University of Vermont ScholarWorks @ UVM
Graduate College Dissertations and Theses Dissertations and Theses
2016 Barcoding the actin track: Differential regulation of myosin motors by tropomyosin Joseph Emerson Clayton University of Vermont
Follow this and additional works at: https://scholarworks.uvm.edu/graddis Part of the Molecular Biology Commons
Recommended Citation Clayton, Joseph Emerson, "Barcoding the actin track: Differential regulation of myosin motors by tropomyosin" (2016). Graduate College Dissertations and Theses. 638. https://scholarworks.uvm.edu/graddis/638
This Dissertation is brought to you for free and open access by the Dissertations and Theses at ScholarWorks @ UVM. It has been accepted for inclusion in Graduate College Dissertations and Theses by an authorized administrator of ScholarWorks @ UVM. For more information, please contact [email protected].
BARCODING THE ACTIN TRACK: DIFFERENTIAL REGULATION OF MYOSIN MOTORS BY TROPOMYOSIN
A Dissertation Presented
by
Joseph E. Clayton
to
The Faculty of the Graduate College
of
The University of Vermont
In Partial Fulfillment of the Requirements For the Degree of Doctor of Philosophy Specializing in Cellular, Molecular, and Biomedical Sciences
October, 2016
Defense Date: June 10, 2016 Dissertation Examination Committee:
Teresa Ruiz, Ph.D., Advisor Karen Lounsbury, Ph.D., Chairperson David Warshaw, Ph.D. Jason Stumpff, Ph.D. Cynthia J. Forehand, Ph.D., Dean of the Graduate College
ABSTRACT
Myosins and tropomyosins represent two types of actin filament-associated proteins that often work together in contractile and motile processes in the cell. While the role of thin filament troponin-tropomyosin complexes in regulating striated muscle myosin II is well characterized, the role of tropomyosins in non-muscle myosin regulation is not well understood. Fission yeast has recently proved to be a useful model with which to study regulation of myosin motors by tropomyosin owing to its tractable genetics, well-defined actin cytoskeleton, and established actin biochemistry. A hallmark of type V myosins is their processivity – the ability to take multiple steps along actin filaments without dissociating. However, the fission yeast type V myosin (Myo52) is a nonprocessive motor whose activity is enhanced by the sole fission yeast tropomyosin (Cdc8). The molecular mechanism and physiological relevance of tropomyosin-mediated regulation of Myo52 transport was investigated using a combination of in vitro and in vivo approaches. Single molecules of Myo52, visualized by total internal reflection fluorescence microscopy, moved processively only when Cdc8 was present on actin filaments. Small ensembles of Myo52 bound to a quantum dot, mimicking the number of motors bound to physiological cargo, also required Cdc8 for continuous motion. Although a truncated form of Myo52 that lacked a cargo-binding domain failed to support function in vivo, it still underwent actin- dependent movement to polarized growth sites. This result suggests that truncated Myo52 lacking cargo, or single molecules of wild-type Myo52 with small cargoes, can undergo processive movement along actin-Cdc8 cables in vivo. These findings outline a mechanism by which tropomyosin facilitates sorting of transport to specific actin tracks within the cell by switching on myosin processivity. To understand the broader implications of actomyosin regulation by tropomyosin we examined the role of two mammalian tropomyosins (Tpm3.1 and Tpm4.2) recently implicated in cancer cell proliferation and metastasis. As previously observed with Cdc8, Tpm3.1 and Tpm4.2 isoforms significantly enhance non-muscle myosin II (Myo2). Additionally, the mammalian tropomyosins enable Myo52 processive movement along actin tracks. In contrast to the positive regulation of Myo2 and Myo52, Cdc8 and the mammalian tropomyosins potently inhibit skeletal muscle myosin II, while having negligible effects on the highly processive mammalian myosin- Va. Thus, different motor outputs favoring functional specification within the same myosin class are possible in the presence of certain tropomyosins. In support of a conserved role for certain tropomyosins in regulating non-muscle actomyosin structures, Tpm3.1 rescued normal contractile ring dynamics, cytokinesis, and fission yeast cell growth in the absence of functional Cdc8. This work has broad implications with regard to regulation of non-muscle and muscle actomyosin function in complex cellular environments such as developing muscle tissue and metastatic cancer cells.
CITATIONS
Material from this dissertation has been published in the following form:
Clayton, J. E., Pollard, L. W., Murray, G. G., & Lord, M.. (2015). Myosin motor isoforms direct specification of actomyosin function by tropomyosins. Cytoskeleton. 72(3), 131-145.
Clayton, J. E., Pollard, L. W., Sckolnick, M., Bookwalter, C. S., Hodges, A. R., Trybus, K. M., & Lord, M.. (2014). Fission yeast tropomyosin specifies directed transport of myosin-V along actin cables. Mol Biol Cell, 25(1), 66-75.
ii
DEDICATION
This is dedicated to my parents, who have never wavered in their love and support. And to Diana, Caroline, and Wilder, who make everything brighter. With all my love – thank you.
iii
ACKNOWLEDGEMENTS
I am grateful to my advisors, Dr. Matt Lord, for the experience and training I gained while working in his lab, and Dr. Teresa Ruiz, for the support and guidance that got me across the finish line. I also want to thank my committee members, Dr. Karen Lounsbury, Dr. David Warshaw, and Dr. Jason Stumpff for all of the thoughtful discussions and advice. Finally, I would like to thank the members of the Molecular Physiology and Biophysics Department, and everyone who has contributed to the work presented in this dissertation.
iv
TABLE OF CONTENTS
Page
CITATIONS ...... ii
DEDICATION ...... iii
ACKNOWLEDGEMENTS ...... iv
LIST OF TABLES ...... ix
LIST OF FIGURES ...... x
CHAPTER 1: INTRODUCTION ...... 1
Actin ...... 2 Actin Polymerization ...... 4 Actin filament structure ...... 6 Myosin Motors ...... 7 Myosin Structure ...... 10 of Type V Myosins ...... 11 Tropomyosin ...... 13 Tropomyosin Expression and Localization ...... 14 Functional Roles of Tropomyosin ...... 18 Role of Tropomyosin During Development ...... 20 Involvement of Tropomyosin in Cancer ...... 21 The Benefits of Using Fission Yeast to Study the Actin Cytoskeleton ...... 23 Scope and Purpose ...... 24
CHAPTER 2: FISSION YEAST TROPOMYOSIN SPECIFIES DIRECTED TRANSPORT OF MYOSIN-V ALONG ACTIN CABLES ...... 28
Abstract ...... 29 Introduction ...... 30 Results ...... 32 Fission Yeast Tropomyosin Converts Myo52p into a Processive Motor...... 32 Tropomyosin Increases Myo52p Run Frequency and Run Length at Low ATP Concentration ...... 34 Myo52p Motors Work in Small Clusters that Rely on Tropomyosin for Effective Transport ...... 35 Myo52p Molecules Lacking a Cargo-Binding Domain Undergo Continuous Motility Along Actin Cables In Vivo ...... 37 v
Discussion ...... 39 Tropomyosin Promotes Myo52p Processivity by Altering The Kinetics of the Motor ...... 39 Alternative Modes of Cdc8p Regulation and Their Relationship to Established Models ...... 41 Materials and Methods ...... 43 Fission Yeast Strains and Genetic Approaches ...... 43 Plasmids ...... 44 Live-Cell Imaging ...... 45 Protein Purification ...... 46 Visualizing Myo52p-Qdot and Myo52p-Cy3 Motility By TIRF Microscopy ...... 47 Acknowledgments ...... 49 References ...... 50 Supplementary Figures and Legends ...... 69 Supplementary Movie Legends ...... 73
CHAPTER 3: MYOSIN MOTOR ISOFORMS DIRECT SPECIFICATION OF ACTOMYOSIN FUNCTION BY TROPOMYOSINS ...... 74
Abstract ...... 75 Introduction ...... 76 Results ...... 79 Selecting Representative Mammalian Tropomyosin Isoforms ...... 79 Differential Regulation of Myo2p and Skeletal Muscle Myosin-II by Mammalian Tropomyosins ...... 80 Differential Regulation of Myo52p and Myosin-Va by Mammalian Tropomyosins ...... 83 Activation of Fission Yeast Myosin-V Processivity by Mammalian Tropomyosins ...... 85 Mammalian Tropomyosin Tpm3.1 Can Function in Place of Fission Yeast Cdc8 In Vivo ...... 86 Discussion ...... 88 Positive Regulation of Non-Muscle Myosin Motors by Tropomyosins ....89 Importance of the Myosin Isoform in Tropomyosin-Mediated Regulation ...... 90 Materials and Methods ...... 93 Bacterial Plasmids ...... 93 Fission Yeast Plasmids and Strains ...... 94 Protein Purification ...... 95 Actin-Activated Atpase Assays ...... 96 In Vitro Actin Filament Gliding Assays ...... 97 Tracking Myo52p-Qdot Motility by TIRF Microscopy ...... 98 vi
Live Cell Imaging ...... 99 Acknowledgements ...... 100 References ...... 101 Tables ...... 108 Supplementary Movie Legends ...... 120
CHAPTER 4: DISCUSSION ...... 121
Future Directions ...... 125
LITERATURE CITED ...... 129
APPENDIX A: TROPOMYOSIN ISOFORM DEPENDENT REGULATION OF TYPE II MYOSIN ...... 145
Introduction ...... 145 Results ...... 148 Discussion ...... 150 Materials and Methods ...... 152 Bacterial Plasmid Expression ...... 152 Actin Expression and Purification ...... 153 Tropomyosin Expression and Purification ...... 153 Myo2 Expression and Purification ...... 154 Actin-activated ATPase Assay ...... 154 References ...... 156 Tables...... 160
vii
LIST OF TABLES
Table Page
Table 3-1. Effect of Cdc8 and the mammalian tropomyosins on the motor activity and motility of Myo2, SKMM-II, MYo52p, and myosin-Va ...... 108
Table A-1. Myo2 Vmax, Km (mM) (mean ± SD) and catalytic efficiency (Vmax/ Km) reported for all tropomyosin isoforms included in this study ...... 161
xiii
LIST OF FIGURES
Figure Page
Figure 1-1: Structure of the actin molecule ...... 3
Figure 1-2: Actin polymerization...... 5
Figure 1-3: Structure of the actin filament...... 6
Figure 1-4: Cartoon of myosin dimer...... 8
Figure 1-5: Myosin ATP hydrolysis cycle...... 9
Figure 1-6: Myosin head subdomains...... 10
Figure 1-7: Conserved amino acid heptad repeat that forms tropomyosin coiled-coil structure...... 14
Figure 1-8: Full cryo-EM reconstruction of F-actin and decorated with tropomyosin...... 15
Figure 1-9: Mammalian tropomyosin isoforms...... 16
Figure 1-10: Primary actin structures in fission yeast...... 24
Figure 2-1: Myo52p constructs and purification...... 62
Figure 2-2: Fission yeast tropomyosin is required for transport of single Myo52p molecules along actin filaments...... 63
Figure 2-3: Movements of single Myo52p molecules along actin and actin- tropomyosin tracks at low ATP concentration...... 64
Figure 2-4: Estimating the numbers of Myo52p molecules per motile particle in the cell...... 65
Figure 2-5: The cargo-binding domain of Myo52p is essential for in vivo function and clustering of Myo52p in subcellular particles in the absence of actin...... 66
xiv
Figure 2-6: Myo52p molecules lacking their cargo-binding domain undergo efficient motility along actin cables...... 67
Figure 2-7: Sorting of Myo52p to actin cables during interphase...... 68
Figure 2-S1: Cy3-labeled Myo52p molecules move processively along actin-Cdc8p filaments...... 69
Figure 2-S2: Cdc8p activates the motility of fluorescence Qdots coated with multiple Myo52p motors...... 70
Figure 2-S3: The cellular function of Myo52p relies on its C-terminal cargo-binding domain...... 71
Figure 2-S4: Polarized localization of truncated Myo52p lacking its cargo- binding domain relies on actin filaments...... 72
Figure 3-1: Tropomyosins under study...... 110
Figure 3-2: Regulation of Myo2p, SKMM-II, Myo52p, and myosin-Va motor activity by tropomyosin...... 111
Figure 3-3: Assessment of tropomyosin acetylation on SKMM-II inhibition and Cdc8p-mediated activation of Myo52p in actin-activated ATPase assays...... 112
Figure 3-4: Regulation of Myo2p- and SKMM-II-driven actin filament gliding by tropomyosin...... 113
Figure 3-5: Effect of tropomyosin on SKMM-II-driven actin filament gliding in relation to myosin concentration...... 115
Figure 3-6: Regulation of Myo52p processivity by tropomyosin...... 116
Figure 3-7: Mammalian tropomyosin Tpm3.1cy rescues Cdc8p function in vivo...... 117
Figure 3-8: Model depicting differential regulation of myosins by the “closed” actin-tropomyosin state...... 119
Figure 4-1: Three-dimensional reconstructions of negatively stained actin filaments...... 128
Figure A-1: Schematic summary of exon usage by mammalian tropomyosin isoforms from the TPM1 gene included in this study...... 162
xv
Figure A-2: Differential regulation of Myo2p actin-activated ATPase activity by non-muscle tropomyosin...... 163
Figure A-3: Relationship between tropomyosin termini and Myo2 regulation...... 164
Figure A-4: Alignment of overlapping N- and C-termini regions from tropomyosin isoforms included in this study...... 165
xvi
Chapter 1: Introduction
The actin cytoskeleton enables eukaryotic cells to respond to developmental and environmental cues with diverse processes, including cell motility, cargo transport, endocytosis, and cytokinesis. These processes rely upon the diverse structures that comprise the actin cytoskeleton and their interactions with myosin motors. Actomyosin complexes provide both the architecture and the force necessary to accomplish these critical tasks. Migrating cells use actomyosin for the translocation of the cell body and the subsequent retraction of the trailing edge (Mitchison et al., 1996). Myosin motors transport cellular components along an elaborate network of actin filaments to meet the specific spatial needs of a cell (Sellers et al., 2006). Cytoplasmic membrane-bound actomyosin patches remodel the cell following endocytosis (Kovar et al., 2011) and the constricting actomyosin ring facilitates the division of replicating cells during cytokinesis (Miller, 2011). Although actin and myosin are essential for each of these processes, they are not sufficient. Numerous actin-binding proteins (ABPs) are critical to form diverse actin structures and for the regulation of myosin motors (dos Remedios et al., 2003; Uribe et al., 2009). It is becoming increasingly clear that the tropomyosin family of ABPs plays an important role in the formation of actin structures as well as in determining their function (Gunning, Hardeman, et al., 2015; Manstein et al., 2016).
Tropomyosin has been identified as playing an important role in regulating myosin function. In particular, the role of tropomyosin in regulating muscle myosin has been the focus of a considerable number of studies, which have provided extensive insights into the mechanism of tropomyosin function (Galinska-Rakoczy et al., 2008;
1
Gordon et al., 2000; Trybus, 1991; Webb, 2003). However, considerable differences exist between actomyosin structures in muscle and nonmuscle cells that indicate a functionally distinct role of tropomyosin in nonmuscle environments.
Actin
Actin is the most abundantly expressed protein in eukaryotic cells (T. D.
Pollard, 2016). Bacteria, archaea, and eukaryotes all express highly functionally related forms of actin (Herman, 1993). The actin population in the cell comprises both globular monomers (G-actin) and filamentous polymers (F-actin). Actin monomers consist of
375 amino acids with a molecular mass of 42 kDa. Structurally related to hexokinases, sugar kinases and Hsp70, actin is a flat protein that is folded into four subdomains,
SD1-4. SD1 and SD3 exhibit a high degree of sequence similarity likely due to a gene duplication event (Dominguez et al., 2011). SD2 and SD4 are small insertions within
SD1 and SD3, respectively. The sequence spanning residues Gly137 to Ser145 connects subdomains SD1 and SD3 and acts as a pivot point within the molecule (von der Ecken et al., 2015). Additionally, this arrangement forms an upper and lower cleft between the subdomains SD2 and SD3. The upper cleft contains an adenine nucleotide-binding pocket between SD1 and SD3. The lower cleft contains the binding site for actin subunit interactions required for filament formation, as well as the interaction site for most ABPs (von der Ecken et al., 2015) (Figure 1-1). This arrangement causes the nucleotide bound at the upper cleft to affect actin polymerization and ABP association.
2
Figure 1-1. Structure of the actin molecule. (A) Ribbon diagram of the actin molecule with space-filling ATP (protein data bank [PDB]: 1ATN). (B) Space- filling model of actin showing the nucleotide-binding cleft with ATP in situ and barbed-end groove. (Modified from Pollard and Earnshaw 2007.)
In contrast to the single actin isoform expressed in yeast, mammals express six actin isoforms. Four actin isoforms are expressed exclusively in muscle: α-skeletal, α- cardiac, α-smooth, and γ-smooth; while β-cytoplasmic and γ-cytoplasmic are ubiquitously expressed (Perrin et al., 2010). Although mammalian actin isoforms are highly conserved – having at least 93% sequence identity – there is limited ability to replace one isoform with another, indicating the importance of even a relatively small fraction of sequence variation to the protein’s function (Gunning, Ghoshdastider, et al.,
2015). Additionally, to further increase diversity, eukaryotic actin is regulated by a
3 number of post-translational modifications, including phosphorylation, acetylation, and methylation (Dominguez & Holmes, 2011). Methylation of actin His-73 in many species regulates stability and interdomain flexibility, while N-terminal acetylation enables actomyosin interactions in muscle cells (Terman et al., 2013).
Actin polymerization
Actin self-assembles into filaments at physiological salt concentrations in the presence of adenosine nucleotides and either Ca2+ or Mg2+ (Chesarone et al., 2009). The helical arrangement of actin monomers in the filamentous polymer results in a polarized structure. The polarization was first revealed by the arrowhead-like structure observed by electron microscopy when myosin was bound to actin filaments. This led to the naming of the pointed (or minus) and barbed (plus) ends (Huxley, 1963). Actin filament length can be highly dynamic and is determined by the ratios between addition and removal of actin subunits at the pointed and barbed ends (Figure 2-1). Diffusion limited subunit addition is slightly faster at the barbed end while subunit disassociation is slow at both ends of the filament (T. D. Pollard et al., 1981).
Rates of actin subunit association are dependent on the bound nucleotide.
Adenosine triphosphate (ATP) bound subunits are more stable than adenosine diphosphate (ADP) bound subunits in the actin filament nucleus (T. D. Pollard, 2016).
The critical concentration for polymerization of ATP bound actin at the barbed end is
0.1 mM compared to 1.8 mM for polymerization of ADP bound actin (Blanchoin et al.,
2002). Once an actin subunit has assembled into the filament the hydrolysis rate of bound Mg-ATP is much faster than the one of G-actin, at 0.3 sec-1 and 7 X 10-6 sec-1,
4 respectively (Blanchoin & Pollard, 2002). Hydrolysis of ATP to ADP occurs soon after subunit addition, resulting in ATP bound subunits at the filament ends and tightly bound
ADP, or ADP-Pi, bound subunits in the center (Carlier et al., 1986). The process of
ATP hydrolysis and phosphate release along the filament results in actin “treadmilling”
– the steady-state addition of subunits at the barbed end and the simultaneous disassociation of subunits at the pointed end (Wegner, 1976). The rates of these
Figure 1-2. Actin polymerization. Cartoon showing ATP- (T) and ADP- (D) actin association rates at the pointed (top) and barbed (bottom) ends. (Modified from Pollard and Earnshaw 2007.) processes seem to indicate that actin filaments should be inherently stable, however, in vivo experiments demonstrate the role of ABPs in providing an additional level of regulation. In some cases, ABPs can lead to an unexpected high degree of filament instability (T. D. Pollard, 2016).
5
Actin filament structure
Actin filaments are left-handed helices comprised of 13 molecules per six turns and can be envisioned as two intertwined strands of actin monomers (Figure 1-3). The axial repeat of the helix is 35.9 nm and the rise per subunit is 27.5 Å. However, F-actin cannot be described as a structure with a single set of helical parameters since it has
Figure 1-3: Structure of the actin filament. (left) Reconstruction of the actin filament from cryo-electron micrographs. (right) Cartoon of the actin filament showing the position of the pointed and barbed ends. (Figure from Fujii et al. 2010 and adapted from Pollard 2016.)
6 been shown to exhibit both twist (Egelman et al., 1982) and subunit tilt variations
(Galkin et al., 2002). The two strands of F-actin are stabilized by interactions at the intra- and inter-strand level. Intra-strand binding is predominantly due to the enveloping of a β-sheet of subdomain SD3 by the DNase I binding loop (D-loop) of the neighboring actin subunit, forming a “lock-and-key” interface (von der Ecken et al.,
2015). Several salt bridges between SD3 and SD4 residues and numerous hydrophobic interactions between residues of adjacent subunits further reinforce intra-strand stability
(von der Ecken et al., 2015). The “hydrophobic plug” connecting three subunits of F- actin contributes to the inter-strand stability of F-actin. Although this connection was originally attributed to hydrophobic interactions, recent structural studies have demonstrated that these inter-strand contacts are the result of electrostatic bonds between the negatively charged surface of the plug with a patch of positive charge on the surface of the opposing actin (von der Ecken et al., 2015).
Myosin Motors
Myosins belong to a large family of molecular motor proteins that bind actin filaments and generate mechanical force as a result of structural changes induced by the hydrolysis of ATP. There are at least 35 classes, or types, of myosin motors categorized by sequence homology. All myosins move toward the plus-end of actin, with the exception of myosin VI, which moves to the minus end (Wells et al., 1999).
Independently of the type, all myosins consist of three primary functional domains
(Figure 1-4). The head domain, which is highly conserved across all myosins, contains both an actin-binding and a nucleotide-binding site. The neck domain, also known as 7 the lever arm, is a short alpha-helical strand containing from one to seven IQ motifs.
Calmodulin-like light-chain subunits bind to the IQ motifs and increase the force- transducing properties of the myosin by stiffening the neck. Extending from the neck,
Figure 1-4: Cartoon of myosin dimer. The globular heads are located at the N- terminus and are linked to the coiled-coil tail by the neck domains which are stiffened by regulatory (RLC) and the essential (ELC) light chains. (Modified, with permission, from Tajsharghi,
the tail domain consists primarily of a long alpha-helical strand. The length of this region and the C-terminal sequence varies considerably across myosin types and is consistent with their function in the cell. Most myosin types, including type II and type
V, exist as homodimers due to a coiled-coil structure formed by complementary α- helical tail domains. Phosphorylation of bound light-chains regulates the ability of type
II myosin dimers to form filament ensembles, as well as the motor activity (Matsumura et al., 1998; Matsumura et al., 2001).
The ability of myosin motors to exert force on actin filaments is directly coupled to their ATPase activity. Myosins hydrolyze ATP in the absence of actin, however
ADP and inorganic phosphate (Pi) release is very slow under these conditions. Initial 8 binding to actin causes myosin to release Pi, strengthening the attachment to actin
(strong-bound state) and triggering the force generating power stroke of the molecule.
Subsequently, ADP is released and ATP is free to bind to myosin, causing it to detach from the actin filament. Unbound myosin hydrolyzes ATP, returning the head to the
“cocked” position, readying it to start a new cycle (Figure 1-5).
Figure 1-5. Myosin ATP hydrolysis cycle. Diagram showing the steps of ATP hydrolysis for myosin with weak actin-bound states in blue and strong actin-bound states in green. (Used with permission from De La Cruz and Ostap, 2004).
The kinetic cycles of all myosins contain the steps described above, however the rates of completion of each step are highly variable (De La Cruz et al., 2004). The variations in kinetic cycles generate myosin motors specialized for particular functions within the cell. The ratio of the time spent in the strong-bound state versus the total cycle time is termed the duty ratio. Low duty ratio myosins are efficient at the cooperative translocation of actin. This is clearly exemplified by the type II myosins moving actin filaments within the highly ordered sarcomere. In contrast, cargo- 9 transporting type V myosins are kinetically tuned to spend a large percentage of time in the strong-bound state. Myosins having a duty ratio of 0.5 and above are classified as processive – a characteristic that enables single myosin molecules to travel long distances on actin without detaching.
Myosin structure
High-resolution structural analysis of skeletal muscle myosin has revealed much about the relationship between myosin ATPase activity and its association with actin.
The myosin head domain is divided into four principal subdomains: the upper and lower 50-kDa, the N-terminal, and the converter subdomains (Figure 1.6). The nucleotide-binding pocket resides between the upper 50-kDa and the N-terminal
Figure 1-6: Myosin head subdomains. The four principal head subdomains of type V myosin: upper 50-kDa in blue (U50), lower 50-kDa in white (L50), N- terminal in grey, and the converter in green
10 subdomains, while the actin binding region consists of four actin binding loops on, and between, the upper and lower 50-kDa subdomains. A large opening between the upper and lower 50-kDa subdomains, known as the 50-kDa cleft, runs between the actin binding region and the nucleotide binding site (Rayment et al., 1993). It is predicted that the 50-kDa cleft closes upon release of ADP, promoting the strong actin-bound state (Rayment et al., 1993; Volkmann et al., 2000). The converter subdomain links the
N-terminal subdomain and the lower 50-kDa subdomain with the light chain-reinforced lever arm, allowing for the translation of small structural changes in the head into large movements of the lever arm (Sweeney et al., 2010). Allosteric effects between myosin dimer heads, or gating, are critical for the translocation of an actin filament and for the efficient movement of a motor along a fixed actin filament.
Type V myosin
Type V myosins are obligate dimers found in diverse eukaryotic organisms where their central role is cargo transport (Reck-Peterson et al., 2000). Canonical type
V myosins, including the archetype MyoV, have two heavy chains consisting of a motor domain followed by a long α-helical neck region containing six IQ motifs. The binding of calmodulin or calmodulin-like light chains to the IQ motifs stiffens the neck.
Dimerization is facilitated by the formation of the coiled-coil tail domain that extends out from the neck and terminates at the globular cargo-binding domain (CBD). The
CBD associates with diverse cargo – e.g. vesicles, melanosomes, and mRNA – via adaptor protein complexes (Wu et al., 2002). Typically type V myosins are processive with a step size of 36 nm, corresponding to the distance between the actin filament 11 helical repeat (Taylor, 2007). The 36 nm step size is likely the result of the combined
~20-25 nm movement of the myosin V center of mass following rotation of the actin bound head and neck region, with the ~11-16 nm movement achieved by the diffusional search of the free head for the next actin binding site (Burgess et al., 2002; Moore et al.,
2001; Purcell et al., 2002; Sellers & Veigel, 2006; Veigel et al., 2002; Walker et al.,
2000). The tight distribution of step-size, and 13 actin monomer distance between the heads when both heads are bound to actin, indicates that myosin V is restricted to specific binding sites on the actin filament (Sellers & Veigel, 2006).
Type V myosins tend to have a high affinity for actin and spend a large portion of their kinetic cycle in the strong bound-state with actin. Human MyoVa has an estimated duty ratio of 70%, constituting a highly processive motor (De La Cruz et al.,
1999). This characteristic is essential to MyoV’s ability to be an efficient cargo transporter and is a product of its kinetic cycle. ADP release is the rate-limiting step of the actin-activated ATPase cycle for most type V myosin. In contrast, the release of Pi is relatively fast compared to conventional type II myosins in which Pi release is the rate-limiting step. The binding of nucleotide-free type V myosin to actin is more rapid than other myosin types, potentially due to a partially closed 50-kDa cleft even prior to actin binding (Coureux et al., 2003). Additionally, type V myosin has a strong affinity for F-actin when bound to ATP and ADP-Pi – conventionally the weak-bound states.
The disassociation constant of ATP-bound MyoV for actin at physiological salt concentration is approximately 100 fold higher than myosin-II under comparable conditions (Berger et al., 1991; Yengo et al., 2002).
12
Unexpectedly, in vitro kinetic studies have identified numerous non-processive type V myosins, including Myosin Vc (human) (Takagi et al., 2008), Myosin V (fruit fly) (Toth et al., 2005), Myo2p (budding yeast) (Hodges et al., 2009; Reck-Peterson et al., 2001), and Myo52 (fission yeast) (Clayton et al., 2010). However, in vivo studies have demonstrated that some non-processive type V myosins are required for cargo transport (Clayton et al., 2010; Hodges et al., 2009; Reck-Peterson et al., 2001).
Regulation of non-processive type V myosins by ABPs, including tropomyosin, may explain the ability of an otherwise non-processive motor accomplishing efficient cargo transport.
Tropomyosin
Tropomyosins are a family of alpha helical proteins that associate with actin filaments. The characteristic coiled-coil structure of tropomyosin results from the formation of parallel dimers that self-polymerize into filaments via head-to-tail interactions (Tobacman, 2008). The tropomyosin sequence exhibits the characteristic heptad-repeat – with amino acids labeled a-g – that leads to a coiled-coil structure.
Residues a and d of the two α-helices interact to form the hydrophobic core of the tropomyosin molecule. Stabilization of the structure is mediated by the formation of inter-strand salt bridges between amino acids e and g (Hitchcock-DeGregori, 2008)
(Figure 1-7).
Filamentous tropomyosin lies along the F-actin groove (von der Ecken et al.,
2015) (Figure 1-8). Unlike most actin binding proteins, tropomyosin binds F-actin with low affinity (Kd~10-3) (Wegner, 1979). Structural studies have determined that 13
Figure 1-7. Conserved amino acid heptad repeat that forms tropomyosin coiled-coil structure. The hydrophobic interactions between residues a and d are stabilized by ionic interactions between residues g and e. (Hitchcock-DeGregori, Tropomyosin.
tropomyosin ‘hovers’ above F-actin at a distance of ~40 Å (von der Ecken et al., 2015).
There are at least two models to explain the interactions between tropomyosin and actin.
The first model describes tropomyosin binding to actin via localized regions present on the tropomyosin molecule that define the structural conformation of the copolymer
(Singh et al., 2006). Alternatively, the “Gestalt-binding” model postulates that the binding affinity of the two polymers cannot be explained by the formation of a number of weak ionic interactions, but instead is the product of the two filaments’ complementary helical structures (Holmes et al., 2008). At the core of the “Gestalt- binding” model is the observation that only tropomyosin in filamentous form has been observed decorating actin, and that tropomyosin filaments are able to readily shift positions relative to the actin filament.
14
Figure 1-8: Full cryo-EM reconstruction of F-actin and decorated with tropomyosin. a. Actin (grey) with five central subunits in green and one subunit in cyan decorated with tropomyosin (yellow). b, Close-up view of a with the atomic and molecular model of an F-actin subunit (cyan) and tropomyosin (yellow) and their corresponding densities, respectively. The density corresponding to ADP is depicted in red. (Figure used with permission from von der Ecken et al. Nature 2015.)
Tropomyosin expression and localization
Mammalian cells contain four tropomyosin genes, TPM1-4. Over 40 known tropomyosin isoforms are expressed from TPM1-4 through alternative splicing of 15 exons (Gooding et al., 2008) (Figure 1-9). Tropomyosin isoforms are divided into two categories by their size. High molecular weight isoforms contain approximately 284 amino acids and span seven actin subunits. Low molecular weight isoforms contain approximately 248 amino acids and span six actin subunits. The origin of the size
15 difference between tropomyosin isoforms resides in the N-terminal exons. High molecular weight isoforms contain exon 1a together with either 2a or 2b while low molecular weight isoforms contain only exon 1b. Metazoan cells can express up to eight different tropomyosin isoforms – with comparable actin affinities – at a given time.
Figure 1-9: Mammalian tropomyosin isoforms. Four mammalian tropomyosin genes (TPM1-4) produce up to 40 alternative splice isoforms. High molecular weight isoforms contain exon 1a together with either 2a or 2b while low molecular weight isoforms contain only exon 1b.
16
Extensive work has been done using tropomyosin isoform-specific antibodies to characterize the tropomyosin expression profile and subcellular localization within numerous mammalian cell types (Schevzov & O'Neill, 2008; Schevzov et al., 2011).
Antibody labeling of neurons revealed Tpm3.1 and Tpm3.2 are present only in the neurite. Following treatment with the actin polymerization-blocking drug, cytochalasin
B, the localization of Tpm3.1 and Tpm3.2 was diffuse in the growth cones. Removal of cytochalasin B returned Tpm3.1 and Tpm3.2 localization to the neurite (Schevzov et al.,
1997). These studies demonstrate that the distinct intracellular localization of tropomyosin isoforms does not rely on transport mechanisms. However, it does require the maintained integrity of actin structures at those locations. At least seven tropomyosin isoforms are expressed in osteoclasts. Tpm1.8 and Tpm4.2 are enriched at sites of osteoclast attachment and podosomes while Tpm3.1 is diffuse throughout the cell cytoplasm (McMichael et al., 2006). Tpm3.2 expressed in fibroblasts localizes to short actin filaments associated with the Golgi complex during the G1 phase of the cell cycle, while the highly similar Tpm3.1 predominantly localizes to stress fibers (Percival et al., 2004). A study conducted using mouse myoblasts evaluated the role of the tropomyosin N-terminus in regulating tropomyosin isoform localization. Levels of the high molecular weight tropomyosin isoform, Tpm1.7, are low at the cell periphery of myoblasts compared to levels of the low molecular weight isoform, Tpm3.1. Replacing the N-termini of Tpm3.1 with the N-termini of Tpm1.7 did not result in diminished levels of the Tpm3.1 chimera, indicating that the N-terminus is not sufficient to direct tropomyosin isoform localization (Martin et al., 2010).
17
Recent evidence has implicated the formin family of unbranched-actin nucleating proteins as playing a role in the localization of tropomyosin isoforms.
Decoration of specific actin structures with acetylated versus unacetylated tropomyosin is determined by formin activity in fission yeast (Johnson et al., 2014). Mammalian cells, which express forty tropomyosin isoforms, have at least 15 different types of formins (T. D. Pollard, 2016). Dorsal stress fiber formation in human osteosarcoma cells requires at least five tropomyosin isoforms as well as the activity of specific formins (Hotulainen et al., 2006; Tojkander et al., 2011). One model proposed to describe the role of formins in the localization of tropomyosin isoforms depicts formin attached to both the barbed end of a nucleated actin filament, as well as to the N- terminus of tropomyosin (Gunning, Hardeman, et al., 2015). The large number of formins expressed in mammalian cells could provide a mechanism for localizing tropomyosin isoforms to specific actin structures (Gunning, Hardeman, et al., 2015;
Johnson et al., 2014), however further studies are needed to determine the extent of formins involvement in this process.
Functional role of tropomyosin
The role of tropomyosin has been studied extensively in contractile muscle systems, in which, in concert with troponin and in response to varying levels of Ca2+, tropomyosin governs the ability of the myosin thick filament to form cross bridges with actin (Gordon et al., 2000). This regulation is dependent on troponin in a Ca2+ level dependent manner. At low Ca2+ levels, troponin is bound to actin and tropomyosin, maintaining tropomyosin in the “blocked” state. The binding of Ca2+ to troponin permits
18 an ~25° azimuthal shift of tropomyosin along actin to assume the “closed” state, allowing for initial myosin binding followed by a rapid shift by tropomyosin to the
“open” state (Xu et al., 1999). However, in the context of non-muscle cells, in which regulation by troponin and Ca2+ levels is absent, the role of tropomyosin in regulating myosin is less clear.
Previous studies have characterized the effects of overexpressing specific tropomyosin isoforms in non-muscle cells. These studies have added to our understanding of how tropomyosins function to regulate actomyosin structures and actin associated processes in a non-muscle setting. Overexpression of Tpm3.1 in the rat cortical neuroblastoma B35 cell line led to increased levels of non-muscle type II myosins at specific actin structures: myosin IIA at stress fibers and myosin IIB at the cell peripheral cortex (Bryce et al., 2003). Consequently, recruitment of myosin IIA to stress fibers inhibited lamellipodia formation and cell migration. In contrast, Tpm1.12 overexpression favored lamellipodia formation, reducing stress fiber formation, and resulting in an increase in cell motility (Bryce et al., 2003). Additionally, Tpm3.1 overexpression in B35 cells reduces the velocity and directional persistence of cell motility by decreasing the turnover rate of focal adhesions. B35 cells overexpressing
Tpm1.7, which also localizes to stress fibers, did not affect directional persistence and resulted in a less marked decrease in velocity (Bach et al., 2009).
