SUPPLEMENTARY DATA
“The receptor tyrosine kinase EPHB4 has tumor suppressor activities in intestinal tumorigenesis “
SUPPLEMENTARY FIGURE LEGENDS
Supplementary Figure 1: Immunostaining with endothelial markers. Immunohistochemical staining against CD34 (A-B, C-D) or CD105 (C-D) did not show significant differences between control HT29 cells transfected with pEGFP-N2 and derivative cells transfected with dominant negative EPHB4 C-EGFP (A-D) or small intestinal tumors from Apcmin/+ mice that are wild type or heterozygous for EphB4 (E-F). Arrowheads indicate blood vessels.
Supplementary Figure 2: Number and location of goblet, Paneth and enteroendocrine cells. Staining with 1% Alcian blue was used to reveal goblet cells. Paneth cells were detected by immunostaining with a rabbit polyclonal anti-lysozyme antibody (Dako, CA; prediluted) after treatment with 10 mM citrate pH 6 for 20 min for antigen retrieval. Enteroendocrine cells were quantified after Grimelius staining as described before (Fernandez Pascual et al 1976 Stain Technol 51:231). No differences were observed in the number and location of small intestinal goblet cells (Alcian blue positive; A-B), Paneth cells (Lysozyme positive; C-D) or enteroendocrine cells (Grimelius staining positive; E-F) of Apcmin/+;EphB4+/- and Apcmin/+;EphB4+/+ mice (n=10 and 7, respectively).
Supplementary Figure 3: Microarray data validation. Histogram A) shows the gene expression differences observed in Apcmin/+;EphB4+/+ and Apcmin/+;EphB4+/+ mice using microarray analysis and quantitative Real-Time RT-PCR. B) An excellent correlation was observed between gene expression assessments made with these two techniques (Pearson ’s R=0.99 and p=0.003). Theprimers used were EhBEphB4-F: CAACTGGATGAGAGCGAGAG; EphB4-R: GAGGCAGAGAACTGCAATGA; Igfpbp5-F: AAGCTTCCCTCCAGGAGTTC; Igfpbp5-R: GGAGGGCTTACACTGCTTTC; Mmp2-F: GGGTGGTGGTCATAGCTACTT; Mmp2-R: TTCCAAACTTCACGCTCTTG; Col5a2-F; CAAGACACCTGCTCTAAGCG; Col5a2-R: CCAACATCTATGATGGGCAA; and for 18S rRNA the sequence of the primers and the internal probe were 18S-rRNA-F: AGTCCCTGCCCTTTGTACACA, 18S-rRNA-R: GATCCGAGGGCCTCACTAAAC and 18S-rRNA-probe: FAM-CGCCCGTCGCTACTACCGATTGG-TAMRA.
Supplementary Figure 4: EPHB4 levels and Wnt signaling. A-D) Immunohistochemical staining with an anti- catenin did not reveal any significant differences in the levels or localization of -catenin. E) The levels of activity of TCF4/ - catenin were assessed using the TOP/FOP system as previously reported (Korinek et al 1997 Science 275:1784). Briefly, cells were transfected with a vector containing a three tandem repeat of a consensus TCF4/ -catenin binding site or a mutated binding site driving the transcription of a Luciferase reporter gene. The pRL-TK plasmid was used to control for transfection efficiency. No differences were observed in catenin/TCF4 trascriptional activity in empty vector control HT29 cells (EV) and EPHB4 dominant negative transfectants (DN).
1 SUPPLEMENTARY FIGURE LEGENDS (cont.)
Supplementary Figure 5: Expression of genes involved in the adenoma to carcinoma transition. Previous studies have identified these eight genes as key players in the transition from adenoma to carcinoma (34). The fold change in the expression of these genes is shown for intestinal carcinomas/adenomas in Apcmin/+ mice (grey bars) and in adenomas from Apcmin/+ mice that are wild type or heterozygous for EphB4 (back bars). The inset shows the correlation between these values.
