DOCSLIB.ORG

A New Cryptic Species of Stygobiotic Amphipod of the Genus Niphargus (Crustacea: Amphipoda: Niphargidae) from the Kumistavi (Prometheus) Cave, Western Georgia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A New Cryptic Species of Stygobiotic Amphipod of the Genus Niphargus (Crustacea: Amphipoda: Niphargidae) from the Kumistavi (Prometheus) Cave, Western Georgia Arthropoda Selecta 29(4): 419–432 © ARTHROPODA SELECTA, 2020 The Quaternary speciation in the Caucasus: a new cryptic species of stygobiotic amphipod of the genus Niphargus (Crustacea: Amphipoda: Niphargidae) from the Kumistavi (Prometheus) Cave, Western Georgia ×åòâåðòè÷íîå âèäîîáðàçîâàíèå íà Êàâêàçå: íîâûé êðèïòè÷åñêèé âèä ñòèãîáèîíòíûõ àìôèïîä ðîäà Niphargus (Crustacea: Amphipoda: Niphargidae) èç ïåùåðû Êóìèñòàâè (Ïðîìåòåé), Çàïàäíàÿ Ãðóçèÿ Ivan N. Marin Èâàí Í. Ìàðèí A.N. Severtsov Institute of Ecology and Evolution of RAS, Leninsky prosp., 33, Moscow 119071 Russia. E-mails: [email protected], [email protected] Институт проблем экологии и эволюции им. А.Н. Северцова РАН, Ленинский просп., 33, Москва 119071 KEY WORDS: Crustacea, Amphipoda, Niphargidae, Niphargus, new species, stygobiotic, Western Georgia, Caucasus. КЛЮЧЕВЫЕ СЛОВА: Crustacea, Amphipoda, Niphargidae, Niphargus, новый вид, стигобионты, Запад- ная Грузия, Кавказ. ABSTRACT. A new cryptic species of stygobiotic (Crustacea: Amphipoda: Niphargidae) from the amphipod of the genus Niphargus Schiödte, 1849 (Am- Kumistavi (Prometheus) Cave, Western Georgia // Ar- phipoda: Niphargidae) is described from underground thropoda Selecta. Vol.29. No.4. P.419–432. doi: stream and lakes in the Kumistavi (Prometheus) Cave, 10.15298/arthsel. 29.4.04 Tskaltubo–Kumistavi, Imereti region of the Western Georgia, Caucasus, based on morphology and DNA РЕЗЮМЕ. Новый криптический вид стигобион- analysis. The new species belongs to the “carpathicus“ тных амфипод рода Niphargus Schiödte, 1849 species complex with the representatives in Europe, (Amphipoda: Niphargidae) описан из подземного ру- Caucasus and Iran, but clearly differs from all Cauca- чья и озер в пещере Кумистави (Прометея), Цхал- sian congeners by stout telson, which is about as long тубо-Кумистави, Имеретинская область Западной as wide (vs. about not less than 1.5 times in other Грузии, Кавказ, на основе морфологии и анализа related species); relatively stout basal part of dactyli of ДНК. Новый вид принадлежит к видовому комп- pereopods V–VII, which is about as long as wide (vs. лексу “carpathicus”, в который входят представите- usually more than 1.5 times as long as wide in other ли рода, обитающие в Европе, на Кавказе и в Ира- related species); and almost rectangular palm of gna- не, но явно отличается от всех кавказских сороди- thopods I and II with straight distal margin (vs. usually чей более коротким тельсоном, который примерно sloped distal margin in other related species). The sis- такой же длины как и ширины (у других родствен- ter species N. borutzkyi Birštein, 1933, inhabiting the ных видов он примерно в 1,5 раза длиннее); отно- neighboring, but isolated underground karst system, сительно толстой базальной частью дактилусов пе- including of the Sataplia, Sapichkhia and Tskaltsitela реопод V–VII, длине которой примерно равна ши- caves, differs from the new species in some minor рине (у родственных видов эта часть дактилуса бо- morphological features and genetically (about 10% or лее чем 1,5 раза длиннее, чем шире); и почти пря- 0.1 substitutions per 100 nucleotides by COI gene mark- моугольная пальмарной частью гнатопод I и II с er). The phylogenetic analysis of available genetic data прямым дистальным краем (он обычно скошен у (COI mtDNA) shows that karsts regions in the vicinity других родственных видов). Наиболее родствен- of Kutaisi are currently inhabited by closely related ный вид N. borutzkyi Birљtein, 1933, обитающий в Niphargus species descended from the ancestral taxon соседней, но изолированной подземной карстовой in the Quaternary as a result of geological processes системе, включающей пещеры Сатаплия, Сапич- that caused fragmentation of the ancestral range. хия и Цхалицитела, отличается от нового вида не- How to cite this article: Marin I.N. 