DOCSLIB.ORG

Supplementary Data

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Data SUPPLEMENTARY DATA “The receptor tyrosine kinase EPHB4 has tumor suppressor activities in intestinal tumorigenesis “ SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1: Immunostaining with endothelial markers. Immunohistochemical staining against CD34 (A-B, C-D) or CD105 (C-D) did not show significant differences between control HT29 cells transfected with pEGFP-N2 and derivative cells transfected with dominant negative EPHB4C-EGFP (A-D) or small intestinal tumors from Apcmin/+ mice that are wild type or heterozygous for EphB4 (E-F). Arrowheads indicate blood vessels. Supplementary Figure 2: Number and location of goblet, Paneth and enteroendocrine cells. Staining with 1% Alcian blue was used to reveal goblet cells. Paneth cells were detected by immunostaining with a rabbit polyclonal anti-lysozyme antibody (Dako, CA; prediluted) after treatment with 10 mM citrate pH 6 for 20 min for antigen retrieval. Enteroendocrine cells were quantified after Grimelius staining as described before (Fernandez Pascual et al 1976 Stain Technol 51:231). No differences were observed in the number and location of small intestinal goblet cells (Alcian blue positive; A-B), Paneth cells (Lysozyme positive; C-D) or enteroendocrine cells (Grimelius staining positive; E-F) of Apcmin/+;EphB4+/- and Apcmin/+;EphB4+/+ mice (n=10 and 7, respectively). Supplementary Figure 3: Microarray data validation. Histogram A) shows the gene expression differences observed in Apcmin/+;EphB4+/+ and Apcmin/+;EphB4+/+ mice using microarray analysis and quantitative Real-Time RT-PCR. B) An excellent correlation was observed between gene expression assessments made with these two techniques (Pearson ’s R=0.99 and p=0.003). Theprimers used were EhBEphB4-F: CAACTGGATGAGAGCGAGAG; EphB4-R: GAGGCAGAGAACTGCAATGA; Igfpbp5-F: AAGCTTCCCTCCAGGAGTTC; Igfpbp5-R: GGAGGGCTTACACTGCTTTC; Mmp2-F: GGGTGGTGGTCATAGCTACTT; Mmp2-R: TTCCAAACTTCACGCTCTTG; Col5a2-F; CAAGACACCTGCTCTAAGCG; Col5a2-R: CCAACATCTATGATGGGCAA; and for 18S rRNA the sequence of the primers and the internal probe were 18S-rRNA-F: AGTCCCTGCCCTTTGTACACA, 18S-rRNA-R: GATCCGAGGGCCTCACTAAAC and 18S-rRNA-probe: FAM-CGCCCGTCGCTACTACCGATTGG-TAMRA. Supplementary Figure 4: EPHB4 levels and Wnt signaling. A-D) Immunohistochemical staining with an anti-catenin did not reveal any significant differences in the levels or localization of -catenin. E) The levels of activity of TCF4/- catenin were assessed using the TOP/FOP system as previously reported (Korinek et al 1997 Science 275:1784). Briefly, cells were transfected with a vector containing a three tandem repeat of a consensus TCF4/-catenin binding site or a mutated binding site driving the transcription of a Luciferase reporter gene. The pRL-TK plasmid was used to control for transfection efficiency. No differences were observed in catenin/TCF4 trascriptional activity in empty vector control HT29 cells (EV) and EPHB4 dominant negative transfectants (DN). 1 SUPPLEMENTARY FIGURE LEGENDS (cont.) Supplementary Figure 5: Expression of genes involved in the adenoma to carcinoma transition. Previous studies have identified these eight genes as key players in the transition from adenoma to carcinoma (34). The fold change in the expression of these genes is shown for intestinal carcinomas/adenomas in Apcmin/+ mice (grey bars) and in adenomas from Apcmin/+ mice that are wild type or heterozygous for EphB4 (back bars). The inset shows the correlation between these values. Supplementary Figure 6: Functional network of 60 out of 183 genes differentially expressed in Apcmin/+ mice that are wild type or heterozygous for EPHB4. This network graph represents genes as nodes and functional connections as links. Genes down-regulated (red nodes), genes coding for collagen (blue nodes), genes coding for proteinases (green nodes) and genes coding for growth factors (orange nodes) are highlighted. The larger red node corresponds to EphB4. 