Decoration of actin filaments by specific tropomyosin isoforms blocks particular myosins from binding to actin. Actin filaments containing Tpm1.6 exclude Myo1b in
NRK cells (Tang et al., 2001) and inhibit Myo1c in vitro activity (McIntosh et al.,
2015). In fission yeast, type I myosin is blocked from interacting with filaments that
19 contain tropomyosin. Consequently, type I myosin localizes at actin structures containing the actin bundling protein fimbrin, which displaces tropomyosin from actin filaments (Clayton et al., 2010). The actin binding protein complex, ADF/cofilin, is also regulated by the expression of different tropomyosin isoforms. The actin severing activity of ADF/cofilin in B35 neuroblastoma cells is inhibited by overexpression of
Tpm3.1, while overexpressing Tpm1.12 favors severing by cofilin (Bryce et al., 2003;
Creed et al., 2011). The interplay between cofilin and tropomyosin could be the result of a competition for the same actin binding site (Kuhn et al., 2008). Alternatively, changes to the actin filament structure induced by bound tropomyosin could inhibit cofilin binding, or the roles could be reversed (Kuhn & Bamburg, 2008).
Tropomyosin has also been shown to regulate actin polymerization and filament stability. Over expression of Tpm3.1 in primary hippocampal neurons increases actin polymer levels (Schevzov, Fath, et al., 2008). In vitro studies demonstrated that alpha/alpha- and alpha/beta-tropomyosin decrease the bulk actin polymerization rate by stabilizing actin filaments, thus reducing the number of actin filament ends (Hitchcock-
DeGregori et al., 1988). Furthermore, decoration of purified F-actin with non-muscle tropomyosin decreased the rate of actin depolymerization at the pointed end by 44%
(Broschat et al., 1989).
Role of tropomyosin during development
Expression of tropomyosin isoforms is tightly regulated temporally and spatially. Changes to tropomyosin expression during development can lead to aberrant neuronal outgrowth, organ defects, and death. Tropomyosin isoforms are important for
20 the control of actin filaments required for neuronal morphogenesis and neurite outgrowth in B35 neuroblastoma cells (Curthoys et al., 2014). Similarly, Tpm3.1 expression promotes growth cones and increases the number of axonal branches and the number of dendrites while Tpm1.7 inhibits neurite outgrowth (Schevzov et al., 2005).
The Drosophila tropomyosin II gene (TmII) regulates the size of the dendritic branch network and interacts with flamingo, a membrane receptor that regulates dendritic growth (Li et al., 2003). In addition to its roles in neurons, tropomyosin is an important regulator of cardiac development. Translational regulation of alpha-tropomyosin isoforms is required for cardiac muscle morphogenesis (Rethinasamy et al., 1998).
Involvement of tropomyosin in cancer
The loss of actin microfilament structures in transformed cancer cells was first described in 1975 (Pollack et al., 1975; Wang et al., 1976). After this discovery, alterations in the tropomyosin profile of a variety of transformed cell lines have been characterized – indicating the potential involvement of tropomyosins in the transformation process (H. L. Cooper et al., 1985; Hendricks et al., 1981, 1984; Leavitt et al., 1986; Leonardi et al., 1982). A few striking trends have emerged from these studies. Tpm3.1 expression is maintained in all characterized tumor cells (Stehn et al.,
2006). The loss of Tpm2.1 correlates closely with cell transformation, while restoring
Tpm2.1 levels – or increasing Tpm1.6 levels – reverses key transformation features
(Bharadwaj et al., 2005; Boyd et al., 1995; Gunning, Hardeman, et al., 2015).
Additionally, the overall amount of tropomyosin decreases in transformed cells compared to untransformed cells (Leonardi et al., 1982). Tpm1.8 expression levels
21 directly correlate with B16 mouse melanoma cell motility (Helfman et al., 2008;
Miyado et al., 1996). While some tropomyosin-dependent effects appear to be consistent across studies, the effect of a given tropomyosin can vary considerably between two cell types. For instance, Tpm2.1 inhibits cell adhesion-independent growth in Syrian hamster embryo cells (Boyd et al., 1995). However, Tpm2.1 promotes sensitivity of breast cancer cells to anoikis by increasing stress fiber formation
(Bharadwaj et al., 2005).
Several studies have indicated potential mechanisms to explain the role of tropomyosin in the transformation process, some of which rely on the activity of myosins. Depletion of Tpm3.1 and Tpm3.2 reduces actomyosin-induced tension at the apical junctions of the zonula adherens in epithelial colorectal adenocarcinoma cells
(Caldwell et al., 2014). Furthermore, measurements conducted with an atomic force microscope demonstrate the role of tropomyosin isoforms in regulating cell stiffness in a myosin II dependent manner. Over expression of Tpm3.1 in B35 neuroblastoma cells led to the greatest increase in cell stiffness (Jalilian et al., 2015). Tropomyosins are also involved in signaling pathways that contribute to cell growth and proliferation. The
ERK-regulated cell proliferation pathway depends on Tpm3.1 for the nuclear translocation of pERK by importin7 (Schevzov et al., 2015). Understanding the mechanism of the involvement of tropomyosin in the transformation process is critical to developing novel anticancer therapeutics that target tropomyosin.
22
Fission yeast as a model organism for studying the actin cytoskeleton
Fission yeast provides a powerful system for studying actomyosin regulation due to its highly tractable genome as well as its relatively simple actin cytoskeleton and few myosin types. The sole fission yeast actin gene produces the subunits for the three primary actin structures: actin patches, actin cables, and the contractile ring (Figure 1-
10). Actin patches are a dynamic network of branched actin and type I myosin involved in endocytosis and membrane remodeling. Actin cables are unbranched parallel bundles of actin that act as polarized tracks for cargo transport by type V myosin motors. The contractile ring consists of unbranched anti-parallel actin bundles that guide cell wall deposition during cytokinesis through the “ratcheting” action of type II myosin (Lord et al., 2005).
Fission yeast contains only five myosin motor isoforms, including two type II myosins: the essential Myo2 required for ring constriction, and the non-essential Myp2
(Mulvihill et al., 2003; Sladewski et al., 2009). Additionally, there are two type V myosins: Myo51 and Myo52. Myo52 is required for cargo transport along cables while
Myo51 appears to aid in cytokinesis (East & Mulvihill, 2011; Win et al., 2001). The single headed Myo1, active at actin patches, is the only type I myosin in fission yeast
(Lee et al., 2000). The sole fission yeast tropomyosin, Cdc8, contains 161 amino acids and covers four actin subunits. Cdc8 exists in two forms, acetylated and unacetylated.
Approximately 80% of Cdc8 is N-terminally acetylated and is required to regulate
Myo2 at the ring during mitosis (Coulton et al., 2010). However, acetylation of Cdc8 is not required to regulate type I or type V myosins (Coulton et al., 2010).
23
Figure 1-10: Primary actin structures in fission yeast depicted during the cell cycle.
Scope and Purpose
The focus of the studies included in this dissertation is characterizing the role of
tropomyosin in regulating non-muscle myosin, with the intent of improving our
understanding of tropomyosin function in normal and diseased non-muscle cells.
Previously we identified the fission yeast tropomyosin Cdc8 as playing a role in
regulating the activity of type V myosins. Decoration of F-actin with Cdc8 increases
the actin affinity of purified full length Myo52, producing a 2 to 3-fold decrease in Km.
Similarly, the Vmax of Myo52 actin-dependent ATPase activity increased ~50% with the
addition of Cdc8. Using an in vitro actin filament gliding assay, we demonstrated that,
similar to the fission yeast type II myosin (Stark et al., 2010), Myo52-driven, Cdc8-
decorated actin filament velocities were significantly reduced compared to those of bare
actin (Clayton et al., 2010). An increase in the percentage of total cycle time spent in
the strong-bound state could explain the observed decrease in filament gliding rates. To
address this possibility, the average length of motile actin filaments observed at low 24 myosin concentrations was measured to calculate the duty ratios. Using this method, shorter filament lengths indicate a decrease in the required number of engaged myosin motors due to increased occupancy of the strong-bound state. It was calculated that
Myo52 had a two-fold increase in duty ratio in the presence of Cdc8. To characterize the role of Cdc8 in Myo52-dependent transport in vivo, a fully functional integrated myo52-3xGFP was tracked in wild type and Cdc8 deficient cells. Wild type cells exhibited faster Myo52 particles and more frequent motile events (Clayton et al., 2010).
It was previously shown that the budding yeast type V myosin, Myo2p, requires tropomyosin for processive movement (Hodges et al., 2012). In chapter 2, a combination of single molecule in vitro studies and fission yeast based in vivo studies are described that address the molecular mechanism and physiological relevance of
Myo52 regulation by Cdc8. Single molecules of Myo52 are shown to require Cdc8 decorated actin tracks for processive movement. Furthermore, ensembles of Myo52 that mimic multiple motors bound to physiological cargo also require Cdc8. These results demonstrate a mechanism that provides the ability to sort Myo52-driven cargo transport to specific actin tracks based on the presence or absence of tropomyosin.
Unlike the single tropomyosin isoform found in fission yeast, mammals depend on a much larger number of tropomyosin isoforms, with at least 40 isoforms expressed in humans (Gunning, Hardeman, et al., 2015). Tropomyosin expression is tightly regulated during mammalian development (Schevzov & O'Neill, 2008), although the reason why mammalian cells depend on so many tropomyosin isoforms is not clear. A likely explanation is that higher eukaryotic cells may rely on diverse tropomyosin
25 isoforms to regulate more complex actin cytoskeletal structures and a large number of expressed myosin motor types.
The importance of regulating non-muscle tropomyosins has been suggested over the years by studies that have characterized the tropomyosin profile of multiple transformed cancer cell types (Helfman et al., 2008; Stehn et al., 2006). Transformed neuroblastoma and melanoma cells exhibit a characteristic shift from expressing predominantly high molecular weight tropomyosin isoforms to expressing the two low molecular weight isoforms Tpm3.1 and Tpm4.2 (Stehn et al., 2013). A novel type of anti-cancer therapeutic targeting Tpm3.1 has shown promise as an effective treatment in neuroblastoma and melanoma mouse models, although the mechanism through which these compounds work has not been determined (Stehn et al., 2013).
In chapter 3, a combination of in vitro and in vivo studies are employed to characterize the ability of Tpm3.1 and Tpm4.2 to regulate type V and type II myosins in a myosin isoform dependent manner. Both Tpm3.1 and Tpm4.2 enhance Myo52
ATPase and actin filament gliding motility in a manner similar to Cdc8. In contrast, the highly processive type V myosin, MyoVa, is not affected by these tropomyosins in filament gliding assays, although their activity is slightly reduced in ATPase assays.
The type II non-muscle myosin Myo2 activity was enhanced with Tpm3.1 and Tpm4.2, however these tropomyosins starkly inhibited both the ATPase activity and gliding filament motility of type II skeletal muscle myosin SKMMII.
In chapter 4, the results described in chapters 2 and 3 are discussed within the broader context of actomyosin regulation by non-muscle tropomyosins, as well as how these studies improve our understanding of this process in normal and diseased cells.
26
As an appendix, chapter 5 describes a preliminary study that examines the regulation of
Myo2 by a panel of tropomyosins, revealing a tropomyosin isoform dependent level of actomyosin regulation. This study supports a mechanism of actomyosin regulation by tropomyosin that is determined in part by the terminal tropomyosin sequences involved in head to tail polymerization.
27
CHAPTER 2: FISSION YEAST TROPOMYOSIN SPECIFIES DIRECTED TRANSPORT OF MYOSIN-V ALONG ACTIN CABLES
Joseph E. Clayton, Luther W. Pollard, Maria Sckolnick, Carol S. Bookwalter, Alex R. Hodges, Kathleen M. Trybus, and Matthew Lord
Department of Molecular Physiology and Biophysics, University of Vermont, Burlington, VT 05405
*Present address: Department of Chemistry and Physical Sciences, Quinnipiac University, Hamden, CT 06518.
Abbreviations used:
GFP, green fluorescent protein; Qdot, quantum dot; ScMyo2p, class V myosin Saccharomyces cerevisiae; SpMyo2p, class II myosin from Schizosaccharomyces pombe; TIRF, total internal reflection fluorescence
28
Abstract
A hallmark of class-V myosins is their processivity—the ability to take multiple steps along actin filaments without dissociating. Our previous work suggested, however, that the fission yeast myosin-V (Myo52p) is a nonprocessive motor whose activity is enhanced by tropomyosin (Cdc8p). Here we investigate the molecular mechanism and physiological relevance of tropomyosin-mediated regulation of Myo52p transport, using a combination of in vitro and in vivo approaches. Single molecules of Myo52p, visualized by total internal reflection fluorescence microscopy, moved processively only when Cdc8p was present on actin filaments. Small ensembles of Myo52p bound to a quantum dot, mimicking the number of motors bound to physiological cargo, also required Cdc8p for continuous motion. Although a truncated form of Myo52p that lacked a cargo-binding domain failed to support function in vivo, it still underwent actin-dependent movement to polarized growth sites. This result suggests that truncated
Myo52p lacking cargo, or single molecules of wild-type Myo52p with small cargoes, can undergo processive movement along actin-Cdc8p cables in vivo. Our findings outline a mechanism by which tropomyosin facilitates sorting of transport to specific actin tracks within the cell by switching on myosin processivity.
29
Introduction
The myosin motors are large, actin-activated ATPases that use the free energy generated from Pi release to power conformational changes leading to contractility, tension, or transport. Tropomyosins, on the other hand, are small, dimeric, α-helical coiled-coil proteins that bind end to end along both sides of the actin filament (Gunning et al., 2005). Tropomyosin promotes actin filament stability and has long been known to work in concert with the troponin complex to regulate striated muscle myosin-II motors by gating access to the actin track in a calcium-dependent manner (J. A. Cooper, 2002;
Gunning et al., 2005). Whereas troponin is unique to muscle, tropomyosin is widespread, yet exactly how this protein influences myosins in nonmuscle systems is not clear. There is a vexing number of possibilities with respect to actomyosin regulation when one considers the abundance of tropomyosin and myosin isoforms in mammalian cells. Humans use four tropomyosin genes to generate >40 tropomyosin isoforms by alternative splicing, and there are at least 10 classes of myosin motors in humans, each with multiple isoforms.
Fission yeast provides an excellent model system with which to probe the role of tropomyosin in nonmuscle myosin regulation. Cdc8p is the sole tropomyosin, which is essential for the formation of the actomyosin contractile ring and the actin cables spanning the length of the cell (Balasubramanian et al., 1992). Moreover, only three classes of myosins (I, II, and V) are represented in fission yeast. We recently showed that Cdc8p promotes myosin-II activity and actomyosin ring assembly during cytokinesis (Stark et al., 2010). This same regulation may account for the ability of tropomyosins to enhance the activity of smooth muscle myosin-II and platelet myosin-II
30
(myosin-IIA) observed in past studies (Merkel et al., 1989; Nosaka et al., 1984; M.
Yamaguchi et al., 1984). Cdc8p also regulates unconventional myosins from fission yeast (Clayton et al., 2010). Decoration of actin filaments with Cdc8p inhibited myosin-I (Myo1p) but enhanced the activity of the myosin-Vs (Myo51p and Myo52p).
The ability of Cdc8p to inhibit Myo1p is consistent with studies showing that tropomyosin can block myosin-I activity in higher eukaryotes (Collins et al., 1990;
Fanning et al., 1994; Tang & Ostap, 2001). However, the ability of Cdc8p to promote
Myo51p and Myo52p activity was the first example of tropomyosin-mediated regulation of a class V myosin.
Most myosin-V isoforms studied to date are high–duty ratio motors, meaning that they spend a large proportion of their ATPase cycle in the strong actin-bound ADP or apo states. The high duty ratio and dimeric nature of such motors facilitates processive, hand-over-hand walking along actin filaments (De La Cruz et al., 1999;
Mehta et al., 1999). Recent kinetic and motility studies suggest, however, that a subpopulation of myosin-V isoforms are low–duty ratio motors. These include class V myosin from the budding yeast Saccharomyces cerevisiae Sc Myo2p; (Reck-Peterson et al., 2001), Drosophila myosin-V (Toth et al., 2005), human myosin-Vc (Takagi et al.,
2008; Watanabe et al., 2008), and fission yeast Myo52p (Clayton et al., 2010). Using single-molecule techniques, we recently confirmed that Sc Myo2p is not processive on bare actin but, surprisingly, becomes highly processive when it walks on actin- tropomyosin. Tropomyosin increases the time the motor spends strongly attached to actin by slowing the rate of Mg2+-ADP release. This is the first example of
31 tropomyosin switching a motor from nonprocessive to processive motion (Hodges et al.,
2012).
Here we used single-molecule approaches and total internal reflection fluorescence (TIRF) microscopy to show that decoration of actin by Cdc8p also converts single molecules of fission yeast Myo52p into processive motors. In vitro results suggest a mechanism involving both kinetic and cooperative regulation of actomyosin interactions by tropomyosin-actin. Our findings have physiological relevance because truncated Myo52p, lacking its cargo-binding domain (and thus presumably operating as a single molecule), can still undergo directed motility along actin cables in the cell. Of importance, small ensembles of Myo52p motors that support directed transport in vivo also relied on tropomyosin to support motility when reconstituted in vitro. We propose that tropomyosins can sort myosin molecules to specific actin populations by programming a switch from nonprocessive to processive behavior.
Results
Fission yeast tropomyosin converts Myo52p into a processive motor
We tested whether Myo52p was processive or not using single-molecule assays. Our previous duty ratio estimates (percentage of time a motor spends in the strong actin- bound ADP/apo state per ATPase hydrolysis cycle), calculated from actin-activated
ATPase and ensemble motility data, suggested that Myo52p comes up well short of being processive even in the presence of tropomyosin (Clayton et al., 2010). A minimum duty ratio of 50% is required for processive stepping of a myosin-V dimer
32 along an actin filament. To examine this question further, we coexpressed a truncated heavy meromyosin (HMM) form of Myo52p, which lacks the C-terminal cargo-binding globular tail domain, with the Myo52p light chains Cam1p (calmodulin) and Cdc4p
(essential light chain) in the baculovirus-Sf9 insect cell system (Figure 2-1A). The
Myo52p-HMM had a C-terminal biotin tag for attachment to streptavidin–quantum dots
(Qdots) or a streptavidin-conjugated fluorophore (Figure 2-1A) and a FLAG tag to facilitate affinity purification (Figure 2-1, A and B).
TIRF microscopy was used to determine whether single Myo52p motors were able to walk processively along actin filaments. Fluorescently labeled actin filaments were attached to a glass coverslip, and a solution containing Myo52p labeled with fluorescent quantum dots was added. No processive movements were observed
(Supplemental Movie 2-S1), suggesting that Myo52p has a duty ratio <50% on bare actin under our in vitro conditions. On the basis of the observation that budding yeast myosin-V (Sc Myo2p) requires tropomyosin for processivity, and because the actin cables on which Myo52p transports cargo in the cell depend on Cdc8p for their assembly and maintenance (Arai et al., 1998; Balasubramanian et al., 1992), we repeated these experiments using Cdc8p-decorated filaments. Recombinant Cdc8p was purified from bacteria (Figure 2-1C). Strikingly, the presence of Cdc8p facilitated processive movements of Myo52p– quantum dots (Qdots) along actin filaments (Figure
2-2, A and B, and Supplemental Movie 2-S1). The switch in behavior was quite dramatic, given that the processive runs showed efficiency in terms of both speed
(∼1.25 µm/s; Figure 2-2C) and run length (∼0.6 µm; Figure 2-2D), values comparable to those for bona fide processive myosin-Vs previously characterized using this approach 33
(Warshaw et al., 2005). The experiments were repeated using Myo52p labeled with a streptavidin-Cy3 fluorescent dye instead of quantum dots. The Cy3-labeled Myo52p molecules moved processively only when actin filaments were decorated with Cdc8p
(Supplemental Figure 2-S1 and Supplemental Movie 2-S2). We assume that both of our labeling approaches achieve single-molecule resolution, thereby demonstrating that tropomyosin is required for Myo52p to move processively.
Tropomyosin increases Myo52p run frequency and run length at low ATP concentration
The ability of tropomyosins to activate Myo52p processivity suggests that tropomyosin may increase the duty ratio of the motor by increasing the occupancy of the strong actin-bound ADP or apo states. To further understand the mechanism by which Cdc8p contributes to Myo52p processivity, we repeated our single-molecule studies at low (10
µm) ATP. At this concentration ATP binding becomes the rate-limiting step of the
Myo52p ATPase cycle, allowing the strongly bound apo state to predominate. Thus the nonphysiological low ATP concentration increases the duty ratio, and Myo52p remains strongly bound to actin as it awaits an ATP molecule to bind and dissociate the head from actin. Under these low-ATP conditions, Myo52p exhibited processive movements along both bare and Cdc8p-decorated actin filaments (Supplemental Movie 2-S3). Thus
Cdc8p becomes dispensable for processivity when the Myo52p duty ratio is artificially increased, similar to what was observed with Sc Myo2p from budding yeast and its cognate tropomyosin, Tpm1p (Hodges et al., 2012). Although the speeds of these
Myo52p movements were not statistically different on actin versus actin-Cdc8p tracks
(Figure 2-3A), as expected they were more than 10-fold lower than those observed on
34 actin-Cdc8p filaments at 2 mM ATP (Figure 2-2C). Surprisingly, the frequency at which these runs were observed was more than sevenfold higher when actin was decorated with Cdc8p (Figure 2-3B and Supplemental Movie 2-S3). Furthermore, the average run lengths were approximately twofold longer in the presence of Cdc8p
(Figure 2-3C). The increased run frequency and run length with Cdc8p at low ATP highlights that Cdc8p does something beyond enhancing the duty cycle of the motor.
Myo52p motors work in small clusters that rely on tropomyosin for effective transport
Myo52p moves along actin cables to polarized growth sites (Grallert et al., 2007), and the localization of a number of different proteins has been shown to rely on this transport, namely α-glucan synthase Mok1p (Win et al., 2001), synaptobrevin Syb1p
(Edamatsu et al., 2003), β-1,3-glucan synthase Bgs1p (Mulvihill et al., 2006), chitin synthase Chs2p (Martin-Garcia et al., 2006), CLIP-170 homologue Tip1p (Martin-
Garcia et al., 2009), exocytosis factor Mug33p (Snaith et al., 2011), and GTPase Ypt3p
(Lo Presti et al., 2011). Whereas Myo52p may well operate as a single molecule to directly transport some of these proteins to the cortex, it probably also works as an ensemble in which multiple motors work together to mediate motility via attachment to a larger cargo, such as the previously characterized Syb1p- or Mug33p-associated vesicles (Edamatsu & Toyoshima, 2003; Snaith et al., 2011). We used clathrin light chain (Clc1p-3x green fluorescent protein [GFP]) at endocytic patches as a standard to estimate the numbers of Myo52p-3xGFP molecules in particles undergoing directed transport. Clc1p is ideal since its distribution at patches has already been quantified
(Sirotkin et al., 2010), and its signal intensity is very similar to Myo52p, enabling
35 accurate extrapolation between the similar-sized Clc1p patches and Myo52p particles.
We performed time-lapse analysis of a mixed population of myo52-3xGFP and clc1-
3xGFP cells (Figure 2-4A). Analysis of the two strains in the same field allowed us to estimate the number of Myo52p molecules per motile particle, which ranged from 4 to
34, with a mean of 12.9 ± 6.7 (Figure 2-4, B and C). Thus four molecules of Myo52p appear to be enough to support directed transport of cargoes in vivo. However, although an average of 13 molecules may be associated with a given cargo, the number of
Myo52p molecules contacting the track at any one time is probably less, given the geometry and size of cargoes such as vesicles. Even if Myo52p-decorated vesicles or organelles became stretched out along the length of the actin cable as they moved along the track, approximately half of the Myo52p molecules would still be out of reach of the track, meaning that an average of six to seven molecules is enough to propagate transport in vivo.
The in vitro motility behavior of physiologically relevant numbers of Myo52p molecules was examined in the presence or absence of Cdc8p. Qdots were mixed with a
10-fold molar excess of Myo52p-HMM, yielding approximately three to five molecules per Qdot based on geometrical considerations. As seen at the single-molecule level, bare actin was unable to support transport by multiple Myo52p motors (Supplemental
Movie 2-S4). However, Cdc8p-decorated actin filaments supported continuous motility by multiple motors (Supplemental Figure 2-S2A and Supplemental Movie 2-S4). These overloaded Qdots exhibited similar speeds to single Myo52p molecules, and their average run length was ∼1.3-fold higher (Supplemental Figure 2-S2B). This modest increase upon overloading the quantum dots suggests that single Myo52p motors are 36 responsible for motility at the limiting molar ratio. Our findings indicate that Cdc8p is essential for Myo52p transport powered by physiological ensembles of motors.
Myo52p molecules lacking a cargo-binding domain undergo continuous motility along actin cables in vivo
To test the importance of cargo binding in Myo52p transport and polarization, we constructed a truncated form of Myo52p in which the C-terminal cargo-binding globular tail domain was replaced with a triple GFP tag (Myo52pΔCBD-3xGFP). The truncated form did not support cellular function, as reflected by morphological defects reminiscent of a myo52Δ strain (Figure 2-5A) and the inability to colocalize with the cargo-associated protein Ypt3p (Supplemental Figure 2-S3). However, despite the loss- of-function phenotype, Myo52pΔCBD could still accumulate at polarized growth sites
(Figure 2-5B).
Time-lapse analysis of live cells revealed that polarization of Myo52pΔCBD stemmed from its ability to undergo directed transport, similar to full-length Myo52p
(Figure 2-6A and Supplemental Movie 2-S5). Analysis of these intracellular movements revealed a slightly slower speed for the truncated form (Figure 2-6B), whereas the average run length and frequency of the Myo52pΔCBD particle movements were indistinguishable from those of full-length Myo52p (Figure 2-6, C and D). Although our findings with the truncated form imply that individual Myo52p molecules are capable of intracellular motility when not bound to a cargo, quantitative analysis of
Myo52pΔCBD-3xGFP fluorescence intensities estimated an average of 10 truncated
Myo52p molecules/motile particle (Figure 2-6E). Although motile single molecules
37 cannot be resolved amid the background fluorescence of cytoplasmic Myo52pΔCBD-
3xGFP, our cellular counts suggest that truncated motors often move together in groups
(making them amenable to detection in our setup).
When actin cables were depolymerized by latrunculin A, Myo52pΔCBD-3xGFP showed diffuse fluorescence throughout the cytoplasm, unlike full-length Myo52p-
3xGFP, which showed punctuate fluorescence, which presumably reflects clustering on cargoes (Figure 2-5B). These data suggest that the groups of truncated motors detected by time-lapse microscopy (Figure 2-6B) are actin dependent and unlikely due to aggregation propagated by either the motor itself or the 3xGFP of the fusion construct.
We further verified this by repeating the latrunculin A experiment using an alternative fluorescent protein tag to label Myo52pΔCBD. We wanted to rule out the possibility that the 3xGFP tags specifically favor aggregation and multiple motor-based transport of Myo52pΔCBD when molecules are put into closer contact (i.e., when they bind close by one another along the actin track). We instead used the equally bright tdTomato tag.
Like Myo52pΔCBD-3xGFP, Myo52pΔCBD-tdTomato transported to polarized growth sites in an actin-dependent manner, becoming diffuse throughout the cytoplasm upon treatment with latrunculin A (Supplemental Figure 2-S4). We conclude that actin- tropomyosin cables support processive movements of Myo52pΔCBD molecules. The observation that these movements can be visualized as relatively uniform groups of
Myo52p molecules moving in unison may reflect cooperative binding of motors to
Cdc8p-decorated cables under physiological conditions.
38
Discussion
Here we show that adding tropomyosin to the actin filament converts a single molecule of fission yeast myosin-V from a nonprocessive to a processive motor. Tropomyosin also activates continuous transport by multiple motors of Myo52p bound to a Qdot.
Small ensembles of motors more closely mimic the situation found on cellular cargoes.
We determined an average of 13 motors per motile particle in vivo, although this number likely exceeds the number of track-engaged motors at any time. In vivo,
Myo52p shows continuous motion along tropomyosin-bound actin cables. Processive motion would ensure highly efficient movement of larger cargoes by multiple Myo52p motors, as well as facilitating transport of cytoplasmic proteins or smaller cargoes by single motors. Whether or not an actin track has tropomyosin bound to it provides a simple mechanism by which myosin motor function can be sorted to specific cellular actin structures (Figure 2-7). Cdc8p-mediated sorting of Myo52p motors to cables ensures directed transport toward polarized growth sites, as well as contri-buting to the extension and organization of the cables (Lo Presti et al., 2012), all of which help to establish normal cell shape. This tropomyosin-dependent regulation may be relevant in higher eukaryotes, given that nonprocessive myosin-Vs have also been identified in
Drosophila and humans (Takagi et al., 2008; Toth et al., 2005; Watanabe et al., 2008).
Tropomyosin promotes Myo52p processivity by altering the kinetics of the motor
Regulation of Myo52p processivity by Cdc8p ultimately involves significant changes in the kinetic properties of the motor. The duty cycle of a processive motor must be >50% to ensure that one head remains strongly bound to actin at any time. The duty cycle can
39 be increased by increasing the time in the strongly bound states or decreasing the time in the weakly bound states. Our previous work with class II myosin from the fission yeast Schizosaccharomyces pombe (Sp Myo2p) and Myo52p showed that Cdc8p increases the VMAX and apparent actin affinity of these motors in actin-activated
ATPase assays while slowing the rates at which they propel actin filaments in filament gliding assays (Clayton et al., 2010; Stark et al., 2010). Given the increased actin affinities and the fact that filament gliding is rate limited by the strong actin-bound state
(Siemankowski et al., 1985), the ability of tropomyosin to activate processivity lies in its ability to favor the strong actin-bound state of the actomyosin ATPase cycle, resulting in an increased duty ratio for the motor. The observation that Cdc8p increases
Myo52p VMAX values in ATPases (Clayton et al., 2010) suggests that activation of
Myo52p processivity may largely involve a significant increase in the rate of Pi release, facilitating rapid movement into the strong actin-bound ADP state. The detailed effects of tropomyosin depend on the specific myosin isoform. Both Myo52p and budding yeast Myo2p are class V myosins, but they are affected differently by tropomyosin. For
Myo2p, steady-state, actin-activated ATPase assays showed no change in either KM or
VMAX value when actin was decorated with tropomyosin (Hodges et al., 2012). For this myosin, duty cycle was increased by slowing the rate of ADP release and the rate of
ATP-induced dissociation of the acto-motor complex (Hodges et al., 2012). The effects of tropomyosin on Pi release rate were not as pronounced as they were for Myo52p.
40
Alternative modes of Cdc8p regulation and their relationship to established models
Myo52p was capable of processive movements on bare actin at low ATP. This condition increases motor duty ratio because ATP binding becomes rate limiting, so that myosin motors spend most of their time without nucleotide in the strong actin-bound rigor state. The ability of bare actin to support processivity is consistent with a general mechanism in which tropomyosin mediates processivity by increasing the duty ratio, as opposed to changing the structure of the actin track. Strikingly, the frequency at which
Myo52p processivity was observed at low ATP was sevenfold higher when actin was decorated with Cdc8p. The decreased KM value (higher affinity) seen in the presence of tropomyosin in ATPase assays (Clayton et al., 2010) may account for this increase in run frequency. In addition, as with Sc Myo2p and budding yeast Tpm1p, the average
Myo52p run length increased at low ATP in the presence of Cdc8p. This was unexpected, given that the predicted duty ratio would be >95% whether tropomyosin is present or not. One possibility to explain the enhanced run length is improved gating between the two heads, perhaps by slowing ADP release from the lead head, as previously suggested for Sc Myo2p (Hodges et al., 2012). Meanwhile, recent structural evidence suggests a more direct role for tropomyosin in myosin recruitment. A pseudoatomic model of a rigor motor head actin-tropomyosin complex, based on an 8-Å structure determined by cryo–electron microscopy, showed for the first time a direct interaction between myosin and tropomyosin in the actin-bound complex (Behrmann et al., 2012). Collectively these findings suggest that tropomyosin promotes processivity by doing more than simply increasing the duty cycle of the motor. A related mechanism, which can also apply to multiple motors, may lie in cooperative binding of
41 myosin heads. Such a mechanism is a variation on the role of tropomyosin in striated muscle contraction, where the troponin-tropomyosin complex establishes a “blocked” state on the actin filament that prevents myosin-II binding (Gordon et al., 2000; Lehrer,
1994; Swartz et al., 1996). Binding of Ca2+ to troponin triggers a shift in the position of tropomyosin from the “blocked” to “closed” state. The ”closed” state is initially inhibitory, as it requires binding of a myosin head to complete the shift in tropomyosin position to the “open” state, which then allows unrestricted and cooperative binding of neighboring myosin heads. The high concentrations of actin and myosin in muscle, coupled with the precise manner in which these molecules are lined up in sarcomeres, favors rapid movement into the “open” state. Cryo–electron microscopy showed that
Cdc8p-decorated actin filaments assume the “closed” state (Skoumpla et al., 2007), which predictably results in inhibition of skeletal muscle myosin-II actin-activated
ATPase activity (East, Sousa, et al., 2011). However, these same Cdc8p-actin filaments significantly enhance Sp Myo2p and Myo52p activity in the same assays (Clayton et al.,
2010; Stark et al., 2010). Enhancement of Myo52p activity by Cdc8p does not appear to be limited by the “closed” state, given that very low concentrations of Myo52p (<1 nM) were able to walk on Cdc8p-decorated filaments in single-molecule assays. Moreover, the actin-dependent clustering of truncated Myo52p motors lacking cargo that we observed on actin cables in vivo is reminiscent of cooperative binding, in which binding of one head favors the binding of neighboring heads close by. We propose that the
“closed” state is multifaceted and can activate (e.g., Myo52p with Cdc8p), inhibit (e.g., skeletal muscle myosin-II with Cdc8p), or block (e.g., fission yeast myosin-I with
Cdc8p) motor activity, depending on the tropomyosin and myosin isoforms in play. In
42 the case of Myo52p and Cdc8p, the “closed” state may favor activation by promoting initial actomyosin interactions that subsequently influence the position of Cdc8p and favor more interactions. However, this same state can completely block or limit initial interactions with muscle myosin needed for any subsequent cooperative binding.
Activation of Myo52p by Cdc8p may reflect kinetic regulation in combination with cooperative effects by which the strong binding of one head shifts the position of tropomyosin, thus favoring strong binding of additional heads nearby.
Materials and Methods
Fission yeast strains and genetic approaches
Standard fission yeast genetic and cell biology protocols were used (Moreno et al.,
1991). myo52Δ::natR (h−, MLY 759), myo52-3xGFP:kanR (h−, MLY 975), myo52ΔCBD-3xGFP:kanR (h+, LP 86), and clc1-3xGFP: kanR uch2-mCherry:natR
(h+, LP 123) haploid strains were constructed by performing genomic integrations using the relevant G418-resistant (kanR) or nourthreothricin-resistant (natR) antibiotic markers and (YE5S-drug) rich media selection plates (Bahler et al., 1998; Snaith et al.,
2010). The myo52ΔCBD-3xGFP strain encodes a C-terminal truncation in which the globular cargo-binding region of the Myo52p tail (amino acids 1025–1516) is replaced by a triple-GFP tag. The SFY 527/528 strain background (h−/h+ leu1-32 ura4-D18 his3-D1 ade6-M216/ade6-M210) was used throughout. An exception was the myo52ΔCBD-tdTomato strain, which was a gift from Sophie Martin (University of
Lausanne, Lausanne, Switzerland;(Lo Presti et al., 2012)).
