Identification and Molecular Survey of Borrelia

Acta Tropica 166 (2017) 54–57

Contents lists available at ScienceDirect

Acta Tropica

jo urnal homepage: www.elsevier.com/locate/actatropica

Identiﬁcation and molecular survey of Borrelia burgdorferi sensu lato

in sika deer (Cervus nippon) from Jilin Province, north-eastern China

a,b b,∗∗ b b b b,c

Bintao Zhai , Qingli Niu , Jifei Yang , Zhijie Liu , Junlong Liu , Hong Yin , a,∗

Qiaoying Zeng

The College of Veterinary Medicine, Gansu Agricultural University, Lanzhou 730070, PR China

State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research

Institute, Chinese Academy of Agricultural Sciences, Xujiaping 1, Lanzhou, Gansu 730046, PR China

Jiangsu Co-Innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou 225009, PR China

a r t i c l e i n f o a b s t r a c t

Article history: Lyme disease caused by Borrelia burgdorferi sensu lato (s.l.) is a common disease of domestic animals and

Received 19 September 2016

wildlife worldwide. Sika deer is ﬁrst-grade state-protected wildlife animals in China and have economic

Received in revised form 17 October 2016

consequences for humans. It is reported that sika deer may serve as an important reservoir host for several

Accepted 1 November 2016

species of B. burgdorferi s.l. and may transmit these species to humans and animals. However, little is

Available online 3 November 2016

known about the presence of Borrelia pathogens in sika deer in China. In this study, the existence and

prevalence of Borrelia sp. in sika deer from four regions of Jilin Province in China was assessed. Seventy-

Keywords:

one blood samples of sika deer were collected and tested by nested-PCRs based on 16S ribosomal RNA

Borrelia burgdorferi sensu lato

(16S rRNA), outer surface protein A (OspA), ﬂagenllin (ﬂa), and 5S-23S rRNA intergenic spacer (5S-23S

Sika deer

Identiﬁcation rRNA) genes of B. burgdorferi s.l. Six (8.45%) samples were positive for Borrelia sp. based on sequences of

Survey 4 genes. The positive samples were detected 18 for 16S rRNA, 10 for OspA, 16 for ﬂa and 6 for 5S-23S,

with the positive rates 25.35% (95% CI = 3.8–35.6), 14.08% (95% CI = 3.0–21.6), 22.54% (95% CI = 4.3–36.9)

and 8.45% (95% CI = 1.7–22.9), respectively. Sequence analysis of the positive PCR products revealed that

the partial 4 genes sequences in this study were all most similar to the sequences of B. garinii and B.

burgdorferi sensu stricto (s.s.), no other Borrelia genospecies were found. This is the ﬁrst report of Borrelia

pathogens in sika deer in China. The ﬁndings in this study indicated that sika deer as potential natural

host and may spread Lyme disease pathogen to animals, ticks, and even humans.

1. Introduction ease (Wang et al., 1999; Situm et al., 2000). To date, at least 20

genotypes of B. burgdorferi s.l. have been reported around the world

Lyme disease (LD) is the most prevalent vector-borne disease in (Baranton and De Martino, 2009; Ivanova et al., 2014). B. burgdor-

Europe, North America, and Asia, with an increasing annual inci- feri s.s. is mainly found in Europe and North America. B. afzelii and

dence and geographic range (Bacon et al., 2008). More than 70 B. garinii are mainly found in Europe and Asia. B. burgdorferi s.l.

countries have reported cases of LD (Xie et al., 2015). LD is caused by is primarily distributed in northern China. B. garinii and B. afzelii

bacteria spirochete, B. burgdorferi s.l., transmitted to humans most are distributed in north-eastern and north-western China, and B.

commonly through Ixodes tick vectors, causing a multi-system dis- burgdorferi s.s. in southern China with low prevalence (Zhang et al.,

1997).

Since ﬁrst detection of B. burgdorferi from Hailin County, Hei-

longjiang Province, China in 1986, clinical cases and epidemiologic

∗

Corresponding author at: The College of Veterinary Medicine, Gansu Agricultural study demonstrated its sustaining till now (Ai et al., 1988). Sub-

University, Lanzhou, 730070, China. Tel.: +86 931 7631783; Fax: +86 931 7632858.