Supplementary Figure 6: Functional network of 60 out of 183 genes differentially expressed in Apcmin/+ mice that are wild type or heterozygous for EPHB4. This network graph represents genes as nodes and functional connections as links. Genes down-regulated (red nodes), genes coding for collagen (blue nodes), genes coding for proteinases (green nodes) and genes coding for growth factors (orange nodes) are highlighted. The larger red node corresponds to EphB4.
2 Supplementary Figure 1
ABAnti CD34 Anti CD34
HT29 HT29 pEGFP N2 pEPHB4 C EGFP C Anti CD105D Anti CD105
HT29 HT29 pEGFP N2 pEPHB4 C EGFP EFAnti CD34 Anti CD34
Apcmin/+ ;EphB4+/+ Apcmin/+ ;EphB4+/
3 Supplementary Figure 2
A) Alcian Blue B) Alcian Blue
EphB4+/+;Apcmin/+ EphB4+/-;Apcmin/+
C) Anti-Lysozyme D) Anti-Lysozyme
EphB4+/+;Apcmin/+ EphB4+/-;Apcmin/+
E) Grimelius F) Grimelius
Apcmin/+;EphB4+/+ Apcmin/+;EphB4+/- 4 Supplementary Figure 3
A) 16 qPCR 12 Array
nge 8
4 Fold cha Fold 0 MMP2 Col5a2 EPHB4 IGFBP5 B)
Pearson’s R=0.99 p=0.003 5 Supplementary Figure 4
6 E) vity ls) i e 4
2 elative Lucelative lev atenin/TCF4 act c R - (
0 HT29- HT29- 6 EV DN Supplementary Figure 5
10 Carcinoma/adenoma 5 EphB4 het/wt
0 nge a -5 Fold EphB4 5 WT/HET -10 -5 5 10 -10 -5
Fold ch -10 A/C
-15 d Fol -15 -20 Pearson R: 0.96 p<0.003 -20 5 2 g l9 t2 2f e 17 0 p r y p M Mc S10 Sox Spr Igfb Serpin
7 Supplementary Figure 6
COLOR KEY
8 EphB4 in intestinal tumorigenesis Dopeso et al
Supplementary Table 1: Genes with fold difference greater than 2-fold in adenomas of Apcmin/+ mice that are wild type or heterozygous for EphB4.
Mean fold in probe set Gene Symbol Gene Name EphB4 WT vs. HET 1448964_at S100g S100 calcium binding protein G 6,07 1448194_a_at H19 H19 fetal liver mRNA 5,91 1417600_at Slc15a2 solute carrier family 15 (H+/peptide transporter), 5,62 member 2 1416040_at Lipf lipase, gastric 3,77 1453645_at 2700046A07Rik RIKEN cDNA 2700046A07 gene 3,27 1449833_at Sprr2f small proline rich protein 2F 3,18 1419118_at 2900093B09Rik RIKEN cDNA 2900093B09 gene 2,92 1459309_at Rufy3 RUN and FYVE domain containing 3 2,83 1445104_at E230029C05Rik RIKEN cDNA E230029C05 gene 2,82 1423935_x_at Krt1 14 keratin complex 1, acidic, gene 14 2,82 1438519_at Klhl24 kelch like 24 (Drosophila) 2,76 1449254_at Spp1 secreted phosphoprotein 1 2,63 1439351_at A930031D07Rik RIKEN cDNA A930031D07 gene 2,53 1442489_at D1Ertd564e DNA segment, Chr 1, ERATO Doi 564, expressed 2,45 1446693_at 2,43 1436780_at Ogt O linked N acetylglucosamine (GlcNAc) transferase 2,42 (UDP N acetylglucosamine:polypeptide N acetylglucosaminyl transferase) 1438676_at Mpa2l macrophage activation 2 like /// similar to 2,34 macrophage activation 2 like /// similar to macrophage activation 2 like 1450165_at Slfn2 schlafen 2 2,33 1452787_a_at Prmt1 protein arginine N methyltransferase 1 2,31 1449286_at Ntng1 netrin G1 2,24 1449488_at Pitx1 paired like homeodomain transcription factor 1 2,18 1447845_s_at Vnn1 vanin 1 2,06 1423954_at C3 complement component 3 2,07 1416619_at 4632428N05Rik RIKEN cDNA 4632428N05 gene 2,09 1448748_at Plek pleckstrin 2,11 1441972_at 6230424C14Rik RIKEN cDNA 6230424C14 gene 2,12 1416778_at Sdpr serum deprivation response 2,14 1424733_at P2ry14 purinergic receptor P2Y, G protein coupled, 14 2,14 1416980_at Mettl7b methyltransferase like 7B 2,15 1424600_at Abp1 amiloride binding protein 1 (amine oxidase, copper 2,15 containing) 1418739_at Sgk2 serum/glucocorticoid regulated kinase 2 2,16