2 SupplementaryFigure1 ABAntiCD34 AntiCD34 HT29 HT29 pEGFPN2 pEPHB4C EGFP C AntiCD105D AntiCD105 HT29 HT29 pEGFPN2 pEPHB4C EGFP EFAntiCD34 AntiCD34 Apcmin/+;EphB4+/+ Apcmin/+;EphB4+/ 3 SupplementaryFigure2 A) Alcian Blue B) Alcian Blue EphB4+/+;Apcmin/+ EphB4+/-;Apcmin/+ C) Anti-Lysozyme D) Anti-Lysozyme EphB4+/+;Apcmin/+ EphB4+/-;Apcmin/+ E) Grimelius F) Grimelius Apcmin/+;EphB4+/+ Apcmin/+;EphB4+/- 4 SupplementaryFigure3 A) 16 qPCR 12 Array nge 8 4 Fold cha Fold 0 MMP2 Col5a2 EPHB4 IGFBP5 B) Pearson’s R=0.99 p=0.003 5 SupplementaryFigure4 -catenin/TCF4 activity (Relative Luc levels) 0 2 4 6 HT29- EV HT29- DN E) 6 SupplementaryFigure5 Fold change -20 -15 -10 10 -5 0 5 S100g EphB4 het/wt Carcinoma/adenoma Sprr2f Sox17 Myl9 -10 Fold EphB4 WT/HET Mcpt2 -5 -20 -15 -10 -5 5 Pearson R:0.96 Igfbp5 Fold A/C 5 p<0.003 Serpine2 10 7 SupplementaryFigure6 COLOR KEY 8 EphB4inintestinaltumorigenesis Dopesoetal Supplementary Table 1: Genes with fold difference greater than 2-fold in adenomas of Apcmin/+ mice that are wild type or heterozygous for EphB4. Meanfoldin probeset Gene Symbol Gene Name EphB4WTvs. HET 1448964_at S100g S100calciumbindingproteinG 6,07 1448194_a_at H19 H19fetallivermRNA 5,91 1417600_at Slc15a2 solutecarrierfamily15(H+/peptidetransporter), 5,62 member2 1416040_at Lipf lipase,gastric 3,77 1453645_at 2700046A07Rik RIKENcDNA2700046A07gene 3,27 1449833_at Sprr2f smallprolinerichprotein2F 3,18 1419118_at 2900093B09Rik RIKENcDNA2900093B09gene 2,92 1459309_at Rufy3 RUNandFYVEdomaincontaining3 2,83 1445104_at E230029C05Rik RIKENcDNAE230029C05gene 2,82 1423935_x_at Krt114 keratincomplex1,acidic,gene14 2,82 1438519_at Klhl24 kelchlike24(Drosophila) 2,76 1449254_at Spp1 secretedphosphoprotein1 2,63 1439351_at A930031D07Rik RIKENcDNAA930031D07gene 2,53 1442489_at D1Ertd564e DNAsegment,Chr1,ERATODoi564,expressed 2,45 1446693_at RRR RRR 2,43 1436780_at Ogt OlinkedNacetylglucosamine(GlcNAc)transferase 2,42 (UDPNacetylglucosamine:polypeptideNR acetylglucosaminyltransferase) 1438676_at Mpa2l macrophageactivation2like///similarto 2,34 macrophageactivation2like///similarto macrophageactivation2like 1450165_at Slfn2 schlafen2 2,33 1452787_a_at Prmt1 proteinarginineNmethyltransferase1 2,31 1449286_at Ntng1 netrinG1 2,24 1449488_at Pitx1 pairedlikehomeodomaintranscriptionfactor1 2,18 1447845_s_at Vnn1 vanin1 2,06 1423954_at C3 complementcomponent3 2,07 1416619_at 4632428N05Rik RIKENcDNA4632428N05gene 2,09 1448748_at Plek pleckstrin 2,11 1441972_at 6230424C14Rik RIKENcDNA6230424C14gene 2,12 1416778_at Sdpr serumdeprivationresponse 2,14 1424733_at P2ry14 purinergicreceptorP2Y,Gproteincoupled,14 2,14 1416980_at Mettl7b methyltransferaselike7B 2,15 1424600_at Abp1 amiloridebindingprotein1(amineoxidase,copper 2,15 containing) 1418739_at Sgk2 serum/glucocorticoidregulatedkinase2 2,16 9 EphB4inintestinaltumorigenesis Dopesoetal (Continued) Meanfoldin probeset Gene Symbol Gene Name EphB4WTvs. HET 1435137_s_at 1200015M12Rik RIKENcDNA1200015M12gene///RIKENcDNA 2,27 1200016E24gene///RIKENcDNAA130040M12 gene///RIKENcDNAE430024C06gene 1430927_at Ceacam18 CEArelatedcelladhesionmolecule1 2,31 1425102_a_at Ace2 angiotensinIconvertingenzyme(peptidyl 2,31 dipeptidaseA)2 1423489_at Mmd monocytetomacrophagedifferentiationassociated 2,32 1416905_at Guca2a guanylatecyclaseactivator2a(guanylin) 2,34 1427054_s_at Abi3bp ABIgenefamily,member3(NESH)bindingprotein 2,34 1418237_s_at