2020. The Qua- которыми незначительными морфологическими ternary speciation in the Caucasus: a new cryptic spe- признаками и генетически (около 10% или 0,03 за- cies of stygobiotic amphipod of the genus Niphargus мен на 100 нуклеотидов по генетическому маркеру 420 I.N. Marin COI мтДНК). Филогенетический анализ имеющих- (=Prometheus, Gliani) Cave, Tskaltubo–Kumistavi ся генетических данных (COI мтДНК) показывает, (42°22′35.8″N 42°36′03.2″E) and the Tskaltsitela (=Ia- что в карстовых районах окрестностей Кутаиси в zoni) Cave (42°16′19.62″N 42°44′1.63″E) in Kutaisi, настоящее время обитает группа близкородствен- Western Georgia, Caucasus, in 2017–2018. The study ных видов рода Niphargus, произошедшие от еди- does not include endangered or protected species. All ного предкового таксона в Четвертичном периоде collected specimens were preserved in 90% solution of в результате геологических процессов, которые при- ethanol for further DNA analysis. Body length (bl., in вели к фрагментации предкового ареала. mm), dorsal length from the tip of rostrum till distal margin of telson, is used as standard measurements. The Introduction type material is deposited in the collection of Zoological Museum of Moscow State University, Moscow (ZMMU) The Caucasus is a hotspot of biodiversity, charac- and the Laboratory of Ecology and Evolution of Marine terized by a unique and very rich fauna, formed by Invertebrates of A.N. Severtsov Institute of Ecology and local separation of ecological niches and microhabitats Evolution of the Russian Academy of Sciences, Mos- [Myers et al., 2000; Krever et al., 2001]. Diverse sty- cow, Russia (LEMMI). All obtained sequences are gobiotic fauna, including numerous crustacean species, deposited in the GenBank (NCBI) database. is recently described as new to science from the region A fragment of the mitochondrial gene coding for (e.g., Marin, Sokolova, 2014; Sidorov et al., 2015a, b, cytochrome c oxidase subunit I gene marker (COI) was 2018; Sidorov, Samokhin, 2016; Marin, 2017a, b, amplified, sequencing and compared to resolve the 2018a, b, 2019a, b, 2020; Marin, Sinelnikov, 2017; cryptic diversity. Total genomic DNA was extracted Turbanov, Marin, 2017; Marin, Palatov, 2019), show- from abdominal and pereiopod muscle tissue using the ing that the real diversity of the region is far to be well innuPREP DNA Micro Kit (AnalitikJena, Germany) known. It is obvious that the fauna of the region has following the manufacturer’s protocol. The mitochon- been studied unevenly, and it is very likely that a large drial marker COI was amplified with the help of the number of new species will be described in the future. universal primers LCO1490 (5'–ggtcaacaaatcataaagatat- The genus Niphargus Schiödte, 1849 (Crustacea: tgg–3') and HC02198 (5'–taaacttcagggtgaccaaaaaatca– Amphipoda: Niphargidae) is one of the largest fresh- 3') [Folmer et al., 1994]. PCR products were performed water amphipod genus, comprising over 400 described on amplificator T100 (Bio-Rad, USA) under the fol- species, inhabiting various subterranean and epigean lowing conditions: initial denaturation at 96 °C for 1.5 aquatic habitats such as deep cave lakes, wells, small min followed by 42 cycles of 95 °C for 2 min, 49°C for pores in the epikarst, helocrene of springs and hyporeic 35 seconds, and 72 °C for 1.5 min, followed by chain zone of rivers in the West Palearctic [Fišer et al., 2006, extension at 72 °C for 7 min. The volume of 10 uL of 2014; Väinölä et al., 2008; Fišer, 2012; Horton et al., reaction mixture contained 1 uL of total DNA, 2 uL of 2017]. During the speleological survey along karst sys- 5x PCR mix (Dialat, Russia) and 1 uL of each primer. tems of Imereti region of the Western Georgia in Sep- The amplification products were separated by using tember 2017 numerous specimens of the genus Niphar- gel electrophoresis of nucleic acids on a 1.5% agarose gus were discovered in subterranean cave streams and gel in 1xTBE, and then stained and visualized with lakes in Kumistavi (=Prometheus, Gliani) Cave 0.003% EtBr using imaging UV software. DNA nucle- (42°22′35.8″N 42°36′03.2″E), Tskaltubo-Kumistavi, in otide sequences were determined using Genetic Anal- the Imereti region