43
Plasmids
A PCR product encoding a truncated form of Myo52p (amino acids 1–1056 spanning the motor domain, light chain–binding region, and coiled-coil region) was amplified from S. pombe cDNA. The fragment was cloned into the baculovirus transfer vector pAcSG2 with a C-terminal biotin tag, followed by a C-terminal FLAG tag for purification by affinity chromatography. The biotin tag is an 88–amino acid sequence segment from the Escherichia coli biotin carboxyl carrier protein, which, when expressed in Sf9 cells, is biotinylated at a single Lys residue. The tag is used for attachment to streptavidin-coated Qdots or streptavidin-Cy3. Myo52p light-chain genes
(cam1 and cdc4) were amplified from S. pombe cDNA and cloned into the dual expression vector pAcUW51 behind separate promoters. The fidelity of constructs was confirmed by DNA sequencing. A Cdc8p construct was used to overexpress an acetylated-mimicking form of the protein in E. coli. The cdc8 gene was PCR amplified from S. pombe cDNA using the following primers: 5′, NdeI-cdc8,
CAATCATATGGCTAGCATGGATAAGCTTAGAGAG (the NdeI site is italicized, and the start codon of the cdc8 ORF is underlined); and 3′, BamHI-cdc8
CAATGGATCCCTACAAGTCCTCA-AGAGCTT (the BamHI site is italicized, and the cdc8 stop codon is underlined). The 5′ primer encodes an Ala-Ser (acetylation mimicking) dipeptide immediately upstream of the cdc8 start codon. The start codon for the recombinant protein actually lies in the second half of the NdeI site, allowing for incorporation of the Ala-Ser codons. The resultant oligonucleotide was cloned into the pET3 vector and fidelity confirmed by DNA sequencing. The cam1 and cdc4 Myo52p light-chain open reading frames were cut out from the pAcUW51 baculovirus vector
44 using BamHI and inserted into the BamHI sites of pET3a for bacterial expression. The orientation and fidelity of the light-chain sequences was confirmed by restriction analysis and DNA sequencing. The pREP41-tdTomato-ypt3 plasmid was a gift from
Sophie Martin (Lo Presti & Martin, 2011) and was used to visualize Myo52p-dependent localization of Ypt3p at polarized growth sites (Supplemental Figure 2-S3).
Live-cell imaging
Tracking of Myo52p-3xGFP particle motility used a Nikon (Melville, NY) Eclipse Ti-U inverted microscope equipped with a 100× PlanApo objective lens (1.40 numerical aperture [NA]) for through-the-objective near-TIRF microscopy. The GFP was excited with a 473-nm laser line. The angle at which the laser entered the objective was tuned such that the illumination was not perfect TIRF, allowing the laser to excite the entire thickness of the cell, yet resulting in a better signal-to-noise ratio than with epi- illumination. Images were obtained using a Stanford Photonics XR/Turbo-Z camera running Piper Control (Stanford, CA) version 2.3.39, software. The pixel resolution was
145.5 nm. Data were collected at 7.7 frames/sat room temperature. Movement of GFP particles over time was tracked manually using ImageJ (National Institutes of Health,
Bethesda, MD). A Nikon TE2000-E2 inverted microscope with motorized fluorescence filter turret and a Plan Apo 60× (1.45 NA) objective was used to capture differential interference contrast and epifluorescence images (using GFP or tetramethyl rhodamine isothiocyanate filters) at room temperature. Fluorescence used an EXFO X-CITE 120 illuminator (Mississauga, Ontario, Canada). NIS Elements software (Melville, NY) was used to control the microscope, together with two Uniblitz shutters (Rochester, NY). A
45
Photometrics (Tucson, AZ) CoolSNAP HQ2 14-bit camera was used for single-plane colocalization imaging of Myo52p-3xGFP (or Myo52pΔCBD-3xGFP) and Tomato-
Ypt3p (Supplemental Figure 2-S2). Time-lapse movies of cells monitoring Clc1p-
3xGFP patches and Myo52p-3xGFP (or Myo52pΔCBD-3xGFP) particles were captured using an Andor (Belfast, UK) 16-bit electron-multiplying charge-coupled device camera. Images were captured every 2 s as z-stacks (every 0.70 µm over 4.2 µm) spanning the cell depth. Cell suspensions (3 µl) were mounted on flat, 30-µl media pads
(solidified by 1% agarose) prepared on the slide surface. VALAP (1:1:1 Vasoline, lanolin, and paraffin) was used to seal slides and coverslips. Latrunculin A treatment
(10 µM) was used to remove actin cables from myo52-3xGFP and myo52ΔCBD-
3xGFP cells growing exponentially in YE5S media. Images were captured 45 min after the addition of the drug (or dimethylsulfoxide in controls).
Protein purification
Baculovirus harboring the Myo52p and Cam1p-Cdc4p constructs was prepared using established protocols (Hodges et al., 2009). Sf9 cells were coinfected with both the heavy and light chains. Sf9 cells were grown in suspension and harvested at 72 h.
Harvested cells were pelleted at low speed for 10 min and resuspended in lysis buffer
(300 mM NaCl, 10 mM imidazole, pH 7.2, 1 mM ethylene glycol tetraacetic acid
[EGTA], 5 mM MgCl2, 2 mM dithiothreitol [DTT], 5 µg/ml leupeptin, 0.8 mg/ml benzamidine, and 0.4 µg/ml recombinant Cam1p and Cdc4p). Cells were lysed by sonication and pelleted after addition of 2 mM Mg2+-ATP. The supernatant was incubated with anti-FLAG resin for 1.5 h, transferred to a column, and washed with 100
46 ml of FLAG buffer (300 mM NaCl, 10 mM imidazole, pH 7.2, 1 mM EGTA, 1 mM
NaN3). The sample was eluted off the column by the addition of FLAG buffer containing 150 µg/ml FLAG peptide. Protein-rich fractions were pooled followed by three rounds of dialysis (3 × 1 l) against storage buffer (300 mM KCl, 10 mM imidazole, pH 7.2, 1 mM NaN3, 1 mM DTT), followed by addition of 5 µg/ml leupeptin. Cdc8p and Myo52p light-chain proteins were produced in E. coli BL21 DE3– competent cells. Cultures were grown in LB media at 37°C and protein overexpression induced at an OD600 of 0.5 by addition of 0.4 mM isopropyl-β-D-thiogalactoside. Cells were harvested after overnight induction at 25°C. Proteins were purified as described previously (Pruyne et al., 1998). Cell pellets were resuspended in lysis buffer (100 mM
NaCl, 10 mM imidazole, pH 7.2, 2 mM EDTA, and 1 mM DTT) and sonicated. Lysates were boiled for 10 min while stirring, then pelleted to remove denatured protein and other debris. Soluble tropomyosin (or light chains) were precipitated from the supernatant by lowering the pH to 0.2 U below the isoelectric point of the relevant protein. The protein precipitate was resuspended in 50 mM NaCl, 1 mM DTT, and 10 mM imidazole, pH 7.4, and dialyzed for three rounds (3 × 1 l) against the same buffer, followed by addition of 5 µg/ml leupeptin.
Actin was purified from acetone powder (Spudich et al., 1971), and myosin-II was purified as described previously (Margossian et al., 1982).
Visualizing Myo52p-Qdot and Myo52p-Cy3 motility by TIRF microscopy
Myo52p-HMM (0.2 µM) was mixed with a twofold molar excess of actin and 2 mM
Mg2+-ATP and centrifuged for 20 min at 400,000 × g to remove any myosin that was
47 unable to dissociate from actin in the presence of ATP. To investigate processivity of individual myosin V motors, Myo52p was then mixed with a 10-fold molar excess of
655-nm streptavidin-coated Qdots (Invitrogen, Grand Island, NY). In principle, a small fraction of Qdots will have two or more motors bound, but previous controls demonstrated that Qdots are driven primarily by a single motor at this mixing ratio
(Hodges et al., 2012). To investigate multiple motor transport, we mixed Qdots with a
10-fold excess of Myo52p to generate Qdots with multiple motors, with typical saturation yielding ∼3–5 motors/Qdot based on geometrical considerations (Hodges et al., 2009; Hodges et al., 2012). Flow cells made from glass coverslips were prepared by introducing the following solutions into the flow cell: 0.1 mg/ml N-ethylmaleimide– modified skeletal muscle myosin (5-min incubation), 5× rinse of 1 mg/ml bovine serum albumin (BSA; 2 min), 2 µM rhodamine-phalloidin–labeled chicken skeletal muscle actin filaments (plus or minus 1 µM tropomyosin; 2–5 min), 5× rinse with motility buffer, and, finally 0.2 nM Myo52p in motility buffer with 2 mM MgATP. Motility buffer consists of 50 mM KCl, 25 mM imidazole, pH 7.4, 4 mM MgCl2, 1 mM EGTA,
50 mM DTT, 1 mg/ml BSA, 3.5 µM fission yeast calmodulin (Cam1p), 3.5 µM fission yeast essential light chain (Cdc4p), and an oxygen-scavenging system (3 mg/ml glucose, 0.1 mg/ml glucose oxidase, and 0.18 mg/ml catalase). For experiments with
Cdc8p, 1 µM Cdc8p was included in the motility buffer to prevent dissociation from actin. For single-molecule experiments using Cy3-labeled Myo52p, motors were mixed with a fivefold molar excess of Cy3-streptavidin (Invitrogen) and diluted to a final concentration of 0.5 nM in buffer C-50 (10 mM imidazole, pH 7.4, 50 mM KCl, 4 mM
MgCl2, 1 mM EGTA, 10 mM DTT, plus light chains, oxygen scavengers, and 2 µM 48
Cdc8p when included) before adding to the flow cell. Alexa 635-phalloidin–labeled chicken skeletal muscle actin filaments were used. Through-the-objective TIRF microscopy was performed at room temperature using the Nikon Eclipse Ti-U microscope equipped with a 100× Plan Apo objective lens (1.49 NA) and auxiliary 1.5× magnification. Fluorophores were excited with a 473-nm (Qdots) or 532-nm (Cy3 and actin) laser line, and images were obtained using the XR/Turbo-Z camera running Piper
Control software, version 2.3.39. The pixel resolution was 95.0 nm, and data were collected at 5–30 frames/s. Qdot movement along rhodamine-labeled actin filaments was tracked by hand using ImageJ. For each event, we required Qdot-labeled Myo52p to move continuously for at least three frames to qualify as a run. Cy3 movement along
Alexa 635–labeled actin filaments was tracked using the MtrackJ plug-in for ImageJ.
Runs that artificially terminated by running off the end of an actin filament were not included in the run length analysis.
Acknowledgments
We thank Sophie Martin (University of Lausanne, Lausanne, Switzerland) for the ypt3 plasmid and the myo52ΔCBD-tdTomato strain. We are very grateful to Guy Kennedy and David Warshaw (University of Vermont, Burlington, VT) for providing access to and guidance with TIRF microscopy. This work was supported by American Heart
Association Scientist Development Grant 0835236N and National Institutes of Health
Grant GM097193 to M.L. and National Institutes of Health Grant GM078097 to K.M.T.
49
References
Arai, R., Nakano, K., & Mabuchi, I. (1998). Subcellular localization and possible function of actin, tropomyosin and actin-related protein 3 (Arp3) in the fission yeast Schizosaccharomyces pombe. Eur J Cell Biol, 76(4), 288-295. doi:10.1016/S0171-9335(98)80007-1
Bach, C. T., Creed, S., Zhong, J., Mahmassani, M., Schevzov, G., Stehn, J., . . . O'Neill, G. M. (2009). Tropomyosin isoform expression regulates the transition of adhesions to determine cell speed and direction. Mol Cell Biol, 29(6), 1506-1514. doi:10.1128/MCB.00857-08
Bahler, J., Wu, J. Q., Longtine, M. S., Shah, N. G., McKenzie, A., 3rd, Steever, A. B., . . . Pringle, J. R. (1998). Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast, 14(10), 943-951. doi:10.1002/(sici)1097-0061(199807)14:10<943::aid-yea292>3.0.co;2-y
Balasubramanian, M. K., Helfman, D. M., & Hemmingsen, S. M. (1992). A new tropomyosin essential for cytokinesis in the fission yeast S. pombe. Nature, 360(6399), 84-87. doi:10.1038/360084a0
Behrmann, E., Muller, M., Penczek, P. A., Mannherz, H. G., Manstein, D. J., & Raunser, S. (2012). Structure of the rigor actin-tropomyosin-myosin complex. Cell, 150(2), 327-338. doi:10.1016/j.cell.2012.05.037
Berger, C. L., & Thomas, D. D. (1991). Rotational dynamics of actin-bound intermediates in the myosin ATPase cycle. Biochemistry, 30(46), 11036-11045.
Bharadwaj, S., Thanawala, R., Bon, G., Falcioni, R., & Prasad, G. L. (2005). Resensitization of breast cancer cells to anoikis by tropomyosin-1: role of Rho kinase-dependent cytoskeleton and adhesion. Oncogene, 24(56), 8291-8303. doi:10.1038/sj.onc.1208993
Blanchoin, L., & Pollard, T. D. (2002). Hydrolysis of ATP by polymerized actin depends on the bound divalent cation but not profilin. Biochemistry, 41(2), 597- 602.
Boyd, J., Risinger, J. I., Wiseman, R. W., Merrick, B. A., Selkirk, J. K., & Barrett, J. C. (1995). Regulation of microfilament organization and anchorage-independent growth by tropomyosin 1. Proc Natl Acad Sci U S A, 92(25), 11534-11538.
Broschat, K. O., Weber, A., & Burgess, D. R. (1989). Tropomyosin stabilizes the pointed end of actin filaments by slowing depolymerization. Biochemistry, 28(21), 8501-8506.
50
Bryce, N. S., Schevzov, G., Ferguson, V., Percival, J. M., Lin, J. J., Matsumura, F., . . . Weinberger, R. P. (2003). Specification of actin filament function and molecular composition by tropomyosin isoforms. Mol Biol Cell, 14(3), 1002-1016. doi:10.1091/mbc.E02-04-0244
Burgess, S., Walker, M., Wang, F., Sellers, J. R., White, H. D., Knight, P. J., & Trinick, J. (2002). The prepower stroke conformation of myosin V. J Cell Biol, 159(6), 983- 991. doi:10.1083/jcb.200208172
Caldwell, B. J., Lucas, C., Kee, A. J., Gaus, K., Gunning, P. W., Hardeman, E. C., . . . Gomez, G. A. (2014). Tropomyosin isoforms support actomyosin biogenesis to generate contractile tension at the epithelial zonula adherens. Cytoskeleton (Hoboken), 71(12), 663-676. doi:10.1002/cm.21202
Carlier, M. F., & Pantaloni, D. (1986). Direct evidence for ADP-Pi-F-actin as the major intermediate in ATP-actin polymerization. Rate of dissociation of Pi from actin filaments. Biochemistry, 25(24), 7789-7792.
Chesarone, M. A., & Goode, B. L. (2009). Actin nucleation and elongation factors: mechanisms and interplay. Curr Opin Cell Biol, 21(1), 28-37. doi:10.1016/j.ceb.2008.12.001
Clayton, J. E., Sammons, M. R., Stark, B. C., Hodges, A. R., & Lord, M. (2010). Differential regulation of unconventional fission yeast myosins via the actin track. Curr Biol, 20(16), 1423-1431. doi:10.1016/j.cub.2010.07.026
Collins, K., Sellers, J. R., & Matsudaira, P. (1990). Calmodulin dissociation regulates brush border myosin I (110-kD-calmodulin) mechanochemical activity in vitro. J Cell Biol, 110(4), 1137-1147.
Cooper, H. L., Feuerstein, N., Noda, M., & Bassin, R. H. (1985). Suppression of tropomyosin synthesis, a common biochemical feature of oncogenesis by structurally diverse retroviral oncogenes. Mol Cell Biol, 5(5), 972-983.
Cooper, J. A. (2002). Actin dynamics: tropomyosin provides stability. Curr Biol, 12(15), R523-525.
Coulton, A. T., East, D. A., Galinska-Rakoczy, A., Lehman, W., & Mulvihill, D. P. (2010). The recruitment of acetylated and unacetylated tropomyosin to distinct actin polymers permits the discrete regulation of specific myosins in fission yeast. J Cell Sci, 123(Pt 19), 3235-3243. doi:10.1242/jcs.069971
Coureux, P. D., Wells, A. L., Menetrey, J., Yengo, C. M., Morris, C. A., Sweeney, H. L., & Houdusse, A. (2003). A structural state of the myosin V motor without bound nucleotide. Nature, 425(6956), 419-423. doi:10.1038/nature01927
51
Creed, S. J., Desouza, M., Bamburg, J. R., Gunning, P., & Stehn, J. (2011). Tropomyosin isoform 3 promotes the formation of filopodia by regulating the recruitment of actin-binding proteins to actin filaments. Exp Cell Res, 317(3), 249- 261. doi:10.1016/j.yexcr.2010.10.019
Curthoys, N. M., Freittag, H., Connor, A., Desouza, M., Brettle, M., Poljak, A., . . . Fath, T. (2014). Tropomyosins induce neuritogenesis and determine neurite branching patterns in B35 neuroblastoma cells. Mol Cell Neurosci, 58, 11-21. doi:10.1016/j.mcn.2013.10.011
De La Cruz, E. M., & Ostap, E. M. (2004). Relating biochemistry and function in the myosin superfamily. Curr Opin Cell Biol, 16(1), 61-67. doi:10.1016/j.ceb.2003.11.011
De La Cruz, E. M., Wells, A. L., Rosenfeld, S. S., Ostap, E. M., & Sweeney, H. L. (1999). The kinetic mechanism of myosin V. Proc Natl Acad Sci U S A, 96(24), 13726-13731.
Dominguez, R., & Holmes, K. C. (2011). Actin structure and function. Annu Rev Biophys, 40, 169-186. doi:10.1146/annurev-biophys-042910-155359 dos Remedios, C. G., Chhabra, D., Kekic, M., Dedova, I. V., Tsubakihara, M., Berry, D. A., & Nosworthy, N. J. (2003). Actin binding proteins: regulation of cytoskeletal microfilaments. Physiol Rev, 83(2), 433-473. doi:10.1152/physrev.00026.2002
East, D. A., & Mulvihill, D. P. (2011). Regulation and function of the fission yeast myosins. J Cell Sci, 124(Pt 9), 1383-1390. doi:10.1242/jcs.078527
East, D. A., Sousa, D., Martin, S. R., Edwards, T. A., Lehman, W., & Mulvihill, D. P. (2011). Altering the stability of the Cdc8 overlap region modulates the ability of this tropomyosin to bind co-operatively to actin and regulate myosin. Biochem J, 438(2), 265-273. doi:10.1042/BJ20101316
Edamatsu, M., & Toyoshima, Y. Y. (2003). Fission yeast synaptobrevin is involved in cytokinesis and cell elongation. Biochem Biophys Res Commun, 301(3), 641-645.
Egelman, E. H., Francis, N., & DeRosier, D. J. (1982). F-actin is a helix with a random variable twist. Nature, 298(5870), 131-135.
Fanning, A. S., Wolenski, J. S., Mooseker, M. S., & Izant, J. G. (1994). Differential regulation of skeletal muscle myosin-II and brush border myosin-I enzymology and mechanochemistry by bacterially produced tropomyosin isoforms. Cell Motil Cytoskeleton, 29(1), 29-45. doi:10.1002/cm.970290104
Galinska-Rakoczy, A., Engel, P., Xu, C., Jung, H., Craig, R., Tobacman, L. S., & Lehman, W. (2008). Structural basis for the regulation of muscle contraction by troponin and tropomyosin. J Mol Biol, 379(5), 929-935. doi:10.1016/j.jmb.2008.04.062 52
Galkin, V. E., VanLoock, M. S., Orlova, A., & Egelman, E. H. (2002). A new internal mode in F-actin helps explain the remarkable evolutionary conservation of actin's sequence and structure. Curr Biol, 12(7), 570-575.
Gooding, C., & Smith, C. W. (2008). Tropomyosin exons as models for alternative splicing. Adv Exp Med Biol, 644, 27-42.
Gordon, A. M., Homsher, E., & Regnier, M. (2000). Regulation of contraction in striated muscle. Physiol Rev, 80(2), 853-924.
Grallert, A., Martin-Garcia, R., Bagley, S., & Mulvihill, D. P. (2007). In vivo movement of the type V myosin Myo52 requires dimerisation but is independent of the neck domain. J Cell Sci, 120(Pt 23), 4093-4098. doi:10.1242/jcs.012468
Gunning, P. W., Ghoshdastider, U., Whitaker, S., Popp, D., & Robinson, R. C. (2015). The evolution of compositionally and functionally distinct actin filaments. J Cell Sci, 128(11), 2009-2019. doi:10.1242/jcs.165563
Gunning, P. W., Hardeman, E. C., Lappalainen, P., & Mulvihill, D. P. (2015). Tropomyosin - master regulator of actin filament function in the cytoskeleton. J Cell Sci, 128(16), 2965-2974. doi:10.1242/jcs.172502
Gunning, P. W., Schevzov, G., Kee, A. J., & Hardeman, E. C. (2005). Tropomyosin isoforms: divining rods for actin cytoskeleton function. Trends Cell Biol, 15(6), 333- 341. doi:10.1016/j.tcb.2005.04.007
Helfman, D. M., Flynn, P., Khan, P., & Saeed, A. (2008). Tropomyosin as a regulator of cancer cell transformation. Adv Exp Med Biol, 644, 124-131.
Hendricks, M., & Weintraub, H. (1981). Tropomyosin is decreased in transformed cells. Proc Natl Acad Sci U S A, 78(9), 5633-5637.
Hendricks, M., & Weintraub, H. (1984). Multiple tropomyosin polypeptides in chicken embryo fibroblasts: differential repression of transcription by Rous sarcoma virus transformation. Mol Cell Biol, 4(9), 1823-1833.
Herman, I. M. (1993). Actin isoforms. Curr Opin Cell Biol, 5(1), 48-55.
Hitchcock-DeGregori, S. E. (2008). Tropomyosin: function follows structure. Adv Exp Med Biol, 644, 60-72.
Hitchcock-DeGregori, S. E., Sampath, P., & Pollard, T. D. (1988). Tropomyosin inhibits the rate of actin polymerization by stabilizing actin filaments. Biochemistry, 27(26), 9182-9185.
53
Hodges, A. R., Bookwalter, C. S., Krementsova, E. B., & Trybus, K. M. (2009). A nonprocessive class V myosin drives cargo processively when a kinesin- related protein is a passenger. Curr Biol, 19(24), 2121-2125. doi:10.1016/j.cub.2009.10.069
Hodges, A. R., Krementsova, E. B., Bookwalter, C. S., Fagnant, P. M., Sladewski, T. E., & Trybus, K. M. (2012). Tropomyosin is essential for processive movement of a class V myosin from budding yeast. Curr Biol, 22(15), 1410-1416. doi:10.1016/j.cub.2012.05.035
Holmes, K. C., & Lehman, W. (2008). Gestalt-binding of tropomyosin to actin filaments. J Muscle Res Cell Motil, 29(6-8), 213-219. doi:10.1007/s10974-008- 9157-6
Hotulainen, P., & Lappalainen, P. (2006). Stress fibers are generated by two distinct actin assembly mechanisms in motile cells. J Cell Biol, 173(3), 383-394. doi:10.1083/jcb.200511093
Huxley, H. E. (1963). Electron Microscope Studies on the Structure of Natural and Synthetic Protein Filaments from Striated Muscle. J Mol Biol, 7, 281-308.
Jalilian, I., Heu, C., Cheng, H., Freittag, H., Desouza, M., Stehn, J. R., . . . Gunning, P. W. (2015). Cell elasticity is regulated by the tropomyosin isoform composition of the actin cytoskeleton. PLoS One, 10(5), e0126214. doi:10.1371/journal.pone.0126214
Johnson, M., East, D. A., & Mulvihill, D. P. (2014). Formins determine the functional properties of actin filaments in yeast. Curr Biol, 24(13), 1525-1530. doi:10.1016/j.cub.2014.05.034
Kovar, D. R., Sirotkin, V., & Lord, M. (2011). Three's company: the fission yeast actin cytoskeleton. Trends Cell Biol, 21(3), 177-187. doi:10.1016/j.tcb.2010.11.001
Kuhn, T. B., & Bamburg, J. R. (2008). Tropomyosin and ADF/cofilin as collaborators and competitors. Adv Exp Med Biol, 644, 232-249.
Leavitt, J., Latter, G., Lutomski, L., Goldstein, D., & Burbeck, S. (1986). Tropomyosin isoform switching in tumorigenic human fibroblasts. Mol Cell Biol, 6(7), 2721- 2726.
Lee, W. L., Bezanilla, M., & Pollard, T. D. (2000). Fission yeast myosin-I, Myo1p, stimulates actin assembly by Arp2/3 complex and shares functions with WASp. J Cell Biol, 151(4), 789-800.
Lehrer, S. S. (1994). The regulatory switch of the muscle thin filament: Ca2+ or myosin heads? J Muscle Res Cell Motil, 15(3), 232-236.
54
Leonardi, C. L., Warren, R. H., & Rubin, R. W. (1982). Lack of tropomyosin correlates with the absence of stress fibers in transformed rat kidney cells. Biochim Biophys Acta, 720(2), 154-162.
Li, W., & Gao, F. B. (2003). Actin filament-stabilizing protein tropomyosin regulates the size of dendritic fields. J Neurosci, 23(15), 6171-6175.
Lo Presti, L., Chang, F., & Martin, S. G. (2012). Myosin Vs organize actin cables in fission yeast. Mol Biol Cell, 23(23), 4579-4591. doi:10.1091/mbc.E12-07-0499
Lo Presti, L., & Martin, S. G. (2011). Shaping fission yeast cells by rerouting actin- based transport on microtubules. Curr Biol, 21(24), 2064-2069. doi:10.1016/j.cub.2011.10.033
Lord, M., Laves, E., & Pollard, T. D. (2005). Cytokinesis depends on the motor domains of myosin-II in fission yeast but not in budding yeast. Mol Biol Cell, 16(11), 5346-5355. doi:10.1091/mbc.E05-07-0601
Manstein, D. J., & Mulvihill, D. P. (2016). Tropomyosin-mediated Regulation of Cytoplasmic Myosins. Traffic. doi:10.1111/tra.12399
Margossian, S. S., & Lowey, S. (1982). Preparation of myosin and its subfragments from rabbit skeletal muscle. Methods Enzymol, 85 Pt B, 55-71.
Martin, C., Schevzov, G., & Gunning, P. (2010). Alternatively spliced N-terminal exons in tropomyosin isoforms do not act as autonomous targeting signals. J Struct Biol, 170(2), 286-293. doi:10.1016/j.jsb.2009.12.016
Martin-Garcia, R., & Mulvihill, D. P. (2009). Myosin V spatially regulates microtubule dynamics and promotes the ubiquitin-dependent degradation of the fission yeast CLIP-170 homologue, Tip1. J Cell Sci, 122(Pt 21), 3862-3872. doi:10.1242/jcs.054460
Martin-Garcia, R., & Valdivieso, M. H. (2006). The fission yeast Chs2 protein interacts with the type-II myosin Myo3p and is required for the integrity of the actomyosin ring. J Cell Sci, 119(Pt 13), 2768-2779. doi:10.1242/jcs.02998
Matsumura, F., Ono, S., Yamakita, Y., Totsukawa, G., & Yamashiro, S. (1998). Specific localization of serine 19 phosphorylated myosin II during cell locomotion and mitosis of cultured cells. J Cell Biol, 140(1), 119-129.
Matsumura, F., Totsukawa, G., Yamakita, Y., & Yamashiro, S. (2001). Role of myosin light chain phosphorylation in the regulation of cytokinesis. Cell Struct Funct, 26(6), 639-644.
55
McIntosh, B. B., Holzbaur, E. L., & Ostap, E. M. (2015). Control of the initiation and termination of kinesin-1-driven transport by myosin-Ic and nonmuscle tropomyosin. Curr Biol, 25(4), 523-529. doi:10.1016/j.cub.2014.12.008
McMichael, B. K., Kotadiya, P., Singh, T., Holliday, L. S., & Lee, B. S. (2006). Tropomyosin isoforms localize to distinct microfilament populations in osteoclasts. Bone, 39(4), 694-705. doi:10.1016/j.bone.2006.04.031
Mehta, A. D., Rock, R. S., Rief, M., Spudich, J. A., Mooseker, M. S., & Cheney, R. E. (1999). Myosin-V is a processive actin-based motor. Nature, 400(6744), 590-593. doi:10.1038/23072
Merkel, L., Ikebe, M., & Hartshorne, D. J. (1989). Interaction of smooth muscle tropomyosin and smooth muscle myosin. Effect on the properties of myosin. Biochemistry, 28(5), 2215-2220.
Miller, A. L. (2011). The contractile ring. Curr Biol, 21(24), R976-978. doi:10.1016/j.cub.2011.10.044
Mitchison, T. J., & Cramer, L. P. (1996). Actin-based cell motility and cell locomotion. Cell, 84(3), 371-379.
Miyado, K., Kimura, M., & Taniguchi, S. (1996). Decreased expression of a single tropomyosin isoform, TM5/TM30nm, results in reduction in motility of highly metastatic B16-F10 mouse melanoma cells. Biochem Biophys Res Commun, 225(2), 427-435. doi:10.1006/bbrc.1996.1190
Moore, J. R., Krementsova, E. B., Trybus, K. M., & Warshaw, D. M. (2001). Myosin V exhibits a high duty cycle and large unitary displacement. J Cell Biol, 155(4), 625- 635. doi:10.1083/jcb.200103128
Moreno, S., Klar, A., & Nurse, P. (1991). Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol, 194, 795-823.
Mulvihill, D. P., Edwards, S. R., & Hyams, J. S. (2006). A critical role for the type V myosin, Myo52, in septum deposition and cell fission during cytokinesis in Schizosaccharomyces pombe. Cell Motil Cytoskeleton, 63(3), 149-161. doi:10.1002/cm.20113
Mulvihill, D. P., & Hyams, J. S. (2003). Role of the two type II myosins, Myo2 and Myp2, in cytokinetic actomyosin ring formation and function in fission yeast. Cell Motil Cytoskeleton, 54(3), 208-216. doi:10.1002/cm.10093
Nosaka, S., Onji, T., & Shibata, N. (1984). Enhancement of actomyosin ATPase activity by tropomyosin. Recombination of myosin and tropomyosin between muscles and platelet. Biochim Biophys Acta, 788(3), 290-297. 56
Percival, J. M., Hughes, J. A., Brown, D. L., Schevzov, G., Heimann, K., Vrhovski, B., . . . Gunning, P. W. (2004). Targeting of a tropomyosin isoform to short microfilaments associated with the Golgi complex. Mol Biol Cell, 15(1), 268-280. doi:10.1091/mbc.E03-03-0176
Perrin, B. J., & Ervasti, J. M. (2010). The actin gene family: function follows isoform. Cytoskeleton (Hoboken), 67(10), 630-634. doi:10.1002/cm.20475
Pollack, R., Osborn, M., & Weber, K. (1975). Patterns of organization of actin and myosin in normal and transformed cultured cells. Proc Natl Acad Sci U S A, 72(3), 994-998.
Pollard, T. D. (2016). Actin and Actin-Binding Proteins. Cold Spring Harb Perspect Biol. doi:10.1101/cshperspect.a018226
Pollard, T. D., & Mooseker, M. S. (1981). Direct measurement of actin polymerization rate constants by electron microscopy of actin filaments nucleated by isolated microvillus cores. J Cell Biol, 88(3), 654-659.
Pruyne, D. W., Schott, D. H., & Bretscher, A. (1998). Tropomyosin-containing actin cables direct the Myo2p-dependent polarized delivery of secretory vesicles in budding yeast. J Cell Biol, 143(7), 1931-1945.
Purcell, T. J., Morris, C., Spudich, J. A., & Sweeney, H. L. (2002). Role of the lever arm in the processive stepping of myosin V. Proc Natl Acad Sci U S A, 99(22), 14159- 14164. doi:10.1073/pnas.182539599
Rayment, I., Rypniewski, W. R., Schmidt-Base, K., Smith, R., Tomchick, D. R., Benning, M. M., . . . Holden, H. M. (1993). Three-dimensional structure of myosin subfragment-1: a molecular motor. Science, 261(5117), 50-58.
Reck-Peterson, S. L., Provance, D. W., Jr., Mooseker, M. S., & Mercer, J. A. (2000). Class V myosins. Biochim Biophys Acta, 1496(1), 36-51.
Reck-Peterson, S. L., Tyska, M. J., Novick, P. J., & Mooseker, M. S. (2001). The yeast class V myosins, Myo2p and Myo4p, are nonprocessive actin-based motors. J Cell Biol, 153(5), 1121-1126.
Rethinasamy, P., Muthuchamy, M., Hewett, T., Boivin, G., Wolska, B. M., Evans, C., . . . Wieczorek, D. F. (1998). Molecular and physiological effects of alpha-tropomyosin ablation in the mouse. Circ Res, 82(1), 116-123.
Schevzov, G., Bryce, N. S., Almonte-Baldonado, R., Joya, J., Lin, J. J., Hardeman, E., . . . Gunning, P. (2005). Specific features of neuronal size and shape are regulated by tropomyosin isoforms. Mol Biol Cell, 16(7), 3425-3437. doi:10.1091/mbc.E04-10- 0951 57
Schevzov, G., Fath, T., Vrhovski, B., Vlahovich, N., Rajan, S., Hook, J., . . . Gunning, P. W. (2008). Divergent regulation of the sarcomere and the cytoskeleton. J Biol Chem, 283(1), 275-283. doi:10.1074/jbc.M704392200
Schevzov, G., Gunning, P., Jeffrey, P. L., Temm-Grove, C., Helfman, D. M., Lin, J. J., & Weinberger, R. P. (1997). Tropomyosin localization reveals distinct populations of microfilaments in neurites and growth cones. Mol Cell Neurosci, 8(6), 439-454. doi:10.1006/mcne.1997.0599
Schevzov, G., Kee, A. J., Wang, B., Sequeira, V. B., Hook, J., Coombes, J. D., . . . Gunning, P. W. (2015). Regulation of cell proliferation by ERK and signal-dependent nuclear translocation of ERK is dependent on Tm5NM1-containing actin filaments. Mol Biol Cell, 26(13), 2475-2490. doi:10.1091/mbc.E14-10-1453
Schevzov, G., & O'Neill, G. (2008). Tropomyosin gene expression in vivo and in vitro. Adv Exp Med Biol, 644, 43-59.
Schevzov, G., Whittaker, S. P., Fath, T., Lin, J. J., & Gunning, P. W. (2011). Tropomyosin isoforms and reagents. Bioarchitecture, 1(4), 135-164. doi:10.4161/bioa.1.4.17897
Sellers, J. R., & Veigel, C. (2006). Walking with myosin V. Curr Opin Cell Biol, 18(1), 68-73. doi:10.1016/j.ceb.2005.12.014
Siemankowski, R. F., Wiseman, M. O., & White, H. D. (1985). ADP dissociation from actomyosin subfragment 1 is sufficiently slow to limit the unloaded shortening velocity in vertebrate muscle. Proc Natl Acad Sci U S A, 82(3), 658-662.
Singh, A., & Hitchcock-DeGregori, S. E. (2006). Dual requirement for flexibility and specificity for binding of the coiled-coil tropomyosin to its target, actin. Structure, 14(1), 43-50. doi:10.1016/j.str.2005.09.016
Sirotkin, V., Berro, J., Macmillan, K., Zhao, L., & Pollard, T. D. (2010). Quantitative analysis of the mechanism of endocytic actin patch assembly and disassembly in fission yeast. Mol Biol Cell, 21(16), 2894-2904. doi:10.1091/mbc.E10-02-0157
Skoumpla, K., Coulton, A. T., Lehman, W., Geeves, M. A., & Mulvihill, D. P. (2007). Acetylation regulates tropomyosin function in the fission yeast Schizosaccharomyces pombe. J Cell Sci, 120(Pt 9), 1635-1645. doi:10.1242/jcs.001115
Sladewski, T. E., Previs, M. J., & Lord, M. (2009). Regulation of fission yeast myosin- II function and contractile ring dynamics by regulatory light-chain and heavy-chain phosphorylation. Mol Biol Cell, 20(17), 3941-3952. doi:10.1091/mbc.E09-04-0346
58
Snaith, H. A., Anders, A., Samejima, I., & Sawin, K. E. (2010). New and old reagents for fluorescent protein tagging of microtubules in fission yeast; experimental and critical evaluation. Methods Cell Biol, 97, 147-172. doi:10.1016/s0091- 679x(10)97009-x
Snaith, H. A., Thompson, J., Yates, J. R., 3rd, & Sawin, K. E. (2011). Characterization of Mug33 reveals complementary roles for actin cable-dependent transport and exocyst regulators in fission yeast exocytosis. J Cell Sci, 124(Pt 13), 2187-2199. doi:10.1242/jcs.084038
Spudich, J. A., & Watt, S. (1971). The regulation of rabbit skeletal muscle contraction. I. Biochemical studies of the interaction of the tropomyosin-troponin complex with actin and the proteolytic fragments of myosin. J Biol Chem, 246(15), 4866-4871.