∗∗ sequently, Borrelia spirochete has been detected and isolated from

Corresponding author at: State Key Laboratory of Veterinary Etiological Biology,

humans, cattle, horses, sheep, dogs, mice, cats, and camels from 29

Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary

Provinces in China using aetiology and serology methods (Wang

Research Institute, Chinese Academy of Agricultural Sciences, Xujiaping 1, Lanzhou,

Gansu 730046, China. Tel.: +86 931 8354814; Fax: +86 931 8340977. et al., 2015).

E-mail addresses: [email protected] (B. Zhai), [email protected] (Q. Niu), The blacklegged tick (Ixodes scapularis) is one of the most

[email protected] (J. Yang), [email protected] (Z. Liu), [email protected] (J. Liu),

important tick-borne disease vectors, responsible for transmitting

[email protected] (H. Yin), [email protected] (Q. Zeng).

http://dx.doi.org/10.1016/j.actatropica.2016.11.002

B. Zhai et al. / Acta Tropica 166 (2017) 54–57 55

a variety of zoonosis to humans, including Lyme disease, human 2.5. Detection of Borrelia sp.

granulocytic anaplasmosis (HGA), and human babesiosis (Zolnik

et al., 2015). Not only do adult blacklegged ticks feed and mate A nested PCR-speciﬁc detection of B. burgdorferi s.l. DNA was

on deer, but the population of deer and tick maintains a positive performed using eight independent sets of primers as described

linear correlation (Moyer, 2015; Levi et al., 2012). When deer are in Table 1, targeting the16S rRNA gene, OspA gene, ﬂa gene, and

eliminated from some habitats by hunting or fencing, the abun- 5S-23S rRNA gene (Marconi and Garon, 1992; Zhang et al., 2014;

dance of ticks typically decreases. Many studies have reported that Postic et al., 1994; Guy and Stanek, 1991; Wodecka, 2007). The

B. burgdorferi s.l. could infect cervids, including white-tail deer speciﬁcity of these primers was tested using standard Borrelia sp.

(Odocoileus yirginianus), mule deer (Odocoileus hemionus), and sika genomic DNA samples, as well as other pathogens (Babesia, Theile-

deer mainly in the United States, Canada, Japan, and France (Chomel ria and Anaplasma), and these primers were then used to detect

et al., 1994; Levi et al., 2012; Nieto et al., 2012). The sika deer (Cervus ﬁeld blood samples of sika deer. PCR reactions were performed

nippon) is a ﬁrst-grade state-protected animal. There are less than in a DNA thermocycler (BioRad, Hercules, CA, USA), and the PCR

one thousand wild sika deer in China, and it is considered to be a conditions were the same as those reported previously (Marconi

highly endangered species. Little information is available about B. and Garon, 1992; Zhang et al., 2014; Postic et al., 1994; Guy and

burgdorferi s.l. infection in sika deer in China. Stanek, 1991; Wodecka, 2007). PCR products were separated by

Although it is well known that Ixodes ticks feed on deer species, 1% agarose gel electrophoresis, and the positive amplicons were

the role played by sika deer in the epidemiology of Lyme disease directly sequenced to single sequencing (GENEWIZ, Inc. Beijing

spirochetes and as a potential source for the spread of B. burgdor- China). The sequences obtained were compared aligned with pre-

feri in China is not completely understood (Lane et al., 1991; Wilson viously published sequences deposited in GenBank by using BLAST

et al., 1988). In the present study, blood samples of sika deer from (http:blast.ncbi.nim.nih.gov/blast.cgi), and the alignments of mul-

four farms in Jilin Province of China were analysed for B. burgdor- tiple sequences were executed in Florence Corpet (http://multalin.

feri s.l. infections using nested PCR assays. The potential risk of B. toulouse.inra.fr/multalin/).

burgdorferi infections in sika deer was assessed.

2.6. Statistical analysis

2. Materials and methods

The 95% conﬁdence intervals (95% CIs) for the overall prevalence

values of B. burgdorferi s.l. were calculated using IBM SPSS Statistics

2.1. Ethics statement

version 19.0.