Col18a1 procollagen,typeXVIII,alpha1 2,34 1448741_at Slc3a1 solutecarrierfamily3,member1 2,36 1450852_s_at F2r coagulationfactorII(thrombin)receptor 2,37 1419498_at Tmigd transmembraneandimmunoglobulindomain 2,39 containing 1448823_at Cxcl12 chemokine(CXCmotif)ligand12 2,39 1416454_s_at Acta2 actin,alpha2,smoothmuscle,aorta 2,41 1427137_at Ces5 carboxylesterase5 2,42 1457721_at AI118064 ExpressedsequenceAI118064 2,43 1428909_at A130040M12Rik RIKENcDNAA130040M12gene 2,48 1455454_at Akr1c19 aldoketoreductasefamily1,memberC19 2,50 1426497_at Jarid1c jumonji,ATrichinteractivedomain1C(Rbp2like) 2,52 1446368_at 9130221J18Rik RIKENcDNA9130221J18gene 2,55 1423025_a_at Schip1 schwannomininteractingprotein1 2,55 1419703_at Col5a3 procollagen,typeV,alpha3 2,55 1426511_at Susd2 sushidomaincontaining2 2,56 1424245_at Ces2 carboxylesterase2///similartocarboxylesterase2 2,57 1421134_at Areg amphiregulin 2,59 1416194_at Cyp4b1 cytochromeP450,family4,subfamilyb,polypeptide 2,59 1 1449453_at Bst1 bonemarrowstromalcellantigen1 2,61 1451547_at 0610009A07Rik RIKENcDNA0610009A07gene 2,62 1448485_at Ggt1 gammaglutamyltransferase1 2,62 1451481_s_at Osta organicsolutetransporteralpha 2,63 1456733_x_at Serpinh1 serine(orcysteine)peptidaseinhibitor,cladeH, 2,64 member1 1418278_at Apoc3 apolipoproteinCIII 2,67 1456768_a_at RRR RRR 2,68 1418723_at Edg7 endothelialdifferentiation,lysophosphatidicacidG 2,68 proteincoupledreceptor7 1421489_a_at 2010106E10Rik RIKENcDNA2010106E10gene 2,69 10 EphB4inintestinaltumorigenesis Dopesoetal (Continued) Meanfoldin probeset Gene Symbol Gene Name EphB4WTvs. HET 1417976_at Ada adenosinedeaminase 2,70 1424768_at Cald1 caldesmon1 2,74 1424114_s_at Lamb11 lamininB1subunit1 2,75 1448755_at Col15a1 procollagen,typeXV 2,78 1443746_x_at Dmp1 dentinmatrixprotein1 2,79 1450641_at Vim vimentin 2,81 1422134_at Fosb FBJosteosarcomaoncogeneB 2,82 1452035_at Col4a1 procollagen,typeIV,alpha1 2,82 1424265_at Npl Nacetylneuraminatepyruvatelyase 2,84 1418601_at Aldh1a7 aldehydedehydrogenasefamily1,subfamilyA7 2,85 1437726_x_at C1qb complementcomponent1,qsubcomponent,beta 2,85 polypeptide 1449094_at Gja7 gapjunctionmembranechannelproteinalpha7 2,85 1417903_at Dfna5h deafness,autosomaldominant5homolog(human) 2,85 1448499_a_at Ephx2 epoxidehydrolase2,cytoplasmic
Load more

Recommended publications
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Mesenchymal–Epithelial Interactions Involving Epiregulin in Tuberous Sclerosis Complex Hamartomas
    Mesenchymal–epithelial interactions involving epiregulin in tuberous sclerosis complex hamartomas Shaowei Li*, Fumiko Takeuchi*, Ji-an Wang*, Qingyuan Fan*, Toshi Komurasaki†, Eric M. Billings‡, Gustavo Pacheco-Rodriguez‡, Joel Moss‡, and Thomas N. Darling*§ *Department of Dermatology, Uniformed Services University of the Health Sciences, 4301 Jones Bridge Road, Bethesda, MD 20814-4712; †Molecular Biology Laboratory, Molecular and Pharmacology Laboratories, Taisho Pharmaceutical Co., Ltd., 430-1 Yoshino-cho, Saitma-shi, Saitama 331-9530, Japan; and ‡Translational Medicine Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Building 10, Room 6D05, MSC 1590, Bethesda, MD 20892-1590 Communicated by Martha Vaughan, National Institutes of Health, Bethesda, MD, December 31, 2007 (received for review November 30, 2007) Patients with tuberous sclerosis complex (TSC) develop hamarto- Like other hamartomas, those in TSC skin contain abnormal mas containing biallelic inactivating mutations in either TSC1 or numbers of several types of cells. In the dermis, there are TSC2, resulting in mammalian target of rapamycin (mTOR) activa- increased numbers of large stellate fibroblasts, capillaries, and tion. Hamartomas overgrow epithelial