9 EphB4 in intestinal tumorigenesis Dopeso et al
(Continued) Mean fold in probe set Gene Symbol Gene Name EphB4 WT vs. HET 1435137_s_at 1200015M12Rik RIKEN cDNA 1200015M12 gene /// RIKEN cDNA 2,27 1200016E24 gene /// RIKEN cDNA A130040M12 gene /// RIKEN cDNA E430024C06 gene 1430927_at Ceacam18 CEA related cell adhesion molecule 1 2,31 1425102_a_at Ace2 angiotensin I converting enzyme (peptidyl 2,31 dipeptidase A) 2 1423489_at Mmd monocyte to macrophage differentiation associated 2,32
1416905_at Guca2a guanylate cyclase activator 2a (guanylin) 2,34 1427054_s_at Abi3bp ABI gene family, member 3 (NESH) binding protein 2,34 1418237_s_at Col18a1 procollagen, type XVIII, alpha 1 2,34 1448741_at Slc3a1 solute carrier family 3, member 1 2,36 1450852_s_at F2r coagulation factor II (thrombin) receptor 2,37 1419498_at Tmigd transmembrane and immunoglobulin domain 2,39 containing 1448823_at Cxcl12 chemokine (C X C motif) ligand 12 2,39 1416454_s_at Acta2 actin, alpha 2, smooth muscle, aorta 2,41 1427137_at Ces5 carboxylesterase 5 2,42 1457721_at AI118064 Expressed sequence AI118064 2,43 1428909_at A130040M12Rik RIKEN cDNA A130040M12 gene 2,48 1455454_at Akr1c19 aldo keto reductase family 1, member C19 2,50 1426497_at Jarid1c jumonji, AT rich interactive domain 1C (Rbp2 like) 2,52 1446368_at 9130221J18Rik RIKEN cDNA 9130221J18 gene 2,55 1423025_a_at Schip1 schwannomin interacting protein 1 2,55 1419703_at Col5a3 procollagen, type V, alpha 3 2,55 1426511_at Susd2 sushi domain containing 2 2,56 1424245_at Ces2 carboxylesterase 2 /// similar to carboxylesterase 2 2,57 1421134_at Areg amphiregulin 2,59 1416194_at Cyp4b1 cytochrome P450, family 4, subfamily b, polypeptide 2,59 1 1449453_at Bst1 bone marrow stromal cell antigen 1 2,61 1451547_at 0610009A07Rik RIKEN cDNA 0610009A07 gene 2,62 1448485_at Ggt1 gamma glutamyltransferase 1 2,62 1451481_s_at Osta organic solute transporter alpha 2,63 1456733_x_at Serpinh1 serine (or cysteine) peptidase inhibitor, clade H, 2,64 member 1 1418278_at Apoc3 apolipoprotein C III 2,67 1456768_a_at 2,68 1418723_at Edg7 endothelial differentiation, lysophosphatidic acid G 2,68 protein coupled receptor 7 1421489_a_at 2010106E10Rik RIKEN cDNA 2010106E10 gene 2,69
10 EphB4 in intestinal tumorigenesis Dopeso et al