This study was approved by the Animal Ethics Committee

of Lanzhou Veterinary Research Institute, Chinese Academy of 3. Results

Agriculture Sciences (NO. LVRIAEC2013-010). The sika deer were

handled in accordance with good animal practices as set by the DNA extracted from 71 blood samples from sika deer was sub-

Animal Ethics Procedures and Guidelines of China. jected to the nested PCRs, which is targeted the 16S rRNA, OspA, ﬂa,

and 5S-23S genes. According to the PCR results, in general, 6 sam-

ples were determined to be positive for B. burgdorferi s.l. infection,

2.2. B. burgdorferi s.l. strains with the average positive rate of 8.45% (6/71, 95% CI = 1.7–22.9).

The positive samples were detected 18 for 16S rRNA, 10 for OspA,

DNA from four standard B. garinii was provided by Dr. Fingerle 16 for ﬂa and 6 for 5S-23S, with the positive rates 25.35% (95%

(Nationales Referenzzentrum für Borrelien Max von Pettenkofer- CI = 3.8–35.6), 14.08% (95% CI = 3.0–21.6), 22.54% (95% CI = 4.3–36.9)

Institut, LMU München) in Germany. B. afzelii strain Bo23 and and 8.45% (95% CI = 1.7–22.9), respectively. At least one gene of B.

B. burgdorferi s.s. strain B31 were purchased from the American burgdorferi s.l. was detected in 6 (8.45%) blood samples out of the

Type Culture Collection (ATCC, Manassas, VA, USA), Manassas, USA. 71 examined (Table 2).

Strain B. garinii SZ was provided by Lanzhou Veterinary Research Sequence analysis of the positive PCR products based on these 4

Institute. (Baranton et al., 1992; Takada et al., 2001; Niu et al., 2010). genes in this study revealed that the sequences were most similar

to the sequences of B. garinii (based on the sequences of 16S rRNA,

ﬂa and 5S-23S genes) and B. burdorferi s.s. (based on the sequences

2.3. Sample collection

of 16S rRNA and OspA genes), no other Borrelia genospecies were

found.

During June and July 2015, when the peak activities of adult ticks

occur in north-eastern China. A total of 71 blood samples were col-

4. Discussion

lected from the jugular veins of domestic sika deer in Jilin Province

(13 from Dongfeng County of Liaoyuan City, 15 from Tonghua City,

China has a large population of sika deer. Since 1995,

9 from Shuangyang region of Changchun City and 34 from Zuojia

Jilin Province has established two core development zones in

town of Jilin City). The sika deer were bred in the semi-free range

◦

Shuangyang region of Changchun City and Dongfeng County of

system, of all samples were stored in tubes containing EDTA at 4 C

Liaoyuan City developing a domestic industry for sika deer. The

until DNA extraction.

herd number of sika deer in Shuangyang region was 195,000 in

2011, which accounts for 30% of the total deer in China (Jiang et al.,

2.4. Genomic DNA extraction 2012). In contrast, wild sika deer in China are not only ﬁrst-grade

state-protected animals, but are also highly endangered. There are

␮

Genomic DNA was extracted from 300 l blood using a commer- less than one thousand wild sika deer in China, and some sub-

cial kit (DNeasy Blood & Tissue Kit, Qiagen GmbH, Hilden, Germany) species have been deracinated, including Cervus nippon grassianus

according to the manufacturer’s instructions. The DNA concentra- and Cervus nippon hortulorum (Tan, 2011).

tion was determined with a NanoDrop 2000 spectrophotometer Previous studies have reported that B. burgdorferi s.l. could infect

(Nanodrop Technologies, Wilmington, DE, USA), and stored at cervids, including black-tailed deer infected with B. burgdorferi

− ◦

20 C until use. s.s. in California (Lane et al., 2005), sika and roe deer (Capreolus

56 B. Zhai et al. / Acta Tropica 166 (2017) 54–57

Table 1

Targets and sequences of the primers used in this study.

B. burgdorferi Primer Nucleotide sequence (5 -3 ) Annealing Amplicon size Reference

sensu lato target temperature (bp)

gene ( ◦C)

5S-23S 5S rRNA CGACCTTCTTCGCCTTAAAGC 57.6 412 Zhang et al. (2014) (rrf)

23S rRNA TAAGCTGACTAATACTAATTACCC

(rrl)

5S rRNA CTGCGAGTTCGCGGGAGA 57.3 253 Postic et al. (1994) (rrf)IN

23S rRNA TCCTAGGCATTCACCATA

(rrl)IN

OspA N1 GAGCTTAAAGGAACTTCTGATAA 52.5 561 Guy and Stanek (1991)

