Clinical Presentation and Genetic Correlation of Patients with Mutations Affecting the FZD4 Gene

OPHTHALMIC MOLECULAR GENETICS

SECTION EDITOR: JANEY L. WIGGS, MD, PhD Clinical Presentation and Genetic Correlation of Patients With Mutations Affecting the FZD4 Gene

Kimberly A. Drenser, MD, PhD; Wendelin Dailey, BS; Anand Vinekar, MD; Kunal Dalal, MD; Antonio Capone Jr, MD; Michael T. Trese, MD

Objective: To correlate the ophthalmic findings of pa- other FZD4 mutations were found in the patients with tients with pediatric vitreoretinopathies with mutations ROP. Additionally, patients expressing the double mu- occurring in the FZD4 gene. tation had clinical presentations that overlapped, mak- ing it difficult to assign a definitive diagnosis. None of Methods: A total of 123 patients diagnosed with auto- the mutations found in the patients with FEVR or ROP somal-dominant familial exudative vitreoretinopathy (Ad- were seen in the control chromosomes. FEVR) or retinopathy of prematurity (ROP) and 42 control patients were enrolled in the study. Diagnoses were Conclusion: Mutations occurring in the FZD4 gene affect based on retinal findings at each patient’s first examina- patients diagnosed with both FEVR and ROP. The clini- tion or during ROP screening. Genomic DNA was iso- cal picture often overlaps and may require a detailed birth lated and polymerase chain reaction and direct sequenc- and family history for diagnosis. Genetic testing con- ing of the FZD4 gene performed. firms inherited vitreoretinopathy and helps direct clinical management. Results: FZD4 gene mutations were discovered in 13 of the 123 (10.6%) patients. Nine of the 63 patients with Clinical Relevance: Patients diagnosed with ROP may AdFEVR (14.3%) has mutations in the FZD4 gene. Four have a mutation in the FZD4 gene and display charac- heterozygous mutations were identified: C117R, C181Y, teristics consistent with FEVR. Analysis of the FZD4 gene Q505X, and P33S/P168S. Four of the 60 patients with should be considered. ROP (6.7%) have a double missense mutation P33S/ P168S that was also found in the patients with FEVR. No Arch Ophthalmol. 2009;127(12):1649-1654

ϩ UTATIONS IN THE GENE the Wnt-Ca2 pathway. In vitro studies encoding the frizzled-4 have shown that transduction of the FZD4 receptor (FZD4) signal can occur by any of these path- (gene, FZD4; OMIM ways. Although it was originally thought 133780) have been de- that the path taken was determined by the scribedM in many patients diagnosed with ligand, it is still unclear how the frizzled autosomal-dominant familial exudative receptor signals are transduced. retinopathy (AdFEVR)1 and in a smaller The canonical Wnt/␤-catenin pathway is number of patients with retinopathy of pre- the most thoroughly studied. Activation is maturity (ROP).2 In both diseases, the pa- initiated by ligand binding to both the FZD4 tient is born with enlarged and tortuous receptor and its coreceptor, the low-density retinal vessels and an area of avascular pe- lipoprotein receptor–related protein 5 ripheral retina. Additionally, varying de- (LRP5),ultimatelyresultingindephosphory- grees of subretinal exudation, vitreoreti- lation of ␤-catenin and translocation to the nal traction, and abnormal extraretinal nucleus.4 Nuclear ␤-catenin participates as vessels/neovascularization may occur. a transcriptional activator of the transcrip- Proper FZD4 signaling is necessary for tion factor and lymphoid enhancer–binding normal retinal vascular development.3 factor family of DNA-binding proteins Author Affiliations: Associated Frizzled-4 is a 537–amino acid, 7-trans- (Figure 2). Target genes include C-MYC, Retinal Consultants, William membrane receptor that transduces Wnt CYCLIN D1, and VEGF, presumably regu- Beaumont Hospital, Royal Oak, signaling (Figure 1 and Figure 2). Sev- lating cell proliferation in specific tissues. Michigan (Drs Drenser, Dalal, eral Wnt ligands, Wnt-3a, Wnt-8, Wnt- Similar to the canonical pathway, the pla- Capone, and Trese, and 5a, and the non-Wnt ligand, Norrin, are nar cell polarity pathway also involves ac- Ms Dailey); and the Department of Ophthalmology, Advanced known to activate FZD4. There are 6 in- tivation of disheveled protein subsequent to Eye Center, Postgraduate tracellular paths of Wnt signaling that can FZD4 activation (Figure 2). Unlike the ca- Institute of Medical Education occur downstream of frizzled receptor ac- nonical pathway, LRP5 is not needed for this and Research, Chandigarh, tivation: the canonical Wnt/␤-catenin path- signal transduction. Subsequently, 1 of 2 India (Dr Vinekar). way, the planar cell polarity pathway, and small guanosine triphosphatases (Rho or

