OPHTHALMIC MOLECULAR GENETICS SECTION EDITOR: JANEY L. WIGGS, MD, PhD Clinical Presentation and Genetic Correlation of Patients With Mutations Affecting the FZD4 Gene Kimberly A. Drenser, MD, PhD; Wendelin Dailey, BS; Anand Vinekar, MD; Kunal Dalal, MD; Antonio Capone Jr, MD; Michael T. Trese, MD Objective: To correlate the ophthalmic findings of pa- other FZD4 mutations were found in the patients with tients with pediatric vitreoretinopathies with mutations ROP. Additionally, patients expressing the double mu- occurring in the FZD4 gene. tation had clinical presentations that overlapped, mak- ing it difficult to assign a definitive diagnosis. None of Methods: A total of 123 patients diagnosed with auto- the mutations found in the patients with FEVR or ROP somal-dominant familial exudative vitreoretinopathy (Ad- were seen in the control chromosomes. FEVR) or retinopathy of prematurity (ROP) and 42 con- trol patients were enrolled in the study. Diagnoses were Conclusion: Mutations occurring in the FZD4 gene affect based on retinal findings at each patient’s first examina- patients diagnosed with both FEVR and ROP. The clini- tion or during ROP screening. Genomic DNA was iso- cal picture often overlaps and may require a detailed birth lated and polymerase chain reaction and direct sequenc- and family history for diagnosis. Genetic testing con- ing of the FZD4 gene performed. firms inherited vitreoretinopathy and helps direct clini- cal management. Results: FZD4 gene mutations were discovered in 13 of the 123 (10.6%) patients. Nine of the 63 patients with Clinical Relevance: Patients diagnosed with ROP may AdFEVR (14.3%) has mutations in the FZD4 gene. Four have a mutation in the FZD4 gene and display charac- heterozygous mutations were identified: C117R, C181Y, teristics consistent with FEVR. Analysis of the FZD4 gene Q505X, and P33S/P168S. Four of the 60 patients with should be considered. ROP (6.7%) have a double missense mutation P33S/ P168S that was also found in the patients with FEVR. No Arch Ophthalmol. 2009;127(12):1649-1654 ϩ UTATIONS IN THE GENE the Wnt-Ca2 pathway. In vitro studies encoding the frizzled-4 have shown that transduction of the FZD4 receptor (FZD4) signal can occur by any of these path- (gene, FZD4; OMIM ways. Although it was originally thought 133780) have been de- that the path taken was determined by the Mscribed in many patients diagnosed with ligand, it is still unclear how the frizzled autosomal-dominant familial exudative receptor signals are transduced. retinopathy (AdFEVR)1 and in a smaller The canonical Wnt/␤-catenin pathway is number of patients with retinopathy of pre- the most thoroughly studied. Activation is maturity (ROP).2 In both diseases, the pa- initiated by ligand binding to both the FZD4 tient is born with enlarged and tortuous receptor and its coreceptor, the low-density retinal vessels and an area of avascular pe- lipoprotein receptor–related protein 5 ripheral retina. Additionally, varying de- (LRP5),ultimatelyresultingindephosphory- grees of subretinal exudation, vitreoreti- lation of ␤-catenin and translocation to the nal traction, and abnormal extraretinal nucleus.4 Nuclear ␤-catenin participates as vessels/neovascularization may occur. a transcriptional activator of the transcrip- Proper FZD4 signaling is necessary for tion factor and lymphoid enhancer–binding normal retinal vascular development.3 factor family of DNA-binding proteins Author Affiliations: Associated Frizzled-4 is a 537–amino acid, 7-trans- (Figure 2). Target genes include C-MYC, Retinal Consultants, William membrane receptor that transduces Wnt CYCLIN D1, and VEGF, presumably regu- Beaumont Hospital, Royal Oak, signaling (Figure 1 and Figure 2). Sev- lating cell proliferation in specific tissues. Michigan (Drs Drenser, Dalal, eral Wnt ligands, Wnt-3a, Wnt-8, Wnt- Similar to the canonical pathway, the pla- Capone, and Trese, and 5a, and the non-Wnt ligand, Norrin, are nar cell polarity pathway also involves ac- Ms Dailey); and the Department of Ophthalmology, Advanced known to activate FZD4. There are 6 in- tivation of disheveled protein subsequent to Eye Center, Postgraduate tracellular paths of Wnt signaling that can FZD4 activation (Figure 2). Unlike the ca- Institute of Medical Education occur downstream of frizzled receptor ac- nonical pathway, LRP5 is not needed for this and Research, Chandigarh, tivation: the canonical Wnt/␤-catenin path- signal transduction. Subsequently, 1 of 2 India (Dr Vinekar). way, the planar cell polarity pathway, and small guanosine triphosphatases (Rho or (REPRINTED) ARCH OPHTHALMOL / VOL 127 (NO. 12), DEC 2009 WWW.ARCHOPHTHALMOL.COM 1649 ©2009 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/03/2021 Cysteine-rich SS domain 7 Transmembrane domains Intracellular C-terminal domain (K-T-L-H-T-W) (E-T-V-V) AA No. (1-36) (45-204) (223-498) (499-504) (499-537) (534-537) (Wnt/Norrin) Canonical Wnt PDZ-1, noncanonical, Ligand-binding domain signaling motif JNK