of the Western Georgia, Caucasus. izer ABI 3500 (Applied Biosystems, USA) and Big- The only known stygobiotic species from this region is Dye 3.1 (Applied Biosystems, USA) with direct and Niphargus borutzkyi Birštein, 1933 (Malacostraca: reverse primers. Uniformity of obtained sequences was Amphipoda: Niphargidae), originally described from processed using the program BioEdit v. 5.0.9. Unifor- the Tskaltsitela (=Iazoni) Cave in Kutaisi [Birštein, mity of obtained sequences was processed using the 1933, 1950] and lately reported from the neighboring program BioEdit v. 5.0.9. The resulting markers of the Sapichkhia (=Rionhesi) Cave and the Sataplia I COI gene of mtDNA with 620+ nucleotide long sec- Cave (after Barjadze et al., 2015). Careful examination tions were registered in GenBank (NCBI) and used for of the specimens collected from the Kumistavi further phylogenetic analysis. A dataset of COI gene of (Prometheus) Cave and their morpho-genetic compari- mtDNA of our specimens and sequences from Gen- son with the topotypic material of N. borutzkyi from Bank (NCBI) were assembled for phylogenetic analy- the Tskaltsitela Cave, Kutaisi (the type locality of the sis (see Fig. 1). The aligned sequences of COI gene, species) showed that they belong to genetically and 658 base pairs in length, were analyzed and verified morphologically well separated species described here- with MEGA 7.0. The best evolutionary substitution with as a new to science. model was determined using MEGA 7.0. and jModelt- est 2.1.141. The received nucleotide alignments of COI Material and methods mtDNA gene marker were used to reconstruct the phy- logenetic relations (tree) in (http://www.atgc- Amphipods were collected by hand net in subterra- montpellier.fr/phyml/) [Guindon et al., 2020] using nean cave streams and lakes within the Kumistavi GTR+G+I model for Maximum–Likelihood analysis Anew cryptic species of stygobiotic amphipod genus Niphargus from Western Georgia 421 Table 1. Pairwise genetic (COI mtDNA) distances (p-distances) Niphargus amirani sp.n. from the Kumistavi (Prometheus) Cave (n=4) and other related cave-dwelling Niphargus, known from the Northern Caucasus, the Crimean Peninsula and Europe (from GenBank (NCBI) database).
Load more

Recommended publications
  • Zoogeography of Epigean Freshwater Amphipoda (Crustacea) in Romania: Fragmented Distributions and Wide Altitudinal Variability
    Zootaxa 3893 (2): 243–260 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2014 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.3893.2.5 http://zoobank.org/urn:lsid:zoobank.org:pub:8336FFDA-F1A5-4026-A5B6-CCEBFF84F40A Zoogeography of epigean freshwater Amphipoda (Crustacea) in Romania: fragmented distributions and wide altitudinal variability DENIS COPILAȘ-CIOCIANU1, MICHAŁ GRABOWSKI2, LUCIAN PÂRVULESCU3 & ADAM PETRUSEK1 1Charles University in Prague, Faculty of Science, Department of Ecology, Viničná 7, 12844, Prague, Czech Republic. E-mail: [email protected], [email protected] 2University of Łódź, Faculty of Biology and Environmental Protection, Department of Invertebrate Zoology & Hydrobiology, Banacha 12/16, 90-237, Łódź, Poland. E-mail: [email protected] 3West University of Timișoara, Faculty of Chemistry, Biology, Geography, Department of Biology and Chemistry, Pestalozzi 16A, 300115, Timișoara, Romania. E-mail: [email protected] Abstract Inland epigean freshwater amphipods of Romania are diverse and abundant for this region has a favourable geographical position between the Balkans and the Black Sea. Excluding Ponto-Caspian species originating in brackish waters and freshwater subterranean taxa, there are 11 formally recognized epigean freshwater species recorded from this country. They belong to 3 genera, each representing a different family: Gammarus (Gammaridae, 8 species or species complexes), Niphargus (Niphargidae, 2 epigean species) and Synurella (Crangonyctidae, one species). Their large-scale distribution patterns nevertheless remain obscure due to insufficient data, consequently limiting biogeographical interpretations. We provide extensive new data with high resolution distribution maps, thus improving the knowledge of the ranges of these taxa.