(Continued) Mean fold in probe set Gene Symbol Gene Name EphB4 WT vs. HET 1417976_at Ada adenosine deaminase 2,70 1424768_at Cald1 caldesmon 1 2,74 1424114_s_at Lamb1 1 laminin B1 subunit 1 2,75 1448755_at Col15a1 procollagen, type XV 2,78 1443746_x_at Dmp1 dentin matrix protein 1 2,79 1450641_at Vim vimentin 2,81 1422134_at Fosb FBJ osteosarcoma oncogene B 2,82 1452035_at Col4a1 procollagen, type IV, alpha 1 2,82 1424265_at Npl N acetylneuraminate pyruvate lyase 2,84 1418601_at Aldh1a7 aldehyde dehydrogenase family 1, subfamily A7 2,85 1437726_x_at C1qb complement component 1, q subcomponent, beta 2,85 polypeptide 1449094_at Gja7 gap junction membrane channel protein alpha 7 2,85 1417903_at Dfna5h deafness, autosomal dominant 5 homolog (human) 2,85 1448499_a_at Ephx2 epoxide hydrolase 2, cytoplasmic 2,86 1455422_x_at sept4 septin 4 2,89 1418090_at Plvap plasmalemma vesicle associated protein 2,91 1456437_x_at C1r complement component 1, r subcomponent /// 2,92 similar to Complement C1r B subcomponent precursor (Complement component 1, r B subcomponent) /// similar to complement component 1, r subcomponent 1426937_at 6330406I15Rik RIKEN cDNA 6330406I15 gene 2,94 1449379_at Kdr kinase insert domain protein receptor 2,96 1452250_a_at Col6a2 procollagen, type VI, alpha 2 2,96 1425357_a_at Grem1 gremlin 1 2,99 1432249_a_at Ercc8 excision repaiross complementing rodent repair 3,00 deficiency, complementation group 8 1419674_a_at Dpep1 dipeptidase 1 (renal) 3,01 1419589_at Cd93 CD93 antigen 3,02 1419738_a_at Tpm2 tropomyosin 2, beta 3,09 1423606_at Postn periostin, osteoblast specific factor 3,10 1450245_at Slc10a2 solute carrier family 10, member 2 3,11 1459847_x_at Gfra2 glial cell line derived neurotrophic factor family 3,11 receptor alpha 2 1416808_at Nid1 nidogen 1 3,12 1424451_at Acaa1b acetyl Coenzyme A acyltransferase 1B 3,18 1437260_at Mmrn1 multimerin 1 3,19 1417872_at Fhl1 four and a half LIM domains 1 3,19 1419599_s_at Ms4a11 membrane spanning 4 domains, subfamily A, 3,22 member 11
11 EphB4 in intestinal tumorigenesis Dopeso et al
(Continued) Mean fold in probe set Gene Symbol Gene Name EphB4 WT vs. HET 1424051_at Col4a2 procollagen, type IV, alpha 2 3,22 1450958_at Tm4sf1 transmembrane 4 superfamily member 1 3,22 1455442_at Slc6a19 solute carrier family 6 (neurotransmitter 3,23 transporter), member 19 1452412_at Hoxc8 homeo box C8 3,23 1428136_at Sfrp1 secreted frizzled related sequence protein 1 3,28 1419758_at Abcb1a ATP binding cassette, sub family B (MDR/TAP), 3,31 member 1A 1449145_a_at Cav1 caveolin, caveolae protein 1 3,32 1417466_at 3,34 1436939_at Unc45b unc 45 homolog B (C. elegans) 3,35 1424131_at Col6a3 procollagen, type VI, alpha 3 /// similar to alpha 3 3,36 type VI collagen isoform 1 precursor 1455688_at Ddr2 discoidin domain receptor family, member 2 3,37 1448529_at Thbd thrombomodulin 3,42 1460233_at Guca2b guanylate cyclase activator 2b (retina) 3,43 1416953_at Ctgf connective tissue growth factor 3,47 1450719_at Mep1a meprin 1 alpha 3,47 1449399_a_at Il1b interleukin 1 beta 3,49 1455851_at Bmp5 bone morphogenetic protein 5 3,51 1455466_at Gpr133 G protein coupled receptor 133 /// similar to G 3,54 protein coupled receptor 133 1416740_at Col5a1 procollagen, type V, alpha 1 3,57 1418979_at Akr1c14 aldo keto reductase family 1, member C14 3,58 1452270_s_at Cubn cubilin (intrinsic factor