activation motif Figure 1. Diagram of frizzled-4 receptor (FZD4) amino acid sequence. AA inidcates amino acid; JNK, c-Jun N-terminal kinase; SS, signal sequence. β-Catenin Pathway Planar Cell Polarity Pathway Ca2+ Pathway Wnt/Norrin Wnt/Norrin Wnt/Norrin FZD4 FZD4 FZD4 LRP5/6 G-proteins Disheveled Disheveled Axin P Ca2+ GSK-3 Degradation APC β-Cat DAMM 1/2 β-Cat Rac1 RhoA PKC CamK-II (PKC pathway) JNK ROCK2 Nucleus (Cell survival) (Cytoskeleton Nucleus rearrangement) β-Cat NFAT, CREB TCF/LEF (Gene expression) (Gene expression) Figure 2. Schematic of frizzled-4 receptor (FZD4)–dependent pathways. APC indicates antigen-presenting cell; ␤-cat, ␤-catechin; Ca2ϩ, calcium ion; CamK-II, calcium-calmodulin kinase 2; CREB, cAMP response element-binding protein; DAMM, death-associated molecule related to Mch2; G-proteins, guanine nucleotide-binding proteins; GSK, glycogen synthase kinase 3; JNK, c-Jun N-terminal kinase; LRP, low-density lipoprotein receptor–related protein; NFAT, nuclear factor of activated T cells; P, phosphorylated site; PKC, protein kinase C; ROCK2, Rho-associated, coiled-coil–containing protein kinase 2; TCF/LEF, transcription factor and lymphoid enhancer–binding factor. Rac) is activated, which in turn activates an alternative sig- quence variations in relation to signal transduction and nal transduction pathway.5 The planar cell polarity path- disease type will be discussed. way mediates cytoskeletal organization and cell migration. 2ϩ In the Wnt-Ca pathway, FZD receptor activation METHOD stimulates an intracellular Ca2ϩ release, activating calcium- calmodulin kinase 2 and protein kinase C (Figure 2). This PATIENTS pathway is important in cell adhesion and cell move- ment during gastrulation. Patients were recruited to the study through a protocol ap- In this study, we used direct sequencing to screen for proved by the internal review board at William Beaumont Hos- mutations in the coding sequence of FZD4 in patients with pital and consented to participation. They were diagnosed with FEVR and ROP. The possible implications of these se- FEVR or ROP based on fundus examination, family history, and (REPRINTED) ARCH OPHTHALMOL / VOL 127 (NO. 12), DEC 2009 WWW.ARCHOPHTHALMOL.COM 1650 ©2009 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/03/2021 Table 1. Primers Used for Frizzled-4 Sequencing .Primer Sequence (5؅ to 3؅) Primer Length Product Length, Bases, No FZD4 exon 1 forward CTGCTACCCCCGATGCTG 18 396 FZD4 exon 1 reverse GGATGATCAACTTGGCATGG 20 FZD4 exon 2a forward ATTGCCTGGAAGCATTCAAC 20 570 FZD4 exon 2a reverse CGCTCAGGGTAGGAAAACCT 20 FZD4 exon 2b forward CAGCCTGTGTTTCATCTCCA 20 567 FZD4 exon 2b reverse ATTTTGAACAAGGCCACCAA 20 FZD4 exon 2c forward CTGGCTTGTGCTATGTTGGA 20 515 FZD4 exon 2c reverse AAGCATGGAGGCTGACTAGC 20 Table 2. Diagnosis and Frizzled-4 Mutations Age at Patient No. Highest Stage Presentation/ Relative Amino Acid by Diagnosis of Disease Family History With Mutation Change Base Change Novel FEVR 1 4b 1 wk NT C117R b349 (TGCϾCGC) Yes 2 4a; RRD Birth NT 3 4b 4 wk In process C181Y b542 (TGTϾTAT) Yes 4 4b 1 mo NT Q505X b1513 (CAGϾTAG) No 5 2; RRD 7 y NT P33S/P168S b97 (CCGϾTCG), b502 No 6 5 ROP screening Father (CCCϾTCC) 7 5 4 mo Father 84b1yNT 9 4b 7 mo NT APROP 10 5 ROP screening Mother and twin P33S/P168S b97 (CCGϾTCG), b502 No 11 5 ROP screening Mother and twin (CCCϾTCC) ROP 12 4b ROP screening NT P33S/P168S b97 (CCGϾTCG), b502 No 13 1 ROP screening NT (CCCϾTCC) Abbreviations: APROP, aggressive posterior retinopathy of prematurity; FEVR, familial exudative retinopathy; NT, not tested; ROP, retinopathy of prematurity; RRD, rhegmatogenous retinal detachment. gestational age. Participants provided a blood sample from which with AdFEVR (14.3%) were found to have mutations in genomic DNA was isolated from the leucocytes using the Purgene the coding sequence of FZD4 (Table 2). Four hetero- GenomicDNAPurificationKit(Qiagen,Valencia,California).When zygous mutations were found: C117R, C181Y, Q505X, possible, genomic DNA from the relatives of patients expressing and P33S/P168S (eFigure; www.archophthalmol.com). an FZD4 mutation were tested for sequence variations. In addition, 4 of the 60 patients with ROP (6.7%) had SEQUENCING the double missense mutation P33S/P168S that was found in the patients with FEVR (Table 2). No other FZD4 mu- The coding sequence and flanking splice sites of FZD4 were tations were found in the patients with ROP. None of the amplified from 100 ng of genomic DNA using Herculase Hot- mutations found in the patients with FEVR and ROP were start PCR Master Mix (Stratagene, La Jolla, California). Four seen in the 84 control chromosomes. sets of primers were used (Table 1). Amplification condi- Two novel missense mutations were found in pa- tions were as follows: 1 cycle at 98°C for 1 minute, 40 cycles tients with AdFEVR, C117R (2 patients) and C181Y. Both of 30 seconds at 98°C, 30 seconds at 55°C, and 1 minute at 72°C, and a final extension for 10 minutes at 72°C.