    [Show full text]
  • The 17Th International Colloquium on Amphipoda
    Biodiversity Journal, 2017, 8 (2): 391–394 MONOGRAPH The 17th International Colloquium on Amphipoda Sabrina Lo Brutto1,2,*, Eugenia Schimmenti1 & Davide Iaciofano1 1Dept. STEBICEF, Section of Animal Biology, via Archirafi 18, Palermo, University of Palermo, Italy 2Museum of Zoology “Doderlein”, SIMUA, via Archirafi 16, University of Palermo, Italy *Corresponding author, email: [email protected] th th ABSTRACT The 17 International Colloquium on Amphipoda (17 ICA) has been organized by the University of Palermo (Sicily, Italy), and took place in Trapani, 4-7 September 2017. All the contributions have been published in the present monograph and include a wide range of topics. KEY WORDS International Colloquium on Amphipoda; ICA; Amphipoda. Received 30.04.2017; accepted 31.05.2017; printed 30.06.2017 Proceedings of the 17th International Colloquium on Amphipoda (17th ICA), September 4th-7th 2017, Trapani (Italy) The first International Colloquium on Amphi- Poland, Turkey, Norway, Brazil and Canada within poda was held in Verona in 1969, as a simple meet- the Scientific Committee: ing of specialists interested in the Systematics of Sabrina Lo Brutto (Coordinator) - University of Gammarus and Niphargus. Palermo, Italy Now, after 48 years, the Colloquium reached the Elvira De Matthaeis - University La Sapienza, 17th edition, held at the “Polo Territoriale della Italy Provincia di Trapani”, a site of the University of Felicita Scapini - University of Firenze, Italy Palermo, in Italy; and for the second time in Sicily Alberto Ugolini - University of Firenze, Italy (Lo Brutto et al., 2013). Maria Beatrice Scipione - Stazione Zoologica The Organizing and Scientific Committees were Anton Dohrn, Italy composed by people from different countries.
    [Show full text]
  • On Two Members of the Genus Niphargus Schiödte, 1849 (Crustacea: Niphargidae) from the Balkan Peninsula, N
    Acta entomologica serbica, 2013, 18(1/2): 207-235 UDC 595.371.063.8(497.11) ON TWO MEMBERS OF THE GENUS NIPHARGUS SCHIÖDTE, 1849 (CRUSTACEA: NIPHARGIDAE) FROM THE BALKAN PENINSULA, N. DEELEMANAE GREX SSP. N. AND N. JURINACI S. KAR. 1950 (CONTRIBUTION TO THE KNOWLEDGE OF THE AMPHIPODA 271) GORDAN S. KARAMAN Montenegrin Academy of Sciences and Arts, 20000 Podgorica, Montenegro E mail: [email protected] Abstract Two members of the genus Niphargus Schiödte, 1849 (Amphipoda: Gammaridea: Niphargidae) from the subterranean waters of the Balkan Peninsula are treated. Niphargus deelemanae grex ssp. n. is described and figured from Šarbanovac in E Serbia. The species Niphargus jurinaci S. Karaman 1950, scantily described and figured from Crni Lug near Ogulin in Croatia, is redescribed and figured more in detail, based on the type material. The taxonomical position and relations of these two taxa within the genus Niphargus are discussed. KEY WORDS: Amphipoda, taxonomy, Niphargus deelemanae grex ssp. n., jurinaci, redescription, Balkan Peninsula. Introduction The subterranean genus Niphargus Schiödte, 1849 (Amphipoda: Gammaridea: Niphargidae) is widely distributed through Europe and the Near East with over 300 known species and subspecies presented in various types of subterranean waters (caves, springs, subterranean torrents, deep lakes, etc.). The oldest known fossil members of the genus Niphargus are from the Tertiary Period (Eocene), and settled in the freshwaters at various times (G. KARAMAN, 1984). 208 G.S. KARAMAN Recently a new fossil, an amphipod from the Triassic Period, was described in Nevada, USA, Rosagammarus minichiellus (MCMENAMIN et al., 2013) altering our knowledge of fossil Amphipoda to the Mesozoic Period.