Stark, B. C., Sladewski, T. E., Pollard, L. W., & Lord, M. (2010). Tropomyosin and myosin-II cellular levels promote actomyosin ring assembly in fission yeast. Mol Biol Cell, 21(6), 989-1000. doi:10.1091/mbc.E09-10-0852
Stehn, J. R., Haass, N. K., Bonello, T., Desouza, M., Kottyan, G., Treutlein, H., . . . Gunning, P. W. (2013). A novel class of anticancer compounds targets the actin cytoskeleton in tumor cells. Cancer Res, 73(16), 5169-5182. doi:10.1158/0008- 5472.CAN-12-4501
Stehn, J. R., Schevzov, G., O'Neill, G. M., & Gunning, P. W. (2006). Specialisation of the tropomyosin composition of actin filaments provides new potential targets for chemotherapy. Curr Cancer Drug Targets, 6(3), 245-256.
Swartz, D. R., Moss, R. L., & Greaser, M. L. (1996). Calcium alone does not fully activate the thin filament for S1 binding to rigor myofibrils. Biophys J, 71(4), 1891- 1904. doi:10.1016/S0006-3495(96)79388-8
Sweeney, H. L., & Houdusse, A. (2010). Structural and functional insights into the Myosin motor mechanism. Annu Rev Biophys, 39, 539-557. doi:10.1146/annurev.biophys.050708.133751
Takagi, Y., Yang, Y., Fujiwara, I., Jacobs, D., Cheney, R. E., Sellers, J. R., & Kovacs, M. (2008). Human myosin Vc is a low duty ratio, nonprocessive molecular motor. J Biol Chem, 283(13), 8527-8537. doi:10.1074/jbc.M709150200
Tang, N., & Ostap, E. M. (2001). Motor domain-dependent localization of myo1b (myr-1). Curr Biol, 11(14), 1131-1135.
Taylor, K. A. (2007). Regulation and recycling of myosin V. Curr Opin Cell Biol, 19(1), 67-74. doi:10.1016/j.ceb.2006.12.014
59
Terman, J. R., & Kashina, A. (2013). Post-translational modification and regulation of actin. Curr Opin Cell Biol, 25(1), 30-38. doi:10.1016/j.ceb.2012.10.009
Tobacman, L. S. (2008). Cooperative binding of tropomyosin to actin. Adv Exp Med Biol, 644, 85-94.
Tojkander, S., Gateva, G., Schevzov, G., Hotulainen, P., Naumanen, P., Martin, C., . . . Lappalainen, P. (2011). A molecular pathway for myosin II recruitment to stress fibers. Curr Biol, 21(7), 539-550. doi:10.1016/j.cub.2011.03.007
Toth, J., Kovacs, M., Wang, F., Nyitray, L., & Sellers, J. R. (2005). Myosin V from Drosophila reveals diversity of motor mechanisms within the myosin V family. J Biol Chem, 280(34), 30594-30603. doi:10.1074/jbc.M505209200
Trybus, K. M. (1991). Regulation of smooth muscle myosin. Cell Motil Cytoskeleton, 18(2), 81-85. doi:10.1002/cm.970180202
Uribe, R., & Jay, D. (2009). A review of actin binding proteins: new perspectives. Mol Biol Rep, 36(1), 121-125. doi:10.1007/s11033-007-9159-2
Veigel, C., Wang, F., Bartoo, M. L., Sellers, J. R., & Molloy, J. E. (2002). The gated gait of the processive molecular motor, myosin V. Nat Cell Biol, 4(1), 59-65. doi:10.1038/ncb732
Volkmann, N., Hanein, D., Ouyang, G., Trybus, K. M., DeRosier, D. J., & Lowey, S. (2000). Evidence for cleft closure in actomyosin upon ADP release. Nat Struct Biol, 7(12), 1147-1155. doi:10.1038/82008 von der Ecken, J., Muller, M., Lehman, W., Manstein, D. J., Penczek, P. A., & Raunser, S. (2015). Structure of the F-actin-tropomyosin complex. Nature, 519(7541), 114- 117. doi:10.1038/nature14033
Walker, M. L., Burgess, S. A., Sellers, J. R., Wang, F., Hammer, J. A., 3rd, Trinick, J., & Knight, P. J. (2000). Two-headed binding of a processive myosin to F-actin. Nature, 405(6788), 804-807. doi:10.1038/35015592
Wang, E., & Goldberg, A. R. (1976). Changes in microfilament organization and surface topogrophy upon transformation of chick embryo fibroblasts with Rous sarcoma virus. Proc Natl Acad Sci U S A, 73(11), 4065-4069.
Warshaw, D. M., Kennedy, G. G., Work, S. S., Krementsova, E. B., Beck, S., & Trybus, K. M. (2005). Differential labeling of myosin V heads with quantum dots allows direct visualization of hand-over-hand processivity. Biophys J, 88(5), L30-32. doi:10.1529/biophysj.105.061903
60
Watanabe, S., Watanabe, T. M., Sato, O., Awata, J., Homma, K., Umeki, N., . . . Ikebe, M. (2008). Human myosin Vc is a low duty ratio nonprocessive motor. J Biol Chem, 283(16), 10581-10592. doi:10.1074/jbc.M707657200
Webb, R. C. (2003). Smooth muscle contraction and relaxation. Adv Physiol Educ, 27(1-4), 201-206.
Wegner, A. (1976). Head to tail polymerization of actin. J Mol Biol, 108(1), 139-150.
Wegner, A. (1979). Equilibrium of the actin-tropomyosin interaction. J Mol Biol, 131(4), 839-853.
Wells, A. L., Lin, A. W., Chen, L. Q., Safer, D., Cain, S. M., Hasson, T., . . . Sweeney, H. L. (1999). Myosin VI is an actin-based motor that moves backwards. Nature, 401(6752), 505-508. doi:10.1038/46835
Win, T. Z., Gachet, Y., Mulvihill, D. P., May, K. M., & Hyams, J. S. (2001). Two type V myosins with non-overlapping functions in the fission yeast Schizosaccharomyces pombe: Myo52 is concerned with growth polarity and cytokinesis, Myo51 is a component of the cytokinetic actin ring. J Cell Sci, 114(Pt 1), 69-79.
Wu, X. S., Rao, K., Zhang, H., Wang, F., Sellers, J. R., Matesic, L. E., . . . Hammer, J. A., 3rd. (2002). Identification of an organelle receptor for myosin-Va. Nat Cell Biol, 4(4), 271-278. doi:10.1038/ncb760
Xu, C., Craig, R., Tobacman, L., Horowitz, R., & Lehman, W. (1999). Tropomyosin positions in regulated thin filaments revealed by cryoelectron microscopy. Biophys J, 77(2), 985-992. doi:10.1016/S0006-3495(99)76949-3
Yamaguchi, M., Ver, A., Carlos, A., & Seidel, J. C. (1984). Modulation of the actin- activated adenosinetriphosphatase activity of myosin by tropomyosin from vascular and gizzard smooth muscles. Biochemistry, 23(4), 774-779.
Yengo, C. M., De la Cruz, E. M., Safer, D., Ostap, E. M., & Sweeney, H. L. (2002). Kinetic characterization of the weak binding states of myosin V. Biochemistry, 41(26), 8508-8517.
61
Figure 2-1: Myo52p constructs and purification. (A) Top, linear representations of full-length and truncated Myo52p constructs. The positions of specific domains are indicated on the full-length construct. Truncated Myo52p-HMM (amino acids 1–1056 of the Myo52p heavy chain) was used in TIRF-based motility assays. This construct contains a biotin tag following the coiled-coil for attachment to streptavidin-coated Qdots or streptavidin-Cy3, and a FLAG tag to facilitate affinity purification. The C- terminus of both full-length and truncated forms of Myo52p were fused to triple GFP for in vivo studies (Figures 4–6). Bottom, corresponding illustrations of double-headed Myo52p molecules. Six light chains (black ovals) bind to the IQ region of each Myo52p polypeptide. (B, C) Purified protein samples after SDS–PAGE and gel staining with Coomassie blue. Molecular weight standards are included in the left lanes. (B) Myo52p- HMM after elution from anti-FLAG purification resin. HMM was co-overexpressed with its two (untagged) light chains: Cam1p and Cdc4p. These light chains were also purified independently (see Materials and Methods) and added to HMM samples at 10- fold molar excess to minimize light-chain dissociation and suboptimal Myo52p motor activity in biochemical assays. (C) Fission yeast tropomyosin Cdc8p was purified from bacteria as an acetylated-mimicking form.
62
Figure 2-2: Fission yeast tropomyosin is required for transport of single Myo52p molecules along actin filaments. Processive movement of Myo52p-HMM molecules coupled to Qdots (1:10 M ratio) along rhodamine-phalloidin–labeled actin filaments using TIRF microscopy. (A) Movement of a Myo52p-Qdot (green) along a Cdc8p- decorated actin filament (red). Bar, 4 µm. Other representative events are presented in Supplemental Movie S1. (B) Kymograph showing a typical Myo52p-Qdot run along an actin-Cdc8p filament. (C) Histogram of the speed distribution of Myo52p-Qdots. (D) Run length histogram of Myo52p-Qdots moving on Cdc8p-actin tracks. The red curve shows the exponential fit (y = Ae−x/λ), which yields the run length λ.
63
Figure 2-3: Movements of single Myo52p molecules along actin and actin- tropomyosin tracks at low ATP concentration. Processive movement of Myo52p- HMM molecules coupled to Qdots (1:10 M ratio) along rhodamine-phalloidin–labeled actin filaments at low ATP concentration (10 µM) using TIRF microscopy. Representative events are presented in Supplemental Movie S3. (A) Speeds of Myo52p- Qdots on actin vs. actin-Cdc8p tracks (n = 17, actin alone; n = 104, actin-Cdc8p). (B) Relative frequency of Myo52p runs along actin vs. actin-Cdc8p tracks (17 runs/1123.8 µm available actin vs. 104 runs/959.6 µm available actin-Cdc8p). The frequency of Myo52p movements on actin alone was normalized to 1.0. (C) Histogram of run lengths for Myo52p molecules along actin vs. Cdc8p-decorated actin tracks. The red curves show the exponential fits (y = Ae−x/λ) used to determine the run length, λ.
64
Figure 2-4: Estimating the numbers of Myo52p molecules per motile particle in the cell. The signal intensity of GFP in motile Myo52p-3xGFP particles was used to estimate the number of Myo52p molecules/particle. Clathrin light-chain (Clc1p-3xGFP) signal was used as a standard based on its previously characterized distribution at actin patches (40 molecules/patch; Sirotkin et al., 2010). (A) Representative time-lapse images of a mixed population of myo52-3xGFP and clc1-3xGFP cells (after growth on YE5S rich medium at 25°C). clc1-3xGFP cells were distinguished from myo52-3xGFP cells by inclusion of a genomic uch2-Cherry fusion, which marks nuclei red. The GFP (green) images shown are maximum projections generated from seven z-stacks. The arrowheads track the movement of three different motile Myo52p particles. Bar, 4 µm. (B) Histogram comparing the average GFP intensities for motile Myo52p particles and Clc1p patches. (C) Histogram of the distribution of Myo52p GFP intensities expressed as number of dimeric motors/motile particle.
65
Figure 2-5: The cargo-binding domain of Myo52p is essential for in vivo function and clustering of Myo52p in subcellular particles in the absence of actin. (A) Wild- type and myo52 mutant strains were grown at 32°C in YE5S rich media before microscopic imaging. Representative differential interference contrast (DIC) images of wild-type myo52+ (myo52-3xGFP) cells (left), myo52 null mutants (center), and the truncation mutant (myo52ΔCBD-3xGFP, right), which lacks sequence encoding the C- terminal cargo-binding domain (amino acids 1025–1516). Both mutants show a characteristic loss-of-function phenotype reflected by defects in cell shape (Motegi et al., 2001; Win et al., 2001). (B) Wild-type (myo52-3xGFP) and mutant (myo52ΔCBD- 3xGFP) cells were grown at 25°C in YE5S rich media before imaging. Representative DIC and fluorescence micrographs show the subcellular localization of full-length Myo52p-3xGFP (top) and Myo52pΔCBD-3xGFP (bottom) upon treatment with dimethylsulfoxide (controls, left) or 10 µM latrunculin A (right). Bars, 4 µm.
66
Figure 2-6: Myo52p molecules lacking their cargo-binding domain undergo efficient motility along actin cables. (A) Time-lapse montages showing directed movement of full-length Myo52p-3xGFP (top) and truncated Myo52pΔCBD-3xGFP (bottom) particles in wild-type myo52-3xGFP and myo52ΔCBD-3xGFP cells, respectively (after growth on YE5S rich medium at 25°C). Directed movements were captured over time using TIRF microscopy. Far right, maximum projections of the particle trajectories. Bar, 4 µm. Representative events from the myo52ΔCBD-3xGFP strain are also presented in Supplemental Movie S5. (B) Histogram of the speed distribution of full-length Myo52p and Myo52pΔCBD particles. (C, D) Average run length (n = 45 in C) and event frequency (cell number = 82–122 in D) of motile Myo52p and Myo52pΔCBD particles. (E) Histogram of Myo52pΔCBD GFP intensity as number of dimeric motors/motile particle.
67
Figure 2-7: Sorting of Myo52p to actin cables during interphase. An interphase cell uses two distinct actin structures: 1) endocytic actin patches (blue) made up of branched actin filament networks that associate with myosin-I (Myo1p) and lack tropomyosin (Cdc8p), and 2) actin cables (green) made up of unbranched polarized Cdc8p-decorated actin filaments that support Myo52p transport throughout the cell cycle (Kovar et al., 2011). Box, the presence of Cdc8p on actin cables facilitates Myo52p interactions by converting cytoplasmic Myo52p molecules into processive motors, which preferentially bind to and move efficiently along the cables. The absence of tropomyosin at actin patches fails to support Myo52p processivity, preventing inappropriate interactions between myosin-V and endocytic actin structures.
68
Supplementary Figures and Legends
Figure 2-S1. Cy3-labeled Myo52p molecules move processively along actin-Cdc8p filaments. Single Myo52p-HMM molecules were coupled to Cy3 in order to track their ability to move along Alexa 635-phalloidin-labeled actin filaments using TIRF microscopy. A) Movement of a representative Myo52p-Cy3 molecule (green) along a Cdc8p-decorated actin filament (red). Bar: 2 mm. Other representative events are presented in Supplementary Movie 2. B) Representative kymograph summarizing a typical Myo52p-Cy3 run along an actin-Cdc8p filament. C) Histogram summarizing the distribution of Myo52p-Cy3 speeds (n=100). D) Histogram of run lengths for Myo52p- Cy3 along Cdc8p-decorated actin tracks (n=114). The red curve shows the exponential fit (y = Ae-x/l ) to determine the run length l.
69
Figure 2-S2. Cdc8p activates the motility of fluorescence Qdots coated with multiple Myo52p motors. Qdots were saturated with Myo52p-HMM molecules (yielding ~3-5 motors/Qdot) to track the ability of multiple Myo52p molecules to support movement along rhodamine phalloidin-labeled actin filaments using TIRF microscopy. Only actin filaments decorated with tropomyosin (Cdc8p) supported movement of these Myo52p-coated Qdots. A) Movement of a representative Myo52p- coated Qdot (green) along a Cdc8p-decorated actin filament (red). Bar: 4 µm. Other representative events are presented in Supplementary Movie 4. B) Histograms comparing run lengths of Qdots associated with single (n=103) versus multiple (n=117) Myo52p molecules along Cdc8p-decorated actin tracks. The red curves show exponential fits (y = Ae-x/λ ) to determine the run length λ.
70
Figure 2-S3. The cellular function of Myo52p relies on its C-terminal cargo- binding domain. Wild-type myo52-3xGFP and mutant myo52DCBD-3xGFP cells were grown at 25o C in YE5S rich media prior to microscopic imaging. Representative DIC and epi-fluorescence images showing the localization of Myo52p-3xGFP or Myo52pDCBD-3xGFP (GFP) and a Myo52p cargo (GTPase Ypt3p, Tomato-Ypt3p) in wild-type and mutant cells. Unlike in wild-type cells, Ypt3p is not transported with Myo52p to sites of polarized growth in the absence of the cargo-binding domain. Bars: 4 mm.
71
Figure 2-S4. Polarized localization of truncated Myo52p lacking its cargo-binding domain relies on actin filaments. myo52DCBD-tdTomato cells were grown at 25o C in YE5S rich media prior to imaging. Representative DIC and fluorescence micrographs show the sub-cellular localization of Myo52pDCBD-tdTomato upon treatment with DMSO (control, left) or 10 mM Latrunculin A (right). Bar: 4 mm.
72
Supplementary Movie Legends
Movie 2-S1. Cdc8p-decorated actin filaments support the processive movement of single Myo52p-Qdot molecules. Left: Failure of Myo52p-HMM-Qdots (green) to move processively on bare actin filaments (red) in the presence of 2 mM ATP. Right: In contrast, Myo52p-HMM-Qdots can move processively on Cdc8pdecorated actin filaments. Data were collected using TIRF microscopy with a capture rate of 30 frames/s and are played back at this speed. Scale bar: 2 µm.
Movie 2-S2. Cdc8p-decorated actin filaments support the processive movement of single Myo52p-Cy3 molecules. Cy3-labeled Myo52p-HMM (green) moving processively on actin-Cdc8 filaments (red) in the presence of 2 mM ATP. Data were collected using TIRF microscopy with a capture rate of 5 frames/s and are played back at this speed. Scale bar: 2 µm.
Movie 2-S3. Processive movement of Myo52p molecules on bare actin and Cdc8p- decorated actin filaments at low concentrations of ATP. Left: A Myo52p-HMM-Qdot (green) moving processively on bare actin filaments (red) in the presence of 10 µM ATP. Right: Myo52p-HMM-Qdots moving processively on Cdc8p-decorated actin filaments in 10 µM ATP. Data were collected using TIRF microscopy with a capture rate of 1 frame/s and are played back at 30 frames/s (sped-up 30x). Scale bar: 2 µm.
Movie 2-S4. Cdc8p-decorated actin filaments support movement of Qdots by multiple Myo52p molecules. Left: Failure of Qdots (green) bound by multiple Myo52p-HMM motors to move along bare actin filaments (red) in the presence of 2 mM ATP. Right: In contrast, Qdots bound by multiple Myo52p- HMM motors can move processively on Cdc8p-decorated actin filaments. Data were collected using TIRF microscopy with a capture rate of 30 frames/s and are played back at this speed. Scale bar: 2 µm.
Movie 2-S5. The directed motility of Myo52p molecules in the cell does not rely on the C-terminal cargobinding domain. In vivo directed motility of Myo52pΔCBD-3xGFP particles (green) made from clusters of molecules lacking their C-terminal cargo- binding domains in the myo52ΔCBD-3xGFP strain. Data were collected using epi- fluorescence microscopy with a capture rate of 10 frames/s; played back at 100 frames/s (sped up 10x).
Supplemental movies can be found at www.MolBiolCell.org.
73
Chapter 3. Myosin motor isoforms direct specification of actomyosin function by tropomyosins
Joseph E. Clayton, Luther W. Pollard, George G Murray, Mathew Lord
Department of Molecular Physiology & Biophysics, University of Vermont, Burlington, VT 05405
74
Abstract
Myosins and tropomyosins represent two cytoskeletal proteins that often work together with actin filaments in contractile and motile cellular processes. While the specialized role of tropomyosin in striated muscle myosin-II regulation is well characterized, its role in nonmuscle myosin regulation is poorly understood. We previously showed that fission yeast tropomyosin (Cdc8p) positively regulates myosin-II (Myo2p) and myosin-
V (Myo52p) motors. To understand the broader implications of this regulation we examined the role of two mammalian tropomyosins (Tpm3.1cy/Tm5NM1 and
Tpm4.2cy/Tm4) recently implicated in cancer cell proliferation and metastasis. Like
Cdc8p, the Tpm3.1cy and Tpm4.2cy isoforms significantly enhance Myo2p and
Myo52p motor activity, converting nonprocessive Myo52p molecules into processive motors that can walk along actin tracks as single molecules. In contrast to the positive regulation of Myo2p and Myo52p, Cdc8p and the mammalian tropomyosins potently inhibited skeletal muscle myosin-II, while having negligible effects on the highly processive mammalian myosin-Va. In support of a conserved role for certain tropomyosins in regulating nonmuscle actomyosin structures, Tpm3.1cy supported normal contractile ring function in fission yeast. Our work reveals that actomyosin regulation by tropomyosin is dependent on the myosin isoform, highlighting a general role for specific isoforms of tropomyosin in sorting myosin motor outputs.
75
Introduction
Tropomyosins form strand-like molecules made up of parallel dimeric coiled- coils (Hitchcock-DeGregori, 2008). The association of tropomyosin with actin promotes filament stability and is known to regulate associations with actin-binding proteins such as myosin motors (Barua et al., 2013; Barua et al., 2014; Bryce et al.,
2003; Clayton et al., 2010; Coulton et al., 2010; Fanning et al., 1994; Lehrer, 1994;
Stark et al., 2010; Tang & Ostap, 2001), filament cross-linkers (Clayton et al., 2010;
Creed et al., 2008; Skau et al., 2010), filament severing factors (Bernstein et al., 1992;
Fattoum et al., 1983; Ishikawa et al., 1989; Nakano et al., 2006; Ono et al., 2002) (Fan et al., 2008), filament cappers (Fowler et al., 1993; Weber et al., 1994)and actin nucleation factors (Blanchoin et al., 2001; Skau et al., 2009; Wawro et al., 2007). The mechanism by which tropomyosin regulates myosin has been well studied in muscle, yet we are only now beginning to learn how tropomyosin regulates myosin function in nonmuscle cells. There is still much to be learned in this area given the multiple classes of myosins and >40 tropomyosin isoforms expressed in mammalian cells (Gunning et al., 2005).
Fission yeast has recently proved to be a useful model with which to study tropomyosin function owing to its tractable genetics, well-defined actin cytoskeleton, and established actin biochemistry (Kovar et al., 2011). Fission yeast tropomyosin
(Cdc8p) is restricted to the unbranched formin-mediated actin filaments that make up the contractile rings used in cytokinesis and the actin cables used in intracellular transport and maintenance of cell shape (Balasubramanian et al., 1992; Johnson et al.,
2014; Kovar et al., 2011; Lo Presti et al., 2012). By contrast, Cdc8p is absent from the
76
Arp2/3-mediated branched actin utilized in endocytic patches (Balasubramanian et al.,
1992; Kovar et al., 2011). Each of the three fission yeast actin structures associate with different myosins (East & Mulvihill, 2011; Kovar et al., 2011), and previous work with
Cdc8p highlighted a role for tropomyosin in the regulation of these actin-based motors.
As opposed to limiting access to the actin track as in muscle (Lehrer, 1994), decoration of actin with Cdc8p positively regulates myosin-II (Myo2p) activity and function at contractile rings (Stark et al., 2010). In addition, myosin-V (Myo52p) activity and transport along cables is favored by Cdc8p (Clayton et al., 2014; Clayton et al., 2010).
In contrast to Myo2p and Myo52p, decoration of actin with Cdc8p inhibits myosin-I
(Myo1p) in vitro (Clayton et al., 2010). This negative regulation presumably helps to restrict Myo1p motor activity to the branched actin networks (that lack Cdc8p) at endocytic patches.
Tropomyosins form filaments that associate weakly with actin, forming a co- polymer in which tropomyosin wraps longitudinally along both sides of the actin filament (Gunning et al., 2005). In such co-polymers each tropomyosin covers four to seven actin monomers depending on the tropomyosin isoform in play (Gunning et al.,
2005). Neighboring tropomyosins associate with one another via end-to-end interactions between their N- and C-termini (Hitchcock-DeGregori, 2008). These interactions account for cooperative tropomyosin-actin associations and facilitate tropomyosin self- assembly at low ionic strength (Tobacman, 2008). Mutational analysis of the Cdc8p N- terminus revealed a role for this region in promoting actin association and Cdc8p polymer formation (East & Mulvihill, 2011).
77
Interestingly, Cdc8p can be acetylated on its N-terminal methionine, a modification that alters actin-tropomyosisn structure, enhances actin associations, and contributes to Cdc8p function in the cell(Coulton et al., 2010; Skoumpla et al., 2007).
Acetylated Cdc8p predominates at the contractile ring and is important for myosin-II localization and ring function, whereas unacetylated Cdc8p predominates at actin cables and faithfully supports Myo52p transport in the cell (Coulton et al., 2010). Thus, two specific forms of tropomyosin are generated from one isoform in fission yeast. The choice of fission yeast actin-nucleation factor (i.e. the formin isoform) distinguishes which of the two forms of Cdc8p are recruited to the two different unbranched actin filaments structures in the cell (Johnson et al., 2014).
In contrast to fission yeast, a large variety of tropomyosins are expressed in mammalian cells, primarily generated through alternative splicing of a uniform set of exons from four different genes (TPM1-TPM4) (Geeves et al., 2015; Gunning et al.,
2005). Some isoforms are expressed in a tissue-specific manner and are classified as striated muscle-specific (from skeletal and cardiac muscle tissues), smooth muscle- specific, or brain-specific. The remaining isoforms are referred to as “cytoplasmic,” being distributed amongst all other cell types. The different tropomyosins can also be broken down into two general classes based on sequence length. Low molecular weight
(LMW) tropomyosins are ∼248 amino acids in length and incorporate exon 1b of the
TPM gene (Fig. 3-1A); whereas high molecular weight (HMW) tropomyosins are ∼284 amino acids long and utilize exons 1a and 2a (or 2b) (Fig. 3-1A).
In this study we compared the influence of Cdc8p and two LMW cytoplasmic tropomyosins implicated in cancer cell growth and metastasis on four different myosins 78
(Myo2p, Myo52p, skeletal muscle myosin-II, and chick brain myosin-Va). A combination of in vitro and in vivo approaches suggest that the ability of tropomyosin to positively regulate nonmuscle myosins Myo2p and Myo52p is not restricted to
Cdc8p. Moreover, the effects of tropomyosin on myosin activity differ depending on the myosin isoform involved underscoring a general concept in tropomyosin-mediated myosin regulation. Such regulation has the potential to provide tight specification of both nonmuscle and muscle actomyosin function in complex cellular environments.
This work has broad implications with regard to sorting of actomyosin function in cancer cells and developing muscle tissue.
Results
Selecting Representative Mammalian Tropomyosin Isoforms
We wished to compare the role of fission yeast Cdc8p with nonmuscle mammalian tropomyosins previously implicated in myosin function in cancer cells. We chose to focus on two LMW tropomyosin isoforms (Tpm3.1cy/Tm5NM1 and Tpm4.2cy/Tm4) originating from the TPM3 and TPM4 genes, respectively (Fig. 3-1A). We are employing the latest nomenclature to describe mammalian tropomyosin isoforms
(Geeves et al., 2015). As such Tpm3.1cy/Tm5NM1 and Tpm4.2cy/Tm4 will be referred to as Tpm3.1cy and Tpm4.2cy, respectively from here on in.
Our choice of tropomyosins reflects information gleaned from previous work.
Tpm3.1cy and Tpm4.2cy were shown to regulate stress fiber formation and myosin-II recruitment to fibers in B35 neuroblastoma and U2OS osteosarcoma cells respectively
(Bryce et al., 2003; Tojkander et al., 2011). Furthermore, Tpm3.1cy, its closely related
79 isoform Tpm3.2cy, and Tpm4.2cy represent the predominant LMW isoforms found in primary tumors and tumor cell lines (Stehn et al., 2006). Interestingly, Tpm3.1cy and
Tpm3.2cy were recently shown to be essential for neuroblastoma cell proliferation, and represent the only two tropomyosin isoforms up-regulated upon transformation of both primary immortalized human BJ fibroblasts and human melanoma cells (Stehn et al.,
2013). Previous studies revealed that overexpression of Tpm3.1cy generates actin stress fibers exhibiting reduced susceptibility to traditional actin-targeting drugs, suggesting that tropomyosin composition can influence drug action (Creed et al., 2008).
Importantly, recently developed anti-cancer compounds targeting Tpm3.1cy and
Tpm3.2cy are showing promise based on their ability to inhibit tumor cell motility and growth (Stehn et al., 2013).
N-terminal acetylation of tropomyosin has been shown to be important for both
Cdc8p (Coulton et al., 2010; Skoumpla et al., 2007) and striated muscle α- tropomyosin/Tpm1.1st (Heald et al., 1988; Hitchcock-DeGregori et al., 1987;
Urbancikova et al., 1994) function. While post-translational modification offers another potential interesting avenue of regulation, we largely focused on the function of acetylated-mimicking forms of Cdc8p, Tpm3.1cy, and Tpm4.2cy purified following overexpression in Escherichia coli (Fig. 3-1B). Chicken skeletal muscle actin represents the standard actin isoform employed in all our in vitro studies.
Differential Regulation of Myo2p and Skeletal Muscle Myosin-II by Mammalian
Tropomyosins
We compared the ability of Cdc8p, Tpm3.1cy, and Tpm4.2cy to regulate full-length fission yeast myosin-II (Myo2p) and full-length skeletal muscle myosin-II (SKMM-II) 80 using bulk actin-activated ATPase and ensemble actin filament gliding assays. The activities of Myo2p and SKMM-II were compared in an identical fashion in both assays. The concentration of myosin used in the ATPase assays was generally much lower (0.03–0.09 µM) than the various concentrations of actin/actin-tropomyosin filaments present (0.1–30 µM). In contrast, the concentration of myosin (5 nM) employed in the filament gliding assays was closer to the actin/actin-tropomyosin filament concentration used (25 nM).
Michaelis-Menten analysis was employed to compare the ATPase activity of
Myo2p and SKMM-II with actin or actin-tropomyosin filaments. Cdc8p increased the maximal ATPase rate (VMAX) and the overall catalytic efficiency of Myo2p approximately twofold (Fig. 3-2A; Table 3-1). Tpm3.1cy and Tpm4.2cy also enhanced
Myo2p ATPase activity with a similar potency (Fig. 3-2A; Table 3-1). In stark contrast to the positive effect of tropomyosins on Myo2p, Cdc8p, and both cytoplasmic tropomyosins inhibited the ATPase activity of SKMM-II (Fig. 3-2B; Table 3-1). This inhibition does not appear to depend on the acetylation status of the tropomyosins since absence of the acetylation-mimicking Ala-Ser dipeptide (on the N-termini of Cdc8p or
Tpm3.1cy) did not significantly influence the ability of the tropomyosins to inhibit
SKMM-II activity (Fig. 3-3A).
Decoration of actin filaments with Cdc8p led to a significant drop in the rate of
Myo2p-driven actin filament gliding, an effect that was also observed with Tpm3.1cy and Tpm4.2cy (Table 3-1). This drop in rate was statistically more penetrant for actin-
Cdc8p cf. the mammalian tropomyosins (Table 3-1). Based on past studies with Myo2p and Cdc8p (Stark et al., 2010), this tropomyosin-mediated reduction in speed does not
81 reflect inhibition per se, more so it reflects a Cdc8p-mediated bias for the strong actin- bound ADP or apo states of Myo2p (Stark et al., 2010), states which are rate-limiting for myosin motility (Siemankowski et al., 1985). Consistent with such a positive effect, the presence of Cdc8p, Tpm3.1cy, and Tpm4.2cy increased the persistence and efficiency of Myo2p-driven filament gliding (Fig. 3-4A; Table 3-1).
In contrast to the results obtained with Myo2p, decoration of actin with Cdc8p or the mammalian tropomyosins led to a much bigger reduction in SKMM-II-driven actin filament gliding speed (Table 3-1). While these reduced speeds varied statistically
(between the different tropomyosins tested), they all reflected tropomyosin-mediated inhibition as the number of motile filaments and motility efficiency of SKMM-II was greatly diminished in the presence of each tropomyosin (Fig. 3-4B; Table 3-1).
Recent studies have indicated that the use of saturating amounts of SKMM-II avoids tropomyosin-mediated inhibition of filament gliding (Barua et al., 2014).
Nevertheless, we found that the inhibitory effects of the tropomyosins on motility speed and efficiency were still maintained when saturating concentrations of SKMM-II were employed (Figs. 3-5A and 3-5B). These contrasting results may reflect differences in the way SKMM-II preparations were attached to the slides in motility chambers. Barua et al. employed high salt to facilitate attachment of individual SKMM-II molecules, whereas we employed lower concentrations of salt to pre-assemble SKMM-II filament ensembles prior to attachment.
In summary, while Cdc8p and the mammalian tropomyosins had an obvious positive effect on nonmuscle Myo2p motor function, these same tropomyosins potently inhibited SKMM-II motor function in the very same assays.
82
Differential Regulation of Myo52p and Myosin-Va by Mammalian Tropomyosins
Myosin-Vs are transporters that typically operate as processive motors capable of taking multiple steps along actin filaments without falling off. Consequently, most myosin-V isoforms studied to date are high duty ratio motors, meaning that they spend a large proportion of their ATPase cycle in the strong actin-bound state. The high duty ratio and dimeric nature of these molecules facilitates processive, hand-over-hand walking along actin (De La Cruz et al., 1999; Mehta et al., 1999). Mammalian myosin-Va represents a well-studied and highly processive form of myosin-V (De La Cruz et al.,
1999; Mehta et al., 1999). In contrast to myosin-Va, fission yeast Myo52p has a relatively low duty ratio for a myosin-V and is nonprocessive (Clayton et al., 2014;
Clayton et al., 2010). Myo52p processivity and recruitment to actin cables in the cell relies on Cdc8p (Clayton et al., 2014). We wished to compare the ability of Cdc8p and the mammalian tropomyosins to regulate Myo52p and myosin-Va actin-activated
ATPase activity and motility. Truncated heavy meromyosin (HMM) forms of Myo52p and myosin-Va were used that lack the C-terminal cargo-binding globular tail domain.
These HMM forms represent dimeric myosin-V molecules possessing the motor domain, the light chain-binding region, and the coiled-coil region.
Like Cdc8p, Tpm3.1cy, and Tpm4.2cy enhanced the activity of Myo52p motors in ATPase assays, as evidenced by a lower KM, higher VMAX, and greater overall catalytic efficiency compared to bare actin filaments (Fig. 3-2C; Table 3-1). Similar changes in Myo52p KM and VMAX values were also obtained in the presence of
Cdc8p when using an alternative ATPase assay that utilizes an ATP-regenerating
83 system (Fig. 3-3B). This system avoids inhibitory build-up of ADP, which is common with high duty ratio motors like myosin-V. This assay revealed higher VMAX values for Myo52p, values closer to those one would predict from the Myo52p single molecule motility speeds previously reported from our laboratory (Clayton et al., 2014) (Fig. 3-
3B).
We compared the effect of Cdc8p and the mammalian tropomyosins on myosin-
Va actin-activated ATPase activity utilizing the ATP-regenerating system (Fig. 3-2D).
In contrast to the obvious effects seen with Myo52p (where the tropomyosins increased
VMAX, reduced KM, and increased catalytic efficiency), the tropomyosins had little effect on myosin-Va activity. The presence of the three different tropomyosins (if anything) only slightly reduced the VMAX of myosin-Va, while having little effect on
KM and catalytic efficiency values (Fig. 3-2D; Table 3-1).
Similar to the effects of Cdc8p on Myo2p motility (Table 3-1), decoration of actin with Cdc8p significantly reduced the speed of Myo52p motility in filament gliding assays (Table 3-1). Consistent with the positive effect of the mammalian tropomyosins on Myo52p ATPase activity (Fig. 3-2C; Table 3-1), Tpm3.1cy and Tpm4.2cy had the same effect as Cdc8p and significantly reduced Myo52p actin gliding rate (Table 3-1).
As seen with Myo2p, this drop in Myo52p motility rate was statistically more penetrant for actin-Cdc8p cf. the mammalian tropomyosins (Table 3-1). As with Myo2p, we predict that the reduced rates of gliding reflect the ability of tropomyosin to favor movement into the strong actin-bound state. In terms of motility efficiency, all three tropomyosins increased the frequency of Myo52p-driven filament gliding events (Table
3-1), similar to the effect of the tropomyosins on Myo2p motility (Table 3-1).