and mesenchymal cells in dermal dendritic cells (6–9). The epidermis is acanthotic (i.e., TSC skin. The pathogenetic mechanisms for these changes had not thickened from increased numbers of keratinocytes in the spi- been investigated, and the existence or location of cells with nous layer). Acanthosis is pronounced in PFs and variable in AFs biallelic mutations (‘‘two-hit’’ cells) was unclear. We compared TSC (7, 8). The epidermis of treated AFs, several months after argon skin hamartomas (angiofibromas and periungual fibromas) with or CO2 laser surgery, no longer appears acanthotic (10, 11).
    [Show full text]
  • 4 Transcription and Secretion Novel Regulator of Angiopoietin-Like Protein A
    Acute-Phase Protein α1-Antitrypsin−−A Novel Regulator of Angiopoietin-like Protein 4 Transcription and Secretion This information is current as Eileen Frenzel, Sabine Wrenger, Stephan Immenschuh, of September 28, 2021. Rembert Koczulla, Ravi Mahadeva, H. Joachim Deeg, Charles A. Dinarello, Tobias Welte, A. Mario Q. Marcondes and Sabina Janciauskiene J Immunol 2014; 192:5354-5362; Prepublished online 23 April 2014; Downloaded from doi: 10.4049/jimmunol.1400378 http://www.jimmunol.org/content/192/11/5354 Supplementary http://www.jimmunol.org/content/suppl/2014/04/23/jimmunol.140037 http://www.jimmunol.org/ Material 8.DCSupplemental References This article cites 56 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/192/11/5354.full#ref-list-1 Why The JI? Submit online. by guest on September 28, 2021 • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2014 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Acute-Phase Protein a1-Antitrypsin—A Novel Regulator of Angiopoietin-like Protein 4 Transcription and Secretion Eileen Frenzel,* Sabine Wrenger,* Stephan Immenschuh,† Rembert Koczulla,‡ Ravi Mahadeva,x H.
    [Show full text]
  • An Investigation of ADAM-Like Decysin 1 in Macrophage-Mediated Inflammation and Crohn’S Disease
    An Investigation of ADAM-like Decysin 1 in Macrophage-mediated Inflammation and Crohn’s Disease By Nuala Roisin O’Shea A thesis submitted to UCL for the degree of Doctor of Philosophy Division of Medicine Declaration I, Nuala Roisin O’Shea, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. 2 Abstract Crohn’s disease (CD) is now recognised as a defective host response to bacteria in genetically susceptible individuals. The role of innate immunity and impaired bacterial clearance are widely accepted. In this thesis the role of ADAM-like, Decysin-1 (ADAMDEC1) in macrophage-mediated inflammation and gut mucosal immunity is explored. Using transcriptomic analysis of monocyte derived macrophages (MDM) ADAMDEC1 was identified as grossly under expressed in a subset of patients with CD. ADAMDEC1 was found to be highly selective to the intestine, peripheral blood monocyte-derived and lamina propria macrophages. It was shown to be an inflammatory response gene, upregulated in response to bacterial antigens and inflammation. ADAMDEC1 was expressed in prenatal and germ free mice, demonstrating exposure to a bacterial antigen is not a prerequisite for expression. Adamdec1 knock out mice were used to investigate the role of ADAMDEC1 in vivo. Adamdec1-/- mice displayed an increased susceptibility to dextran sodium sulphate (DSS), Citrobacter rodentium and Salmonella typhimurium induced colitis. In Adamdec1-/- mice, bacterial translocation and systemic infection were increased in bacterial models of colitis. These results suggest that individuals with grossly attenuated expression of ADAMDEC1 may be at an increased risk of developing intestinal inflammation as a consequence of an impaired ability to handle enteric bacterial pathogens.