    [Show full text]
  • The Role of Predation in the Diet of Niphargus (Amphipoda: Niphargidae)
    Fišer et al. The role of predation in the diet of Niphargus (Amphipoda: Niphargidae) Cene Fišer, Žana Kovačec, Mateja Pustovrh, and Peter Trontelj Oddelek za biologijo, Biotehniška fakulteta, Univerza v Ljubljani, Večna pot 111, Ljubljana, Slovenia. Emails: [email protected], [email protected], [email protected]; [email protected] Key Words: Niphargus balcanicus, Niphargus timavi, Dinaric Karst, Vjetrenica, feeding, foraging. Niphargus (Amphipoda: Niphargidae) is the largest genus of freshwater amphipods1, with over 300 described species. Recently, it was identified as important for addressing ecological and evolutionary questions2. Nevertheless, the exploration of these issues critically depends on understanding the biology of individual species, which is mostly unknown. For instance, utilization of food sources has rarely been studied. Laboratory observations3,4 acknowledged a broad spectrum of foraging behaviors in N. virei Chevreux 1896 and N. fontanus Bate 1859, ranging from limnivory, detritivory, predation on oligochaetes and arthropods, feeding on decayed leaves and carrion, and fish flakes. Sket5 briefly mentioned how N. krameri Schellenberg 1935 fed on dead conspecifics. Finally, Mathieu et al. speculated that adult N. rhenorhodanesis Schellenberg 1937 could prey upon their own conspecifics6. Here we report on dietary data of two species from the Dinarc Karst. In 2001, we held several individuals of the troglobiotic Niphargus balcanicus Absolon 1927 in an aquarium. Unlike many other amphipods, this large (about 30 mm) species retains an upright position during activity (swimming, walking on ground) and rest. The animals were kept in the speleological laboratory in permanent darkness at 8 ºC. After a few days, we dropped a live isopod Asellus aquaticus (about 10 mm long) into the tank.
    [Show full text]
  • Updates to the Sporadic Knowledge On
    A peer-reviewed open-access journal SubterraneanUpdates Biology to 33:the 71–85 sporadic (2020) knowledge on microsporidian infections in groundwater amphipods 71 doi: 10.3897/subtbiol.33.48633 RESEARCH ARTICLE Subterranean Published by http://subtbiol.pensoft.net The International Society Biology for Subterranean Biology Updates to the sporadic knowledge on microsporidian infections in groundwater amphipods (Crustacea, Amphipoda, Niphargidae) Daniel Grabner1, Dieter Weber2, Alexander M. Weigand3 1 University of Duisburg-Essen, Aquatic Ecology and Centre for Water and Environmental Research, Univer- sitätsstr. 5, 45141 Essen, Germany 2 Université Libre de Bruxelles, Evolutionary Biology & Ecology group, Avenue F.D. Roosevelt 50, B-1050 Brussels, Belgium 3 Musée National d'Histoire Naturelle Luxembourg, 25 Rue Munster, 2160 Luxembourg, Luxembourg Corresponding author: Alexander M. Weigand ([email protected]) Academic editor: O. T. Moldovan | Received 20 November 2019 | Accepted 20 January 2020 | Published 13 February 2020 http://zoobank.org/78CFBE17-0918-455A-8813-C92324DBFCFE Citation: Grabner D, Weber D, Weigand AM (2020) Updates to the sporadic knowledge on microsporidian infections in groundwater amphipods (Crustacea, Amphipoda, Niphargidae). Subterranean Biology 33: 71–85. https://doi. org/10.3897/subtbiol.33.48633 Abstract A set of 69 specimens from 19 groundwater species of the genera Niphargus, Niphargellus, Microniphargus and Crangonyx was genetically screened for microsporidian infections. Samples mostly originated from groundwater-dependent spring environments (71%), natural caves (9%) and artificial caverns/tunnels (13%). Amphipod hosts were identified by morphology and/or molecular data, whereas microsporidian parasites were characterised by a genetic screening assay targeting a section of the small subunit rRNA gene. Five microsporidian species (Dictyocoela duebenum; Nosema sp.; Hyperspora aquatica and two unde- scribed Microsporidium spp.) were revealed from 13 host specimens (Niphargus schellenbergi; N.