84
In contrast to Myo52p, decoration of actin with Cdc8p or the mammalian tropomyosins had minor effects on myosin-Va-driven filament gliding (Table 3-1), consistent with the negligible effects of these tropomyosins on myosin-Va ATPase activity (Fig. 3-2D). While decoration of actin with Cdc8p did not alter myosin-Va gliding speed, decoration with Tpm3.1cy or Tpm4.2cy yielded minor increases in gliding speed (Table 3-1). The motility efficiency of myosin-Va was slightly improved in the presence of both Cdc8p and Tpm4.2cy, a feature which may reflect the wider distribution of motility rates observed with actin-Tpm3.1cy (Table 3-1).
In summary, Cdc8p and the mammalian tropomyosins had an obvious positive effect on the nonprocessive Myo52p motor, whereas analysis of the same tropomyosins in the same assays revealed only minimal effects on the highly processive myosin-Va motor. Our previous work (Clayton et al., 2014) and the new findings with the mammalian tropomyosins implies that Cdc8p, Tpm3.1cy, and Tpm4.2cy favor the strong actin-bound state of myosin, which in turn favors an increase in the duty ratio of non-processive myosin-Vs.
Activation of Fission Yeast Myosin-V Processivity by Mammalian Tropomyosins
We previously used total internal reflection fluorescence (TIRF) microscopy to show that Cdc8p is required for single Myo52p motors to move processively along actin filaments (Clayton et al., 2014). We repeated these experiments to test whether the mammalian tropomyosins could also regulate Myo52p processivity. The Myo52p-
HMM employed had a C-terminal biotin tag for attachment to streptavidin-coated fluorescent quantum dots (Qdots) (Clayton et al., 2014). Fluorescently-labeled actin
85 filaments were attached to a glass coverslip, and a solution containing Myo52p-labeled with Qdots was applied. We assume our labeling approach achieves single molecule resolution based on optimization in previous studies (Clayton et al., 2014; Hodges et al.,
2009; Hodges et al., 2012).
Consistent with our ATPase and filament gliding results, Tpm3.1cy and
Tpm4.2cy behaved like Cdc8p and activated efficient processive movements of
Myo52p along actin filaments (Figs. 3-6A and 3-6B; see Movies 3-S1 and 3-S2 in
Supporting Information). The speeds and run lengths of these processive movements along Tpm3.1cy- and Tpm4.2cy-decorated actin tracks were in fact a little higher (Figs.
3-6C and 3-6D) than those previously reported for Cdc8p-decorated tracks (speed:
1.25 ± 0.43 µmŊs−1; run length: 0.64 µm) (Clayton et al., 2014). The extent to which the different tropomyosin isoforms supported processivity varied with respect to run frequency. The run frequency with Tpm4.2cy was higher than with Cdc8p, while the frequency with Tpm3.1cy was lower than Cdc8p (Fig. 3-6E). In summary, the ability of
Cdc8p to convert Myo52p to a processive motor is not restricted to yeast tropomyosin.
This processivity can be accounted for by a tropomyosin-mediated increase in the myosin-V duty ratio.
Mammalian Tropomyosin Tpm3.1cy can Function in Place of Fission Yeast Cdc8p In
Vivo
Fission yeast actomyosin contractile ring assembly, cytokinesis, and cell growth relies on both Myo2p motor activity and Cdc8p (Balasubramanian et al., 1992; Coffman et al., 2009; Kitayama et al., 1997; Lord et al., 2005; May et al., 1997; Stark et al., 86
2010). Likewise, recent studies highlighted an essential role for Tpm3.1cy in cancer cell proliferation (Stehn et al., 2013). Given that Tpm3.1cy and Tpm4.2cy can function like
Cdc8p in their ability to positively regulate Myo2p activity in vitro (Table 3-1), we wished to test whether either of these tropomyosins could function in place of Cdc8p in vivo. The ability of mammalian tropomyosin to support Cdc8p function is not unprecedented given that rat HMW tropomyosin Tm2 (Tpm1.6cy) can functionally substitute for Cdc8p in fission yeast (Balasubramanian et al., 1992).
We tested whether Tpm3.1cy or Tpm4.2cy could rescue the lethal cytokinesis defects associated with loss of Cdc8p function in the temperature-sensitive cdc8-110 mutant. While cdc8-110 cells carrying plasmids expressing (untagged) Cdc8p,
Tpm3.1cy, or Tpm4.2cy all grew at the permissive growth temperature (25°C), only mutant cells expressing Cdc8p or Tpm3.1cy could sustain growth at the restrictive temperature (36°C) (Fig. 3-7A). Although GFP-Cdc8p and GFP-Tpm3.1cy were routinely found to concentrate at rings during cytokinesis, screening of many cells failed to detect any fluorescently-labeled rings upon GFP-Tpm4.2cy expression. Thus,
Tpm4.2cy may simply fail to rescue cytokinesis in the cdc8-110 background owing to its failure to effectively target actin in the contractile ring (Fig. 3-7B).
While contractile rings failed to assemble at 36°C in cdc8-110 cells harboring an empty vector control or Tpm4.2cy, cells expressing Cdc8p or Tpm3.1cy supported ring assembly and cytokinesis (Fig. 3-7C). Cdc8p and Tpm3.1cy restored normal actomyosin ring dynamics in cdc8-110 cells grown at the restrictive temperature (Fig.
3-7D). The ring dynamics observed for cells expressing Cdc8p or Tpm3.1cy were similar to those of wild-type cells we have previously examined under these higher
87 temperature conditions (L. W. Pollard et al., 2012). Thus, at least in the case of
Tpm3.1cy, mammalian tropomyosin function is suitably conserved to sustain actomyosin ring function in fission yeast cells lacking their functional endogenous tropomyosin.
Discussion
Fission yeast tropomyosin Cdc8p localizes to contractile rings and actin cables where it positively regulates myosin-II and myosin-V respectively (Clayton et al., 2014; Clayton et al., 2010; Coulton et al., 2010; Stark et al., 2010). Such regulation has the potential to contribute to the spatial control of actomyosin function in more complex cellular environments where multiple isoforms of tropomyosin and myosin abound. In this study we demonstrate that Cdc8p and two mammalian nonmuscle LMW tropomyosins
(Tpm3.1cy and Tpm4.2cy) differentially regulate myosin-IIs and myosin-Vs in a myosin isoform-specific manner (Fig. 3-8). We propose that myosin isoform-specific regulation reflects a general feature of certain nonmuscle tropomyosins.
Interestingly, Tpm3.1cy successfully substituted for Cdc8p in vivo, supporting cytokinesis and cell growth. This finding suggests that Tpm3.1cy also shares functional similarity with the HMW isoform Tm2 (Tpm1.6cy)—the mammalian tropomyosin shown to substitute for Cdc8p in the original study on fission yeast tropomyosin
(Balasubramanian et al., 1992). Tpm3.1cy is essential for cancer cell proliferation and motility, and is beginning to show promise as a target for anti-cancer compounds (Stehn et al., 2013). The ability of Tpm3.1cy to positively regulate nonmuscle myosin function may contribute to its role in cancer cell viability. In contrast to Tpm3.1cy, Tpm4.2cy
88 could not function in place of Cdc8p in vivo. Given that Tpm3.1cy and Tpm4.2cy exhibit similar behaviors to Cdc8p in their abilities to regulate myosins, the short- coming of Tpm4.2cy in vivo may simply reflect differences relating to other key actin- binding proteins besides myosin. For example, unlike Cdc8p, Tpm4.2cy may not correctly protect actin filaments from severing by fission yeast ADF/cofilin Adf1p
(Skau & Kovar, 2010), and/or fail to recognize and associate with formin- (Cdc12p-) nucleated actin filaments (Johnson et al., 2014).
Positive Regulation of Nonmuscle Myosin Motors by Tropomyosins
We previously demonstrated that Cdc8p promotes fission yeast Myo2p and
Myo52p function by favoring movement into the strong actin-bound ADP/apo states
(Clayton et al., 2010; Stark et al., 2010). This regulation increases the duty ratio of both myosins (Clayton et al., 2010; Stark et al., 2010), converting the nonprocessive Myo52p into a processive motor that can walk along the actin track as a single molecule
(Clayton et al., 2014). Both of the mammalian tropomyosins tested were also capable of positively regulating Myo2p and Myo52p motor function. Both of these cytoplasmic tropomyosins converted Myo52p into a processive motor underscoring a conserved mechanism of regulation centered on positive modulation of the motor duty ratio.
Collectively, our findings suggest that positive nonmuscle actomyosin regulation represents a conserved function of specific isoforms of tropomyosin. This is surprising given the large evolutionary distance between yeast and mammals reflected by the limited homology between tropomyosins from these two distinct systems. This regulation most likely reflects some conserved features of the tropomyosin sequence in
89 general, which appear to extend from human to yeast tropomyosins (Cranz-Mileva et al., 2013). Striated muscle α-tropomyosin/Tpm1.1st possesses a conserved periodic series of acidic and basic residues that establish association with actin (Barua et al.,
2013; Hitchcock-DeGregori et al., 2002; Singh et al., 2007), while other conserved acidic residues on the tropomyosin surface influence SKMM-II regulation (Barua et al.,
2012; Oguchi et al., 2011). These conserved acidic and basic residues are often found at the b, c, and f positions of the heptad repeats in the tropomyosin coiled-coil. These three positions are not involved with the folding and stability of the coiled-coil and are consequently available for association with other proteins. Similar conserved acidic and basic residues are also found at b, c, and f positions in Cdc8p and other fungal tropomyosins (Cranz-Mileva et al., 2013). Interestingly, amino acid substitutions at some of these sites in Cdc8p were recently found to compromise actin association and in vivo function (Cranz-Mileva et al., 2013).
We speculate that the mammalian cytoplasmic tropomyosins we have studied can work like Cdc8p and facilitate positive regulation of myosins in mammals and other higher eukaryotes. Targets of such regulation likely include nonmuscle myosin-IIs, myosin-Vs, and potentially other classes of myosins that have yet to be tested. It will be interesting to further test the generality of this idea in the future. The influence here of other mammalian tropomyosins, such as other nonmuscle LMW isoforms, nonmuscle
HMW isoforms, or striated muscle Tm1.1st may differ from Tpm3.1cy and Tpm4.2cy.
Importance of the Myosin Isoform in Tropomyosin-Mediated Regulation
The ability of Cdc8p and mammalian tropomyosins to promote nonmuscle myosin function breaks with the established role of tropomyosin in gating muscle 90 myosin-II activity (Lehrer, 1994). In striated muscle, the troponin-tropomyosin complex initially assumes the “blocked” orientation on the actin filament which prevents interactions between myosin heads and actin. Ca2+-binding by troponin shifts tropomyosin into the “closed” position which allows limited binding between myosin heads and actin. However, once a myosin head binds actin it promotes further displacement of the tropomyosin molecule creating the “open” state facilitating cooperative binding of myosin heads nearby. Nevertheless, tropomyosins were obviously present in other cells and tissues long before muscle evolved. Thus, the role of tropomyosin in muscle is highly specialized and represents the exception rather than the rule.
In the absence of troponin and Ca2+, tropomyosin-actin assumes the “closed” conformation (Lehman et al., 1994; Lehman et al., 2000). Electron microscopy of actin filaments decorated with Cdc8p revealed that fission yeast tropomyosin also assumes the “closed” conformation (Skoumpla et al., 2007). We found that the presence of
Cdc8p or mammalian tropomyosins inhibited SKMM-II ATPase and actin filament gliding activities, despite the ability of these same tropomyosins to activate Myo2p and
Myo52p under the same conditions. SKMM-II did show some residual activity in the presence of the tropomyosins in filament gliding assays, where the higher SKMM-II to actin ratios employed in such assays presumably facilitated some cooperative binding in this assay. Nevertheless, significant tropomyosin-mediated inhibition of SKMM-II was always observed even when these saturating concentrations of this myosin were employed in motility assays (Figs. 3-5A and 3-5B).
91
In some ways our results are consistent with previous studies assessing the influence of tropomyosins on SKMM-II activity (Fanning et al., 1994). As we found with Tpm3.1cy and Tpm4.2cy, Fanning et al. saw that the presence of striated muscle
Tm1.1st and nonmuscle HMW isoform Tpm4.1cy inhibited SKMM-II activity. In contrast to our findings, Fanning et al. observed increased SKMM-II activity in the presence of Tpm4.2cy. While the root of this discrepancy is not yet clear, it should be noted that our current study employed full-length SKMM-II that was included in experiments under low, physiological salt concentrations—conditions that yield
SKMM-II filament formation. On the other hand, Fanning et al. employed the truncated
S1 (subfragment 1) form of SKMM-II, which is unable to self-assemble at any salt concentration (as it only includes the motor domain and light chain-binding region of the myosin-II molecule). Nevertheless, consistent with the conflicting results of Fanning et al., Barua et al. (2014) observed increased rates of SKMM-II-driven actin filament gliding in the presence of both Tpm3.1cy and Tpm4.2cy (as pointed out earlier in our
Results). However, unlike in our experiments, Barua et al. applied SKMM-II to motility chambers at a high salt concentration to facilitate antibody-based attachment of individual myosin molecules. We propose that the tropomyosins under study favor inhibition of SKMM-II ensembles, an effect that appears to be reversed when SKMM-II is prepared in its soluble, monomeric form.
While Cdc8p, Tpm3.1cy, and Tpm4.2cy promote Myo52p function, none of the tropomyosins tested had a significant impact on the highly processive myosin-Va.
Given that most class-V myosins studied to date are intrinsically processive, the ability of tropomyosins to positively regulate myosin-V may be restricted to non-processive
92 motors such as Myo52p (Clayton et al., 2014), budding yeast myosin-V (Hodges et al.,
2012), and other non-processive myosin-Vs found in higher eukaryotes (Takagi et al.,
2008; Toth et al., 2005; Watanabe et al., 2008).
In summary, tropomyosin-mediated regulation of SKMM-II and the nonmuscle myosins underscores how actin-tropomyosin can specify different motor outputs (Fig.
3-8). The “closed” actin-tropomyosin conformation appears to be capable of myosin activation (Myo2p and Myo52p) or inhibition (SKMM-II and type-I myosins), while at the same time acting passively on other myosins (myosin-Va). This differential regulation has broad implications for understanding how myosin activity can be sorted at specific tropomyosin-actin structures in time and space in complex systems, such as developing muscle tissue or metastatic cancer cells.
Materials and Methods
Bacterial Plasmids
Tropomyosin constructs were used to overexpress acetylated-mimicking forms of the protein in E. coli. The cdc8 gene was PCR-amplified from Schizosaccharomyces pombe cDNA using the following primers: 5' NdeI-cdc8
CAATCATATGGCTAGCATGGATA-AGCTTAGAGAG (the NdeI site is italicized, and the start codon of the cdc8 ORF is underlined) and 3' BamHI-cdc8
CAATGGATCCCTACAAGTCC-TCAAGAGCTT (the BamHI site is italicized, and the cdc8 stop codon is underlined). The 5' primer includes encodes an Ala-Ser
(acetylation-mimicking) dipeptide immediately upstream of the cdc8 start codon. The start codon for the recombinant protein actually lies in the second half of the NdeI site
93 allowing for incorporation of the Ala-Ser codons. Mammalian tropomyosin constructs were made in an identical fashion using human Tpm3.1cy and Tpm4.2cy cDNAs as templates. Cdc8p and Tpm3.1cy plasmids lacking the Ala-Ser dipeptide were also constructed. Each oligonucleotide was individually cloned into the pET3 vector and fidelities confirmed by DNA sequencing.
Fission Yeast Plasmids and Strains
Untagged and N-terminally GFP-tagged versions of Cdc8p and the mammalian tropomyosins were expressed in fission yeast strains using the pREP-41x and pDS573a-
41x vectors respectively. These ura4+ plasmids utilize the inducible nmt1-41x (medium strength) promoter which drives expression in the absence of thiamine. The cdc8 gene was PCR-amplified from S. pombe cDNA using the following primers: 5' NotI-cdc8
GCGG-CCGCATGGATAAGCTTAGAGAGGTATGAG (the NotI site is italicized, and the start codon of the cdc8 ORF is underlined) and 3' SalI-cdc8 GT-
CGACCTACAAATCCTCAAGAGCTTGGTGA-AC (the SalI site is italicized, and the cdc8 stop codon is underlined). The cdc8 gene was inserted into NotI/SalI linearized pREP-41x and pDS573a-41x. Mammalian tropomyosin constructs were made in an identical fashion using human Tpm3.1cy and Tpm4.2cy cDNAs as templates. The fidelities of inserts was confirmed by DNA sequencing.
Untagged tropomyosins were expressed in a temperature-sensitive cdc8-110 mutant (h- leu1-32 ura4-D18 his3-D1 ade6-M216 cdc8-110 rlc1-mYFP:kanR) mutant, while GFP-tagged tropomyosins were expressed in wild-type (h− leu1-32 ura4-D18 his3-D1 ade6-M216 uch2-mCherry:natR) cells. The rlc1-mYFP and uch2-mCherry
94 genomic integrations were constructed by standard techniques using the appropriate kanamycin-resistant kanR and nourthreothricin-resistant natR casettes (Bahler et al.,
1998; Snaith et al., 2010).
Protein Purification
Full-length fission yeast Myo2p was overexpressed and purified as previously described (Lord et al., 2004). Chicken skeletal muscle myosin-II was purified using standard techniques (Kielley et al., 1960). Recombinant HMM forms of fission yeast
Myo52p and mammalian (chick brain) myosin-Va were overexpressed in the
Baculovirus/Sf9 insect cell system and purified as previously described (Clayton et al.,
2014; Krementsov et al., 2004). Biotin was included in the cell culture media to ensure full biotinylation of biotin-binding tags engineered at the C-terminus of the HMMs.
Additional myosin-V light chains were purified following overexpression in bacteria
(see below) (Clayton et al., 2014; Krementsov et al., 2004). Chicken skeletal muscle actin was employed throughout and purified from acetone powder as previously described (Spudich & Watt, 1971).
Tropomyosin and myosin-V light chain (Cam1p, Cdc4p, and CaMΔall) proteins were produced in E. coli BL21 DE3 competent cells. Cultures were grown in LB media at 37°C and protein overexpression induced at an OD600 of 0.5 by addition of 0.4 mM
IPTG. Cells were harvested following overnight induction at 25°C. Proteins were purified as described previously (Krementsov et al., 2004; Pruyne et al., 1998). Cell pellets were resuspended in lysis buffer (100 mM NaCl, 10 mM imidazole, pH 7.2, 2 mM EDTA, and 1 mM DTT) and sonicated. Lysates were boiled for 10 min while
95 stirring, then pelleted to remove denatured protein and other debris. Soluble tropomyosins (or light chains) were precipitated from the supernatant by lowering the pH to 0.2 units below the isoelectric point of the relevant protein. The protein precipitate was resuspended in 50 mM NaCl, 1 mM DTT, 10 mM imidazole, pH 7.4, and dialyzed for three rounds (3 inline image 1 L) against the same buffer, followed by addition of 5 µg/ml leupeptin.
Actin-Activated ATPase Assays
Standard actin-activated ATPase assays were carried out at room temperature using the Malachite green assay to quantitate Pi release (Henkel et al., 1988). This approach was employed to assay Myo2p, SKMM-II, and Myo52p-HMM. Reactions were carried out in 2 mM Tris-HCl, 10 mM imidazole, pH 7.2, 60 mM KCl, 0.1 mM
CaCl2, 3 mM MgCl2, 2 mM ATP, and 1 mM DTT. Colorimetric measurements were taken at 595 nm in a plate reader. In addition, actin-activated ATPase assays were carried out at room temperature using an ATP-regenerating system to assay Myo52p-
HMM and myosin-Va-HMM. Reactions in this NADH-linked assay were carried out in
10 mM imidazole, pH 7.4, 50 mM KCl, 4 mM MgCl2, 1 mM EGTA, and 1 mM DTT.
Reactions were initiated by the addition of 2 mM Mg2+-ATP. The buffers also contained an ATP regenerating system (0.5 mM phosphoenolpyruvate, 100 units/ml pyruvate kinase), 0.2 mM NADH, and 20 units/ml lactate dehydrogenase. The rate of the reaction was measured from the decrease in absorbance at 340 nm.
The assays included 30 nM Myo2p, 90 nM SKMM-II, 10 nM Myo52p-HMM
(with excess 350 nM Cam1p and Cdc4p light chains), or 14 nM myosin-Va-HMM (with
96 excess 350 nM calmodulin), plus 0–30 µM actin/actin-tropomyosin filaments. Actin was pre-incubated with the different tropomyosins at a 2:1 molar ratio 60 min prior to dilution. Curves were fit to Michaelis-Menten kinetics using Kaleidagraph software.
In Vitro Actin Filament Gliding Assays
We used motility assays based on an established protocol (Kron et al., 1986).
Myosins under study were delivered into motility chambers at the following concentrations: Myo2p, 5 nM; SKMM-II, 5 nM; Myo52p-HMM, 27 nM; and myosin-
Va, 21 nM. Higher concentrations of SKMM-II were also tested (10 and 50 nM); 5 µM stocks of fluorescent actin were polymerized by addition of 50 mM KCl and 1 mM
MgCl2 incubated for 30 min, and then labeled with 5 µM of rhodamine phalloidin for
30 min. After myosins were adhered to the surface of a nitrocellulose-coated cover-slip for 10 min, the chamber was washed: (a) 3× with Motility Buffer (25 mM imidazole, pH 7.4, 50 mM KCl, 1mM EGTA, 4 mM MgCl2, 2 mM DTT) plus 0.5 mg/ml BSA.
Excess light chains were also included in this buffer for experiments with Myo52p-
HMM (14 µM of Cam1p and Cdc4p) and myosin-Va-HMM (14 µM of calmodulin), (b)
3× with Motility Buffer alone, (c) 2× with Motility Buffer containing 1 µM of vortexed
(30 s) unlabeled actin filaments, (d) 3× with Motility Buffer plus 1 mM ATP, (e) 2× with Motility Buffer plus 25 nM rhodamine phalloidin-labeled actin filaments and oxygen scavengers (50 µg/ml catalase, 130 µg/ml glucose oxidase, and 3 mg/ml glucose), (f) twice with Motility Buffer plus 20 mM DTT, 0.5% methyl-cellulose, and scavengers, and (g) twice with Motility Buffer plus 20 mM DTT, 0.5% methyl- cellulose, 1.5 mM ATP, and scavengers. To limit actin-tropomyosin dissociation,
97 washes (e–g) included 10 µM tropomyosin for assays with decorated filaments.
Filaments were observed at room temperature by epi-fluorescence microscopy and recorded at intervals of 1 s for 1 min. Image J software was used to calculate filament velocities from time-lapse series (n = 35–150 filaments).
Tracking Myo52p-Qdot Motility by TIRF Microscopy
Myo52p-HMM (0.2 µM) was mixed with a twofold molar excess of actin and 2 mM Mg2+-ATP, and centrifuged for 20 min at 400,000 × g to remove any myosin that was unable to dissociate from actin in the presence of ATP. To investigate processivity of individual myosin V motors, Myo52p was then mixed with a 10-fold molar excess of
655 nm streptavidin-coated Qdots (Invitrogen). In principle, a small fraction of Qdots will have two or more motors bound, but previous controls demonstrated that Qdots are driven primarily by a single motor at this mixing ratio (Hodges et al., 2012). Flow cells made from glass coverslips were prepared by introducing the following solutions into the flow cell: 0.1 mg/ml N-ethylmaleimide-modified skeletal muscle myosin (5 min incubation), 5× rinse of 1 mg/ml BSA (2 min), 2 µM rhodamine-phalloidin-labeled chicken skeletal muscle actin filaments (plus or minus 1 µM tropomyosin) (2–5 min),
5× rinse with motility buffer, and, finally 0.2 nM Myo52p in motility buffer with 2 mM
MgATP. Motility buffer consists of 50 mM KCl, 25 mM imidazole, pH 7.4, 4 mM
MgCl2, 1 mM EGTA, 50 mM DTT, 1 mg/ml BSA, 3.5 µM Cam1p, 3.5 µM Cdc4p, and an oxygen-scavenging system (3 mg/ml glucose, 0.1 mg/ml glucose oxidase, and 0.18 mg/ml catalase). For experiments with tropomyosin, 1 µM tropomyosin was included in the motility buffer to prevent dissociation from actin.
98
Through-the-objective TIRF microscopy was performed at room temperature using the Nikon Eclipse Ti-U microscope equipped with a 100× Plan Apo objective lens
(1.49 NA) and auxiliary 1.5× magnification. Fluorophores were excited with a 473 nm
(Qdots) laser line and images were obtained using the XR/Turbo-Z camera (Stanford
Photonics) running Piper Control software (v2.3.39). The pixel resolution was 95.0 nm, and data were collected at 5 to 30 frames per second. Qdot movement along rhodamine- labeled actin filaments was tracked by hand using ImageJ. For each event, we required
Qdot-labeled Myo52p to move continuously for at least three frames to qualify as a run.
Runs that artificially terminated by running off the end of an actin filament were not included in the run length analysis.
Live Cell Imaging
DIC and epi-fluorescence cell images were captured using a Nikon TE2000-E2 inverted microscope with motorized fluorescence filter turret and a Plan Apo 60× (1.45
NA) objective. Fluorescence utilized an EXFO X-CITE 120 illuminator. NIS Elements software was used to control the microscope, two Uniblitz shutters, a Photometrics
CoolSNAP HQ2 14-bit camera, and auto-focusing. Still images (GFP-tropomyosins,
Rlc1-YFP) or time-lapse images (Rlc1p-YFP) of contractile rings were generated using the appropriate filters. For ring movies, images were captured every 2 min and autofocusing was performed on the DIC channel before each capture. Cell suspensions
(3 µl) were mounted on flat 30 µl EMM media pads (solidified by 1% agarose) prepared on the slide surface. VALAP (1:1:1 vasoline, lanolin, and paraffin) was used to seal slides and cover-slips. Images were captured using Nikon ND software and analysis of
99 ring dynamics was performed using Image J and Microsoft Excel software. Ring dynamics were quantified by assessing individual phases: assembly, time taken for
Rlc1p-YFP to compact into a mature ring following its appearance as a broad band of nodes; dwell, time from completion of ring compaction until initiation of constriction; constriction, change in ring circumference over time. Dwell times and constriction initiation were discerned by plotting ring diameter over time for each ring, and circumferential ring constriction rates were derived from the slopes of these plots.
Acknowledgments
The authors thank Justine Stehn and Peter Gunning (University of New South
Wales, Sydney, Australia) for providing the mammalian tropomyosin cDNAs. The authors thank Elena Krementsova and Kathy Trybus (University of Vermont,
Burlington, VT) for providing myosin-Va. We are grateful to Kelly Begin (University of Vermont, Burlington, VT) for providing chicken skeletal muscle myosin-II. The authors thank Dan McCollum (University of Massachusetts Medical School, Worcester,
MA) for the cdc8-110 strain. The authors are also very grateful to Guy Kennedy and
David Warshaw (University of Vermont, Burlington, VT) for providing access to TIRF microscopy facilities. This work was supported by a National Institutes of Health grant
(GM097193) to ML.
100
References
Bahler, J., Wu, J. Q., Longtine, M. S., Shah, N. G., McKenzie, A., 3rd, Steever, A. B., . . . Pringle, J. R. (1998). Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast, 14(10), 943-951. doi:10.1002/(sici)1097-0061(199807)14:10<943::aid-yea292>3.0.co;2-y
Balasubramanian, M. K., Helfman, D. M., & Hemmingsen, S. M. (1992). A new tropomyosin essential for cytokinesis in the fission yeast S. pombe. Nature, 360(6399), 84-87. doi:10.1038/360084a0
Barua, B., Fagnant, P. M., Winkelmann, D. A., Trybus, K. M., & Hitchcock-DeGregori, S. E. (2013). A periodic pattern of evolutionarily conserved basic and acidic residues constitutes the binding interface of actin-tropomyosin. J Biol Chem, 288(14), 9602-9609. doi:10.1074/jbc.M113.451161
Barua, B., Nagy, A., Sellers, J. R., & Hitchcock-DeGregori, S. E. (2014). Regulation of nonmuscle myosin II by tropomyosin. Biochemistry, 53(24), 4015-4024. doi:10.1021/bi500162z
Barua, B., Winkelmann, D. A., White, H. D., & Hitchcock-DeGregori, S. E. (2012). Regulation of actin-myosin interaction by conserved periodic sites of tropomyosin. Proc Natl Acad Sci U S A, 109(45), 18425-18430. doi:10.1073/pnas.1212754109
Bernstein, B. W., & Bamburg, J. R. (1992). Actin in emerging neurites is recruited from a monomer pool. Mol Neurobiol, 6(2-3), 95-106. doi:10.1007/BF02780546
Blanchoin, L., Pollard, T. D., & Hitchcock-DeGregori, S. E. (2001). Inhibition of the Arp2/3 complex-nucleated actin polymerization and branch formation by tropomyosin. Curr Biol, 11(16), 1300-1304.
Bryce, N. S., Schevzov, G., Ferguson, V., Percival, J. M., Lin, J. J., Matsumura, F., . . . Weinberger, R. P. (2003). Specification of actin filament function and molecular composition by tropomyosin isoforms. Mol Biol Cell, 14(3), 1002-1016. doi:10.1091/mbc.E02-04-0244
Clayton, J. E., Pollard, L. W., Sckolnick, M., Bookwalter, C. S., Hodges, A. R., Trybus, K. M., & Lord, M. (2014). Fission yeast tropomyosin specifies directed transport of myosin-V along actin cables. Mol Biol Cell, 25(1), 66-75. doi:10.1091/mbc.E13-04- 0200
Clayton, J. E., Sammons, M. R., Stark, B. C., Hodges, A. R., & Lord, M. (2010). Differential regulation of unconventional fission yeast myosins via the actin track. Curr Biol, 20(16), 1423-1431. doi:10.1016/j.cub.2010.07.026
101
Coffman, V. C., Nile, A. H., Lee, I. J., Liu, H., & Wu, J. Q. (2009). Roles of formin nodes and myosin motor activity in Mid1p-dependent contractile-ring assembly during fission yeast cytokinesis. Mol Biol Cell, 20(24), 5195-5210. doi:10.1091/mbc.E09- 05-0428
Coulton, A. T., East, D. A., Galinska-Rakoczy, A., Lehman, W., & Mulvihill, D. P. (2010). The recruitment of acetylated and unacetylated tropomyosin to distinct actin polymers permits the discrete regulation of specific myosins in fission yeast. J Cell Sci, 123(Pt 19), 3235-3243. doi:10.1242/jcs.069971
Cranz-Mileva, S., Pamula, M. C., Barua, B., Desai, B., Hong, Y. H., Russell, J., . . . Hitchcock-DeGregori, S. E. (2013). A molecular evolution approach to study the roles of tropomyosin in fission yeast. PLoS One, 8(10), e76726. doi:10.1371/journal.pone.0076726
Creed, S. J., Bryce, N., Naumanen, P., Weinberger, R., Lappalainen, P., Stehn, J., & Gunning, P. (2008). Tropomyosin isoforms define distinct microfilament populations with different drug susceptibility. Eur J Cell Biol, 87(8-9), 709-720. doi:10.1016/j.ejcb.2008.03.004
De La Cruz, E. M., Wells, A. L., Rosenfeld, S. S., Ostap, E. M., & Sweeney, H. L. (1999). The kinetic mechanism of myosin V. Proc Natl Acad Sci U S A, 96(24), 13726-13731.
East, D. A., & Mulvihill, D. P. (2011). Regulation and function of the fission yeast myosins. J Cell Sci, 124(Pt 9), 1383-1390. doi:10.1242/jcs.078527
Fan, X., Martin-Brown, S., Florens, L., & Li, R. (2008). Intrinsic capability of budding yeast cofilin to promote turnover of tropomyosin-bound actin filaments. PLoS One, 3(11), e3641. doi:10.1371/journal.pone.0003641
Fanning, A. S., Wolenski, J. S., Mooseker, M. S., & Izant, J. G. (1994). Differential regulation of skeletal muscle myosin-II and brush border myosin-I enzymology and mechanochemistry by bacterially produced tropomyosin isoforms. Cell Motil Cytoskeleton, 29(1), 29-45. doi:10.1002/cm.970290104
Fattoum, A., Hartwig, J. H., & Stossel, T. P. (1983). Isolation and some structural and functional properties of macrophage tropomyosin. Biochemistry, 22(5), 1187-1193.
Fowler, V. M., Sussmann, M. A., Miller, P. G., Flucher, B. E., & Daniels, M. P. (1993). Tropomodulin is associated with the free (pointed) ends of the thin filaments in rat skeletal muscle. J Cell Biol, 120(2), 411-420.
Geeves, M. A., Hitchcock-DeGregori, S. E., & Gunning, P. W. (2015). A systematic nomenclature for mammalian tropomyosin isoforms. J Muscle Res Cell Motil, 36(2), 147-153. doi:10.1007/s10974-014-9389-6
102
Gunning, P. W., Schevzov, G., Kee, A. J., & Hardeman, E. C. (2005). Tropomyosin isoforms: divining rods for actin cytoskeleton function. Trends Cell Biol, 15(6), 333- 341. doi:10.1016/j.tcb.2005.04.007
Heald, R. W., & Hitchcock-DeGregori, S. E. (1988). The structure of the amino terminus of tropomyosin is critical for binding to actin in the absence and presence of troponin. J Biol Chem, 263(11), 5254-5259.
Henkel, R. D., VandeBerg, J. L., & Walsh, R. A. (1988). A microassay for ATPase. Anal Biochem, 169(2), 312-318.
Hitchcock-DeGregori, S. E. (2008). Tropomyosin: function follows structure. Adv Exp Med Biol, 644, 60-72.
Hitchcock-DeGregori, S. E., & Heald, R. W. (1987). Altered actin and troponin binding of amino-terminal variants of chicken striated muscle alpha-tropomyosin expressed in Escherichia coli. J Biol Chem, 262(20), 9730-9735.
Hitchcock-DeGregori, S. E., Song, Y., & Greenfield, N. J. (2002). Functions of tropomyosin's periodic repeats. Biochemistry, 41(50), 15036-15044.
Hodges, A. R., Bookwalter, C. S., Krementsova, E. B., & Trybus, K. M. (2009). A nonprocessive class V myosin drives cargo processively when a kinesin- related protein is a passenger. Curr Biol, 19(24), 2121-2125. doi:10.1016/j.cub.2009.10.069
Hodges, A. R., Krementsova, E. B., Bookwalter, C. S., Fagnant, P. M., Sladewski, T. E., & Trybus, K. M. (2012). Tropomyosin is essential for processive movement of a class V myosin from budding yeast. Curr Biol, 22(15), 1410-1416. doi:10.1016/j.cub.2012.05.035
Ishikawa, R., Yamashiro, S., & Matsumura, F. (1989). Differential modulation of actin-severing activity of gelsolin by multiple isoforms of cultured rat cell tropomyosin. Potentiation of protective ability of tropomyosins by 83-kDa nonmuscle caldesmon. J Biol Chem, 264(13), 7490-7497.
Johnson, M., East, D. A., & Mulvihill, D. P. (2014). Formins determine the functional properties of actin filaments in yeast. Curr Biol, 24(13), 1525-1530. doi:10.1016/j.cub.2014.05.034
Kielley, W. W., & Harrington, W. F. (1960). A model for the myosin molecule. Biochim Biophys Acta, 41, 401-421.
Kitayama, C., Sugimoto, A., & Yamamoto, M. (1997). Type II myosin heavy chain encoded by the myo2 gene composes the contractile ring during cytokinesis in Schizosaccharomyces pombe. J Cell Biol, 137(6), 1309-1319. 103
Kovar, D. R., Sirotkin, V., & Lord, M. (2011). Three's company: the fission yeast actin cytoskeleton. Trends Cell Biol, 21(3), 177-187. doi:10.1016/j.tcb.2010.11.001
Krementsov, D. N., Krementsova, E. B., & Trybus, K. M. (2004). Myosin V: regulation by calcium, calmodulin, and the tail domain. J Cell Biol, 164(6), 877-886. doi:10.1083/jcb.200310065
Kron, S. J., & Spudich, J. A. (1986). Fluorescent actin filaments move on myosin fixed to a glass surface. Proc Natl Acad Sci U S A, 83(17), 6272-6276.