    [Show full text]
  • Functional Analysis of Somatic Mutations Affecting Receptor Tyrosine Kinase Family in Metastatic Colorectal Cancer
    Author Manuscript Published OnlineFirst on March 29, 2019; DOI: 10.1158/1535-7163.MCT-18-0582 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Functional analysis of somatic mutations affecting receptor tyrosine kinase family in metastatic colorectal cancer Leslie Duplaquet1, Martin Figeac2, Frédéric Leprêtre2, Charline Frandemiche3,4, Céline Villenet2, Shéhérazade Sebda2, Nasrin Sarafan-Vasseur5, Mélanie Bénozène1, Audrey Vinchent1, Gautier Goormachtigh1, Laurence Wicquart6, Nathalie Rousseau3, Ludivine Beaussire5, Stéphanie Truant7, Pierre Michel8, Jean-Christophe Sabourin9, Françoise Galateau-Sallé10, Marie-Christine Copin1,6, Gérard Zalcman11, Yvan De Launoit1, Véronique Fafeur1 and David Tulasne1 1 Univ. Lille, CNRS, Institut Pasteur de Lille, UMR 8161 - M3T – Mechanisms of Tumorigenesis and Target Therapies, F-59000 Lille, France. 2 Univ. Lille, Plateau de génomique fonctionnelle et structurale, CHU Lille, F-59000 Lille, France 3 TCBN - Tumorothèque Caen Basse-Normandie, F-14000 Caen, France. 4 Réseau Régional de Cancérologie – OncoBasseNormandie – F14000 Caen – France. 5 Normandie Univ, UNIROUEN, Inserm U1245, IRON group, Rouen University Hospital, Normandy Centre for Genomic and Personalized Medicine, F-76000 Rouen, France. 6 Tumorothèque du C2RC de Lille, F-59037 Lille, France. 7 Department of Digestive Surgery and Transplantation, CHU Lille, Univ Lille, 2 Avenue Oscar Lambret, 59037, Lille Cedex, France. 8 Department of hepato-gastroenterology, Rouen University Hospital, Normandie Univ, UNIROUEN, Inserm U1245, IRON group, F-76000 Rouen, France. 9 Department of Pathology, Normandy University, INSERM 1245, Rouen University Hospital, F 76 000 Rouen, France. 10 Department of Pathology, MESOPATH-MESOBANK, Centre León Bérard, Lyon, France. 11 Thoracic Oncology Department, CIC1425/CLIP2 Paris-Nord, Hôpital Bichat-Claude Bernard, Paris, France.