    [Show full text]
  • Discovery of Subterranean Amphipod Niphargus Stygius (Schiodte, 1847)
    NATURA SLOVENIAE 21(1): 57-59 Prejeto / Received: 6. 8. 2019 FIELD NOTE Sprejeto / Accepted: 8. 8. 2019 Discovery of subterranean dvorana«. As the second author tried to drink the water from the water puddles, he noticed its amphipod Niphargus stygius unusually sour and salty taste. We found and (Schiødte, 1847) (Amphipoda: collected one amphipod in one of the puddles filled with dripping water, and a sample of water was Niphargidae) in a cave drip taken directly from the drip. We measured abiotic pool with increased salinity parameters of the water in the lab on the same day, when returning to the lab of the Department Najdba slepe postranice Niphargus of Biology in Ljubljana, using portable multimeter CyberScan PCD650 (Eutech Instruments). The stygius (Schiødte, 1847) (Amphipoda: specific electric conductivity and salinity level were Niphargidae) v jamski luži prenikle increased (Tab. 1) compared to normal values for vode s povečano slanostjo freshwater, having salinity less than 0.5 ‰ (Venice system 1958). Maja ZAGMAJSTER, Teo DELIĆ, SubBioLab, Department of Biology, Biotechnical We repeated the visit two weeks later, on Faculty, University of Ljubljana, Jamnikarjeva 9. 3. 2012, when we checked only the Northern 101, Ljubljana; branch up to app. 600 m from the entrance, to the E-mail: [email protected] lake in »Skalni rov«. This time, there was no active water drip in »Podorna dvorana«, but the water With more than 430 species currently described, remained in puddles on the cave floor. We the subterranean genus Niphargus is the species collected the water from two different puddles, richest genus of amphipods (Fišer 2019).
    [Show full text]
  • Environmental DNA Reveals That Rivers Are Conveyer Belts of Biodiversity Information
    bioRxiv preprint doi: https://doi.org/10.1101/020800; this version posted June 11, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Environmental DNA reveals that rivers are conveyer belts of biodiversity information 2 Kristy Deiner1*, Emanuel A. Fronhofer1,2, Elvira Mächler1 and Florian Altermatt1,2 3 1 Eawag: Swiss Federal Institute of Aquatic Science and Technology, Department of Aquatic 4 Ecology, Überlandstrasse 133, CH-8600 Dübendorf, Switzerland. 5 2 Institute of Evolutionary Biology and Environmental Studies, University of Zurich, 6 Winterthurerstrasse 190, CH-8057 Zürich, Switzerland. 7 Running title: Rivers are conveyer belts of eDNA 8 Keywords: eDNA transport, metabarcoding, COI, river networks, community sampling, land 9 water interface, macroinvertebrates, biomonitoring 10 Type of Article: Letters 11 Abstract: 147 12 Main text: 4879 13 Text box: 360 14 Number of references: 50 15 Number of figures: 5 16 Number of tables: 1 17 *Corresponding author K. Deiner: Ph. +41 (0)58 765 67 35; [email protected] bioRxiv preprint doi: https://doi.org/10.1101/020800; this version posted June 11, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 18 Abstract (150 max) 19 DNA sampled from the environment (eDNA) is becoming a game changer for uncovering 20 biodiversity patterns.
    [Show full text]
  • On Some Species of the Families Niphargidae and Gammaridae from Croatia and Bosnia and Herzegovina (Contribution to the Knowledge of The27 Amphipoda 283)
    On some species of the families Niphargidae and Gammaridae from Croatia and Bosnia and Herzegovina (Contribution to the knowledge of the27 Amphipoda 283) ЦРНОГОРСКА АКАДЕМИЈА НАУКА И УМЈЕТНОСТИ ГЛАСНИК ОДЈЕЉЕЊА ПРИРОДНИХ НАУКА, 21, 2016. ЧЕРНОГОРСКАЯ АКАДЕМИЯ НАУК И ИСКУССТВ ГЛАСНИК ОТДЕЛЕНИЯ ЕСТЕСТВЕННЫХ НАУК, 21, 2016 THE MONTENEGRIN ACADEMY OF SCIENCES AND ARTS PROCEEDINGS OF THE SECTION OF NATURAL SCIENCES, 21, 2016. UDK 595.3(497.5) UDK 595.3(497.6) Gordan S. Karaman* ON SOME SPECIES OF THE FAMILIES NIPHARGIDAE AND GAMMARIDAE FROM CROATIA AND BOSNIA AND HERZEGOVINA (Contribution to the knowledge of the Amphipoda 283) Abstract New data of the genus Niphargus Schiödte, 1849 (Amphipoda, Niphargidae) from Croatia are presented. Niphargus radzai G. Kar., 2014, known from Ravno Vrdovo on Dinara Mt., is discovered in Mareljina Jama Cave near Golubinka Cave, Biteljić Donji (Croatia), and some new data of this species are presented. The new subspecies Niphargus zagorae sterilis, ssp. n. from four caves in Vr- dovo region (Croatia) is described and figured, and its relation to the nominal sub- species, N. zagorae zagorae Švara et al., 2015 is discussed. New data of the Gammarus balcanicus Schäferna, 1922 and Echinogammarus veneris (Heller, 1865) (Amphipoda, Gammaridae) from Croatia and Bosnia and Herzegovina are given. Keywords: taxonomy, Amphipoda, Niphargus radzai sterilis, new, Gammarus balcanicus, Echinogammarus veneris, Croatia, Bosnia and Herzegovina O NEKIM VRSTAMA FAMILIJA NIPHARGIDAE I GAMMARIDAE IZ HRVATSKE I BOSNE I HERCEGOVINE (283. Prilog poznavanju Amphipoda) Sažetak Prezentirani su novi podaci o rodu Niphargus Schiödte, 1849 (Amphipoda, Nip- hargidae) iz Hrvatske: Niphargus radzai G. Kar., 2014, poznat iz lokaliteta Ravno * Gordan S.