Lehman, W., Craig, R., & Vibert, P. (1994). Ca(2+)-induced tropomyosin movement in Limulus thin filaments revealed by three-dimensional reconstruction. Nature, 368(6466), 65-67. doi:10.1038/368065a0
Lehman, W., Hatch, V., Korman, V., Rosol, M., Thomas, L., Maytum, R., . . . Craig, R. (2000). Tropomyosin and actin isoforms modulate the localization of tropomyosin strands on actin filaments. J Mol Biol, 302(3), 593-606. doi:10.1006/jmbi.2000.4080
Lehrer, S. S. (1994). The regulatory switch of the muscle thin filament: Ca2+ or myosin heads? J Muscle Res Cell Motil, 15(3), 232-236.
Lo Presti, L., Chang, F., & Martin, S. G. (2012). Myosin Vs organize actin cables in fission yeast. Mol Biol Cell, 23(23), 4579-4591. doi:10.1091/mbc.E12-07-0499
Lord, M., Laves, E., & Pollard, T. D. (2005). Cytokinesis depends on the motor domains of myosin-II in fission yeast but not in budding yeast. Mol Biol Cell, 16(11), 5346-5355. doi:10.1091/mbc.E05-07-0601
Lord, M., & Pollard, T. D. (2004). UCS protein Rng3p activates actin filament gliding by fission yeast myosin-II. J Cell Biol, 167(2), 315-325. doi:10.1083/jcb.200404045
May, K. M., Watts, F. Z., Jones, N., & Hyams, J. S. (1997). Type II myosin involved in cytokinesis in the fission yeast, Schizosaccharomyces pombe. Cell Motil Cytoskeleton, 38(4), 385-396. doi:10.1002/(sici)1097-0169(1997)38:4<385::aid- cm8>3.0.co;2-2
Mehta, A. D., Rock, R. S., Rief, M., Spudich, J. A., Mooseker, M. S., & Cheney, R. E. (1999). Myosin-V is a processive actin-based motor. Nature, 400(6744), 590-593. doi:10.1038/23072
Motegi, F., Arai, R., & Mabuchi, I. (2001). Identification of two type V myosins in fission yeast, one of which functions in polarized cell growth and moves rapidly in the cell. Mol Biol Cell, 12(5), 1367-1380.
104
Nakano, K., & Mabuchi, I. (2006). Actin-depolymerizing protein Adf1 is required for formation and maintenance of the contractile ring during cytokinesis in fission yeast. Mol Biol Cell, 17(4), 1933-1945. doi:10.1091/mbc.E05-09-0900
Oguchi, Y., Ishizuka, J., Hitchcock-DeGregori, S. E., Ishiwata, S., & Kawai, M. (2011). The role of tropomyosin domains in cooperative activation of the actin-myosin interaction. J Mol Biol, 414(5), 667-680. doi:10.1016/j.jmb.2011.10.026
Ono, S., & Ono, K. (2002). Tropomyosin inhibits ADF/cofilin-dependent actin filament dynamics. J Cell Biol, 156(6), 1065-1076. doi:10.1083/jcb.200110013
Pollard, L. W., Onishi, M., Pringle, J. R., & Lord, M. (2012). Fission yeast Cyk3p is a transglutaminase-like protein that participates in cytokinesis and cell morphogenesis. Mol Biol Cell, 23(13), 2433-2444. doi:10.1091/mbc.E11-07-0656
Pruyne, D. W., Schott, D. H., & Bretscher, A. (1998). Tropomyosin-containing actin cables direct the Myo2p-dependent polarized delivery of secretory vesicles in budding yeast. J Cell Biol, 143(7), 1931-1945.
Siemankowski, R. F., Wiseman, M. O., & White, H. D. (1985). ADP dissociation from actomyosin subfragment 1 is sufficiently slow to limit the unloaded shortening velocity in vertebrate muscle. Proc Natl Acad Sci U S A, 82(3), 658-662.
Singh, A., & Hitchcock-DeGregori, S. E. (2007). Tropomyosin's periods are quasi- equivalent for actin binding but have specific regulatory functions. Biochemistry, 46(51), 14917-14927. doi:10.1021/bi701570b
Skau, C. T., & Kovar, D. R. (2010). Fimbrin and tropomyosin competition regulates endocytosis and cytokinesis kinetics in fission yeast. Curr Biol, 20(16), 1415-1422. doi:10.1016/j.cub.2010.06.020
Skau, C. T., Neidt, E. M., & Kovar, D. R. (2009). Role of tropomyosin in formin- mediated contractile ring assembly in fission yeast. Mol Biol Cell, 20(8), 2160-2173. doi:10.1091/mbc.E08-12-1201
Skoumpla, K., Coulton, A. T., Lehman, W., Geeves, M. A., & Mulvihill, D. P. (2007). Acetylation regulates tropomyosin function in the fission yeast Schizosaccharomyces pombe. J Cell Sci, 120(Pt 9), 1635-1645. doi:10.1242/jcs.001115
Snaith, H. A., Anders, A., Samejima, I., & Sawin, K. E. (2010). New and old reagents for fluorescent protein tagging of microtubules in fission yeast; experimental and critical evaluation. Methods Cell Biol, 97, 147-172. doi:10.1016/s0091- 679x(10)97009-x
105
Spudich, J. A., & Watt, S. (1971). The regulation of rabbit skeletal muscle contraction. I. Biochemical studies of the interaction of the tropomyosin-troponin complex with actin and the proteolytic fragments of myosin. J Biol Chem, 246(15), 4866-4871.
Stark, B. C., Sladewski, T. E., Pollard, L. W., & Lord, M. (2010). Tropomyosin and myosin-II cellular levels promote actomyosin ring assembly in fission yeast. Mol Biol Cell, 21(6), 989-1000. doi:10.1091/mbc.E09-10-0852
Stehn, J. R., Haass, N. K., Bonello, T., Desouza, M., Kottyan, G., Treutlein, H., . . . Gunning, P. W. (2013). A novel class of anticancer compounds targets the actin cytoskeleton in tumor cells. Cancer Res, 73(16), 5169-5182. doi:10.1158/0008- 5472.CAN-12-4501
Stehn, J. R., Schevzov, G., O'Neill, G. M., & Gunning, P. W. (2006). Specialisation of the tropomyosin composition of actin filaments provides new potential targets for chemotherapy. Curr Cancer Drug Targets, 6(3), 245-256.
Takagi, Y., Yang, Y., Fujiwara, I., Jacobs, D., Cheney, R. E., Sellers, J. R., & Kovacs, M. (2008). Human myosin Vc is a low duty ratio, nonprocessive molecular motor. J Biol Chem, 283(13), 8527-8537. doi:10.1074/jbc.M709150200
Tang, N., & Ostap, E. M. (2001). Motor domain-dependent localization of myo1b (myr-1). Curr Biol, 11(14), 1131-1135.
Tobacman, L. S. (2008). Cooperative binding of tropomyosin to actin. Adv Exp Med Biol, 644, 85-94.
Tojkander, S., Gateva, G., Schevzov, G., Hotulainen, P., Naumanen, P., Martin, C., . . . Lappalainen, P. (2011). A molecular pathway for myosin II recruitment to stress fibers. Curr Biol, 21(7), 539-550. doi:10.1016/j.cub.2011.03.007
Toth, J., Kovacs, M., Wang, F., Nyitray, L., & Sellers, J. R. (2005). Myosin V from Drosophila reveals diversity of motor mechanisms within the myosin V family. J Biol Chem, 280(34), 30594-30603. doi:10.1074/jbc.M505209200
Urbancikova, M., & Hitchcock-DeGregori, S. E. (1994). Requirement of amino- terminal modification for striated muscle alpha-tropomyosin function. J Biol Chem, 269(39), 24310-24315.
Watanabe, S., Watanabe, T. M., Sato, O., Awata, J., Homma, K., Umeki, N., . . . Ikebe, M. (2008). Human myosin Vc is a low duty ratio nonprocessive motor. J Biol Chem, 283(16), 10581-10592. doi:10.1074/jbc.M707657200
Wawro, B., Greenfield, N. J., Wear, M. A., Cooper, J. A., Higgs, H. N., & Hitchcock- DeGregori, S. E. (2007). Tropomyosin regulates elongation by formin at the fast- 106 growing end of the actin filament. Biochemistry, 46(27), 8146-8155. doi:10.1021/bi700686p
Weber, A., Pennise, C. R., Babcock, G. G., & Fowler, V. M. (1994). Tropomodulin caps the pointed ends of actin filaments. J Cell Biol, 127(6 Pt 1), 1627-1635.
Win, T. Z., Gachet, Y., Mulvihill, D. P., May, K. M., & Hyams, J. S. (2001). Two type V myosins with non-overlapping functions in the fission yeast Schizosaccharomyces pombe: Myo52 is concerned with growth polarity and cytokinesis, Myo51 is a component of the cytokinetic actin ring. J Cell Sci, 114(Pt 1), 69-79.
107
Tables:
Table 3-1. Effect of Cdc8p and the mammalian tropomyosins on the motor activity and motility of Myo2p, SKMM-II, Myo52p, and myosin-Va Table summarizes how tropomyosins Cdc8p, Tpm3.1cy, and Tpm4.2cy influence myosin motor performance.
aMyo2p, SKMM-II, Myo52p, and myosin-Va actin-activated ATPase values were generated from the average curves presented in Figure 2A–D. Assays utilized a malachite green-based Pi detection system, except for myosin-Va where an ATP-
108 regenerating-based ATPase assay was employed (see Supplemental Proceduresfor further details). Datasets: n=4 (Myo2p and Myo52p), n=3 (SKMM-II), and n=1 (myosin-Va). b Catalytic efficiency = VMAX/KM. cn=50–150. Paired Student’s t-tests were used to test the significance of the tropomyosin-mediated changes in actin filament gliding rate versus actin alone (p <0.05 indicates a significant difference between datasets). All tropomyosins significantly reduced the gliding rates of Myo2p (Cdc8p, <0.0001; Tpm3.1cy, <0.0001; Tpm4.2cy, <0.0001), SKMM-II (Cdc8p, <0.0001; and Tpm3.1cy, <0.0001; Tpm4.2cy, <0.0001), and Myo52p (Cdc8p, <0.0001; and Tpm3.1cy, <0.0001; Tpm4.2cy, <0.0001). However, in the case of myosin-Va, two out of the three tropomyosins tested (Tpm3.1cy and Tpm4.2cy) yielded a significant increase in gliding rate, while Cdc8p had no significant effect (Cdc8p, 0.756; Tpm3.1cy, 0.036; Tpm4.2cy, 0.0006). We performed additional statistical analyses to gauge any significant differences between the effects of the three different tropomyosins on motility. For Myo2p, there was significant difference for Cdc8p vs. Tpm3.1cy (0.02) and Cdc8p vs. Tpm4.2cy (0.0015), but no significant difference for Tpm3.1cy vs. Tpm4.2cy (0.15). For SKMM-II, there were significant differences between all of the tropomyosins (<0.0001 for all combinations). For Myo52p, there was significant difference for Cdc8p vs. Tpm3.1cy (0.0002) and Cdc8p vs. Tpm4.2cy (0.0139), but no significant difference for Tpm3.1cy vs. Tpm4.2cy (0.0786). For myosin-Va, there was significant difference for Cdc8p vs. Tpm3.1cy (<0.0001) and Tpm3.1cy vs. Tpm4.2cy (0.0004), but no significant difference for Cdc8p vs. Tpm4.2cy (0.183). dRelative number of motile (myosin-driven) actin filaments/total actin filaments. A total of five different movie fields were scored for each sample at a set concentration of myosin. The relative number of motile filaments scored for actin alone was set to 1.0.
109
Figure 3-1. Tropomyosins under study. A) Schematic illustration summarizing exon usage by mammalian tropomyosin TPM3 and TPM4 gene products Tpm3.1cy and Tpm4.2cy. While the two proteins are the products of two different genes, their exon usage makes these two LMW tropomyosins very similar. The only obvious difference being that Tpm3.1cy employs exon 6a, while Tpm4.2cy employs exon 6b. B) Purified protein samples following SDS-PAGE and gel staining with Coomassie Blue. Molecular weights are included on the left. Cdc8p and the mammalian tropomyosins were purified from bacteria (acetylation-mimicking forms including the Ala-Ser dipeptide are shown).
110
Figure 3-2. Regulation of Myo2p, SKMM-II, Myo52p, and myosin-Va motor activity by tropomyosin. The actin-activated Mg2+-ATPase activity of Myo2p, SKMM-II, Myo52p, and myosin-Va was measured as a function of actin or actin- tropomyosin concentration. Basal myosin ATPase activities and background Pi from actin or actin-tropomyosin were subtracted from all measurements. Each average curve fit presented was generated from average values obtained from 4 (Myo2p and Myo52p), 3 (SKMM-II), and 1 (myosin-Va) dataset(s). A) Myo2p, B) SKMM-II, C) Myo52p, and D) myosin-Va ATPase activities compared with and without Cdc8p, Tpm3.1cy, and Tpm4.2cy. All the values are summarized in Table 1. The myosin concentrations in these assays were: 30 nM (Myo2p), 90 nM (SKMM-II), 10 nM (Myo52p), and 14 nM (myosin-Va). Actin filaments were preincubated with tropomyosin at a molar ratio of 2 actin:1 tropomyosin. The Myo2p, SKMM-II, and Myo52p curves were generated from data measured using a malachite green-based Pi detection assay. The myosin-Va curves were generated from data measured using an NADH-linked-/ATP-regenerating-based ATPase assay. Myo52p curves generated using the ATP-regenerating-based assay are provided in Fig. 3B. 111
Figure 3-3. Assessment of tropomyosin acetylation on SKMM-II inhibition and Cdc8p-mediated activation of Myo52p in actin-activated ATPase assays. A) The influence of acetylated-mimicking versus unacetylated forms of both Cdc8p and Tpm3.1cy on the actin-activated ATPase activity of SKMM-II were compared in parallel (in the same fashion as the SKMM-II experiments described in Fig. 2). The fitted values for each condition are the averages from two independent experiments. B) The Myo52p VMAX values obtained from ATPase assays employing malachite green- based Pi detection (Fig. 2C; Table 1) were lower than what we would predict from the speeds at which single Myo52p molecules move on Cdc8p-decorated actin tracks (Clayton et al., 2014). Assuming Myo52p has a 36 nm step size similar to other myosin- Vs (Trybus, 2008), a single Myo52p molecule must take ∼35 steps per second to achieve the average speed (1.25 µm/s) of Myo52p on Cdc8p-actin tracks (Clayton et al., 2014). This rate of 35 s−1 is approximately fivefold higher than what we obtained (∼7 s−1) from our ATPase data (Table 1). In light of these observations we employed an alternative assay that utilizes an ATP-regenerating system to avoid any inhibitory build- up of ADP. This assay revealed a higher VMAX of 52 s−1 for Myo52p, closer to the 35 s−1 predicted from single molecule studies. Nevertheless, the general trend of tropomyosin-mediated activation of Myo52p remained the same: the presence of Cdc8p on actin increased the VMAX from 45 to 52 s−1 (compared with 4.7 to 6.6 s−1 in our original assays; Table 1) and significantly reduced the KM from 22 to 5 µM (compared with 9.3 to 2.8 s−1 in our original assays; Table 1). The steady-state actin-activated ATPase activity of Myo52p was measured as a function of actin concentration (actin alone: open circles; actin plus Cdc8p: filled circles). Myo52p was included in the assays at a concentration of 10 nM. Lines are fits to Michaelis-Menten kinetics. The measurements and fitted values (shown inset) are the averages from two independent experiments.
112
Figure 3-4. Regulation of Myo2p- and SKMM-II-driven actin filament gliding by tropomyosin. The efficiency of myosin-driven actin filament gliding is portrayed using representative fields of (rhodamine-phalloidin labeled) filaments generated from time- lapse epi-fluorescence microscopy experiments. Images shown are maximum projections of 60 frames captured every second for both Myo2p (A) and SKMM-II (B). Myo2p and SKMM-II were employed at a working concentration of 5 nM (the same concentration used to generate the filament gliding data presented in Table 1). The trajectory of filament movement over time is tracked and summarized by marking (with 113 colored circles for each frame) the leading ends of any filament exhibiting motility during the movies. Trajectories of filament motility were compared for bare actin and the indicated tropomyosin-decorated filaments. A) The motility events for Myo2p with bare actin filaments are a little faster (circles slightly further apart) yet shorter in duration (shorter trajectory length) compared with the events tracked with actin- tropomyosin filaments. This reflects the slightly slower yet more continuous and efficient filament motility observed for Myo2p with tropomyosin-actin filaments. (Table 1). B) The motility events for SKMM-II with bare actin filaments are much faster (circles an obvious distance apart), more numerous, and more longer lived compared with the events tracked with actin-tropomyosin filaments. This reflects the much slower and much less efficient filament motility observed with tropomyosin-actin filaments (where many more filaments associated with the coverslip surface are non- motile or fail to sustain persistent motility) (Table 1). The speeds and efficiencies of SKMM-II-driven actin filament gliding were also compared with and without tropomyosins at higher SKMM-II concentrations (Figs. 5A and 5B).
114
Figure 3-5. Effect of tropomyosin on SKMM-II-driven actin filament gliding in relation to myosin concentration. The working concentration of SKMM-II employed in our actin filament gliding assays (Fig. 4B; Table 1) was 5 nM (2.5 µg/ml). We also compared the motility activity of SKMM-II at higher myosin concentrations. A) The effect of saturating SKMM-II (50 nM/25.0 µg/ml) was tested with bare actin filaments versus Cdc8p-, Tpm3.1cy-, or Tpm4.2cy-decorated filaments. The histogram summarizes the SKMM-II filament gliding rates (n = 30–70 filaments per experiment). B) Histogram summarizing SKMM-II gliding efficiency versus myosin concentration with bare actin filaments versus Cdc8p-decorated filaments. Gliding efficiency reflects the number of motile (myosin-driven) actin filaments/total actin filaments. A total of two to five different movie fields were scored. The relative number of motile filaments scored for actin alone at 2.5 µg/ml was set to 1.0.
115
Figure 3-6. Regulation of Myo52p processivity by tropomyosin. Processive movement of Myo52p-HMM molecules coupled to Qdots along tropomyosin-decorated rhodamine phalloidin-labeled actin filaments using TIRF microscopy. A) Movement of a Myo52p-Qdot (green) along Tpm3.1cy- and Tpm4.2cy-decorated actin filaments (red). Bars: 4 µm. Representative events are presented in Supporting Information Movies S1 and S2. B) Kymographs of processive runs of Myo52p-HMM along actin filaments decorated with Tpm3.1cy and Tpm4.2cy. C) Histograms of the speed distributions for processive Myo52p runs along actin filaments decorated with Tpm3.1cy and Tpm4.2cy. D) Run length histograms for Myo52p movements along actin filaments decorated with Tpm3.1cy and Tpm4.2cy. The red curves show exponential fits (y = Ae−x/λ) to determine the run length λ. E) Histogram comparing the frequencies of processive Myo52p runs on actin filaments decorated with Cdc8p, Tpm3.1cy, or Tpm4.2cy. Frequency values reflect the number of Myo52p events (runs) observed per µm of actin-tropomyosin filament track available over time. Final values incorporate the myosin concentration to yield frequency as µM Myo52p/µm actin/second.
116
Figure 3-7. Mammalian tropomyosin Tpm3.1cy rescues Cdc8p function in vivo. The ability of Tpm3.1cy or Tpm4.2cy to substitute for Cdc8p during cytokinesis was tested in fission yeast. Tropomyosin (either untagged or GFP-tagged) expression was driven from the inducible nmt41x promoter in fission yeast plasmids (see Experimental Procedures for details). A) Temperature-sensitive cdc8-110 cells were transformed with various ura4+ plasmids and isolated under permissive growth conditions (25°C) on EMM-Ura− minimal media plates. The plate shown indicates the ability/inability of the different plasmids to rescue Cdc8p function. Here transformants were grown on EMM- Ura− plates at the restrictive temperature (36°C) to attenuate Cdc8-110p function and select for rescue. The plates contained 5 µg/ml phloxin B, a pink dye that accumulates inside dead cells (note the darker pink color of the cell streaks that failed to grow). Plasmids harbored untagged cdc8 (positive control), cDNAs for Tpm3.1cy or Tpm4.2cy, or lacked an insert altogether (empty vector, negative control). B) Images of wild-type cells expressing GFP-tagged versions of Cdc8p, Tpm3.1cy, or Tpm4.2cy were captured during cytokinesis. The strain background includes a uch2-mCherry fusion integrated into the chromosome to mark dividing/divided nuclei. Cells were 117 grown in EMM-Ura- minimal media at 30ºC. Scale bar: 4 µm. C) DIC and fluorescence images of cdc8-110 cells expressing untagged Cdc8p (left) or Tpm3.1cy (center). Control cells carrying an empty vector are also shown (right). Cells were grown at 36°C in EMM-Ura- minimal media, and Rlc1p-YFP contractile ring structures visualized via an integrated rlc1-mYFP fusion. Scale bar: 4 µm. D) Plots charting the assembly, dwell, and constriction phases of individual ring diameter traces (red, n = 25) from cdc8-110 cells expressing untagged Cdc8p (left) or Tpm3.1cy (right). The thick black lines reflect average fits of all the individual ring traces. Ring dynamics were recorded using time- lapse epi-fluorescence microscopy of Rlc1p-YFP. For each plot the length of flat line traces shown at negative time represent the assembly phase, while the line traces shown at positive time correspond to ring diameter during the dwell (preconstriction) and constriction phases. Cells were grown as described in C. Average assembly times, dwell times, and (circumferential) constriction rates are included to the right of each plot.
118
Figure 3-8. Model depicting differential regulation of myosins by the “closed” actin-tropomyosin state. The “closed” state reflects the position of Cdc8p and other tropomyosins bound along actin filaments in the absence of troponin. While referred to as “closed,” this state can act positively, negatively, or passively on myosins depending on the myosin isoform. Such features offer the potential for tight spatial regulation of myosin motor activity in complex cellular environments.
119
Supplementary Movie Legends
Movie 3-S1. Tpm3.1cy-decorated actin filaments support the processive movement of Myo52p-Qdots. Myo52p-HMM-Qdots can move processively on Tpm3.1cy-decorated actin filaments. Data were collected using TIRF microscopy with a capture rate of 30 frames/s and are played back at this speed. Scale bar: 2 µm.
Movie 3-S2. Tpm4.2cy-decorated actin filaments support the processive movement of Myo52p-Qdots. Myo52p-HMM-Qdots can move processively on Tpm4.2cy-decorated actin filaments. Data were collected using TIRF microscopy with a capture rate of 30 frames/s and are played back at this speed. Scale bar: 2 µm.
120
CHAPTER 4. DISCUSSION
The work presented in this dissertation describes differential regulation of myosin by non-muscle tropomyosin. Chapter 2 describes single molecule in vitro experiments and fission yeast based in vivo studies that demonstrate enhancement of type V myosin activity by tropomyosin. The sole fission yeast tropomyosin Cdc8 enables processive movement of the low duty ratio motor Myo52. Multiple Myo52 motors bound to a Qdot also require Cdc8 for continuous transport. This finding indicates regulation of Myo52 by Cdc8 is relevant within the context of the fission yeast cell, which relies on multiple Myo52 motors to transport cargo. Decoration of actin tracks with tropomyosin provides a simple mechanism to sort myosin motors to particular actin structures that could be relevant in higher eukaryotes that express nonprocessive type V myosins (Takagi et al., 2008; Toth et al., 2005; Watanabe et al.,
2008) and a larger set of tropomyosin isoforms (Gunning, Hardeman, et al., 2015).
Previous biochemical studies indicate that Myo52 is a low duty ratio motor incapable of processive movement (Clayton et al., 2010). Enabling Myo52 processivity requires increasing the duty ratio of the motor to greater than 50% either by increasing the percentage of cycle time in the strong-bound states or decreasing the time in the weakly bound states. The observed decrease in Myo52 KM and decrease in filament gliding speed with Cdc8 indicates that tropomyosin increases the percentage of time the motor spends in the strong-bound state (Clayton et al., 2010). The increase in Myo52
Vmax achieved with Cdc8 suggests that Cdc8 also decreases the total cycle time of the motor. However, these effects appear to be myosin V isoform specific. The budding yeast type V myosin, Myo2p, requires tropomyosin for processive movement, although
121 tropomyosin does not affect the actin affinity or Vmax of this myosin V (Hodges et al.,
2012). Steady-state enzyme kinetics experiments indicate that tropomyosin dependent processive movement of Myo2p is achieved by decreasing the rate of ADP release and dissociation from actin (Hodges et al., 2012).
Myo52 single molecule experiments at low ATP concentrations demonstrate that increasing the Myo52 strong actin-bound state is sufficient to achieve processive movement. The favoring of the nucleotide-free rigor state at low ATP increases the duty ratio of Myo52 to over 95% with or without tropomyosin. However, under these conditions, the addition of Cdc8 resulted in a seven-fold increase in the number of
Myo52 processive events and longer average run lengths compared to undecorated actin. These results indicate tropomyosin regulates Myo52 through a mechanism that is in addition to increasing the duty ratio of the motor. The increased Myo52 run length with tropomyosin-decorated actin may be explained by an improved gating between the two Myo52 heads – possibly by slowing ADP release in response to tropomyosin induced strain on the motor domain (Geeves et al., 1999). Additionally, a 6.5 Å structure of the actin-tropomyosin complex determined by cryo-electron microscopy illustrates direct interactions between tropomyosin and myosin (von der Ecken et al.,
2015). Contacts between tropomyosin and myosin may increase motility efficiency by increasing myosin affinity for the actin filament or by decreasing the amount of time the advancing myosin head searches for the next actin-docking site.
Clustering of truncated Myo52 motors on actin cables observed in vivo suggests cooperative binding of myosin heads on tropomyosin-decorated actin. A similar mechanism regulates actomyosin in striated muscle, in which a high concentration of
122 ordered type II myosin activates the actin thin filament by shifting tropomyosin from the inhibitory “closed” state to the fully accessible “open” state (VanBuren et al., 1999).
Cryo-electron microscopy of Cdc8 decorated actin showed that these filaments assume the “closed” state (Skoumpla et al., 2007) (Figure 4-1). Consistent with this observation, Cdc8-decorated actin inhibits skeletal muscle myosin activity (East, Sousa, et al., 2011). However, Myo52 processive motility was observed at low concentrations of Myo52 in single molecule assays, demonstrating that either the “closed” state of
Cdc8-actin filaments is not inhibitory to this myosin, or single molecules of Myo52 are able to shift the tropomyosin filament to the “open” state.
The broader implications of actomyosin regulation by tropomyosin were explored in chapter 3. Two tropomyosin isoforms associated with cancer cell transformation (Tpm3.1 and Tpm4.2) were tested for the ability to regulate type II and type V myosin. Both Tpm3.1 and Tpm4.2 decorated actin filaments enhanced Myo52 activity and enabled Myo52 processive motility comparable to that achieved with Cdc8 decorated actin. Tpm3.1 and Tpm4.2 also enhanced type II non-muscle myosin activity
(Myo2), while skeletal muscle myosin II was starkly inhibited by these tropomyosins.
The increase in Myo2 activity with Tpm3.1 and Tpm4.2 is consistent with the increased non-muscle myosin II activity observed during cytokinesis in higher eukaryotes over- expressing Tpm1.8 (Eppinga et al., 2006). The highly processive MyoVa was largely unaffected by Tpm3.1 and Tpm4.2, indicating that positive regulation of type V myosins may be limited to non-processive motors. Activation of type V myosins may
123 be an important form of regulating myosin motor output in higher eukaryotes that express non-processive myosin V, including human myosin Vc (Takagi et al., 2008).
The similarity of tropomyosin function between yeast and mammalian isoforms is unexpected given the large evolutionary distance between these organisms. This is likely due to conserved characteristics of the tropomyosin sequence that determine its association with actin and myosin. Striated muscle tropomyosin Tpm1.1 associates with actin via a periodic series of acidic and basic residues predominantly at locations b, c, and f of the heptad repeats (Barua et al., 2013; Hitchcock-DeGregori et al., 2002).
Highlighting a conserved feature among tropomyosins, amino acid substitutions made to Cdc8 at similar acidic residues at locations b, c, and f disrupted association with actin and in vivo function (Cranz-Mileva et al., 2013).
Conserved features of tropomyosin notwithstanding, considerable differences exist between the sequence and size of Cdc8 versus mammalian tropomyosins. It is therefore unexpected that Tpm3.1 successfully substituted for Cdc8 in vivo, resulting in
Tpm3.1 dependent fission yeast cells exhibiting comparable cytokinesis kinetics and growth rates to wild type cells. Transformed neuroblastoma and melanoma cells depend on Tpm3.1 for proliferation, potentially providing an effective target for anti- cancer therapies. Small molecule compounds are being developed that bind to the
Tpm3.1 C-terminus, altering the Tpm3.1 filaments (Stehn et al., 2013).
Tpm4.2 and Tpm3.1 are the products of similar exon arrangements, although
Tpm4.2 derives from the use of exon 6b while Tpm3.1 uses exon 6a. Despite sequence similarities to Tpm3.1 and exhibiting an ability to regulate type II and type V myosins comparable to Tpm3.1 and Cdc8, Tpm4.2 was unable to replace Cdc8 in vivo. This
124 finding may be explained by sequence variations between the TPM3 and TPM4 genes, or an effect determined by exon 6. Small differences in the sequence or structure of
Tpm3.1 and Tpm4.2 could alter the ability of these tropomyosins to interact with other actin-binding proteins, including blocking actin severing by ADF/cofilin (Skau &
Kovar, 2010), or associating with formin-nucleated actin filaments (Johnson et al.,
2014).
In our proposed model, the “closed” tropomyosin-actin state differentially regulates actomyosin. Consistent with this model, the “closed” Cdc8-actin state prevents myosin I binding (Clayton et al., 2010), while the same filament activates
Myo52 and Myo2. Although the tropomyosin-actin state of Tpm3.1 and Tpm4.2 has not yet been determined, our results indicate that these two tropomyosin isoforms regulate myosin in a manner similar to the “closed” state observed with Cdc8. The differential regulation of actomyosin by non-muscle tropomyosins described in these studies has broad implications to the sorting of myosin motors to specific actin structures and can potentially play an important role in the regulation of actomyosin processes in higher eukaryotes.
Future Directions
The duty ratio of the non-processive type V myosin in budding yeast is increased by a tropomyosin-induced decrease in the ADP release rate. Conducting transient kinetics studies on fission yeast Myo52 will help determine if tropomyosin also decreases the ADP release rate of this type V motor. Additionally, understanding the molecular mechanism of Myo52 regulation by tropomyosin – as well as the
125 regulation of non-muscle type II myosins – depends largely on generating high resolution models of these motors in complex with tropomyosin decorated actin filaments.
A likely important factor in the differential regulation of myosin motors by tropomyosin is the overlapping tropomyosin N- and C-termini (Moraczewska et al.,
2000; Palm et al., 2003). Appendix A describes a preliminary evaluation of type II myosin regulation by tropomyosin that focuses on the role of the tropomyosin C- terminus. This study demonstrates differential regulation of type II non-muscle myosin
(Myo2) that is tropomyosin isoform dependent. Furthermore, there is evidence of a correlation between the C-terminal sequence of a given tropomyosin isoform and its ability to positively regulate Myo2. However, repeating these experiments, as well as expanding them to include other tropomyosin isoforms, will be required to draw conclusions from this preliminary study. Furthermore, all the experiments to date have been performed using skeletal actin. Thus, it is critical to investigate the role actin isoforms play in determining the ability of tropomyosin to regulate myosin needs to be investigated.
Building on the differential regulation of myosin by mammalian tropomyosin isoforms described above and in appendix A, it will be valuable to explore the importance of specific regions of tropomyosin in regulating other actin binding proteins.
Tropomyosin has been shown to affect actin severing by cofilin in yeast (Skau &
Kovar, 2010) and mammals (Bryce et al., 2003). However, the mechanism of this regulation is not known. Focusing on the role of tropomyosin N- and C-termini in blocking actin severing by cofilin could provide valuable insight into the regulation of
126 actin structures by tropomyosin in normal and diseased cells.
Tm3.1 is the predominant low molecular weight tropomyosin isoform expressed in primary tumors and tumor cell lines. Levels of Tm3.1 are elevated in transformed neuroblastoma and melanoma cell lines compared to representative primary and immortalized cell lines (Stehn et al., 2013). Small molecules that target Tpm3.1
(ATMs) have been developed using in silico modeling to identify molecules capable of binding to the C-terminal pocket of Tm3.1. Treatment of neuroblastoma cells with
ATMs disrupts Tm3.1 containing actin filaments in a dose-dependent manner, reverting the actin cytoskeleton back to a pre-transformed state while having minimal effect on normal cells (Stehn et al., 2013). The application of ATMs as anticancer therapeutics will require efficient screening for compounds that effectively disrupt Tpm3.1, as well as determining the mechanism through which this disruption occurs. Fission yeast cells requiring Tpm3.1 for viability potentially provide a unique high-throughput system to screen for new ATMs as well as to characterize existing ones.
127
Figure 4-1. Three-dimensional reconstructions of negatively stained actin filaments. Surface views of reconstructions of (A) F-actin control filaments (actin subdomains 1 to 4 marked on one actin monomer) and (B,C) F-actin-Cdc8. Additional density corresponding to tropomyosin (arrows) is observed for the filaments containing Cdc8. Cdc8 occupies the `closed' position on actin, i.e. it localizes on the outer edge of actin subdomains 3 and 4 next to the cleft separating the inner (subdomains 3 and 4) and outer (subdomains 1 and 2) domains of actin, which is the same position previously described for troponin-tropomyosin-regulated filaments in the absence of Ca2+ by Lehman et al., 1994. (Modified and used, with permission, from Skoumpla et al. Journal of Cell Science, 2007)
128
LITERATURE CITED
Arai, R., Nakano, K., & Mabuchi, I. (1998). Subcellular localization and possible function of actin, tropomyosin and actin-related protein 3 (Arp3) in the fission yeast Schizosaccharomyces pombe. Eur J Cell Biol, 76(4), 288-295. doi:10.1016/S0171-9335(98)80007-1
Bach, C. T., Creed, S., Zhong, J., Mahmassani, M., Schevzov, G., Stehn, J., . . . O'Neill, G. M. (2009). Tropomyosin isoform expression regulates the transition of adhesions to determine cell speed and direction. Mol Cell Biol, 29(6), 1506-1514. doi:10.1128/MCB.00857-08
Bahler, J., Wu, J. Q., Longtine, M. S., Shah, N. G., McKenzie, A., 3rd, Steever, A. B., . . . Pringle, J. R. (1998). Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast, 14(10), 943-951. doi:10.1002/(sici)1097-0061(199807)14:10<943::aid-yea292>3.0.co;2-y
Balasubramanian, M. K., Helfman, D. M., & Hemmingsen, S. M. (1992). A new tropomyosin essential for cytokinesis in the fission yeast S. pombe. Nature, 360(6399), 84-87. doi:10.1038/360084a0
Barua, B., Fagnant, P. M., Winkelmann, D. A., Trybus, K. M., & Hitchcock-DeGregori, S. E. (2013). A periodic pattern of evolutionarily conserved basic and acidic residues constitutes the binding interface of actin-tropomyosin. J Biol Chem, 288(14), 9602-9609. doi:10.1074/jbc.M113.451161
Barua, B., Nagy, A., Sellers, J. R., & Hitchcock-DeGregori, S. E. (2014). Regulation of nonmuscle myosin II by tropomyosin. Biochemistry, 53(24), 4015-4024. doi:10.1021/bi500162z
Barua, B., Winkelmann, D. A., White, H. D., & Hitchcock-DeGregori, S. E. (2012). Regulation of actin-myosin interaction by conserved periodic sites of tropomyosin. Proc Natl Acad Sci U S A, 109(45), 18425-18430. doi:10.1073/pnas.1212754109
Behrmann, E., Muller, M., Penczek, P. A., Mannherz, H. G., Manstein, D. J., & Raunser, S. (2012). Structure of the rigor actin-tropomyosin-myosin complex. Cell, 150(2), 327-338. doi:10.1016/j.cell.2012.05.037
Berger, C. L., & Thomas, D. D. (1991). Rotational dynamics of actin-bound intermediates in the myosin ATPase cycle. Biochemistry, 30(46), 11036-11045.