(REPRINTED) ARCH OPHTHALMOL / VOL 127 (NO. 12), DEC 2009 WWW.ARCHOPHTHALMOL.COM 1649

(K-T-L-H-T-W) (E-T-V-V)

AA No. (1-36) (45-204) (223-498) (499-504) (499-537) (534-537)

(Wnt/Norrin) Canonical Wnt PDZ-1, noncanonical, Ligand-binding domain signaling motif JNK activation motif

Figure 1. Diagram of frizzled-4 receptor (FZD4) amino acid sequence. AA inidcates amino acid; JNK, c-Jun N-terminal kinase; SS, signal sequence.

β-Catenin Pathway Planar Cell Polarity Pathway Ca2+ Pathway

Wnt/Norrin Wnt/Norrin Wnt/Norrin

FZD4 FZD4 FZD4

LRP5/6 G-proteins

Disheveled Disheveled

Axin P Ca2+ GSK-3 Degradation APC β-Cat DAMM 1/2

β-Cat

Rac1 RhoA PKC CamK-II

(PKC pathway)

JNK ROCK2 Nucleus (Cell survival) (Cytoskeleton Nucleus rearrangement) β-Cat NFAT, CREB TCF/LEF (Gene expression) (Gene expression)

Figure 2. Schematic of frizzled-4 receptor (FZD4)–dependent pathways. APC indicates antigen-presenting cell; ␤-cat, ␤-catechin; Ca2ϩ, calcium ion; CamK-II, calcium-calmodulin kinase 2; CREB, cAMP response element-binding protein; DAMM, death-associated molecule related to Mch2; G-proteins, guanine nucleotide-binding proteins; GSK, glycogen synthase kinase 3; JNK, c-Jun N-terminal kinase; LRP, low-density lipoprotein receptor–related protein; NFAT, nuclear factor of activated T cells; P, phosphorylated site; PKC, protein kinase C; ROCK2, Rho-associated, coiled-coil–containing protein kinase 2; TCF/LEF, transcription factor and lymphoid enhancer–binding factor.

Rac) is activated, which in turn activates an alternative sig- quence variations in relation to signal transduction and nal transduction pathway.5 The planar cell polarity path- disease type will be discussed. way mediates cytoskeletal organization and cell migration. 2ϩ In the Wnt-Ca pathway, FZD receptor activation METHOD stimulates an intracellular Ca2ϩ release, activating calcium- calmodulin kinase 2 and protein kinase C (Figure 2). This PATIENTS pathway is important in cell adhesion and cell movement during gastrulation. Patients were recruited to the study through a protocol ap- In this study, we used direct sequencing to screen for proved by the internal review board at William Beaumont Hos- mutations in the coding sequence of FZD4 in patients with pital and consented to participation. They were diagnosed with FEVR and ROP. The possible implications of these se- FEVR or ROP based on fundus examination, family history, and

(REPRINTED) ARCH OPHTHALMOL / VOL 127 (NO. 12), DEC 2009 WWW.ARCHOPHTHALMOL.COM 1650

.Primer Sequence (5؅ to 3؅) Primer Length Product Length, Bases, No FZD4 exon 1 forward CTGCTACCCCCGATGCTG 18 396 FZD4 exon 1 reverse GGATGATCAACTTGGCATGG 20 FZD4 exon 2a forward ATTGCCTGGAAGCATTCAAC 20 570 FZD4 exon 2a reverse CGCTCAGGGTAGGAAAACCT 20 FZD4 exon 2b forward CAGCCTGTGTTTCATCTCCA 20 567 FZD4 exon 2b reverse ATTTTGAACAAGGCCACCAA 20 FZD4 exon 2c forward CTGGCTTGTGCTATGTTGGA 20 515 FZD4 exon 2c reverse AAGCATGGAGGCTGACTAGC 20