    [Show full text]
  • First Observations on the Phylogeny of the Families Gammaridae
    J N H, 2003, 37, 20, 2461–2486 First observations on the phylogeny of the families Gammaridae, Crangonyctidae, Melitidae, Niphargidae, Megaluropidae and Oedicerotidae (Amphipoda, Crustacea), using small subunit rDNA gene sequences ULRIKE ENGLISCH†‡, CHARLES OLIVER COLEMAN‡ and JOHANN WOLFGANG WA¨ GELE‡ †Lehrstuhl fu¨r Spezielle Zoologie, Ruhr-Universita¨t Bochum, 44780 Bochum, Germany; e-mail: [email protected] ‡Humboldt-Universita¨t zu Belrin, Museum fu¨r Naturkunde, Institut fu¨r Systematische Zoologie, 10099 Berlin, Germany (Accepted 21 February 2002) This study examines amphipod phylogeny based on small subunit (18S) rDNA sequence data. Complete sequences of 25 species representing six families were used to test the phylogenetic information content of this gene for reconstruction of amphipod phylogeny. The alignment proved to be informative for most of the studied taxa. The monophyly of the families Gammaridae, Crangonyctidae, Niphargidae and Oedicerotidae is supported. The Melitidae are not monophyletic in the reconstructed topologies, but weak molecular evidence for the monophyly of this group could be observed in spectra of supporting positions. A close relationship of Gammaridae+Melitidae or Gammaridae+Crangonyctidae is not supported, rather there are supporting positions for the incompatible sister-group relationship (Gammaridae+Niphargidae) and (Crangonyctidae+Niphargidae). The molecular evidence is in favour of the latter relationship. The evolution of cephalothoracic apodemes is discussed in the light of other phylogenetic hypotheses resulting from molecular data. K: rDNA, Crustacea, Amphipoda, molecular phylogeny, parsimony, maximum likelihood, Physid. Introduction During the last decade considerable advances concerning the taxonomy of amphi- pods have been achieved (Barnard and Karaman, 1991). Nevertheless, the phylogen- etic position of the major amphipod taxa is controversial.
    [Show full text]
  • The Description of a New Species of Niphargus from Iran Based On
    A peer-reviewed open-access journal Subterranean Biology 22: 43–58The (2017) description of a new species of Niphargus from Iran... 43 doi: 10.3897/subtbiol.22.11286 RESEARCH ARTICLE Subterranean Published by http://subtbiol.pensoft.net The International Society Biology for Subterranean Biology The description of a new species of Niphargus from Iran based on morphological and molecular data Somayeh Esmaeili-Rineh1, Seyyed Ahmad Mirghaffari1, Mozafar Sharifi1 1 Department of Biology, Faculty of Science, Razi University, Kermanshah, Iran Corresponding author: Somayeh Esmaeili-Rineh ([email protected]) Academic editor: O. Moldovan | Received 22 November 2016 | Accepted 9 March 2017 | Published 7 April 2017 http://zoobank.org/ECD4760E-078B-47BE-81FB-9A5390AF045F Citation: Esmaeili-Rineh S, Mirghaffari SA, Sharifi M (2017) The description of a new species Niphargusof from Iran based on morphological and molecular data. Subterranean Biology 22: 43–58. https://doi.org/10.3897/subtbiol.22.11286 Abstract The freshwater amphipods of the genusNiphargus Schiödte, 1849 are widespread in subterranean wa- ters of the western Palearctic. The eastern half of the genus range has been incompletely studied despite the presence of karstic areas and large aquifers. In this paper, we describe a new species from Hamedan Province in Iran and name it as N. hakani sp. n. This species hypothesis is based on the analysis of mor- phological characters and 28S ribosomal DNA sequences. The taxonomic status of the new species within the genus is discussed in comparison to the known Iranian species. Results revealed that this species is phylogenetically close to N. khwarizmi and is morphologically similar to N.