Bernstein, B. W., & Bamburg, J. R. (1992). Actin in emerging neurites is recruited from a monomer pool. Mol Neurobiol, 6(2-3), 95-106. doi:10.1007/BF02780546
129
Bharadwaj, S., Thanawala, R., Bon, G., Falcioni, R., & Prasad, G. L. (2005). Resensitization of breast cancer cells to anoikis by tropomyosin-1: role of Rho kinase-dependent cytoskeleton and adhesion. Oncogene, 24(56), 8291-8303. doi:10.1038/sj.onc.1208993
Blanchoin, L., & Pollard, T. D. (2002). Hydrolysis of ATP by polymerized actin depends on the bound divalent cation but not profilin. Biochemistry, 41(2), 597- 602.
Blanchoin, L., Pollard, T. D., & Hitchcock-DeGregori, S. E. (2001). Inhibition of the Arp2/3 complex-nucleated actin polymerization and branch formation by tropomyosin. Curr Biol, 11(16), 1300-1304.
Boyd, J., Risinger, J. I., Wiseman, R. W., Merrick, B. A., Selkirk, J. K., & Barrett, J. C. (1995). Regulation of microfilament organization and anchorage-independent growth by tropomyosin 1. Proc Natl Acad Sci U S A, 92(25), 11534-11538.
Broschat, K. O., Weber, A., & Burgess, D. R. (1989). Tropomyosin stabilizes the pointed end of actin filaments by slowing depolymerization. Biochemistry, 28(21), 8501-8506.
Bryce, N. S., Schevzov, G., Ferguson, V., Percival, J. M., Lin, J. J., Matsumura, F., . . . Weinberger, R. P. (2003). Specification of actin filament function and molecular composition by tropomyosin isoforms. Mol Biol Cell, 14(3), 1002-1016. doi:10.1091/mbc.E02-04-0244
Burgess, S., Walker, M., Wang, F., Sellers, J. R., White, H. D., Knight, P. J., & Trinick, J. (2002). The prepower stroke conformation of myosin V. J Cell Biol, 159(6), 983- 991. doi:10.1083/jcb.200208172
Caldwell, B. J., Lucas, C., Kee, A. J., Gaus, K., Gunning, P. W., Hardeman, E. C., . . . Gomez, G. A. (2014). Tropomyosin isoforms support actomyosin biogenesis to generate contractile tension at the epithelial zonula adherens. Cytoskeleton (Hoboken), 71(12), 663-676. doi:10.1002/cm.21202
Carlier, M. F., & Pantaloni, D. (1986). Direct evidence for ADP-Pi-F-actin as the major intermediate in ATP-actin polymerization. Rate of dissociation of Pi from actin filaments. Biochemistry, 25(24), 7789-7792.
Chesarone, M. A., & Goode, B. L. (2009). Actin nucleation and elongation factors: mechanisms and interplay. Curr Opin Cell Biol, 21(1), 28-37. doi:10.1016/j.ceb.2008.12.001
Clayton, J. E., Pollard, L. W., Murray, G. G., & Lord, M. (2015). Myosin motor isoforms direct specification of actomyosin function by tropomyosins. Cytoskeleton (Hoboken), 72(3), 131-145. doi:10.1002/cm.21213 130
Clayton, J. E., Pollard, L. W., Sckolnick, M., Bookwalter, C. S., Hodges, A. R., Trybus, K. M., & Lord, M. (2014). Fission yeast tropomyosin specifies directed transport of myosin-V along actin cables. Mol Biol Cell, 25(1), 66-75. doi:10.1091/mbc.E13-04- 0200
Clayton, J. E., Sammons, M. R., Stark, B. C., Hodges, A. R., & Lord, M. (2010). Differential regulation of unconventional fission yeast myosins via the actin track. Curr Biol, 20(16), 1423-1431. doi:10.1016/j.cub.2010.07.026
Coffman, V. C., Nile, A. H., Lee, I. J., Liu, H., & Wu, J. Q. (2009). Roles of formin nodes and myosin motor activity in Mid1p-dependent contractile-ring assembly during fission yeast cytokinesis. Mol Biol Cell, 20(24), 5195-5210. doi:10.1091/mbc.E09- 05-0428
Collins, K., Sellers, J. R., & Matsudaira, P. (1990). Calmodulin dissociation regulates brush border myosin I (110-kD-calmodulin) mechanochemical activity in vitro. J Cell Biol, 110(4), 1137-1147.
Cooper, H. L., Feuerstein, N., Noda, M., & Bassin, R. H. (1985). Suppression of tropomyosin synthesis, a common biochemical feature of oncogenesis by structurally diverse retroviral oncogenes. Mol Cell Biol, 5(5), 972-983.
Cooper, J. A. (2002). Actin dynamics: tropomyosin provides stability. Curr Biol, 12(15), R523-525.
Coulton, A. T., East, D. A., Galinska-Rakoczy, A., Lehman, W., & Mulvihill, D. P. (2010). The recruitment of acetylated and unacetylated tropomyosin to distinct actin polymers permits the discrete regulation of specific myosins in fission yeast. J Cell Sci, 123(Pt 19), 3235-3243. doi:10.1242/jcs.069971
Coureux, P. D., Wells, A. L., Menetrey, J., Yengo, C. M., Morris, C. A., Sweeney, H. L., & Houdusse, A. (2003). A structural state of the myosin V motor without bound nucleotide. Nature, 425(6956), 419-423. doi:10.1038/nature01927
Cranz-Mileva, S., Pamula, M. C., Barua, B., Desai, B., Hong, Y. H., Russell, J., . . . Hitchcock-DeGregori, S. E. (2013). A molecular evolution approach to study the roles of tropomyosin in fission yeast. PLoS One, 8(10), e76726. doi:10.1371/journal.pone.0076726
Creed, S. J., Bryce, N., Naumanen, P., Weinberger, R., Lappalainen, P., Stehn, J., & Gunning, P. (2008). Tropomyosin isoforms define distinct microfilament populations with different drug susceptibility. Eur J Cell Biol, 87(8-9), 709-720. doi:10.1016/j.ejcb.2008.03.004
Creed, S. J., Desouza, M., Bamburg, J. R., Gunning, P., & Stehn, J. (2011). Tropomyosin isoform 3 promotes the formation of filopodia by regulating the 131 recruitment of actin-binding proteins to actin filaments. Exp Cell Res, 317(3), 249- 261. doi:10.1016/j.yexcr.2010.10.019
Curthoys, N. M., Freittag, H., Connor, A., Desouza, M., Brettle, M., Poljak, A., . . . Fath, T. (2014). Tropomyosins induce neuritogenesis and determine neurite branching patterns in B35 neuroblastoma cells. Mol Cell Neurosci, 58, 11-21. doi:10.1016/j.mcn.2013.10.011
De La Cruz, E. M., & Ostap, E. M. (2004). Relating biochemistry and function in the myosin superfamily. Curr Opin Cell Biol, 16(1), 61-67. doi:10.1016/j.ceb.2003.11.011
De La Cruz, E. M., Wells, A. L., Rosenfeld, S. S., Ostap, E. M., & Sweeney, H. L. (1999). The kinetic mechanism of myosin V. Proc Natl Acad Sci U S A, 96(24), 13726-13731.
Dominguez, R., & Holmes, K. C. (2011). Actin structure and function. Annu Rev Biophys, 40, 169-186. doi:10.1146/annurev-biophys-042910-155359 dos Remedios, C. G., Chhabra, D., Kekic, M., Dedova, I. V., Tsubakihara, M., Berry, D. A., & Nosworthy, N. J. (2003). Actin binding proteins: regulation of cytoskeletal microfilaments. Physiol Rev, 83(2), 433-473. doi:10.1152/physrev.00026.2002
East, D. A., & Mulvihill, D. P. (2011). Regulation and function of the fission yeast myosins. J Cell Sci, 124(Pt 9), 1383-1390. doi:10.1242/jcs.078527
East, D. A., Sousa, D., Martin, S. R., Edwards, T. A., Lehman, W., & Mulvihill, D. P. (2011). Altering the stability of the Cdc8 overlap region modulates the ability of this tropomyosin to bind co-operatively to actin and regulate myosin. Biochem J, 438(2), 265-273. doi:10.1042/BJ20101316
Edamatsu, M., & Toyoshima, Y. Y. (2003). Fission yeast synaptobrevin is involved in cytokinesis and cell elongation. Biochem Biophys Res Commun, 301(3), 641-645.
Egelman, E. H., Francis, N., & DeRosier, D. J. (1982). F-actin is a helix with a random variable twist. Nature, 298(5870), 131-135.
Eppinga, R. D., Li, Y., Lin, J. L., & Lin, J. J. (2006). Tropomyosin and caldesmon regulate cytokinesis speed and membrane stability during cell division. Arch Biochem Biophys, 456(2), 161-174. doi:10.1016/j.abb.2006.06.015
Fan, X., Martin-Brown, S., Florens, L., & Li, R. (2008). Intrinsic capability of budding yeast cofilin to promote turnover of tropomyosin-bound actin filaments. PLoS One, 3(11), e3641. doi:10.1371/journal.pone.0003641
Fanning, A. S., Wolenski, J. S., Mooseker, M. S., & Izant, J. G. (1994). Differential regulation of skeletal muscle myosin-II and brush border myosin-I enzymology 132 and mechanochemistry by bacterially produced tropomyosin isoforms. Cell Motil Cytoskeleton, 29(1), 29-45. doi:10.1002/cm.970290104
Fattoum, A., Hartwig, J. H., & Stossel, T. P. (1983). Isolation and some structural and functional properties of macrophage tropomyosin. Biochemistry, 22(5), 1187-1193.
Fowler, V. M., Sussmann, M. A., Miller, P. G., Flucher, B. E., & Daniels, M. P. (1993). Tropomodulin is associated with the free (pointed) ends of the thin filaments in rat skeletal muscle. J Cell Biol, 120(2), 411-420.
Galinska-Rakoczy, A., Engel, P., Xu, C., Jung, H., Craig, R., Tobacman, L. S., & Lehman, W. (2008). Structural basis for the regulation of muscle contraction by troponin and tropomyosin. J Mol Biol, 379(5), 929-935. doi:10.1016/j.jmb.2008.04.062
Galkin, V. E., VanLoock, M. S., Orlova, A., & Egelman, E. H. (2002). A new internal mode in F-actin helps explain the remarkable evolutionary conservation of actin's sequence and structure. Curr Biol, 12(7), 570-575.
Geeves, M. A., Hitchcock-DeGregori, S. E., & Gunning, P. W. (2015). A systematic nomenclature for mammalian tropomyosin isoforms. J Muscle Res Cell Motil, 36(2), 147-153. doi:10.1007/s10974-014-9389-6
Geeves, M. A., & Holmes, K. C. (1999). Structural mechanism of muscle contraction. Annu Rev Biochem, 68, 687-728. doi:10.1146/annurev.biochem.68.1.687
Gooding, C., & Smith, C. W. (2008). Tropomyosin exons as models for alternative splicing. Adv Exp Med Biol, 644, 27-42.
Gordon, A. M., Homsher, E., & Regnier, M. (2000). Regulation of contraction in striated muscle. Physiol Rev, 80(2), 853-924.
Grallert, A., Martin-Garcia, R., Bagley, S., & Mulvihill, D. P. (2007). In vivo movement of the type V myosin Myo52 requires dimerisation but is independent of the neck domain. J Cell Sci, 120(Pt 23), 4093-4098. doi:10.1242/jcs.012468
Gunning, P. W., Ghoshdastider, U., Whitaker, S., Popp, D., & Robinson, R. C. (2015). The evolution of compositionally and functionally distinct actin filaments. J Cell Sci, 128(11), 2009-2019. doi:10.1242/jcs.165563
Gunning, P. W., Hardeman, E. C., Lappalainen, P., & Mulvihill, D. P. (2015). Tropomyosin - master regulator of actin filament function in the cytoskeleton. J Cell Sci, 128(16), 2965-2974. doi:10.1242/jcs.172502
Gunning, P. W., Schevzov, G., Kee, A. J., & Hardeman, E. C. (2005). Tropomyosin isoforms: divining rods for actin cytoskeleton function. Trends Cell Biol, 15(6), 333- 341. doi:10.1016/j.tcb.2005.04.007 133
Heald, R. W., & Hitchcock-DeGregori, S. E. (1988). The structure of the amino terminus of tropomyosin is critical for binding to actin in the absence and presence of troponin. J Biol Chem, 263(11), 5254-5259.
Helfman, D. M., Flynn, P., Khan, P., & Saeed, A. (2008). Tropomyosin as a regulator of cancer cell transformation. Adv Exp Med Biol, 644, 124-131.
Hendricks, M., & Weintraub, H. (1981). Tropomyosin is decreased in transformed cells. Proc Natl Acad Sci U S A, 78(9), 5633-5637.
Hendricks, M., & Weintraub, H. (1984). Multiple tropomyosin polypeptides in chicken embryo fibroblasts: differential repression of transcription by Rous sarcoma virus transformation. Mol Cell Biol, 4(9), 1823-1833.
Henkel, R. D., VandeBerg, J. L., & Walsh, R. A. (1988). A microassay for ATPase. Anal Biochem, 169(2), 312-318.
Herman, I. M. (1993). Actin isoforms. Curr Opin Cell Biol, 5(1), 48-55.
Hitchcock-DeGregori, S. E. (2008). Tropomyosin: function follows structure. Adv Exp Med Biol, 644, 60-72.
Hitchcock-DeGregori, S. E., & Heald, R. W. (1987). Altered actin and troponin binding of amino-terminal variants of chicken striated muscle alpha-tropomyosin expressed in Escherichia coli. J Biol Chem, 262(20), 9730-9735.
Hitchcock-DeGregori, S. E., Sampath, P., & Pollard, T. D. (1988). Tropomyosin inhibits the rate of actin polymerization by stabilizing actin filaments. Biochemistry, 27(26), 9182-9185.
Hitchcock-DeGregori, S. E., Song, Y., & Greenfield, N. J. (2002). Functions of tropomyosin's periodic repeats. Biochemistry, 41(50), 15036-15044.
Hodges, A. R., Bookwalter, C. S., Krementsova, E. B., & Trybus, K. M. (2009). A nonprocessive class V myosin drives cargo processively when a kinesin- related protein is a passenger. Curr Biol, 19(24), 2121-2125. doi:10.1016/j.cub.2009.10.069
Hodges, A. R., Krementsova, E. B., Bookwalter, C. S., Fagnant, P. M., Sladewski, T. E., & Trybus, K. M. (2012). Tropomyosin is essential for processive movement of a class V myosin from budding yeast. Curr Biol, 22(15), 1410-1416. doi:10.1016/j.cub.2012.05.035
Holmes, K. C., & Lehman, W. (2008). Gestalt-binding of tropomyosin to actin filaments. J Muscle Res Cell Motil, 29(6-8), 213-219. doi:10.1007/s10974-008- 9157-6 134
Hotulainen, P., & Lappalainen, P. (2006). Stress fibers are generated by two distinct actin assembly mechanisms in motile cells. J Cell Biol, 173(3), 383-394. doi:10.1083/jcb.200511093
Huxley, H. E. (1963). Electron Microscope Studies on the Structure of Natural and Synthetic Protein Filaments from Striated Muscle. J Mol Biol, 7, 281-308.
Ishikawa, R., Yamashiro, S., & Matsumura, F. (1989). Differential modulation of actin-severing activity of gelsolin by multiple isoforms of cultured rat cell tropomyosin. Potentiation of protective ability of tropomyosins by 83-kDa nonmuscle caldesmon. J Biol Chem, 264(13), 7490-7497.
Jalilian, I., Heu, C., Cheng, H., Freittag, H., Desouza, M., Stehn, J. R., . . . Gunning, P. W. (2015). Cell elasticity is regulated by the tropomyosin isoform composition of the actin cytoskeleton. PLoS One, 10(5), e0126214. doi:10.1371/journal.pone.0126214
Johnson, M., East, D. A., & Mulvihill, D. P. (2014). Formins determine the functional properties of actin filaments in yeast. Curr Biol, 24(13), 1525-1530. doi:10.1016/j.cub.2014.05.034
Kielley, W. W., & Harrington, W. F. (1960). A model for the myosin molecule. Biochim Biophys Acta, 41, 401-421.
Kitayama, C., Sugimoto, A., & Yamamoto, M. (1997). Type II myosin heavy chain encoded by the myo2 gene composes the contractile ring during cytokinesis in Schizosaccharomyces pombe. J Cell Biol, 137(6), 1309-1319.
Kovar, D. R., Sirotkin, V., & Lord, M. (2011). Three's company: the fission yeast actin cytoskeleton. Trends Cell Biol, 21(3), 177-187. doi:10.1016/j.tcb.2010.11.001
Krementsov, D. N., Krementsova, E. B., & Trybus, K. M. (2004). Myosin V: regulation by calcium, calmodulin, and the tail domain. J Cell Biol, 164(6), 877-886. doi:10.1083/jcb.200310065
Kron, S. J., & Spudich, J. A. (1986). Fluorescent actin filaments move on myosin fixed to a glass surface. Proc Natl Acad Sci U S A, 83(17), 6272-6276.
Kuhn, T. B., & Bamburg, J. R. (2008). Tropomyosin and ADF/cofilin as collaborators and competitors. Adv Exp Med Biol, 644, 232-249.
Leavitt, J., Latter, G., Lutomski, L., Goldstein, D., & Burbeck, S. (1986). Tropomyosin isoform switching in tumorigenic human fibroblasts. Mol Cell Biol, 6(7), 2721- 2726.
135
Lee, W. L., Bezanilla, M., & Pollard, T. D. (2000). Fission yeast myosin-I, Myo1p, stimulates actin assembly by Arp2/3 complex and shares functions with WASp. J Cell Biol, 151(4), 789-800.
Lehman, W., Craig, R., & Vibert, P. (1994). Ca(2+)-induced tropomyosin movement in Limulus thin filaments revealed by three-dimensional reconstruction. Nature, 368(6466), 65-67. doi:10.1038/368065a0
Lehman, W., Hatch, V., Korman, V., Rosol, M., Thomas, L., Maytum, R., . . . Craig, R. (2000). Tropomyosin and actin isoforms modulate the localization of tropomyosin strands on actin filaments. J Mol Biol, 302(3), 593-606. doi:10.1006/jmbi.2000.4080
Lehrer, S. S. (1994). The regulatory switch of the muscle thin filament: Ca2+ or myosin heads? J Muscle Res Cell Motil, 15(3), 232-236.
Leonardi, C. L., Warren, R. H., & Rubin, R. W. (1982). Lack of tropomyosin correlates with the absence of stress fibers in transformed rat kidney cells. Biochim Biophys Acta, 720(2), 154-162.
Li, W., & Gao, F. B. (2003). Actin filament-stabilizing protein tropomyosin regulates the size of dendritic fields. J Neurosci, 23(15), 6171-6175.
Lo Presti, L., Chang, F., & Martin, S. G. (2012). Myosin Vs organize actin cables in fission yeast. Mol Biol Cell, 23(23), 4579-4591. doi:10.1091/mbc.E12-07-0499
Lo Presti, L., & Martin, S. G. (2011). Shaping fission yeast cells by rerouting actin- based transport on microtubules. Curr Biol, 21(24), 2064-2069. doi:10.1016/j.cub.2011.10.033
Lopez, J. I., Mouw, J. K., & Weaver, V. M. (2008). Biomechanical regulation of cell orientation and fate. Oncogene, 27(55), 6981-6993. doi:10.1038/onc.2008.348
Lord, M., Laves, E., & Pollard, T. D. (2005). Cytokinesis depends on the motor domains of myosin-II in fission yeast but not in budding yeast. Mol Biol Cell, 16(11), 5346-5355. doi:10.1091/mbc.E05-07-0601
Lord, M., & Pollard, T. D. (2004). UCS protein Rng3p activates actin filament gliding by fission yeast myosin-II. J Cell Biol, 167(2), 315-325. doi:10.1083/jcb.200404045
Manstein, D. J., & Mulvihill, D. P. (2016). Tropomyosin-mediated Regulation of Cytoplasmic Myosins. Traffic. doi:10.1111/tra.12399
Margossian, S. S., & Lowey, S. (1982). Preparation of myosin and its subfragments from rabbit skeletal muscle. Methods Enzymol, 85 Pt B, 55-71.
136
Martin, C., Schevzov, G., & Gunning, P. (2010). Alternatively spliced N-terminal exons in tropomyosin isoforms do not act as autonomous targeting signals. J Struct Biol, 170(2), 286-293. doi:10.1016/j.jsb.2009.12.016
Martin-Garcia, R., & Mulvihill, D. P. (2009). Myosin V spatially regulates microtubule dynamics and promotes the ubiquitin-dependent degradation of the fission yeast CLIP-170 homologue, Tip1. J Cell Sci, 122(Pt 21), 3862-3872. doi:10.1242/jcs.054460
Martin-Garcia, R., & Valdivieso, M. H. (2006). The fission yeast Chs2 protein interacts with the type-II myosin Myo3p and is required for the integrity of the actomyosin ring. J Cell Sci, 119(Pt 13), 2768-2779. doi:10.1242/jcs.02998
Matsumura, F., Ono, S., Yamakita, Y., Totsukawa, G., & Yamashiro, S. (1998). Specific localization of serine 19 phosphorylated myosin II during cell locomotion and mitosis of cultured cells. J Cell Biol, 140(1), 119-129.
Matsumura, F., Totsukawa, G., Yamakita, Y., & Yamashiro, S. (2001). Role of myosin light chain phosphorylation in the regulation of cytokinesis. Cell Struct Funct, 26(6), 639-644.
May, K. M., Watts, F. Z., Jones, N., & Hyams, J. S. (1997). Type II myosin involved in cytokinesis in the fission yeast, Schizosaccharomyces pombe. Cell Motil Cytoskeleton, 38(4), 385-396. doi:10.1002/(sici)1097-0169(1997)38:4<385::aid- cm8>3.0.co;2-2
McIntosh, B. B., Holzbaur, E. L., & Ostap, E. M. (2015). Control of the initiation and termination of kinesin-1-driven transport by myosin-Ic and nonmuscle tropomyosin. Curr Biol, 25(4), 523-529. doi:10.1016/j.cub.2014.12.008
McMichael, B. K., Kotadiya, P., Singh, T., Holliday, L. S., & Lee, B. S. (2006). Tropomyosin isoforms localize to distinct microfilament populations in osteoclasts. Bone, 39(4), 694-705. doi:10.1016/j.bone.2006.04.031
Mehta, A. D., Rock, R. S., Rief, M., Spudich, J. A., Mooseker, M. S., & Cheney, R. E. (1999). Myosin-V is a processive actin-based motor. Nature, 400(6744), 590-593. doi:10.1038/23072
Merkel, L., Ikebe, M., & Hartshorne, D. J. (1989). Interaction of smooth muscle tropomyosin and smooth muscle myosin. Effect on the properties of myosin. Biochemistry, 28(5), 2215-2220.
Miller, A. L. (2011). The contractile ring. Curr Biol, 21(24), R976-978. doi:10.1016/j.cub.2011.10.044
137
Mitchison, T. J., & Cramer, L. P. (1996). Actin-based cell motility and cell locomotion. Cell, 84(3), 371-379.
Miyado, K., Kimura, M., & Taniguchi, S. (1996). Decreased expression of a single tropomyosin isoform, TM5/TM30nm, results in reduction in motility of highly metastatic B16-F10 mouse melanoma cells. Biochem Biophys Res Commun, 225(2), 427-435. doi:10.1006/bbrc.1996.1190
Moore, J. R., Krementsova, E. B., Trybus, K. M., & Warshaw, D. M. (2001). Myosin V exhibits a high duty cycle and large unitary displacement. J Cell Biol, 155(4), 625- 635. doi:10.1083/jcb.200103128
Moraczewska, J., & Hitchcock-DeGregori, S. E. (2000). Independent functions for the N- and C-termini in the overlap region of tropomyosin. Biochemistry, 39(23), 6891-6897.
Moreno, S., Klar, A., & Nurse, P. (1991). Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol, 194, 795-823.
Motegi, F., Arai, R., & Mabuchi, I. (2001). Identification of two type V myosins in fission yeast, one of which functions in polarized cell growth and moves rapidly in the cell. Mol Biol Cell, 12(5), 1367-1380.
Mulvihill, D. P., Edwards, S. R., & Hyams, J. S. (2006). A critical role for the type V myosin, Myo52, in septum deposition and cell fission during cytokinesis in Schizosaccharomyces pombe. Cell Motil Cytoskeleton, 63(3), 149-161. doi:10.1002/cm.20113
Mulvihill, D. P., & Hyams, J. S. (2003). Role of the two type II myosins, Myo2 and Myp2, in cytokinetic actomyosin ring formation and function in fission yeast. Cell Motil Cytoskeleton, 54(3), 208-216. doi:10.1002/cm.10093
Murrell, M., Oakes, P. W., Lenz, M., & Gardel, M. L. (2015). Forcing cells into shape: the mechanics of actomyosin contractility. Nat Rev Mol Cell Biol, 16(8), 486-498. doi:10.1038/nrm4012
Nakano, K., & Mabuchi, I. (2006). Actin-depolymerizing protein Adf1 is required for formation and maintenance of the contractile ring during cytokinesis in fission yeast. Mol Biol Cell, 17(4), 1933-1945. doi:10.1091/mbc.E05-09-0900
Nosaka, S., Onji, T., & Shibata, N. (1984). Enhancement of actomyosin ATPase activity by tropomyosin. Recombination of myosin and tropomyosin between muscles and platelet. Biochim Biophys Acta, 788(3), 290-297.
138
Oguchi, Y., Ishizuka, J., Hitchcock-DeGregori, S. E., Ishiwata, S., & Kawai, M. (2011). The role of tropomyosin domains in cooperative activation of the actin-myosin interaction. J Mol Biol, 414(5), 667-680. doi:10.1016/j.jmb.2011.10.026
Ono, S., & Ono, K. (2002). Tropomyosin inhibits ADF/cofilin-dependent actin filament dynamics. J Cell Biol, 156(6), 1065-1076. doi:10.1083/jcb.200110013
Palm, T., Greenfield, N. J., & Hitchcock-DeGregori, S. E. (2003). Tropomyosin ends determine the stability and functionality of overlap and troponin T complexes. Biophys J, 84(5), 3181-3189. doi:10.1016/S0006-3495(03)70042-3
Percival, J. M., Hughes, J. A., Brown, D. L., Schevzov, G., Heimann, K., Vrhovski, B., . . . Gunning, P. W. (2004). Targeting of a tropomyosin isoform to short microfilaments associated with the Golgi complex. Mol Biol Cell, 15(1), 268-280. doi:10.1091/mbc.E03-03-0176
Perrin, B. J., & Ervasti, J. M. (2010). The actin gene family: function follows isoform. Cytoskeleton (Hoboken), 67(10), 630-634. doi:10.1002/cm.20475
Pollack, R., Osborn, M., & Weber, K. (1975). Patterns of organization of actin and myosin in normal and transformed cultured cells. Proc Natl Acad Sci U S A, 72(3), 994-998.
Pollard, L. W., Onishi, M., Pringle, J. R., & Lord, M. (2012). Fission yeast Cyk3p is a transglutaminase-like protein that participates in cytokinesis and cell morphogenesis. Mol Biol Cell, 23(13), 2433-2444. doi:10.1091/mbc.E11-07-0656
Pollard, T. D. (2016). Actin and Actin-Binding Proteins. Cold Spring Harb Perspect Biol. doi:10.1101/cshperspect.a018226
Pollard, T. D., & Mooseker, M. S. (1981). Direct measurement of actin polymerization rate constants by electron microscopy of actin filaments nucleated by isolated microvillus cores. J Cell Biol, 88(3), 654-659.
Pruyne, D. W., Schott, D. H., & Bretscher, A. (1998). Tropomyosin-containing actin cables direct the Myo2p-dependent polarized delivery of secretory vesicles in budding yeast. J Cell Biol, 143(7), 1931-1945.
Purcell, T. J., Morris, C., Spudich, J. A., & Sweeney, H. L. (2002). Role of the lever arm in the processive stepping of myosin V. Proc Natl Acad Sci U S A, 99(22), 14159- 14164. doi:10.1073/pnas.182539599
Rayment, I., Rypniewski, W. R., Schmidt-Base, K., Smith, R., Tomchick, D. R., Benning, M. M., . . . Holden, H. M. (1993). Three-dimensional structure of myosin subfragment-1: a molecular motor. Science, 261(5117), 50-58.
139
Reck-Peterson, S. L., Provance, D. W., Jr., Mooseker, M. S., & Mercer, J. A. (2000). Class V myosins. Biochim Biophys Acta, 1496(1), 36-51.
Reck-Peterson, S. L., Tyska, M. J., Novick, P. J., & Mooseker, M. S. (2001). The yeast class V myosins, Myo2p and Myo4p, are nonprocessive actin-based motors. J Cell Biol, 153(5), 1121-1126.
Rethinasamy, P., Muthuchamy, M., Hewett, T., Boivin, G., Wolska, B. M., Evans, C., . . . Wieczorek, D. F. (1998). Molecular and physiological effects of alpha-tropomyosin ablation in the mouse. Circ Res, 82(1), 116-123.
Schevzov, G., Bryce, N. S., Almonte-Baldonado, R., Joya, J., Lin, J. J., Hardeman, E., . . . Gunning, P. (2005). Specific features of neuronal size and shape are regulated by tropomyosin isoforms. Mol Biol Cell, 16(7), 3425-3437. doi:10.1091/mbc.E04-10- 0951
Schevzov, G., Fath, T., Vrhovski, B., Vlahovich, N., Rajan, S., Hook, J., . . . Gunning, P. W. (2008). Divergent regulation of the sarcomere and the cytoskeleton. J Biol Chem, 283(1), 275-283. doi:10.1074/jbc.M704392200
Schevzov, G., Gunning, P., Jeffrey, P. L., Temm-Grove, C., Helfman, D. M., Lin, J. J., & Weinberger, R. P. (1997). Tropomyosin localization reveals distinct populations of microfilaments in neurites and growth cones. Mol Cell Neurosci, 8(6), 439-454. doi:10.1006/mcne.1997.0599
Schevzov, G., Kee, A. J., Wang, B., Sequeira, V. B., Hook, J., Coombes, J. D., . . . Gunning, P. W. (2015). Regulation of cell proliferation by ERK and signal-dependent nuclear translocation of ERK is dependent on Tm5NM1-containing actin filaments. Mol Biol Cell, 26(13), 2475-2490. doi:10.1091/mbc.E14-10-1453
Schevzov, G., & O'Neill, G. (2008). Tropomyosin gene expression in vivo and in vitro. Adv Exp Med Biol, 644, 43-59.
Schevzov, G., Whittaker, S. P., Fath, T., Lin, J. J., & Gunning, P. W. (2011). Tropomyosin isoforms and reagents. Bioarchitecture, 1(4), 135-164. doi:10.4161/bioa.1.4.17897
Sellers, J. R., & Veigel, C. (2006). Walking with myosin V. Curr Opin Cell Biol, 18(1), 68-73. doi:10.1016/j.ceb.2005.12.014
Siemankowski, R. F., Wiseman, M. O., & White, H. D. (1985). ADP dissociation from actomyosin subfragment 1 is sufficiently slow to limit the unloaded shortening velocity in vertebrate muscle. Proc Natl Acad Sci U S A, 82(3), 658-662.
140
Singh, A., & Hitchcock-DeGregori, S. E. (2006). Dual requirement for flexibility and specificity for binding of the coiled-coil tropomyosin to its target, actin. Structure, 14(1), 43-50. doi:10.1016/j.str.2005.09.016
Singh, A., & Hitchcock-DeGregori, S. E. (2007). Tropomyosin's periods are quasi- equivalent for actin binding but have specific regulatory functions. Biochemistry, 46(51), 14917-14927. doi:10.1021/bi701570b
Sirotkin, V., Berro, J., Macmillan, K., Zhao, L., & Pollard, T. D. (2010). Quantitative analysis of the mechanism of endocytic actin patch assembly and disassembly in fission yeast. Mol Biol Cell, 21(16), 2894-2904. doi:10.1091/mbc.E10-02-0157
Skau, C. T., & Kovar, D. R. (2010). Fimbrin and tropomyosin competition regulates endocytosis and cytokinesis kinetics in fission yeast. Curr Biol, 20(16), 1415-1422. doi:10.1016/j.cub.2010.06.020
Skau, C. T., Neidt, E. M., & Kovar, D. R. (2009). Role of tropomyosin in formin- mediated contractile ring assembly in fission yeast. Mol Biol Cell, 20(8), 2160-2173. doi:10.1091/mbc.E08-12-1201
Skoumpla, K., Coulton, A. T., Lehman, W., Geeves, M. A., & Mulvihill, D. P. (2007). Acetylation regulates tropomyosin function in the fission yeast Schizosaccharomyces pombe. J Cell Sci, 120(Pt 9), 1635-1645. doi:10.1242/jcs.001115
Sladewski, T. E., Previs, M. J., & Lord, M. (2009). Regulation of fission yeast myosin- II function and contractile ring dynamics by regulatory light-chain and heavy-chain phosphorylation. Mol Biol Cell, 20(17), 3941-3952. doi:10.1091/mbc.E09-04-0346
Snaith, H. A., Anders, A., Samejima, I., & Sawin, K. E. (2010). New and old reagents for fluorescent protein tagging of microtubules in fission yeast; experimental and critical evaluation. Methods Cell Biol, 97, 147-172. doi:10.1016/s0091- 679x(10)97009-x
Snaith, H. A., Thompson, J., Yates, J. R., 3rd, & Sawin, K. E. (2011). Characterization of Mug33 reveals complementary roles for actin cable-dependent transport and exocyst regulators in fission yeast exocytosis. J Cell Sci, 124(Pt 13), 2187-2199. doi:10.1242/jcs.084038
Spudich, J. A., & Watt, S. (1971). The regulation of rabbit skeletal muscle contraction. I. Biochemical studies of the interaction of the tropomyosin-troponin complex with actin and the proteolytic fragments of myosin. J Biol Chem, 246(15), 4866-4871.
141
Stark, B. C., Sladewski, T. E., Pollard, L. W., & Lord, M. (2010). Tropomyosin and myosin-II cellular levels promote actomyosin ring assembly in fission yeast. Mol Biol Cell, 21(6), 989-1000. doi:10.1091/mbc.E09-10-0852
Stehn, J. R., Haass, N. K., Bonello, T., Desouza, M., Kottyan, G., Treutlein, H., . . . Gunning, P. W. (2013). A novel class of anticancer compounds targets the actin cytoskeleton in tumor cells. Cancer Res, 73(16), 5169-5182. doi:10.1158/0008- 5472.CAN-12-4501
Stehn, J. R., Schevzov, G., O'Neill, G. M., & Gunning, P. W. (2006). Specialisation of the tropomyosin composition of actin filaments provides new potential targets for chemotherapy. Curr Cancer Drug Targets, 6(3), 245-256.
Swartz, D. R., Moss, R. L., & Greaser, M. L. (1996). Calcium alone does not fully activate the thin filament for S1 binding to rigor myofibrils. Biophys J, 71(4), 1891- 1904. doi:10.1016/S0006-3495(96)79388-8
Sweeney, H. L., & Houdusse, A. (2010). Structural and functional insights into the Myosin motor mechanism. Annu Rev Biophys, 39, 539-557. doi:10.1146/annurev.biophys.050708.133751
Takagi, Y., Yang, Y., Fujiwara, I., Jacobs, D., Cheney, R. E., Sellers, J. R., & Kovacs, M. (2008). Human myosin Vc is a low duty ratio, nonprocessive molecular motor. J Biol Chem, 283(13), 8527-8537. doi:10.1074/jbc.M709150200
Tang, N., & Ostap, E. M. (2001). Motor domain-dependent localization of myo1b (myr-1). Curr Biol, 11(14), 1131-1135.
Taylor, K. A. (2007). Regulation and recycling of myosin V. Curr Opin Cell Biol, 19(1), 67-74. doi:10.1016/j.ceb.2006.12.014
Terman, J. R., & Kashina, A. (2013). Post-translational modification and regulation of actin. Curr Opin Cell Biol, 25(1), 30-38. doi:10.1016/j.ceb.2012.10.009
Tobacman, L. S. (2008). Cooperative binding of tropomyosin to actin. Adv Exp Med Biol, 644, 85-94.
