blue-Green Algae; Sovetskaya Nauka: Moscow, Russia, 1953; Volume 2. 35. Starmach, K. Cyanophyta-Sinice, Glaucophyta-Glaukofity; PaństwoweWydawnictwo Naukowe: Warszawa, Poland, 1966. 36. Komárek, J.; Anagnostidis, K. Cyanoprokaryota. Teil 1/Part 1: Chroococcales. In Süßwasserflora von Mitteleuropa; Ettl, H., Gerloff, J., Heynig, H., Mollenhauer, D., Eds.; Spektrum Akademischer Verlag: Heidelberg, Germany, 2008; Volume 19/1, pp. 1–556. 37. Komárek, J.; Komárková, J. Review of the European Microcystis morphospecies (Cyanoprokaryotes) from nature. Czech Phycol. 2002, 2, 1–24. 38. Šejnohová, L.; Maršálek, B. Microcystis. In Ecology of Cyanobacteria II. Their Diversity in Space and Time; Whitton, B.A., Ed.; Springer: Dordrecht, The Netherlands, 2012; pp. 195–228. Toxins 2020, 12, 39 23 of 24

39. Basic Local Alignment Search Tool (BLAST). Available online: https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 24 October 2019). 40. National Centre for Biotechnology Information (NCBI). Available online: https://www.ncbi.nlm.nih.gov/ (accessed on 24 October 2019). 41. Tang, X.; Krausfeldt, L.E.; Shao, K.; LeCleir, G.R.; Stough, J.M.A.; Gao, G.; Boyer, G.L.; Zhang, Y.; Paerl, H.W.; Qin, B.; et al. Seasonal Gene Expression and the ecophysiological implications of toxic Microcystis aeruginosa blooms in Lake Taihu. Environ. Sci. Technol. 2018, 52, 11049–11059. [CrossRef] 42. Vasconcelos, V. Global changes and the new challenges in the research on cyanotoxin risk evaluation. Limnetica 2015, 34, 149–158. [CrossRef] 43. Harke, M.J.; Steffen, M.M.; Gobler, C.J.; Otten, T.G.; Wilhelm, S.W.; Wood, S.A.; Paerl, H.W. A review of the global ecology, genomics, and biogeography of the toxic cyanobacterium, Microcystis spp. Harmful Algae 2016, 54, 4–20. [CrossRef][PubMed] 44. Le Manach, S.; Duval, C.; Marie, A.; Djediat, C.; Catherine, A.; Edery, M.; Bernard, C.; Marie, B. Global metabolomic characterizations of Microcystis spp. Highlights clonal diversity in natural bloom-forming populations and expands metabolite structural diversity. Front. Microbiol. 2019, 10, 791. [CrossRef][PubMed] 45. Pavlova, V.; Babica, P.; Todorova, D.; Bratanova, Z.; Maršalek, B. Contamination of some reservoirs and lakes in Republic of Bulgaria by microcystins. Acta Hydrochim. Hydrobiol. 2006, 34, 437–441. [CrossRef] 46. Stoyneva, M. Contribution to the Studies of the Biodiversity of Hydro- and Aerobiontic Prokaryotic and Eukaryotic Algae in Bulgaria. Ph.D. Thesis, Sofia University “St. Kliment Ohridski”, Sofia, Bulgaria, 2014. 47. Alvarenga, D.O.; Fiore, M.F.; Varani, A.M. A metagenomic approach to cyanobacterial genomics. Front. Microbiol. 2017, 8, 809. [CrossRef] 48. Dvoˇrák, P.; Jahodáˇrová, E.; Casamatta, D.A.; Hašler, P.; Poulíˇcková, A. Difference without distinction? Gaps in cyanobacterial systematics; when more is just too much. Fottea 2018, 18, 130–136. [CrossRef] 49. Meyer, K.A.; Davis, T.W.; Watson, S.B.; Denef, V.J.; Berry, M.A.; Dick, G.J. Genome sequences of lower Great Lakes Microcystis sp. reveal strain-specific genes that are present and expressed in western Lake Erie blooms. PLoS ONE 2017, 12, e0183859. [CrossRef][PubMed] 50. Liu, Y.; Tan, W.; Wu, X.; Wu, Z.; Yu, G.; Li, R. First report of microcystin production in Microcystis smithii Komárek and Anagnostidis (Cyanobacteria) from a water bloom in Eastern China. J. Environ. Sci. 2011, 23, 102–107. [CrossRef] 51. Otsuka, S.; Suda, S.; Li, R.H.; Matsumoto, S.; Watanabe, M.M. Morphological variability of colonies of Microcystis morphospecies in culture. J. Gen. Appl. Microbiol. 2000, 46, 39–50. [CrossRef][PubMed] 52. Otsuka, S.; Suda, S.; Renhui, L.; Watanabe, M.; Oyaizu, H.; Matsumoto, S.; Watanabe, M.M. 16S rDNA sequences and phylogenetic analyses of Microcystis strains with and without phycoerythrin. FEMS Microbiol. Lett. 1998, 164, 119–124. [CrossRef] 53. Otsuka, S.; Suda, S.; Shibata, S.; Oyaizu, H.; Matsumoto, S.; Watanabe, M.M. A proposal for the unification of five species of the cyanobacterial genus Microcystis Kützing ex Lemmermann 1907 under the rules of the bacteriological code. Int. J. Syst. Evol. Microbiol. 2001, 51, 873–879. [CrossRef] 54. Sanchis, D.; Padilla, C.; Del Campo, F.F.; Quesada, A.; Sanz-Alferez, S. Phylogenetic and morphological analyses of Microcystis strains (Cyanophyta/Cyanobacteria) from a Spanish water reservoir. Nova Hedwig. 