    [Show full text]
  • HCC and Cancer Mutated Genes Summarized in the Literature Gene Symbol Gene Name References*
    HCC and cancer mutated genes summarized in the literature Gene symbol Gene name References* A2M Alpha-2-macroglobulin (4) ABL1 c-abl oncogene 1, receptor tyrosine kinase (4,5,22) ACBD7 Acyl-Coenzyme A binding domain containing 7 (23) ACTL6A Actin-like 6A (4,5) ACTL6B Actin-like 6B (4) ACVR1B Activin A receptor, type IB (21,22) ACVR2A Activin A receptor, type IIA (4,21) ADAM10 ADAM metallopeptidase domain 10 (5) ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 (4) ADCY2 Adenylate cyclase 2 (brain) (26) AJUBA Ajuba LIM protein (21) AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 (4) Akt AKT serine/threonine kinase (28) AKT1 v-akt murine thymoma viral oncogene homolog 1 (5,21,22) AKT2 v-akt murine thymoma viral oncogene homolog 2 (4) ALB Albumin (4) ALK Anaplastic lymphoma receptor tyrosine kinase (22) AMPH Amphiphysin (24) ANK3 Ankyrin 3, node of Ranvier (ankyrin G) (4) ANKRD12 Ankyrin repeat domain 12 (4) ANO1 Anoctamin 1, calcium activated chloride channel (4) APC Adenomatous polyposis coli (4,5,21,22,25,28) APOB Apolipoprotein B [including Ag(x) antigen] (4) AR Androgen receptor (5,21-23) ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (4) ARHGAP35 Rho GTPase activating protein 35 (21) ARID1A AT rich interactive domain 1A (SWI-like) (4,5,21,22,24,25,27,28) ARID1B AT rich interactive domain 1B (SWI1-like) (4,5,22) ARID2 AT rich interactive domain 2 (ARID, RFX-like) (4,5,22,24,25,27,28) ARID4A AT rich interactive domain 4A (RBP1-like) (28) ARID5B AT rich interactive domain 5B (MRF1-like) (21) ASPM Asp (abnormal
    [Show full text]
  • Proteomic Analysis of Human Osteoarthritis Synovial Fluid
    Balakrishnan et al. Clinical Proteomics 2014, 11:6 http://www.clinicalproteomicsjournal.com/content/11/1/6 CLINICAL PROTEOMICS RESEARCH Open Access Proteomic analysis of human osteoarthritis synovial fluid Lavanya Balakrishnan1,2, Raja Sekhar Nirujogi1,3, Sartaj Ahmad1,4, Mitali Bhattacharjee1,5, Srikanth S Manda1,3, Santosh Renuse1,5, Dhanashree S Kelkar1,5, Yashwanth Subbannayya1,6, Rajesh Raju1, Renu Goel1,2, Joji Kurian Thomas1,5, Navjyot Kaur7, Mukesh Dhillon7, Shantal Gupta Tankala7, Ramesh Jois8, Vivek Vasdev9, YL Ramachandra2, Nandini A Sahasrabuddhe1, TS Keshava Prasad1,3,4, Sujatha Mohan10, Harsha Gowda1, Subramanian Shankar7* and Akhilesh Pandey11,12,13,14* Abstract Background: Osteoarthritis is a chronic musculoskeletal disorder characterized mainly by progressive degradation of the hyaline cartilage. Patients with osteoarthritis often postpone seeking medical help, which results in the diagnosis being made at an advanced stage of cartilage destruction. Sustained efforts are needed to identify specific markers that might help in early diagnosis, monitoring disease progression and in improving therapeutic outcomes. We employed a multipronged proteomic approach, which included multiple fractionation strategies followed by high resolution mass spectrometry analysis to explore the proteome of synovial fluid obtained from osteoarthritis patients. In addition to the total proteome, we also enriched glycoproteins from synovial fluid using lectin affinity chromatography. Results: We identified 677 proteins from synovial fluid of patients
    [Show full text]
  • Inflammatory Modulation of Hematopoietic Stem Cells by Magnetic Resonance Imaging
    Electronic Supplementary Material (ESI) for RSC Advances. This journal is © The Royal Society of Chemistry 2014 Inflammatory modulation of hematopoietic stem cells by Magnetic Resonance Imaging (MRI)-detectable nanoparticles Sezin Aday1,2*, Jose Paiva1,2*, Susana Sousa2, Renata S.M. Gomes3, Susana Pedreiro4, Po-Wah So5, Carolyn Ann Carr6, Lowri Cochlin7, Ana Catarina Gomes2, Artur Paiva4, Lino Ferreira1,2 1CNC-Center for Neurosciences and Cell Biology, University of Coimbra, Coimbra, Portugal, 2Biocant, Biotechnology Innovation Center, Cantanhede, Portugal, 3King’s BHF Centre of Excellence, Cardiovascular Proteomics, King’s College London, London, UK, 4Centro de Histocompatibilidade do Centro, Coimbra, Portugal, 5Department of Neuroimaging, Institute of Psychiatry, King's College London, London, UK, 6Cardiac Metabolism Research Group, Department of Physiology, Anatomy & Genetics, University of Oxford, UK, 7PulseTeq Limited, Chobham, Surrey, UK. *These authors contributed equally to this work. #Correspondence to Lino Ferreira ([email protected]). Experimental Section Preparation and characterization of NP210-PFCE. PLGA (Resomers 502 H; 50:50 lactic acid: glycolic acid) (Boehringer Ingelheim) was covalently conjugated to fluoresceinamine (Sigma- Aldrich) according to a protocol reported elsewhere1. NPs were prepared by dissolving PLGA (100 mg) in a solution of propylene carbonate (5 mL, Sigma). PLGA solution was mixed with perfluoro- 15-crown-5-ether (PFCE) (178 mg) (Fluorochem, UK) dissolved in trifluoroethanol (1 mL, Sigma). This solution was then added to a PVA solution (10 mL, 1% w/v in water) dropwise and stirred for 3 h. The NPs were then transferred to a dialysis membrane and dialysed (MWCO of 50 kDa, Spectrum Labs) against distilled water before freeze-drying. Then, NPs were coated with protamine sulfate (PS).