CI GTATTGTTGTACTGTAATTGT

N2 ATGGATCTGGAGTACTTGAA 53.0 352

C2 CTTAAAGTAACAGTTCCTTCT

ﬂa outerF TGGTATGGGAGTTTCTGG 53.3 774 Wodecka (2007)

outerR TCTGTCATTGTAGCATCTTT

innerF CAGACAACAGAGGGAAAT 54.7 604

innerR TCAAGTCTATTTTGGAAAGCACC

16S rRNA outerF GAGGCGAAGGCGAACTTCTG 60.2 622 This study

outerR CTAGCGATTCCAACTTCATGAAG

internalF GATGCACACTTGGTGTTAACT 57.0 354 Marconi and Garon

internalR GACTTATCACCGGCAGTCTTA (1992)

Table 2

Prevalence of B. burgdorferi s.l. in blood samples of sika deer from different regions in China assessed by the nested-PCRs.

site Sample No. of positive sample (%, 95% CI)

City County 16S OspA ﬂa 5S-23S At least one gene

Jilin Zuojia 34 8 (23.5, 4.3–39.5) 3 (8.82, 1.9–24.1) 4 (11.76,2.6–24.9) 1 (2.94, 0.1–16.2) 1 (2.94, 0.1–16.2)

Liaoyuan Dongfeng 13 3 (23.08,4.1–38.7) 2 (15.38, 3.2–28.1) 5 (38.46, 8.3–52.8) 1 (7.69, 1.5–20.9) 1 (7.69, 1.5–20.9)

Changchun Shuangyang 9 2 (22.22, 4.0–36.1) 2 (22.22, 4.0–36.1) 2 (22.22, 4.0–36.1) 2 (22.22, 4.0–36.1) 2 (22.22, 4.0–36.1)

Tonghua 15 5 (33.33, 7.1–45.9) 3 (20.00, 3.6–33.7) 5 (33.33, 7.1–45.9) 2 (13.33, 3.0–25.1) 2 (13.33, 3.0–25.1)

Total 71 18 (25.35, 5.2–40.6) 10 (14.08, 3.0–21.6) 16 (22.54, 4.3–36.9) 6 (8.45, 1.7–22.9) 6 (8.45, 1.7–22.9)

caprelous) infected with B. garinii in Japan and France (Bruno et al., In China, the I. persulcatus ticks are mainly distributed in

2000), roe deer infected with the Eurasian Lyme disease spirochete northwest (Xinjiang and Tibet Province) and northeast (Jilin,

in the Czech Republic (Hulinska et al., 2002), mule deer infected Heilongjiang and Liaoning Province) (Teng and Jiang, 1991). I.

with B. burgdorferi in California (Chomel et al., 1994), and North persulcatus ticks are the dominant tick species in Jilin Province,

American deer infected with B. bissettii (Lane et al., 2005). which is the major transmitting vector of Lyme disease and For-

In the present study, 8 primer sets, 2 sets for each gene, designed est encephalitis, the infected rate of these diseases could be up

to amplify 4 genes (16S, OspA, ﬂa, and 5S-23S) were used to detect to 46.0%. In general, the seasonal active regularity of I. persulcatus

the DNA of B. burgdorferi s.l. in wild blood samples of sika deer by varies with the change of temperature, the growth of its population

nested-PCRs. The detected results indicated that 6 positive sam- quantity was increased with the gradually increased temperature

ples for B. burgdorferi s.l. infection were found. This is the ﬁrst (Gao et al., 2007). The activity peek of ticks is usually between May

time to report the Borrelia pathogens infection of sika deer in China and July. In this study, the sika deer were bred in the semi-free

using nested-PCR assay based on 4 molecular markers. According range system, and the tested blood samples were collected during

to nested-PCRs result, the detection of DNA from 71 ﬁeld blood this period of time. Hence, we do not exclude the possibility that

samples by the primers targeting the 16S, OspA, ﬂa, and 5S-23S the detected sika deer have been biting by the existed tick species

genes revealed 18 (25.35%), 10 (14.08%), 16 (22.54%), and 6 (8.45%) in the collected locations, which these ticks have been carrying B.

positive samples, respectively. It is demonstrated that the primers burgdorferi s.l. pathogens and transmitted bacteria to the animals.