cobalamin receptor) 3,60 1427256_at Cspg2 chondroitin sulfate proteoglycan 2 3,61 1422413_at 3,67 1447181_s_at Slc7a7 solute carrier family 7 (cationic amino acid 3,71 transporter, y+ system), member 7 1419209_at Cxcl1 chemokine (C X C motif) ligand 1 3,79 1455965_at 3,80 1451446_at Antxr1 anthrax toxin receptor 1 3,80 1436791_at Wnt5a wingless related MMTV integration site 5A 3,81 1431701_a_at Pdzk1 PDZ domain containing 1 3,81 1420664_s_at Procr protein C receptor, endothelial 3,86 1436546_at Lix1l Lix1 like 3,88 1436367_at Ptprb Protein tyrosine phosphatase, receptor type, B 3,90 1436698_x_at BC054438 cDNA sequence BC054438 3,97 1435752_s_at Abcc9 ATP binding cassette, sub family C (CFTR/MRP), 4,00 member 9 1449632_s_at Fkbp10 FK506 binding protein 10 4,01
12 EphB4 in intestinal tumorigenesis Dopeso et al
(Continued) Mean fold in probe set Gene Symbol Gene Name EphB4 WT vs. HET 1437401_at Igf1 insulin like growth factor 1 4,05 1455494_at Col1a1 procollagen, type I, alpha 1 4,12 1418990_at Ms4a4d membrane spanning 4 domains, subfamily A, 4,15 member 4D 1417256_at Mmp13 matrix metallopeptidase 13 4,18 1422053_at Inhba inhibin beta A 4,24 1449430_a_at Treh trehalase (brush border membrane glycoprotein) 4,26 1436970_a_at Pdgfrb platelet derived growth factor receptor, beta 4,28 polypeptide 1452330_a_at Mxra8 matrix remodelling associated 8 4,28 1432466_a_at Apoe apolipoprotein E 4,31 1431004_at Loxl2 lysyl oxidase like 2 4,33 1423584_at Igfbp7 insulin like growth factor binding protein 7 4,33 1423607_at Lum lumican 4,38 1418395_at 1300013J15Rik RIKEN cDNA 1300013J15 gene 4,50 1431379_a_at Slc13a1 solute carrier family 13 (sodium/sulphate 4,54 symporters), member 1 1452366_at 4732435N03Rik RIKEN cDNA 4732435N03 gene 4,80 1422340_a_at Actg2 actin, gamma 2, smooth muscle, enteric 4,83 1438405_at Fgf7 fibroblast growth factor 7 4,84 1448723_at Rdh7 retinol dehydrogenase 7 4,87 1416114_at Sparcl1 SPARC like 1 (mast9, hevin) 5,17 1448392_at Sparc secreted acidic cysteine rich glycoprotein 5,26 1416342_at Tnc tenascin C 5,27 1423110_at 5,32 1419476_at Adamdec1 ADAM like, decysin 1 5,32 1424973_at Cyp3a25 cytochrome P450, family 3, subfamily a, polypeptide 5,46 25 /// similar to cytochrome P450, family 3, subfamily a, polypeptide 25 1450857_a_at Col1a2 procollagen, type I, alpha 2 5,54 1416468_at Aldh1a1 aldehyde dehydrogenase family 1, subfamily A1 5,63 1415800_at Gja1 gap junction membrane channel protein alpha 1 5,69 1416041_at Sgk serum/glucocorticoid regulated kinase 5,80 1420450_at Mmp10 matrix metallopeptidase 10 5,82 1425471_x_at 5,92 1427883_a_at Col3a1 procollagen, type III, alpha 1 5,99 1449375_at Ces6 carboxylesterase 6 6,25 1416136_at Mmp2 matrix metallopeptidase 2 6,32 1450826_a_at Saa3 serum amyloid A 3 6,33 1422437_at Col5a2 procollagen, type V, alpha 2 6,36 1440147_at Lgi2 leucine rich repeat LGI family, member 2 6,36
13 EphB4 in intestinal tumorigenesis Dopeso et al