Table 2. Diagnosis and Frizzled-4 Mutations

Age at Patient No. Highest Stage Presentation/ Relative Amino Acid by Diagnosis of Disease Family History With Mutation Change Base Change Novel FEVR 1 4b 1 wk NT C117R b349 (TGCϾCGC) Yes 2 4a; RRD Birth NT 3 4b 4 wk In process C181Y b542 (TGTϾTAT) Yes 4 4b 1 mo NT Q505X b1513 (CAGϾTAG) No 5 2; RRD 7 y NT P33S/P168S b97 (CCGϾTCG), b502 No 6 5 ROP screening Father (CCCϾTCC) 7 5 4 mo Father 84b1yNT 9 4b 7 mo NT APROP 10 5 ROP screening Mother and twin P33S/P168S b97 (CCGϾTCG), b502 No 11 5 ROP screening Mother and twin (CCCϾTCC) ROP 12 4b ROP screening NT P33S/P168S b97 (CCGϾTCG), b502 No 13 1 ROP screening NT (CCCϾTCC)

Abbreviations: APROP, aggressive posterior retinopathy of prematurity; FEVR, familial exudative retinopathy; NT, not tested; ROP, retinopathy of prematurity; RRD, rhegmatogenous retinal detachment.

gestational age. Participants provided a blood sample from which with AdFEVR (14.3%) were found to have mutations in genomic DNA was isolated from the leucocytes using the Purgene the coding sequence of FZD4 (Table 2). Four hetero- GenomicDNAPurificationKit(Qiagen,Valencia,California).When zygous mutations were found: C117R, C181Y, Q505X, possible, genomic DNA from the relatives of patients expressing and P33S/P168S (eFigure; www.archophthalmol.com). an FZD4 mutation were tested for sequence variations. In addition, 4 of the 60 patients with ROP (6.7%) had SEQUENCING the double missense mutation P33S/P168S that was found in the patients with FEVR (Table 2). No other FZD4 mu- The coding sequence and flanking splice sites of FZD4 were tations were found in the patients with ROP. None of the amplified from 100 ng of genomic DNA using Herculase Hot- mutations found in the patients with FEVR and ROP were start PCR Master Mix (Stratagene, La Jolla, California). Four seen in the 84 control chromosomes. sets of primers were used (Table 1). Amplification condi- Two novel missense mutations were found in pa- tions were as follows: 1 cycle at 98°C for 1 minute, 40 cycles tients with AdFEVR, C117R (2 patients) and C181Y. Both of 30 seconds at 98°C, 30 seconds at 55°C, and 1 minute at 72°C, and a final extension for 10 minutes at 72°C. Amplified DNA occur in 1 of the 13 conserved cysteine residues of FZD4 was cleaned using the QIAquick Multiwell PCR Purification Kit ligand–binding domain (Figure 1). (Qiagen). Sequencing reactions were performed using the Beck- One patient with FEVR had a mutation resulting in man Dye Terminator Cycle Sequenc Quick Start Kit (Beck- early termination of protein translation, Q505X. This mu- man Coulter, Inc, Fullerton, California) and a Beckman CEQ tation has been reported in an Australian family.6 It is 8000 autosequencer. located immediately downstream from the highly conserved canonical Wnt activation motif (disheveled bind- RESULTS ing; KTXXXW) and causes premature termination prior to the planar cell polarity (c-Jun N-terminal kinase) path- MUTATION ANALYSIS way, PDZ1 binding motif (KTXV) (Figure 1). A double missense mutation, P33S/P168S, was found FZD4 gene mutations were discovered in 13 of the 123 in patients with both FEVR (5 patients; 7.9%) and ROP (4 patients enrolled in this study. Nine of the 63 patients patients; 6.7%). The double mutation was previously re-

(REPRINTED) ARCH OPHTHALMOL / VOL 127 (NO. 12), DEC 2009 WWW.ARCHOPHTHALMOL.COM 1651

Figure 3. Mother of patient 11. A peripheral avascular zone can be appreciated by fluorescein angiography.