targeting the 16S and ﬂa genes, showed higher sensitivity than Moreover, previous study has indicated that the B. burgdorferi s.l.

that of the PCRs targeting for the OspA and 5S-23S genes. These strains were isolated from 229 I. persulcatus of 542 collected from

detected results using ﬂa gene were consistent with previous study Changchun City, the positive rate was more than 40%, which is the

by using the same molecular marker to detected the infection of B. ﬁrst time to report natural foci of Lyme disease in Changchun City.

burgdorferi s.l. in ﬁeld tick samples (Yang et al., 2012). The detected Moreover, the infected rate of B. burgdorferi s.l. in I. persulcatus ticks

sensitivity of these genes in our study was 16S >ﬂa >OspA >5S- was up to 40%-90% in other regions, including Tonghua City, Jilin

23S, while the sensitivity order in nested-PCRs is ﬂa > OspA> 16S City and Liaoyuan City (Gao et al., 2007). The distribution of Lyme

(rrs) > P66 in previous study (Yang et al., 2012). It is present that disease in Jilin Province has obviously geographical, including the

the ﬂa gene seem an ideal molecular marker using molecular sur- investigated regions of Tonghua City, Jilin City, Liaoyuan City and

vey for ﬁeld samples. In addition, the samples from different host, Changchun City, where are forest areas. Taken together, the sika

the detected results could be different, even though using the same deer were possible infected B. burgdorferi s.l. by biting of ticks car-

molecular and detected method, since the amount or concentra- ried Lyme disease pathogens in these forest areas. Furthermore, to

tion of DNA in different samples of host from variable regions exist our knowledge, many tick species have been reported to transmit

difference. the agents of Borrelia sp. to deer species, including I. persulcatus,

B. Zhai et al. / Acta Tropica 166 (2017) 54–57 57

I. scapularis, Dermacentor occidentalis, D. albipictus (Moyer, 2015; Ivanova, L.B., Tomova, A., González-Acuna,˜ D., Murúa, R., Moreno, C.X., Hernández,

C., Cabello, J., Cabello, C., Daniels, T.J., Godfrey, H.P., Cabello, F.C., 2014. Borrelia

Mays et al., 2014; Lane et al., 2005).

chilensis, a new member of the Borrelia burgdorferi sensu lato complex that

It has been reported that B. garinii is a dominant species among

extends the range of this genospecies in the Southern Hemisphere. Environ.

the B. burgdorferi s.l., and it has been demonstrated that Jilin Microbiol. 16, 1069–1080.

Jiang, Y.F., Li, F., Zhang, S.D., Cheng, W.J., Li, X.P., Yu, M., Liu, H.M., 2012. Current

Province, where is a natural focus of B. burgdorferi s.l. epidemiology

Situation and Prospects of sika deer industry in China. Shandong Agric. Sci. 44,

(Gao et al., 2007). Some species of cervidae are not only the host for

109–111 (In Chinese).

transmitting vector ticks infected with B. burgdorferi s.l., but could Lane, R.S., Piesman, J., Burgdorfer, W., 1991. Lyme borreliosis: relation of its

causative agent to its vectors and hosts in North America and Europe. Annu.

also be a direct host of B. burgdorferi s.l. (Chomel et al., 1994). Hence,

Rev. Entomol. 36, 587–609.

the risk of B. burgdorferi s.l. spreading to humans through contact

Lane, R.S., Mun, J., Parker, J.M., White, M., 2005. Columbian black-tailed deer

with sika deer products cannot exclude. (Odocoileus hemionus columbianus) as hosts for Borrelia spp. in northern

California. J. Wildl. Dis. 41, 115–125.

Levi, T., Kilpatrick, A.M., Mangel, M., Wilmers, C.C., 2012. Deer, predators, and the

5. Conclusions

emergence of Lyme disease. Proc. Natl. Acad. Sci. U. S. A. 109, 10942–10947.

Marconi, R.T., Garon, C.F., 1992. Development of polymerase chain reaction primer

To the best of our knowledge, this study is the first to demon- sets for diagnosis of Lyme disease and for species-specific identification of

Lyme disease isolates by 16S rRNA signature nucleotide analysis. J. Clin.

strate the prevalence of Borrelia sp. infection in sika deer in China.

Microbiol. 30, 2830–2834.