(Continued) Mean fold in probe set Gene Symbol Gene Name EphB4 WT vs. HET 1417023_a_at Fabp4 fatty acid binding protein 4, adipocyte 6,43 1416666_at Serpine2 serine (or cysteine) peptidase inhibitor, clade E, 6,43 member 2 1417761_at Apoa4 apolipoprotein A IV 6,47 1448323_a_at Bgn biglycan 6,53 1452114_s_at Igfbp5 insulin like growth factor binding protein 5 6,59 1449368_at Dcn decorin 6,96 1422317_a_at Il1rl1 interleukin 1 receptor like 1 7,18 1417262_at Ptgs2 prostaglandin endoperoxide synthase 2 7,40 1437347_at Ednrb endothelin receptor type B 7,62 1416809_at Cyp3a11 cytochrome P450, family 3, subfamily a, polypeptide 7,68 11 1449310_at Ptger2 prostaglandin E receptor 2 (subtype EP2) 7,70 1425470_at 9,13 1419582_at Cyp2c55 cytochrome P450, family 2, subfamily c, polypeptide 9,55 55 1418937_at Dio2 deiodinase, iodothyronine, type II 10,32 1419431_at Ereg epiregulin 11,83
14 EphB4 in intestinal tumorigenesis Dopeso et al
Supplementary Table 2: Fold expression differences of Wnt target genes in Apcmin/+ mice that are wild type or heterozygous for EphB4 (gene list from http://www.stanford.edu/~rnusse/pathways/targets.html).
Mean fold in Gene probe set Gene Title EphB4 WT Symbol vs. HET 1439336_at Tcf4 Transcription factor 4 1.83 1436398_at Lef1 Lymphoid enhancer binding factor 1 1.56 1424942_a_at Myc myelocytomatosis oncogene 1.50 1440106_at Tcf4 Transcription factor 4 1.46 1417419_at Ccnd1 cyclin D1 1.44 1436845_at Axin2 axin2 1.40 1434149_at Tcf4 transcription factor 4 1.36 1446386_at Tcf4 Transcription factor 4 1.33 1454022_at Ephb2 Eph receptor B2 1.22 1416723_at Tcf4 transcription factor 4 1.22 1423760_at Cd44 CD44 antigen 1.21 1424089_a_at Tcf4 transcription factor 4 1.20 1417420_at Ccnd1 cyclin D1 1.19 1449478_at Mmp7 matrix metallopeptidase 7 1.15 1427939_s_at Mycbp c myc binding protein 1.15 1416724_x_at Tcf4 transcription factor 4 1.15 1439797_at Ppard peroxisome proliferator activator receptor delta 1.14 1434148_at Tcf4 transcription factor 4 1.13 1437932_a_at Cldn1 claudin 1 1.13 1451736_a_at Map2k7 mitogen activated protein kinase kinase 7 1.12 1451550_at Ephb3 Eph receptor B3 1.08 1453596_at Id2 inhibitor of DNA binding 2 1.06 1448698_at Ccnd1 cyclin D1 1.01 1434376_at Cd44 CD44 antigen 1.01 1425016_at Ephb2 Eph receptor B2 1.01 1458201_at Tcf4 Transcription factor 4 1.00 1424278_a_at Birc5 baculoviral IAP repeat containing 5 1.00 1457182_at Map2k7 mitogen activated protein kinase kinase 7 1.01 1442471_at Ephb2 Eph receptor B2 1.05 1452608_at Mycbp c myc binding protein 1.05 1435176_a_at Id2 inhibitor of DNA binding 2 1.08 1427940_s_at Mycbp c myc binding protein 1.11 1417487_at Fosl1 fos like antigen 1 1.28 1420909_at Vegfa vascular endothelial growth factor A 1.32 1451924_a_at Edn1 endothelin 1 1.33 1449822_at Atoh1 atonal homolog 1 (Drosophila) 1.47 1452521_a_at Plaur plasminogen activator, urokinase receptor 1.48
15 EphB4 in intestinal tumorigenesis Dopeso et al
Supplementary Table 3: Fold expression differences of the genes involved in the transition from adenoma to carcinoma in adenomas from Apcmin/+ mice that are wild type or heterozygous for EphB4.