    [Show full text]
  • Development and Validation of a Protein-Based Risk Score for Cardiovascular Outcomes Among Patients with Stable Coronary Heart Disease
    Supplementary Online Content Ganz P, Heidecker B, Hveem K, et al. Development and validation of a protein-based risk score for cardiovascular outcomes among patients with stable coronary heart disease. JAMA. doi: 10.1001/jama.2016.5951 eTable 1. List of 1130 Proteins Measured by Somalogic’s Modified Aptamer-Based Proteomic Assay eTable 2. Coefficients for Weibull Recalibration Model Applied to 9-Protein Model eFigure 1. Median Protein Levels in Derivation and Validation Cohort eTable 3. Coefficients for the Recalibration Model Applied to Refit Framingham eFigure 2. Calibration Plots for the Refit Framingham Model eTable 4. List of 200 Proteins Associated With the Risk of MI, Stroke, Heart Failure, and Death eFigure 3. Hazard Ratios of Lasso Selected Proteins for Primary End Point of MI, Stroke, Heart Failure, and Death eFigure 4. 9-Protein Prognostic Model Hazard Ratios Adjusted for Framingham Variables eFigure 5. 9-Protein Risk Scores by Event Type This supplementary material has been provided by the authors to give readers additional information about their work. Downloaded From: https://jamanetwork.com/ on 10/02/2021 Supplemental Material Table of Contents 1 Study Design and Data Processing ......................................................................................................... 3 2 Table of 1130 Proteins Measured .......................................................................................................... 4 3 Variable Selection and Statistical Modeling ........................................................................................
    [Show full text]
  • The Receptor Tyrosine Kinase EPHB4 Has Tumor Suppressor Activities in Intestinal Tumorigenesis
    Published OnlineFirst September 8, 2009; DOI: 10.1158/0008-5472.CAN-09-0706 Molecular Biology, Pathobiology, and Genetics The Receptor Tyrosine Kinase EPHB4 Has Tumor Suppressor Activities in Intestinal Tumorigenesis Higinio Dopeso,1,5 Silvia Mateo-Lozano,1 Rocco Mazzolini,1 Paulo Rodrigues,1 Laura Lagares-Tena,1 Julian Ceron,2 Jordi Romero,1,5 Marielle Esteves,1 Stefania Landolfi,4 Javier Herna´ndez-Losa,4 Julio Castan˜o,3 Andrew J. Wilson,6 Santiago Ramon y Cajal,4 John M. Mariadason,7 Simo Schwartz, Jr.,3,5 and Diego Arango1,5 Groups of 1Molecular Oncology, 2Functional Genomics and Genetics, and 3Drug Delivery and Targeting, Molecular Biology and Biochemistry Research Center (CIBBIM-Nanomedicine) and 4Department of Pathology, Vall d’Hebron Hospital; 5CIBER de Bioingenierı´a, Biomateriales y Nanomedicina, Barcelona, Spain; 6Department of Obstetrics and Gynecology, Vanderbilt University Medical Center, Nashville, Tennessee; and 7Ludwig Institute for Cancer Research, Melbourne Centre for Clinical Sciences, Austin Health, Heidelberg, Victoria, Australia Abstract Introduction Colorectal cancer is the second cause of cancer-related death Colorectal cancer is one of the leading causes of cancer-related in the western world, and although the genetic and molecular death in the western world and accounts for f1 million new mechanisms involved in the initiation and progression of these cases and f500,000 deaths every year worldwide. At the molecular tumors are among the best characterized, there are significant level, the constitutive activation of Wnt signaling is one of the gaps in our understanding of this disease. The role of EPHB hallmarks of colorectal cancer. Wnt activation most frequently signaling in colorectal cancer has only recently been realized.