However, evidences of Borrelia pathogens transmission from deer

Mays, S.E., Hendricks, B.M., Paulsen, D.J., Houston, A.E., Trout, Fryxell.R.T., 2014.

to uninfected ticks is lacking. Hence, future work, including trans- Prevalence of ﬁve tick-borne bacterial genera in adult Ixodes scapularis

removed from white-tailed deer in western Tennessee. Parasit Vectors 22

mission experiments, isolation of Borrelia strains from sika deer or

(7:473).

ticks collected from sika deer should be performed to further con-

Moyer, M.W., 2015. The growing global battle against blood-sucking ticks. Nature

ﬁrm whether sika deer are vectors for Ixodes tick species. Moreover, 524, 406–408.

Nieto, N.C., Teglas, M.B., Stewart, K.M., Wasley, T., Wolff, P.L., 2012. Detection of

as described before, livestock can act as a maintenance host and

relapsing fever spirochetes (Borrelia hermsii and Borrelia coriaceae) in

transmit the disease to wildlife, or vice versa. Thus, conﬁrmation

free-ranging mule deer (Odocoileus hemionus) from Nevada: United States.

of the ability of B. burgdorferi s.l. isolated from sika deer to infect Vector Borne Zoonotic Dis. 12, 99–105.

Niu, Q., Yang, J., Guan, G., Fu, G., Ma, M., Li, Y., Liu, J., Liu, Z., Liu, A., Ren, Q., Hao, X.,

their original host is needed, hence helping with the control of the

Luo, J., Yin, H., 2010. Identiﬁcation and phylogenetic analysis of Lyme disease

disease in both livestock and wildlife.

Borrelia spp. isolated from Shangzhi Prefecture of Heilongjiang Province. Chin.

Vet. Sci. 40, 661–666.

Postic, D., Assous, M.V., Grimont, P.A., Baranton, G., 1994. Diversity of Borrelia

Competing interests

burgdorferi sensu lato evidenced by restriction fragment length polymorphism

of rrf (5S)-rrl (23S) intergenic spacer amplicons. Int. J. Syst. Bacteriol. 44,

The authors declare that they have no competing interests. 743–752.

Situm, M., Grahovac, B., Markovic,´ S., Lipozencic,´ J., Poje, G., Dobric,´ I., Marinovic,´ B.,

Bolanca-Bumber, S., Misic-Majerus,´ L., 2000. Detection and genotyping of

Acknowledgements

Borrelia burgdorferi sensu lato by polymerase chain reaction. Croat. Med. J. 41,

47–53.

Takada, N., Masuzawa, T., Ishiguro, F., Fujita, H., Kudeken, M., Mitani, H., Fukunaga,

This study was ﬁnancially supported by the NSFC (Nos.

M., Tsuchiya, K., Yano, Y., Ma, X.H., 2001. Lyme disease Borrelia spp. in ticks and

31502054 and 31471967), ASTIP, Creative Research Groups of

rodents from northwestern China. Appl. Environ. Microbiol. 67, 5161–5165.

Gansu Province (No. 1210RJIA006), NBCIS CARS-38, the Spe- Tan, B.J., 2011. Precious cervid family. Zhong guo xu mu xin xi wang. http://www.

cial Fund for Agro-scientiﬁc Research in Public Research (Nos. caaa.cn/show/newsarticle.php?ID=201113.

Teng, G.F., Jiang, Z.J., 1991. Ecnomic Insect Fauna of China. Fasc 39 Acari. Ixodidae

201303035 and 201303037), MOA, and the Jiangsu Co-innovation

Science Press, Beijing, pp. 50 (39).

Center Programme for the Prevention and Control of Important Ani-

Wang, G., van Dam, A.P., Schwartz, I., Dankert, J., 1999. Molecular typing of Borrelia

mal Infectious Diseases and Zoonoses as a State Key Laboratory of burgdorferi sensu lato: taxonomic, epidemiological, and clinical implications.

Clin. Microbiol Rev. 12, 633–653.

Veterinary Etiological Biology Project.

Wang, Y.Z., Mu, L.M., Zhang, K., Yang, M.H., Zhang, L., Du, J.Y., Liu, Z.Q., Li, Y.X., Lu,

W.H., Chen, C.F., Wang, Y., Chen, R.G., Xu, J., Yuan, L., Zhang, W.J., Zuo, W.Z.,

References Shao, R.F., 2015. A broad-range survey of ticks from livestock in Northern

Xinjiang: changes in tick distribution and the isolation of Borrelia burgdorferi

sensu stricto. Parasit Vectors 8, 449.