ported in a patient with AdFEVR.2 Both P33S and P168S have been independently reported in patients with Ad- FEVR.6,7 AA33 is within the signal sequence and AA168 lies downstream of the cysteine-rich domain (CRD), Wnt- binding domain, and prior to the start of the 7-transmem- brane domains (Figure 1). The P168S mutation has been reported in 1 control (of 400) but the P33S and double mutation have not been reported in control patients. Several relatives of the patients with the double missense mutation P33S/P168S were screened and found to Figure 4. A, Classic retinopathy of prematurity progressed to retinal express the mutation as well. Asymptomatic family mem- detachment despite laser ablation; B, aggressive posterior retinopathy of bers demonstrated retinal peripheral avascularity but no prematurity with a total detachment. abnormal extraretinal vessels or exudates (Figure 3). Interestingly, 1 patient with ROP had a fraternal twin with All 4 infants with ROP with FZD4 mutations had the the mutation but no apparent manifestation of disease, double mutation (Table 2), with various degrees of dis- although fluorescein angiography was not performed and ease severity (Figure 4). Three of the 4 had poor out- retinal avascular zones could not be definitively as- comes. Two developed APROP (zone 1, stage 3, Plus) sessed. The asymptomatic twin is fraternal, had mini- and developed bilateral stage 5 retinal detachments. mal comorbidities, and had much better systemic health, One infant with classic (zone 2, stage 3, Plus) ROP pro- suggesting a role for epigenetics in the severity of dis- gressed to bilateral stage 4b despite appropriate and ease manifestation. timely laser ablation. One of the premature infants demonstrated peripheral avascular retina only and did CLINICAL COURSE not progress to neovascular changes. The infants with APROP were both products of multiple births, one with The clinical course varied for the individual patients in a surviving twin and the other a sole surviving triplet. which a mutation was identified. Patients presented be- The twins were fraternal but both have the FZD4 tween birth (up to 16 weeks premature) and 7 years of age, double mutation. The twins had very different postnatal although all patients reported poor vision in at least 1 eye courses; the twin with APROP had multiple comorbidi- since birth. Four of the 13 patients had ROP, and 2 devel- ties and poor health, whereas the asymptomatic twin oped aggressive posterior ROP (APROP). Nine patients had had an uneventful course with no systemic maladies. phenotypes consistent with FEVR, although 2 of these pa- The surviving triplet, similarly, had multiple comor- tients were initially diagnosed with ROP. One patient had bidities and poor systemic health. Both cases suggest a an initial diagnosis of persistent fetal vasculature syn- role for epigenetics in the development and severity of drome due to a posterior lens plaque but surgical inter- inherited diseases. vention demonstrated a temporal retinal fold with a pos- The patients with FEVR generally showed asymme- terior lens attachment consistent with FEVR. A single patient try between the eyes and ranged from stage 1 disease to with the double mutation in FZD4 also expressed a cyste- stage 5 (Table 1 and Table 2; Figure 5). Two patients ine mutation in the NDP gene, and demonstrated severe also had rhegmatogenous retinal detachments. All pa- bilateral retinal dysgenesis. This patient was diagnosed with tients had a history of amblyopia or strabismus shortly Norrie disease and excluded from this study. after birth (Table 2).

(REPRINTED) ARCH OPHTHALMOL / VOL 127 (NO. 12), DEC 2009 WWW.ARCHOPHTHALMOL.COM 1652

C D

Figure 5. An example of familial exudative retinopathy (FEVR). A, Fundus photograph and fluorescein angiography of patient 9 demonstrates a peripheral avascular zone (stage 1). B, The fellow eye had subretinal exudate and retinal detachment involving the fovea (stage 4b). C, Fundus photograph of patient 8 shows stage 1 FEVR. D, The fellow eye demonstrates stage 4b FEVR.