    [Show full text]
  • Original Article Cytochrome P450 Family Proteins As Potential Biomarkers for Ovarian Granulosa Cell Damage in Mice with Premature Ovarian Failure
    Int J Clin Exp Pathol 2018;11(8):4236-4246 www.ijcep.com /ISSN:1936-2625/IJCEP0080020 Original Article Cytochrome P450 family proteins as potential biomarkers for ovarian granulosa cell damage in mice with premature ovarian failure Jiajia Lin1, Jiajia Zheng1, Hu Zhang1, Jiulin Chen1, Zhihua Yu1, Chuan Chen1, Ying Xiong3, Te Liu1,2 1Shanghai Geriatric Institute of Chinese Medicine, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai, China; 2Department of Pathology, Yale UniversitySchool of Medicine, New Haven, USA; 3Department of Gynaecology and Obestetrics, Xinhua Hospital Affiliated to Shanghai Jiaotong University School of Medicine, Shanghai, China Received May 21, 2018; Accepted June 29, 2018; Epub August 1, 2018; Published August 15, 2018 Abstract: Premature ovarian failure (POF) is the pathological aging of ovarian tissue. We have previously established a cyclophosphamide-induced mouse POF model and found that cyclophosphamide caused significant damage and apoptosis of mouse ovarian granulosa cells (mOGCs). To systematically explore the molecular biologic evidence of cyclophosphamide-induced mOGC damage at the gene transcription level, RNA-Seqwas used to analyse the differ- ences in mOGC transcriptomes between POF and control (PBS) mice. The sequencing results showed that there were 18765 differential transcription genes between the two groups, of which 192 were significantly up-regulated (log2 [POF/PBS] > 2.0) and 116 were significantly down-regulated (log2 [POF/PBS] < -4.0). Kyoto Encyclopedia of Genes and Genomes analysis found that the neuroactive ligand-receptor interaction pathway was significantly up-regulated and metabolic pathways were significantly down-regulated in the POF group. Gene Ontology analy- sis showed that the expression of plasma membrane, regulation of transcription and ion binding functions were significantly up-regulated in the POF group, while the expression of cell and cell parts, catalytic activity and single- organism process functions were significantly down-regulated.
    [Show full text]
  • Genomic Signature of Parity in the Breast of Premenopausal Women
    Santucci-Pereira et al. Breast Cancer Research (2019) 21:46 https://doi.org/10.1186/s13058-019-1128-x RESEARCH ARTICLE Open Access Genomic signature of parity in the breast of premenopausal women Julia Santucci-Pereira1*† , Anne Zeleniuch-Jacquotte2,3†, Yelena Afanasyeva2†, Hua Zhong2†, Michael Slifker4, Suraj Peri4, Eric A. Ross4, Ricardo López de Cicco1, Yubo Zhai1, Theresa Nguyen1, Fathima Sheriff1, Irma H. Russo1, Yanrong Su1, Alan A. Arslan2,5, Pal Bordas6,7, Per Lenner7, Janet Åhman6, Anna Stina Landström Eriksson6, Robert Johansson8, Göran Hallmans9, Paolo Toniolo5 and Jose Russo1 Abstract Background: Full-term pregnancy (FTP) at an early age confers long-term protection against breast cancer. Previously, we reported that a FTP imprints a specific gene expression profile in the breast of postmenopausal women. Herein, we evaluated gene expression changes induced by parity in the breast of premenopausal women. Methods: Gene expression profiling of normal breast tissue from 30 nulliparous (NP) and 79 parous (P) premenopausal volunteers was performed using Affymetrix microarrays. In addition to a discovery/validation analysis, we conducted an analysis of gene expression differences in P vs. NP women as a function of time since last FTP. Finally, a laser capture microdissection substudy was performed to compare the gene expression profile in the whole breast biopsy with that in the epithelial and stromal tissues. Results: Discovery/validation analysis identified 43 differentially expressed genes in P vs. NP breast. Analysis of expression as a function of time since FTP revealed 286 differentially expressed genes (238 up- and 48 downregulated) comparing all P vs. all NP, and/or P women whose last FTP was less than 5 years before biopsy vs.
    [Show full text]