    [Show full text]
  • Amphipod Newsletter 44 2020
    AMPHIPOD NEWSLETTER 44 2020 BIBLIOGRAPHY “THE OLD PHOTO” JEAN-CLAUDE SORBE VADIM V. TAKHTEEV PAGE 11 PAGE 65 IN MEMORIAM IN MEMORIAM PAGE 2 PAGE 6 ICA 19 PAGE 64 AMPHIPOD NEWSLETTER 44 Dear Amphipodologists, We hope this newsletter finds of you safe and healthy. The time since many of us last met in Dijon for a wonderful week of amphipodology has been difficult and heartbreaking. Many of us have also been sent into isolation Statistics from and “home-officing”, and the daily contact with our colleagues is now more than ever depending on emails and electronic platforms for contact. this Newsletter Conferences and meetings are rapidly being moved to electronic platforms 4 new higher taxa or postponed, the latter being the case for our beloved ICA, see more about that on page 64. 7 new families We are happy to see that the facebook group is active, and our bibliography 3 new subfamilies might give indication that, for some of us, the time away from the lab has 19 new genera brought about the possibility to focus on writing. Writing publications is not an easy task when combined with homeschooling or care for family- 92 new species members and neighbours “locked up” in their homes, and we are very impressed with the 397 publications the bibliography presents. Also, make sure to check out the last page for a new feature: “the old photo”. We hope this will bring happy memories to some, and pleasure to all. 2020 has also seen the debate of scientific recognition (in the form of impact factor) for one of the journals several of our taxonomy-oriented colleagues are using - Zootaxa.
    [Show full text]
  • Global Diversity of Amphipods (Amphipoda; Crustacea) in Freshwater
    Hydrobiologia (2008) 595:241–255 DOI 10.1007/s10750-007-9020-6 FRESHWATER ANIMAL DIVERSITY ASSESSMENT Global diversity of amphipods (Amphipoda; Crustacea) in freshwater R. Va¨ino¨la¨ Æ J. D. S. Witt Æ M. Grabowski Æ J. H. Bradbury Æ K. Jazdzewski Æ B. Sket Ó Springer Science+Business Media B.V. 2007 Abstract Amphipods are brooding peracaridan abundant in cool and temperate environments; they crustaceans whose young undergo direct develop- are particularly diversified in subterranean environ- ment, with no independent larval dispersal stage. ments and in running waters (fragmented habitats), Most species are epibenthic, benthic, or subterranean. and in temperate ancient lakes, but are notably rare in There are some 1,870 amphipod species and subspe- the tropics. Of the described freshwater taxa 70% are cies recognized from fresh or inland waters world- Palearctic, 13% Nearctic, 7% Neotropical, 6% Aus- wide at the end of 2005. This accounts for 20% of the tralasian and 3% Afrotropical. Approximately 45% of total known amphipod diversity. The actual diversity the taxa are subterranean; subterranean diversity is may still be several-fold. Amphipods are most highest in the karst landscapes of Central and Southern Europe (e.g., Niphargidae), North America (Crangonyctidae), and Australia (Paramelitidae). The Guest editors: E. V. Balian, C. Le´veˆque, H. Segers and K. Martens majority of Palearctic epigean amphipods are in the Freshwater Animal Diversity Assessment superfamily Gammaroidea, whereas talitroid amphi- pods (Hyalella) account for all Neotropic and much R. Va¨ino¨la¨ (&) of the Nearctic epigean fauna. Major concentrations Finnish Museum of Natural History, University of of endemic species diversity occur in Southern Helsinki, POB 17, 00014 Helsinki, Finland e-mail: risto.vainola@helsinki.fi Europe, Lake Baikal, the Ponto-Caspian basin, Southern Australia (including Tasmania), and the J.
    [Show full text]