13 COMMENT resulted in this occurrence. Finally, Robitaille et al demonstrated that the L501fsX533 mutation decreased activation of the Wnt-Ca2ϩ pathway. It is therefore difficult FZD4 MUTATIONS to tell which intracellular Wnt pathway is disrupted by this mutation. The mutations found in this study involve residues that A double missense mutation, P33S/P168S, was found are located in distinct regions of the FZD4 protein. A novel mutation (C117R) was found in 2 patients. It is located in 9 of the screened patients. The P33S mutation is in in the extracellular Wnt-binding domain. In the wild- the signal sequence portion of the gene and could im- type protein, Cys117 forms a disulfide bond with Cys158 pair translocation of FZD4 to the plasma membrane. Ad- (in the CRD of FZD4).8 Presumably, disruption of this ditionally, proline is not a common amino acid and has bond causes a change in the FZD4 conformation, there- the unique characteristic of rigidity that could be essen- fore affecting its ability to bind ligands. Wu et al9 showed tial to the proper conformation of the protein. Another that similar cysteine mutations in the CRD of Norrin, a possibility is that this mutation affects a second tran- FZD4 ligand, resulted in the most severe phenotype. script of the FZD4 gene, FZD4S. This transcript variant The other novel mutation found in this study, C181Y, retains the intron between exon 1 and exon 2 and is 327 is located within the N-terminal extracellular domain of amino acids long. Currently, it is unclear whether FZD4S 14,15 FZD4 as well. This cysteine residue is not known to form is an antagonist or agonist of FZD4 signaling. an intracellular disulfide bond but it is the 11th of 13 cys- New blood vessel formation requires the coordina- teine residues that are conserved in vertebrate and may tion of endothelial cell division and the morphogenic be required for dimerization.10 Dann et al11 observed that movement of vessel expansion,16 and there is evidence other frizzled receptors can dimerize and proposed that for both canonical and noncanonical signal transduc- this may be relevant to the mechanism of Wnt binding tion in this process. For instance, LRP5 is known only and signaling. to participate in canonical signal transduction. Because The Q505X mutation falls immediately after the highly mutations in LRP5 have been associated with some cases conserved Wnt signaling motif (KTXXXW). Presum- of AdFEVR, it is likely that the canonical pathway plays ably, this early termination results in haploinsufficiency a role in vascular eye development. Additionally, in vitro due to nonsense-mediated mRNA decay. It is possible that testing in STF cells has shown that mutations in either a truncated protein is produced and terminated prior to FZD4 or LRP5 result in decreased Wnt/␤-catenin signal the PDZ binding motif (ETXV) of FZD4 (c-Jun N- compared with wild type.3 terminal kinase pathway) (Figures 1 and 2). Perhaps non- There is also evidence to support the noncanonical canonical signal transduction via the c-Jun N-terminal transmission of the signal. Zeng et al16 demonstrated that kinase pathway is necessary for normal angiogenesis and perpendicular orientation of endothelial cell division is vascularization of the retina. Alternatively, the mutant necessary for elongation of new vessels and suggests that allele may form an oligomer with the wild type, trap- planar cell polarity is required for this proper orienta- ping both in the endoplasmic reticulum. Kaykas et al12 tion. The FZD4 ligand, Wnt5a, has been shown to acti- demonstrated that a similar FZD4 mutation (L501fsX533) vate signal transduction by a planar cell polarity path-