2005, 81, 431–448. [CrossRef] 55. Bernard, C.; Ballot, A.; Thomazeau, S.; Maloufi, S.; Furey, A.; Mankiewicz-Boczek, I.; Pawlik-Skowrońska,B.; Capelli, C.; Salmazo, N. Appendix 2. Cyanobacteria associated with the production of cyanotoxins. In Handbook of Cyanobacterial Monitoring and Cyanotoxin Analysis; Meriluoto, J., Spoof, L., Codd, J., Eds.; John Wiley & Sons, Ltd.: Chichester, UK, 2017; pp. 501–525. [CrossRef] 56. Kurmayer, R.; Dittmann, E.; Fastner, J.; Chorus, I. Diversity of microcystin genes within a population of the toxic cyanobacterium Microcystis spp. in Lake Wannsee (Berlin, Germany). Microb. Ecol. 2002, 43, 107–118. [CrossRef][PubMed] 57. Via-Ordorika, L.; Fastner, J.; Kurmayer, R.; Hisbergues, M.; Dittmann, E.; Komárek, J.; Erhard, M.; Chorus, I. Distribution of microcystin-producing and non-microcystin-producing Microcystis sp. in European freshwater bodies: Detection of microcystins and microcystin genes in individual colonies. Syst. Appl. Microbiol. 2004, 27, 592–602. [CrossRef][PubMed] Toxins 2020, 12, 39 24 of 24

58. Pavlova, V.; Stoyneva, M.; Georgieva, V.; Donchev, D.; Spoof, L.; Meriluoto, J.; Bratanova, Z.; Karadjova, I. New records of microcystins in some Bulgarian water bodies of health and conservational importance. J. Water Res. Protect. 2014, 6, 446–453. [CrossRef] 59. Komárek, J. Cyanoprokaryota. 3. Heterocytous genera. In Süswasserflora von Mitteleuropa/Freshwater Flora of Central Europe; Büdel, B., Gärtner, G., Krienitz, L., Schagerl, M., Eds.; Springer Spektrum: Berlin, Germany, 2013; pp. 1–1130. 60. AlgaeBase. Available online: http://www.algaebase.org/ (accessed on 18 September 2019). 61. CyanoDB 2.0. Available online: http://www.cyanodb.cz (accessed on 19 September 2019). 62. Rott, E. Some results from phytoplankton counting intercalibration. Schweiz. Z. Hydrol. 1981, 43, 34–62. [CrossRef] 63. Valério, E.; Chambel, L.; Paulino, S.; Faria, N.; Pereira, P.; Tenreiro, R. Multiplex PCR for detection of microcystins-producing cyanobacteria from freshwater samples. Environ. Toxicol. 2010, 25, 251–260. [CrossRef] 64. Vaitomaa, J.; Rantala, A.; Halinen, K.; Rouhiainen, L.; Tallberg, P.; Mokelke, L.; Sivonen, K. Quantitative real-time PCR for determination of microcystin synthetase E copy numbers for Microcystis and Anabaena in lakes. Appl. Environ. Microbiol. 2003, 69, 7289–7297. [CrossRef] 65. Jungblut, A.-D.; Neilan, B.A. Molecular identification and evolution of the cyclic peptide hepatotoxins, microcystin and nodularin synthetase genes in three orders of cyanobacteria. Arch. Microbiol. 2006, 185, 107–114. [CrossRef] 66. Rantala, A.; Rajaniemi-Wacklin, P.; Lyra, C.; Lepistö, L.; Rintala, J.; Mankiewicz-Boczek, J.; Sivonen, K. Detection of microcystin-producing cyanobacteria in Finnish lakes with genus-specific microcystin synthetase gene E (mcyE) PCR and associations with environmental factors. Appl. Environ. Microb. 2006, 72, 6101–6110. [CrossRef] 67. Weller, D.I. Detection, identification and toxigenicity of cyanobacteria in New Zealand lakes using PCR-based methods. N. Z. J. Mar. Freshw. Res. 2011, 45, 651–664. [CrossRef] 68. Conradie, K.R.; Barnard, S. The dynamics of toxic Microcystis strains and microcystin production in two hypertrofic South African reservoirs. Harmful Algae 2012, 20, 1–10. [CrossRef] 69. Ngwa, F.; Madramootoo, C.A.; Jabaj, S. Comparison of cyanobacterial microcystin synthetase (mcy) E gene transcript levels, mcy E gene copies, and biomass as indicators of microcystin risk under laboratory and field conditions. Microbiol. Open 2014, 3, 411–425. [CrossRef][PubMed] 70. Rantala, A. Evolution and Detection of Cyanobacterial Hepatotoxin Synthetase Genes. Ph.D. Thesis, University of Helsinki, Helsinki, Finland, 27 November 2007. 71. Rantala, A.; Rizzi, E.; Castiglioni, B.; de Bellis, G.; Sivonen, K. Identification of hepatotoxin-producing cyanobacteria by DNA-chip. Environ. Microbiol. 2008, 10, 653–664. [CrossRef][PubMed] 72. Ghosh, S.K.; Das, P.K.; Bagchi, S.N. PCR-based microcystin-producing cyanobacterial blooms from Central India. Indian J. Exp. Biol. 2008, 46, 66–70. 73. Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [CrossRef]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).