Fold Fold Gene Gene name Expression in Expression in difference in difference symbol EphB4+/+ EphB4+/ EphB4 wt in the A/C vs. Het transition1
Gpx5 glutathione peroxidase 5 229,37 N/D 16,2
S100g S100 calcium binding protein G 698,88 123,05 5,68 15
Sprr2f small proline rich protein 2F 84,06 29,34 2,87 4,6
Sox17 SRY box containing gene 17 360,75 170,17 2,12 4,2
Myl9 myosin, light polypeptide 9, 137,14 81,67 1,68 4 regulatory
Mcpt2 mast cell protease 2 2451,19 2050,75 1,20 2,9
Igfbp5 insulin like growth factor 159,45 1015,56 6,37 2,6 binding protein 5
Serpine2 serine (or cysteine) peptidase 269,37 1456,38 5,41 3,4 inhibitor, clade E, member 2
N/D: not detectable 1Fold difference in the adenoma to carcinoma transition reported in Physiological Genomics 15:228-235 (2003)
16 EphB4 in intestinal tumorigenesis Dopeso et al
Supplementary Table 4: Functional group enrichment analysis of the 183 genes differentially expressed in Apcmin/+ that are wild type or heterozygous for EphB4 using Cellular Component terms from Gene Ontology.
List Name Total Expected Actual Fold Binomial probes matches matches Enrichment p value
extracellular region part 1072 6.65 46 6.92 9.50e 24
proteinaceous extracellular 463 2.87 31 10.79 5.20e 22
matrix extracellular region 1551 9.62 52 5.40 7.63e 22
extracellular matrix 474 2.94 31 10.54 1.03e 21
collagen 61 0.38 13 34.35 1.00e 16
extracellular matrix part 174 1.08 17 15.75 1.83e 15
fibrillar collagen 18 0.11 7 62.68 1.06e 11
extracellular space 664 4.12 20 4.85 1.37e 08
chylomicron 12 0.07 3 40.29 5.04e 05
17 EphB4 in intestinal tumorigenesis Dopeso et al
Supplementary Table 5: Functional group enrichment analysis of the 183 genes differentially expressed in Apcmin/+ that are wild type or heterozygous for EphB4 using Molecular function terms from Gene Ontology.
List Name Total Expected Actual Fold Binomial probes matches matches Enrichment p value
extracellular matrix structural 141 0.87 15 17.15 2.28e 14
constituent
structural molecule activity 1146 7.11 24 3.38 4.52e 07
unspecific monooxygenase activity 26 0.16 4 24.80 1.99e 05
oxidoreductase activity, acting on 32 0.20 4 20.15 4.64e 05 paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom
of oxygen
glycosaminoglycan binding 161 1.00 7 7.01 7.50e 05
polysaccharide binding 165 1.02 7 6.84 8.75e 05
heparin binding 115 0.71 6 8.41 9.01e 05
18 EphB4 in intestinal tumorigenesis Dopeso et al
Supplementary Table 6: Functional group enrichment analysis of the 183 genes differentially expressed in Apcmin/+ that are wild type or heterozygous for EphB4 using Biological process terms from Gene Ontology.
List Name Total Expected Actual Fold Binomial probes matches matches Enrichment p value
phosphate transport 141 0.87 13 14.86 7.63e 12
anion transport 291 1.81 15 8.31 7.52e 10
inorganic anion transport 247 1.53 14 9.14 8.06e 10
multicellular organismal process 5226 32.42 66 2.04 1.36e 07
organ development 2055 12.75 32 2.51 3.87e 06
response to wounding 598 3.71 15 4.04 7.62e 06
extracellular matrix organization and 77 0.48 6 12.56 9.28e 06
biogenesis
circulation 232 1.44 9 6.25 1.81e 05
system development 2865 17.78 38 2.14 1.91e 05
extracellular structure organization 150 0.93 7 7.52 4.80e 05
and biogenesis
skeletal development 397 2.46 11 4.47 4.97e 05
response to external stimulus 880 5.46 17 3.11 5.39e 05
multicellular organismal 3810 23.64 45 1.90 5.59e 05
development
response to chemical stimulus 730 4.53 15 3.31 7.36e 05
19