Tojkander, S., Gateva, G., Schevzov, G., Hotulainen, P., Naumanen, P., Martin, C., . . . Lappalainen, P. (2011). A molecular pathway for myosin II recruitment to stress fibers. Curr Biol, 21(7), 539-550. doi:10.1016/j.cub.2011.03.007
Toth, J., Kovacs, M., Wang, F., Nyitray, L., & Sellers, J. R. (2005). Myosin V from Drosophila reveals diversity of motor mechanisms within the myosin V family. J Biol Chem, 280(34), 30594-30603. doi:10.1074/jbc.M505209200
142
Trybus, K. M. (1991). Regulation of smooth muscle myosin. Cell Motil Cytoskeleton, 18(2), 81-85. doi:10.1002/cm.970180202
Urbancikova, M., & Hitchcock-DeGregori, S. E. (1994). Requirement of amino- terminal modification for striated muscle alpha-tropomyosin function. J Biol Chem, 269(39), 24310-24315.
Uribe, R., & Jay, D. (2009). A review of actin binding proteins: new perspectives. Mol Biol Rep, 36(1), 121-125. doi:10.1007/s11033-007-9159-2
VanBuren, P., Palmiter, K. A., & Warshaw, D. M. (1999). Tropomyosin directly modulates actomyosin mechanical performance at the level of a single actin filament. Proc Natl Acad Sci U S A, 96(22), 12488-12493.
Veigel, C., Wang, F., Bartoo, M. L., Sellers, J. R., & Molloy, J. E. (2002). The gated gait of the processive molecular motor, myosin V. Nat Cell Biol, 4(1), 59-65. doi:10.1038/ncb732
Volkmann, N., Hanein, D., Ouyang, G., Trybus, K. M., DeRosier, D. J., & Lowey, S. (2000). Evidence for cleft closure in actomyosin upon ADP release. Nat Struct Biol, 7(12), 1147-1155. doi:10.1038/82008 von der Ecken, J., Muller, M., Lehman, W., Manstein, D. J., Penczek, P. A., & Raunser, S. (2015). Structure of the F-actin-tropomyosin complex. Nature, 519(7541), 114- 117. doi:10.1038/nature14033
Vrhovski, B., Theze, N., & Thiebaud, P. (2008). Structure and evolution of tropomyosin genes. Adv Exp Med Biol, 644, 6-26.
Walker, M. L., Burgess, S. A., Sellers, J. R., Wang, F., Hammer, J. A., 3rd, Trinick, J., & Knight, P. J. (2000). Two-headed binding of a processive myosin to F-actin. Nature, 405(6788), 804-807. doi:10.1038/35015592
Wang, E., & Goldberg, A. R. (1976). Changes in microfilament organization and surface topogrophy upon transformation of chick embryo fibroblasts with Rous sarcoma virus. Proc Natl Acad Sci U S A, 73(11), 4065-4069.
Warshaw, D. M., Kennedy, G. G., Work, S. S., Krementsova, E. B., Beck, S., & Trybus, K. M. (2005). Differential labeling of myosin V heads with quantum dots allows direct visualization of hand-over-hand processivity. Biophys J, 88(5), L30-32. doi:10.1529/biophysj.105.061903
Watanabe, S., Watanabe, T. M., Sato, O., Awata, J., Homma, K., Umeki, N., . . . Ikebe, M. (2008). Human myosin Vc is a low duty ratio nonprocessive motor. J Biol Chem, 283(16), 10581-10592. doi:10.1074/jbc.M707657200
143
Wawro, B., Greenfield, N. J., Wear, M. A., Cooper, J. A., Higgs, H. N., & Hitchcock- DeGregori, S. E. (2007). Tropomyosin regulates elongation by formin at the fast- growing end of the actin filament. Biochemistry, 46(27), 8146-8155. doi:10.1021/bi700686p
Webb, R. C. (2003). Smooth muscle contraction and relaxation. Adv Physiol Educ, 27(1-4), 201-206.
Weber, A., Pennise, C. R., Babcock, G. G., & Fowler, V. M. (1994). Tropomodulin caps the pointed ends of actin filaments. J Cell Biol, 127(6 Pt 1), 1627-1635.
Wegner, A. (1976). Head to tail polymerization of actin. J Mol Biol, 108(1), 139-150.
Wegner, A. (1979). Equilibrium of the actin-tropomyosin interaction. J Mol Biol, 131(4), 839-853.
Wells, A. L., Lin, A. W., Chen, L. Q., Safer, D., Cain, S. M., Hasson, T., . . . Sweeney, H. L. (1999). Myosin VI is an actin-based motor that moves backwards. Nature, 401(6752), 505-508. doi:10.1038/46835
Win, T. Z., Gachet, Y., Mulvihill, D. P., May, K. M., & Hyams, J. S. (2001). Two type V myosins with non-overlapping functions in the fission yeast Schizosaccharomyces pombe: Myo52 is concerned with growth polarity and cytokinesis, Myo51 is a component of the cytokinetic actin ring. J Cell Sci, 114(Pt 1), 69-79.
Wu, X. S., Rao, K., Zhang, H., Wang, F., Sellers, J. R., Matesic, L. E., . . . Hammer, J. A., 3rd. (2002). Identification of an organelle receptor for myosin-Va. Nat Cell Biol, 4(4), 271-278. doi:10.1038/ncb760
Xu, C., Craig, R., Tobacman, L., Horowitz, R., & Lehman, W. (1999). Tropomyosin positions in regulated thin filaments revealed by cryoelectron microscopy. Biophys J, 77(2), 985-992. doi:10.1016/S0006-3495(99)76949-3
Yamaguchi, H., & Condeelis, J. (2007). Regulation of the actin cytoskeleton in cancer cell migration and invasion. Biochim Biophys Acta, 1773(5), 642-652. doi:10.1016/j.bbamcr.2006.07.001
Yamaguchi, M., Ver, A., Carlos, A., & Seidel, J. C. (1984). Modulation of the actin- activated adenosinetriphosphatase activity of myosin by tropomyosin from vascular and gizzard smooth muscles. Biochemistry, 23(4), 774-779.
Yengo, C. M., De la Cruz, E. M., Safer, D., Ostap, E. M., & Sweeney, H. L. (2002). Kinetic characterization of the weak binding states of myosin V. Biochemistry, 41(26), 8508-8517.
144
APPENDIX A: TROPOMYOSIN ISOFORM DEPENDENT REGULATION OF TYPE II MYOSIN
Introduction
The actin cytoskeleton facilitates a variety of processes in eukaryotic cells, including cargo transport, cell motility, membrane remodeling, and division. These processes depend upon diverse actin structures – cables, stress fibers, membrane patches, and the mitotic ring – interacting with specific myosin motors (dos Remedios et al., 2003;
Fanning et al., 1994; Murrell et al., 2015). Given the large number of myosin subtypes operating in close proximity to one another, establishing and maintaining the specificity of these actomyosin interactions presents a challenge to eukaryotic cells. The tropomyosin family of proteins has been identified as playing a critical role in this process, although it remains unclear how the ~40 identified mammalian tropomyosin isoforms accomplish this task (Clayton et al., 2015; Clayton et al., 2014; Clayton et al.,
2010; Gunning, Hardeman, et al., 2015).
The importance of non-muscle tropomyosins has recently been highlighted by a growing appreciation of their involvement in multiple types of metastatic cancers
(Lopez et al., 2008; H. Yamaguchi et al., 2007). A characteristic shift has been identified in the tropomyosin expression profile of melanoma and neuroblastoma cells
(Stehn et al., 2013). The mechanism of tropomyosin involvement in metastatic cells is not clear, though a new class of cancer therapeutics is being developed to target specific tropomyosins (Stehn et al., 2013). Identifying the determining factors behind the differential ability of tropomyosin isoforms to regulate myosin function is critical to understanding their role in normal and disease cellular processes.
145
Tropomyosins are a family of alpha helical proteins that form coiled coil parallel dimers that self assemble into filaments in a head to tail fashion, through the overlapping N- and C-termini of adjacent molecules. Unlike the high actin affinity of many actin binding proteins, tropomyosin filaments form weak ionic interactions along the large helical groove of filamentous actin (F-actin) (Hitchcock-DeGregori, 2008).
Four mammalian tropomyosin genes, TPM1-4, produce over forty isoforms by alternate splicing exons one through nine. Tropomyosin isoforms containing exon 1a and either
2a or 2b are termed high molecular weight, with approximately 284 amino acids and covering seven actin subunits. Low molecular weight tropomyosin isoforms contain exon 1b and consist of approximately 248 amino acids covering six actin subunits
(Hitchcock-DeGregori, 2008). All tropomyosin isoforms contain one exon nine variant,
9a, 9b, 9c, or 9d (Gooding & Smith, 2008; Vrhovski et al., 2008).
Tropomyosin isoforms that follow tissue specific expression are categorized as: brain-, smooth muscle-, and or striated muscle-specific. The remaining isoforms are referred to collectively as cytoplasmic. Multiple tropomyosin isoforms are expressed concurrently in mammalian cells but localize to distinct actin structures (Bryce et al.,
2003). The mechanisms involved in establishing and maintaining these different actin- tropomyosin populations is not entirely known, though recent evidence points to the actin-nucleating family of proteins (e.g. formins and Arp2/3) as playing an important role in the process (Johnson et al., 2014; Tojkander et al., 2011).
The ability of tropomyosins to regulate myosin motor function in contractile muscle systems has been well characterized (Gordon et al., 2000). However, much less is known about the role of tropomyosin in regulating the large number of non-muscle
146 myosins (Gunning et al., 2005). Fission yeast has proven to be a powerful model organism in which to study the effect of tropomyosin on non-muscle myosins due to the organism’s highly tractable genetics and relatively simple cytoskeleton. The sole fission yeast tropomyosin, Cdc8, is restricted to the mitotic ring and actin cables, where it promotes the contractile activity of the type II non-muscle myosin, Myo2
(Balasubramanian et al., 1992; Stark et al., 2010), and cargo transport by the type-V myosin, Myo52 (Clayton et al., 2014). Conversely, the presence of Cdc8 at these two actin structures inhibits the association of the type-I myosin, Myo1, limiting its function to the actin patches responsible for membrane remodeling (Clayton et al., 2010; Skau &
Kovar, 2010).
Previously we used the fission yeast system to evaluate the ability of mammalian tropomyosin isoforms to regulate non-muscle myosins (Chapter 3) (Clayton et al., 2015). We demonstrated that decoration of actin filaments by two cancer associated low-molecular weight tropomyosin isoforms, Tpm3.1 or Tpm4.2, enhanced the actin-dependent ATPase and actin filament gliding activity of Myo2 and Myo52, while inhibiting skeletal muscle myosin II (SKMM-II). These tropomyosins did not significantly affect the chick brain type-V myosin MyoVa (Clayton et al., 2015). Our findings demonstrate a myosin isoform dependent level of differential regulation by tropomyosin, in which for a given myosin, all tropomyosins tested show a similar behavior. Although Tpm3.1 and Tpm4.2 are produced from different genes and therefore do not consist of identical sequences, both are products of the same exon arrangement – specifically, both contain exons 1b, 6b, and 9d from their respective gene. Given the large cast of mammalian tropomyosin isoforms produced through
147 alternate exon arrangements, it seems highly unlikely that all isoforms would behave the same with respect to regulating myosin.
The N- and C-termini have been identified as playing an important role in defining how skeletal muscle tropomyosins interact with both actin and myosin (Palm et al., 2003). Therefore, in this study we focus on the role of sequence differences in tropomyosin terminal exons (1 and 9) in regulating Myo2p. Four non-muscle tropomyosin isoforms from the TPM1 gene were selected to assess the role of the overlapping N- and C-termini in the regulation of Myo2p activity using actin activated
ATPase assays. The tropomyosin panel consists of one pair of low molecular weight isoforms, Tpm1.8 and Tpm1.12, and one pair of high molecular weight isoforms,
Tpm1.6 and Tpm1.10. Each member of a given pair has an identical N-terminus – derived from either exon 1a or 1b, for high and low molecular weight, respectively.
The C-terminus of Tpm1.12 and Tpm1.10 contain exon 9c, while Tpm1.8 and Tpm1.6 contain exon 9d. Preliminary findings indicate that the particular coupling of N- and C- termini sequences appears to be an important determinant in the ability of mammalian tropomyosin isoforms to differentially regulate Myo2p.
Results
Previously it was demonstrated that Tpm3.1 and Tpm4.2 – tropomyosin isoforms expressed from two different genes, though sharing the same exon arrangement – showed a similar Myo2 regulation (Chapter 3) (Clayton et al., 2015). Here we identified two sets of tropomyosin isoforms from TPM1 identical to one another except at exon 9 (Figure A-1). Tpm1.6 and Tpm1.10 are both high molecular weight isoforms
148 containing exon 1a. The C-terminus of Tpm1.6 is encoded by exon 9d while the C- terminus of Tpm1.10 is encoded by exon 9c. Similarly, the low molecular weight
Tpm1.8 and Tpm1.12 derive from exon 1b, with Tpm1.8 containing exon 9d while
Tpm1.12 is derived from exon 9c.
The ATPase activity of myosin is coupled to its binding to F-actin. Therefore the activity of Myo2 in solution with F-actin and Mg2+-ATP can be determined under varying conditions by measuring the production of inorganic phosphate (Pi) over time.
To measure the effect of different tropomyosin isoforms on Myo2 activity in this system, actin was polymerized in the presence of tropomyosin at a ratio of 2:1 for 30 minutes. Myo2 activity was determined by measuring the production of Pi over a thirty- minute reaction with 1, 2, 5, 10 and 30 mM of undecorated F-actin or F-actin and tropomyosin, using a standard Malachite green assay. The results from three independent experiments were plotted and fitted with an exponential curve following
Michaelis-Menten kinetics. This assumption has been validated in previous experiments and allows to determine Myo2 kinetics (Stark et al., 2010). Tpm1.8 significantly increased Myo2 ATPase activity over undecorated actin, similar to that achieved with actin decorated with Cdc8p. In contrast, Tpm1.12 did not significantly alter Myo2p
ATPase activity (Figure A-2a). Tpm1.6 and Tpm1.10 both slightly increased Myo2p
ATPase activity compared to undecorated actin, though considerably less than Cdc8p
(Figure A-2b). Michaelis-Menten kinetics and Myo2p efficiency can be derived from the ATPase graphs (Table A-1). Actin decorated with Tpm1.8 resulted in over a two- fold increase in Myo2 Vmax and over a four-fold reduction in KM compared to undecorated actin. These results are comparable to those previously observed with
149
Tpm3.1, Tpm4.2, and Cdc8 (Clayton et al., 2015; Stark et al., 2010). In contrast, the exon 9c derived Tpm1.12 did not significantly alter the Vmax or Km of Myo2p. The high molecular weight TPM1 isoforms, Tpm1.6 and Tpm1.10, behaved nearly identically to one another, resulting in a slight, but significant, increase in Myo2 Vmax and over a four fold reduction in KM relative to undecorated actin.
Discussion
Tropomyosin isoforms demonstrate varying abilities to regulate myosin activity.
Four TPM1 isoforms were selected for this study to evaluate the role of sequence variations in the tropomyosin C-terminus in the context of two different N-termini sequences. Since the sequences of the tropomyosin isoforms being compared are identical up to the terminal exon, any differences in actomyosin regulation resulting within these tropomyosin pairs can be strictly attributed to changes induced by the C- terminus (Figure A-3).
The comparison of the low-molecular weight tropomyosin isoforms Tpm1.8 and
Tpm1.12 shows that a C-terminus derived from exon 9d is able to activate Myo2 while a C-terminus derived from exon 9c is not. These differences could be explained mechanistically by direct interactions between myosin and the C-terminus of tropomyosin, and/or tropomyosin C-terminus dependent changes to actin that affect myosin binding. However, when two tropomyosin isoforms with a different N-terminus,
Tpm1.6 and Tpm1.10, are compared, the same respective 9c and 9d C-terminal sequences do not affect Myo2 regulation. Thus, it appears that both the N- and the C- termini are responsible for determining the ability of tropomyosin to regulate Myo2.
150
The particular pairing of overlapping N- and C-termini may induce allosteric effects along the length of the tropomyosin filament. In this case, a tropomyosin filament built on interactions between the exon 9d derived C-terminus with the exon 1b encoded N- terminus results in a conformation that activates Myo2. In stark contrast, Myo2 activation is not achieved by a tropomyosin filament conformation in which the exon 9c derived C-terminus overlaps with the exon 1b derived N-terminus.
A preliminary experiment comparing two low-molecular tropomyosin isoforms from TPM3, Tpm3.1 and Tpm3.7, indicates that the exon 9d derived Tpm3.1 activated
Myo2 as previously described (Clayton et al., 2015). Interestingly though, the exon 9c derived Tpm3.7 also slightly increased Myo2 activity over undecorated actin (data not shown). Although this experiment needs to be repeated, it could be explained by sequence differences between the TPM3 9c and TPM1 9c exons.
We conducted a sequence alignment of the overlapping N- and C-terminal regions of each of the tropomyosin isoforms included in this study to identify any obvious residues responsible for the observed effects on Myo2 activity (Figure A-4).
The first 25 amino acids of the N-terminal and C-terminal sequences of each of the tropomyosin isoforms were included in the alignment. Exon sequences have high similarity across genes (i.e., TPM1 1a vs. TPM3 1a; and TPM1 1b vs TPM3 1b), however sequences vary considerably between different exons of the same gene (i.e.,
TPM1 1a vs. TPM1 1b; and TPM3 1a vs. TPM3 1b). In the future, these alignments can be used to generate models of the tropomyosin-actin copolymer for each tropomyosin isoform. These models will add valuable insight to understanding the structural mechanism underlying differential regulation of myosin by tropomyosin.
151
Additionally, it would be informative to test tropomyosin chimeras constructed by systematically swapping-in only the ten to twelve overlapping residues at the N- and C- termini into one of the isoforms in this study and measuring the effect on Myo2 ATPase activity. However, it remains likely that in addition to sequence differences at the N- and C-termini, short sequence variations throughout the length of tropomyosins contribute to differing abilities of isoforms to activate Myo2 and should also be investigated further.
In summary, we have described a tropomyosin isoform dependent level of differential regulation of myosin. The tropomyosin N- and C-termini determine, at least partially, the regulatory effect on the type II non-muscle myosin Myo2. This work improves our understanding of how eukaryotic cells are able to establish and maintain specific myosin motor behavior at diverse actin structures.
Materials and Methods
Bacterial plasmid expression
Rattus Norvegious tropomyosin isoform cDNA was generously provided by
Sarah Hitchcock-DeGregori (Tpm1.6, Tpm1.8 and Tpm1.10) and Peter Gunning
(Tpm3.12). Tropomyosin constructs were cloned into pET-3 vectors as previously described and confirmed by DNA sequencing completed by the DNA Analysis Facility at UVM. Briefly, Tpm1.6 was PCR amplified from cDNA using the following primers:
5’ CATATGGCGTCGATGCACGCCAT- CAAGAAGAAGATGCAG (the Nde1 site is italicized, the Ala-Ser acetylation mimic is in bold, and the start codon is underlined), and 3’ GGATCCTTAATCCTCA-TTCAGGGCCAGC (the BamH1 site is italicized and
152 the stop codon is underlined). Tropomyosin-pET-3 vectors were subsequently cloned in
BL21 Escherichia coli cells. Tpm1.8, Tpm1.10, and Tpm1.12 were cloned in an identical manner.
Actin expression and purification
Actin was purified from acetone powder derived from chicken pectoral muscle as previously described (Spudich & Watt, 1971). Briefly, acetone powder was dissolved in 20 mL/g G-buffer (2mM Tris-Cl pH 8.0, 0.2mM ATP, 0.5mM DTT,
o 0.1mM CaCL2, 1mM NaAzide) at 4 C to release actin. After 30 minutes the suspension was subjected to centrifugation for 30 minutes at 25,000 RCF and the supernatant was filtered using glass wool. The pellet was resuspended in original volume of G-buffer and steps two and three were repeated to extract the remaining actin. KCl and MgCl2 were added to the pooled supernatants from previous steps to bring the concentrations to 50mM and 2mM, respectively, enabling actin polymerization. After one hour, actin associated proteins were released from the actin in suspension by the addition of KCl to
0.8M. Following a 30 min incubation, actin was pelleted by centrifugation at 200,000
RCF for 90 minutes. Actin pellets were rinsed with G-buffer before homogenization in
3mL G-buffer/gram of acetone powder used. Aliquots of G-actin were flash frozen in liquid nitrogen and stored at -80o C for later use.
Tropomyosin expression and purification
BL21 e. coli cells transformed with tropomyosin plasmids were grown in
o Lysogeny Broth at 37 C to OD600 0.8. Tropomyosin expression was induced by 153 addition of 0.4mM Isopropyl β-D-1-thiogalactopyranoside to BL21 cultures. Twelve hours at 25o C after induction, cells were pelleted by centrifugation at 18,000 RCF for
30 minutes. Pelleted cells were resuspended in lysis buffer (100 mM NaCl, 10 mM imidazole, pH 7.2, 2 mM EDTA, and 1 mM DTT) and lysed by tip sonication. Lysed cells were then boiled for 10 minutes and subjected to centrifugation for 15 minutes at
45,000 RCF. Tropomyosin was subsequently precipitated out of the collected supernatants by reducing the pH to 0.2 units below the isoelectric point of the respective tropomyosin (e.g. pH 4.2 for Tpm1.12) and pelleted by centrifugation for 15 minutes at
45,000 RCF. Tropomyosin pellets were resuspended in Tpm buffer (50 mM NaCl, 1 mM DTT, 10 mM imidazole (pH 7.4)) and dialyzed 3 times against 1 L of Tpm buffer.
Aliquots of tropomyosin were flash frozen in liquid nitrogen and stored at -80o C for later use.
Myo2p expression and purification
Full-length Myo2p heavy chain and GST- tagged light chains were over- expressed in fission yeast cells and purified as previously described (Lord & Pollard,
2004). Briefly, fission yeast cultures were grown in Edinburgh Minimal Media (EMM) plus 20 mg/mL thiamine overnight to OD595 2.0. Cultures were subsequently diluted in
o EMM minus thiamine to OD595 0.05 and allowed to grow at 30 C for 24 hours. Cells were harvested by centrifugation at 2000 RCF for 10 minutes. Cell pellets were resuspended in 10 mL/1L culture in Lysis buffer (750mM KCl, 25mM Tris-HCl, pH
7.4, 4mM MgCl2, 20mM Na4P2O7, 2mM EGTA, 0.1% Triton X-100, 1mM DTT,
2mM PMSF, 4mM ATP, 2mM Benzamidine) and lysed using a Fastprep bead-beater
154
(MP Biochemicals). Beads were removed by low-speed centrifugation and the collected lysate was subjected to centrifugation at 100,000 RCF for 45 minutes. The supernatant was incubated for 2 hours with 0.4 mL glutathione-Sepharose (Amersham
Biosciences) per liter of the original culture and placed into an empty column. After allowing the lysate to flow through the column, the glutathione-Sepharose resin bed was washed with 10 column volumes of Lysis buffer. Bound GST tagged light chains and associated heavy chains were eluted by addition of Lysis buffer plus 100mM glutathione. Pooled elution fractions were dialyzed 3 times against 1 L of A15 Buffer
(500mM KCl, 10mM Imidazole (pH7.2), 0.4mM NaN3, 1.0mM DTT, 50% glycerol) and stored at 4o C for later use.
Actin-activated ATPase assay
Myo2 activity was measured using a standard F-actin dependent Malachite green
ATPase assay to quantify Pi release as previously described. Briefly, all assays were conducted at room temperature with 30nM Myo2p in 2 mM Tris-HCl, 10 mM imidazole, pH 7.2, 60 mM KCl, 0.1 mM CaCl2, 3 mM MgCl2, 2 mM ATP, and 1 mM
DTT. Actin filaments were pre-incubated with tropomyosin at a 2:1 ratio for 30 minutes and added to the assay at 1, 2, 5, 10 or 30mM. Reactions were initiated by the addition of 2mM Mg+-ATP and quenched after 30 minutes by the addition of 32% sodium citrate. Three independent experiments were conducted and fit to Michaelis-
Menten kinetics using Graphpad Prism 6.
155
References
Balasubramanian, M. K., Helfman, D. M., & Hemmingsen, S. M. (1992). A new tropomyosin essential for cytokinesis in the fission yeast S. pombe. Nature, 360(6399), 84-87. doi:10.1038/360084a0
Barua, B., Fagnant, P. M., Winkelmann, D. A., Trybus, K. M., & Hitchcock-DeGregori, S. E. (2013). A periodic pattern of evolutionarily conserved basic and acidic residues constitutes the binding interface of actin-tropomyosin. J Biol Chem, 288(14), 9602-9609. doi:10.1074/jbc.M113.451161
Bryce, N. S., Schevzov, G., Ferguson, V., Percival, J. M., Lin, J. J., Matsumura, F., . . . Weinberger, R. P. (2003). Specification of actin filament function and molecular composition by tropomyosin isoforms. Mol Biol Cell, 14(3), 1002-1016. doi:10.1091/mbc.E02-04-0244
Clayton, J. E., Pollard, L. W., Murray, G. G., & Lord, M. (2015). Myosin motor isoforms direct specification of actomyosin function by tropomyosins. Cytoskeleton (Hoboken), 72(3), 131-145. doi:10.1002/cm.21213
Clayton, J. E., Pollard, L. W., Sckolnick, M., Bookwalter, C. S., Hodges, A. R., Trybus, K. M., & Lord, M. (2014). Fission yeast tropomyosin specifies directed transport of myosin-V along actin cables. Mol Biol Cell, 25(1), 66-75. doi:10.1091/mbc.E13-04- 0200
Clayton, J. E., Sammons, M. R., Stark, B. C., Hodges, A. R., & Lord, M. (2010). Differential regulation of unconventional fission yeast myosins via the actin track. Curr Biol, 20(16), 1423-1431. doi:10.1016/j.cub.2010.07.026
Cranz-Mileva, S., Pamula, M. C., Barua, B., Desai, B., Hong, Y. H., Russell, J., . . . Hitchcock-DeGregori, S. E. (2013). A molecular evolution approach to study the roles of tropomyosin in fission yeast. PLoS One, 8(10), e76726. doi:10.1371/journal.pone.0076726 dos Remedios, C. G., Chhabra, D., Kekic, M., Dedova, I. V., Tsubakihara, M., Berry, D. A., & Nosworthy, N. J. (2003). Actin binding proteins: regulation of cytoskeletal microfilaments. Physiol Rev, 83(2), 433-473. doi:10.1152/physrev.00026.2002
East, D. A., Sousa, D., Martin, S. R., Edwards, T. A., Lehman, W., & Mulvihill, D. P. (2011). Altering the stability of the Cdc8 overlap region modulates the ability of this tropomyosin to bind co-operatively to actin and regulate myosin. Biochem J, 438(2), 265-273. doi:10.1042/BJ20101316
Eppinga, R. D., Li, Y., Lin, J. L., & Lin, J. J. (2006). Tropomyosin and caldesmon regulate cytokinesis speed and membrane stability during cell division. Arch Biochem Biophys, 456(2), 161-174. doi:10.1016/j.abb.2006.06.015 156
Fanning, A. S., Wolenski, J. S., Mooseker, M. S., & Izant, J. G. (1994). Differential regulation of skeletal muscle myosin-II and brush border myosin-I enzymology and mechanochemistry by bacterially produced tropomyosin isoforms. Cell Motil Cytoskeleton, 29(1), 29-45. doi:10.1002/cm.970290104
Geeves, M. A., & Holmes, K. C. (1999). Structural mechanism of muscle contraction. Annu Rev Biochem, 68, 687-728. doi:10.1146/annurev.biochem.68.1.687
Gooding, C., & Smith, C. W. (2008). Tropomyosin exons as models for alternative splicing. Adv Exp Med Biol, 644, 27-42.
Gordon, A. M., Homsher, E., & Regnier, M. (2000). Regulation of contraction in striated muscle. Physiol Rev, 80(2), 853-924.
Gunning, P. W., Hardeman, E. C., Lappalainen, P., & Mulvihill, D. P. (2015). Tropomyosin - master regulator of actin filament function in the cytoskeleton. J Cell Sci, 128(16), 2965-2974. doi:10.1242/jcs.172502
Gunning, P. W., Schevzov, G., Kee, A. J., & Hardeman, E. C. (2005). Tropomyosin isoforms: divining rods for actin cytoskeleton function. Trends Cell Biol, 15(6), 333- 341. doi:10.1016/j.tcb.2005.04.007
Hitchcock-DeGregori, S. E. (2008). Tropomyosin: function follows structure. Adv Exp Med Biol, 644, 60-72.
Hitchcock-DeGregori, S. E., Song, Y., & Greenfield, N. J. (2002). Functions of tropomyosin's periodic repeats. Biochemistry, 41(50), 15036-15044.
Hodges, A. R., Krementsova, E. B., Bookwalter, C. S., Fagnant, P. M., Sladewski, T. E., & Trybus, K. M. (2012). Tropomyosin is essential for processive movement of a class V myosin from budding yeast. Curr Biol, 22(15), 1410-1416. doi:10.1016/j.cub.2012.05.035
Johnson, M., East, D. A., & Mulvihill, D. P. (2014). Formins determine the functional properties of actin filaments in yeast. Curr Biol, 24(13), 1525-1530. doi:10.1016/j.cub.2014.05.034
Lopez, J. I., Mouw, J. K., & Weaver, V. M. (2008). Biomechanical regulation of cell orientation and fate. Oncogene, 27(55), 6981-6993. doi:10.1038/onc.2008.348
Lord, M., & Pollard, T. D. (2004). UCS protein Rng3p activates actin filament gliding by fission yeast myosin-II. J Cell Biol, 167(2), 315-325. doi:10.1083/jcb.200404045
Moraczewska, J., & Hitchcock-DeGregori, S. E. (2000). Independent functions for the N- and C-termini in the overlap region of tropomyosin. Biochemistry, 39(23), 6891-6897. 157
Murrell, M., Oakes, P. W., Lenz, M., & Gardel, M. L. (2015). Forcing cells into shape: the mechanics of actomyosin contractility. Nat Rev Mol Cell Biol, 16(8), 486-498. doi:10.1038/nrm4012
Palm, T., Greenfield, N. J., & Hitchcock-DeGregori, S. E. (2003). Tropomyosin ends determine the stability and functionality of overlap and troponin T complexes. Biophys J, 84(5), 3181-3189. doi:10.1016/S0006-3495(03)70042-3
Skau, C. T., & Kovar, D. R. (2010). Fimbrin and tropomyosin competition regulates endocytosis and cytokinesis kinetics in fission yeast. Curr Biol, 20(16), 1415-1422. doi:10.1016/j.cub.2010.06.020
Skoumpla, K., Coulton, A. T., Lehman, W., Geeves, M. A., & Mulvihill, D. P. (2007). Acetylation regulates tropomyosin function in the fission yeast Schizosaccharomyces pombe. J Cell Sci, 120(Pt 9), 1635-1645. doi:10.1242/jcs.001115
Spudich, J. A., & Watt, S. (1971). The regulation of rabbit skeletal muscle contraction. I. Biochemical studies of the interaction of the tropomyosin-troponin complex with actin and the proteolytic fragments of myosin. J Biol Chem, 246(15), 4866-4871.
Stark, B. C., Sladewski, T. E., Pollard, L. W., & Lord, M. (2010). Tropomyosin and myosin-II cellular levels promote actomyosin ring assembly in fission yeast. Mol Biol Cell, 21(6), 989-1000. doi:10.1091/mbc.E09-10-0852
Stehn, J. R., Haass, N. K., Bonello, T., Desouza, M., Kottyan, G., Treutlein, H., . . . Gunning, P. W. (2013). A novel class of anticancer compounds targets the actin cytoskeleton in tumor cells. Cancer Res, 73(16), 5169-5182. doi:10.1158/0008- 5472.CAN-12-4501
Takagi, Y., Yang, Y., Fujiwara, I., Jacobs, D., Cheney, R. E., Sellers, J. R., & Kovacs, M. (2008). Human myosin Vc is a low duty ratio, nonprocessive molecular motor. J Biol Chem, 283(13), 8527-8537. doi:10.1074/jbc.M709150200
Tojkander, S., Gateva, G., Schevzov, G., Hotulainen, P., Naumanen, P., Martin, C., . . . Lappalainen, P. (2011). A molecular pathway for myosin II recruitment to stress fibers. Curr Biol, 21(7), 539-550. doi:10.1016/j.cub.2011.03.007
Toth, J., Kovacs, M., Wang, F., Nyitray, L., & Sellers, J. R. (2005). Myosin V from Drosophila reveals diversity of motor mechanisms within the myosin V family. J Biol Chem, 280(34), 30594-30603. doi:10.1074/jbc.M505209200
VanBuren, P., Palmiter, K. A., & Warshaw, D. M. (1999). Tropomyosin directly modulates actomyosin mechanical performance at the level of a single actin filament. Proc Natl Acad Sci U S A, 96(22), 12488-12493. 158 von der Ecken, J., Muller, M., Lehman, W., Manstein, D. J., Penczek, P. A., & Raunser, S. (2015). Structure of the F-actin-tropomyosin complex. Nature, 519(7541), 114- 117. doi:10.1038/nature14033
Vrhovski, B., Theze, N., & Thiebaud, P. (2008). Structure and evolution of tropomyosin genes. Adv Exp Med Biol, 644, 6-26.
Watanabe, S., Watanabe, T. M., Sato, O., Awata, J., Homma, K., Umeki, N., . . . Ikebe, M. (2008). Human myosin Vc is a low duty ratio nonprocessive motor. J Biol Chem, 283(16), 10581-10592. doi:10.1074/jbc.M707657200
Yamaguchi, H., & Condeelis, J. (2007). Regulation of the actin cytoskeleton in cancer cell migration and invasion. Biochim Biophys Acta, 1773(5), 642-652. doi:10.1016/j.bbamcr.2006.07.001
159
Tables
Table A-1. Myo2 Vmax, Km (µM) (mean ± SD) and catalytic efficiency (Vmax/ Km) reported for all tropomyosin isoforms included in this study. -1 Actin track Myo2 Vmax (S ) Myo2 Km (µM) Catalytic Efficiency Actin- 1.1 ± 0.1 11.2 ± 1.8 0.1
Actin-Cdc8p 2.0 ± 0.1 1.0 ± 0.1 2.0
Actin-Tpm1.6 1.5 ± 0.1 2.4 ± 0.7 0.6
Actin-Tpm1.10 1.3 ± 0.1 2.4 ± 0.4 0.5
Actin-Tpm1.8 2.4 ± 0.1 2.6 ± 0.4 0.9
Actin-Tpm1.12 0.9 ± 0.2 14.2 ± 5.1 0.1
160
Figure A-1. Schematic summary of exon usage by mammalian tropomyosin isoforms from the TPM1 gene included in this study. A panel of four TPM1 gene products were selected based on differences at the N- and C-termini.
161
Figure A-2. Differential regulation of Myo2p actin-activated ATPase activity by non-muscle tropomyosin. Standard Malachite green actin dependent ATPase assays were used to compare the ability of tropomyosin isoforms to regulate Myo2p activity. (A) Comparison of two low-molecular weight tropomyosin isoforms, Tpm1.8 and Tpm1.12. (B) Comparison of two high-molecular weight tropomyosin isoforms, Tpm1.6 and Tpm1.10. Cdc8p and undecorated values were standardized across both graphs. Values from three independent rounds were fit to Michaelis-Menten kinetics with standard deviation reported.
162
Effect on Myo2 C-term N-term 1b 6b 9d Tpm1.8 High actvaton
1b 6b 9c Tpm1.12 No actvaton
1a 2b 6b 9d Tpm1.6 Low actvaton
1a 2b 6b 9c Tpm1.10 Low actvaton
Figure A-3. Relationship between tropomyosin termini and Myo2 regulation. Cartoon of tropomyosin protein N- to C-terminal overlap for isoforms included in this study and summary of effect on Myo2p ATPase activity.
163
Figure 4. Alignment of overlapping N- and C-termini regions from tropomyosin isoforms included in this study. Protein sequence alignments were performed using the Clustal Omega program by EMBL-EBI. Alignment results were used to construct sequence overlap models of the first ten amino acids of the N-termini and the last ten amino acids from the C-termini of tropomyosin isoforms. These models can be used to identify sequence differences between tropomyosin isoforms that may contribute to variable levels of Myo2 enhancement.
164