Ai, C.X., Wen, Y.X., Zhang, Y.G., Wang, S.S., Qiu, Q.C., Shi, Z.X., Chen, Z.Q., 1988.

Wilson, M.L., Telford S.R.3rd. Piesman, J., Spielman, A., 1988. Reduced abundance of

Clinical manifestations and epidemiological characteristics of Lyme disease in

immature Ixodes dammini (Acari: Ixodidae) following elimination of deer. J.

Hailin County Heilongjiang Province, China. Ann. N. Y. Acad. Sci. 539, 302–313.

Med. Entomol. 25, 224–228.

Bacon, R.M., Kugeler, K.J., Mead, P.S., 2006. Surveillance for lyme disease-United

Wodecka, B., 2007. Signiﬁcance of red deer (Cervus elaphus) in the ecology of

States, 1992–2006. MMWR Surveill. Summ. 57, 1–9.

Borrelia burgdorferi sensu lato. Wiad Parazytol. 53, 231–237.

Baranton, G., De Martino, S.J., 2009. Borrelia burgdorferi sensu lato diversity and its

Xie, C.Y., Liu, X.Q., Hu, G.L., 2015. Progress in epidemiological research of Lyme

inﬂuence on pathogenicity in humans. Curr. Probl. Dermatol. 37, 1–17.

disease. Mod. Preventive Med. 42, 9.

Baranton, G., Postic, D., Saint, Girons.I., Boerlin, P., Piffaretti, J.C., Assous, M.,

Yang, J., Liu, Z., Guan, G., Che, R., Niu, Q., Li, Y., Liu, J., Ma, M., Ren, Q., Liu, A., Luo, J.,

Grimont, P.A., 1992. Delineation of Borrelia burgdorferi sensu stricto, Borrelia

Yin, H., 2012. Evaluation of molecular methods for detection of Borrelia

garinii sp. nov., and group VS461 associated with Lyme borreliosis. Int. J. Syst.

burgdorferi senso lato in ticks. Diagn. Microbiol. Infect. Dis. 73, 80–83.

Bacteriol. 42, 378–383.

Zhang, Z.F., Wan, K.L., Zhang, J.S., Zhu, G.F., Dou, G.L., Li, M.Q., Zheng, L., Liang, J.G.,

Chomel, B.B., Carniciu, M.L., Kasten, R.W., Castelli, P.M., Work, T.M., Jessup, D.A.,

Hou, X.X., Wang, H.Y., 1997. Studies on epidemiology and etiology of Lyme

1994. Antibody prevalence of eight ruminant infectious diseases in California

disease in China. Chin. J. Epidemiol. 18, 1.

mule and black-tailed deer (Odocoileus hemionus). J. Wildl. Dis. 30, 51–59.

Zhang, L., Wang, Y., Chen, C., Li, Y., Zhang, K., Du, J., Zhang, Y., Che, Z., 2014.

Gao, L.Y., Wang, C.S., Yang, X.J., Du, Z.S., 2007. Studies on the ticks and its

Isolation of Borrelia burgdorferi in ixodes from four counties, in North Xinjiang.

transmission Lyme disease in Jilin Province. Chin. J. Hyg. Insect. Equip. 13, 1.

Chin. J. Epidemiol. 35, 262–265.

Guy, E.C., Stanek, G., 1991. Detection of Borrelia burgdorferi in patients with Lyme

Zolnik, C.P., Makkay, A.M., Falco, R.C., Daniels, T.J., 2015. American Black Bears as

disease by the polymerase chain reaction. J. Clin. Pathol. 44, 610–611.

Hosts of Blacklegged Ticks (Acari: Ixodidae) in the Northeastern United States. J.

Hulinska, D., Votypka, J., Plch, J., Vlcek, E., Valesová, M., Bojar, M., Hulinsky, V.,

Med. Entomol. 52, 1103–1110.

Smetana, K., 2002. Molecular and microscopical evidence of Ehrlichia spp. and

Borrelia burgdorferi sensu lato in patients, animals and ticks in the Czech

Republic. New Microbiol. 25, 437–448. 本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP 图书馆。图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页文献云下载图书馆入口外文数据库大全疑难文献辅助工具