(REPRINTED) ARCH OPHTHALMOL / VOL 127 (NO. 12), DEC 2009 WWW.ARCHOPHTHALMOL.COM 1653

©2009 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/03/2021 way. Wnt5a−/− animals have a disrupted polarization of Financial Disclosure: None reported. sensory hair cell stereocilia in the cochlea of the inner Funding/Support: This study was supported by the Mar- ear,17 similar to that seen in the FZD4−/− mice, which also garet Walters Research Fund; and The Association for have enlarged and disorganized vessels in both the coch- Retinopathy of Prematurity and Related Diseases. lea and retina.3 Additional Information: The eFigure is available at http: Perhaps the FZD4 signal transduction, through both //www.archophthalmol.com. canonical and noncanonical pathways, is necessary for normal vessel development. One could envision upregu- lation of endothelial cell growth stimulated by canoni- REFERENCES cal activated transcription followed by noncanonical stimulated cytoskeletal rearrangement and subsequent 1. Toomes C, Downey L. GeneReviews: Familial Exudative Vitreoretinopathy, Au- expansion of cells to form new vessels. tosomal Dominant. Seattle, OR: National Center for Biotechnology Information; 2008. 2. MacDonald ML, Goldberg YP, Macfarlane J, Samuels ME, Trese MT, Shastry BS. CLINICAL MANIFESTATIONS Genetic variants of frizzled-4 gene in familial exudative vitreoretinopathy and advanced retinopathy of prematurity. Clin Genet. 2005;67(4):363-366. This study highlights the complexity of categorizing ge- 3. Xu Q, Wang Y, Dabdoub A, et al. Vascular development in the retina and inner netic diseases. There is a clinical diagnosis and a genetic ear: control by norrin and frizzled-4, a high-affinity ligand-receptor pair. Cell. 2004; 116(6):883-895. diagnosis, neither of which alone sufficiently describes 4. Staal FJT, van Noort M, Strous GJ, Clevers HC. Wnt signals are transmitted through the disease state. Often a diagnosis of ROP or FEVR is N-terminally dephosphorylated ␤-Catenin. EMBO Rep. 2002;3(1):63-68. determined by family and birth histories in addition to 5. Yao R, Natsume Y, Noda T. MAGI-3 is involved in the regulation of the JNK sig- clinical findings. This study indicates that the differen- naling pathway as a scaffold protein for frizzled and Ltap. Oncogene. 2004; 23(36):6023-6030. tiation between these two diseases is not always distinct 6. Toomes C, Bottomley HM, Scott S, et al. Spectrum and frequency of FZD4 mu- because the same FZD4 mutation was highly prevalent tations in familial exudative vitreoretinopathy. Invest Ophthalmol Vis Sci. 2004; in both types of patients but not in controls. 45(7):2083-2090. Both ROP and FEVR share similar clinical pheno- 7. Nallathambi J, Shukla D, Rajendran A, Namperumalsamy P, Muthulakshmi R, types such as avascular peripheral retina, neovascular Sundaresan P. Identification of novel FZD4 mutations in Indian patients with familial exudative vitreoretinopathy. Mol Vis. 2006;12:1086-1092. changes, vascular tortuosity and dilation, exudation, and 8. Smallwood PM, Williams J, Xu Q, Leahy DJ, Nathans J. Mutational analysis of vitreoretinal fibrosis. However, the presence of a periph- norrin-frizzled recognition. J Biol Chem. 2007;282(6):4057-4068. eral avascular zone alone does not always lead to sec- 9. Wu W-C, Drenser K, Trese M, Capone A Jr, Dailey W. Retinal phenotype-genotype ondary complications in either disease. This is shown in correlation of pediatric patients expressing mutations in the Norrie disease gene. Arch Ophthalmol. 2007;125(2):225-230. this study by the fact that the parents of both types of 10. Omoto S, Hayashi T, Kitahara K, Takeuchi T, Ueoka Y. Autosomal dominant fa- patients and the twin with ROP who had the double- milial exudative vitreoretinopathy in two Japanese families with FZD4 mutations missense mutation were asymptomatic despite periph- (H69Y and C181R). Ophthalmic Genet. 2004;25(2):81-90. eral retinal avascularity (Figure 3). Presumably, many in- 11. Dann CE, Hsieh JC, Rattner A, Sharma D, Nathans J, Leahy DJ. Insights into Wnt dividuals with a peripheral avascular zone and a FZD4 binding and signalling from the structures of two frizzled cysteine-rich domains. Nature. 2001;412(6842):86-90. mutation are never evaluated. 12. Kaykas A, Yang-Snyder J, He´roux M, Shah KV, Bouvier M, Moon RT. Mutant frizzled It has long been suspected that genetics plays a role 4 associated with vitreoretinopathy traps wild-type frizzled in the endoplasmic in ROP, and a recent twin study18 concluded that there reticulum by oligomerizaton. Nat Cell Biol. 2004;6(1):52-58. is a 70% genetic predisposition to development of ROP. 13. Robitaille J, MacDonald ML, Kaykas A, et al. Mutant frizzled-4 disrupts retinal angiogenesis in familial exudative vitreoretinopathy. Nat Genet. 2002;32(2): Prior to this study, only 1 FZD4 mutation in a patient 326-330. 2 with ROP had been described. We suggest that the se- 14. Sagara N, Kirikoshi H, Terasaki H, et al. FZD4S, a splicing variant of frizzled-4, verity of retinal abnormalities is secondary to both ge- encodes a soluble-type positive regulator of the WNT signaling pathway. Bio- netic predisposition and epigenetics. It is our goal to in- chem Biophys Res Commun. 2001;282(3):750-756. vestigate this possibility in further studies. 15. Swain RK. Xenopus frizzled-4S, a splicing variant of Xfzd4 is a context- dependent activator and inhibitor of Wnt/B-catenin signaling. Cell Commun Signal. 2005;3:1-9. Submitted for Publication: March 13, 2009; final revi- 16. Zeng G, Taylor SM, McColm JR, et al. Orientation of endothelial cell division is sion received May 29, 2009; accepted June 6, 2009. regulated by VEGF signaling during blood vessel formation. Blood. 2007;109 Correspondence: Kimberly A. Drenser, MD, PhD, (4):1345-1352. 17. Qian D, Jones C, Rzadzinska A, et al. Wnt5a functions in planar cell polarity regu- Associated Retinal Consultants, William Beaumont lation in mice. Dev Biol. 2007;306(1):121-133. Hospital, 3535 W 13 Mile Rd, No. 344, Royal Oak, MI 18. Bizzarro MJ, Hussain N, Jonsson B, et al. Genetic susceptibility to retinopathy of 48073 ([email protected]). prematurity. Pediatrics. 2006;118(5):1858-1863.

(REPRINTED) ARCH OPHTHALMOL / VOL 127 (NO. 12), DEC 2009 WWW.ARCHOPHTHALMOL.COM 1654