Regulation of Cardiac Hypertrophy and Metabolism by Regulator of G Protein Signalling 2 (RGS2)

Western University Scholarship@Western

Electronic Thesis and Dissertation Repository

9-1-2017 10:45 AM

Katherine N. Lee The University of Western Ontario

Supervisor Dr. Peter Chidiac The University of Western Ontario Co-Supervisor Dr. Qingping Feng The University of Western Ontario

Graduate Program in Pharmacology and Toxicology A thesis submitted in partial fulfillment of the equirr ements for the degree in Doctor of Philosophy © Katherine N. Lee 2017

Follow this and additional works at: https://ir.lib.uwo.ca/etd

Recommended Citation Lee, Katherine N., "Regulation of Cardiac Hypertrophy and Metabolism by Regulator of G Protein Signalling 2 (RGS2)" (2017). Electronic Thesis and Dissertation Repository. 4929. https://ir.lib.uwo.ca/etd/4929

This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected].

Abstract

Pathological left ventricular hypertrophy is a maladaptive cardiomyocyte growth response to various cardiovascular conditions such as hypertension, and is a major risk factor for heart failure and stroke. The majority of drugs used to treat cardiovascular diseases target G protein coupled receptors (GPCRs), which are regulated by regulator of G protein signalling (RGS) proteins. RGS2 is a GTPase activating protein which limits Gq- and Gs-mediated signalling, which are known to play major roles in the development of pathological cardiac hypertrophy. In addition to its G protein effects, we have previously shown that RGS2 can also inhibit protein synthesis and cultured cardiomyocyte growth via a region in its RGS domain, RGS2eb, which inhibits the rate-limiting eIF2B/eIF2 step of protein synthesis initiation. Thus, we hypothesized that the in vivo expression of RGS2eb could limit the development of experimentally induced hypertrophy. Herein, we demonstrate that the in vivo cardiomyocyte specific overexpression of RGS2eb prevents the development of cardiac hypertrophy in a transverse aortic constriction (TAC) model of experimental pressure overload, as well as functional loss and the expression of “fetal” genes associated with hypertrophy and heart failure. Although we further hypothesized that the expression of RGS2eb in Rgs2-/- mice (which are highly sensitive to hypertrophy and heart failure following pressure overload) could compensate for the loss of endogenous RGS2, we were limited in our characterizations by poor survival rates in Rgs2-/- animals following TAC surgery.

Cardiovascular dysfunction is also known to be directly influenced by obesity and weight gain, which reflects the importance of understanding the mechanisms behind metabolic dysregulation. We have previously demonstrated that Rgs2-/- mice exhibit a lean phenotype on a normal chow diet, but still gain weight on a high fat diet. We thus sought to further characterize the metabolic role of RGS2 via Comprehensive Lab Animal Monitoring System (CLAMS) metabolic cages and gene expression analysis of skeletal rather than adipose tissue. Here we report that loss of RGS2 leads to greater use of carbohydrates and significant increases in basal metabolism, as well as increases in associated metabolism-related genes. Altogether, these studies provide new insights into the role of RGS2 in cardiovascular health and metabolism.

Keywords

Regulator of G protein signalling 2 (RGS2), RGS2eb, G protein-coupled receptors (GPCRs), eukaryotic initiation factor 2 (eIF2), eukaryotic initiation factor 2B (eIF2B), cardiac hypertrophy, CLAMS metabolic cages, metabolism, lean phenotype.

Co-Authorship Statement

Chapter 3: Lee KN, Lu X, Nguyen C, Feng QP, Chidiac P (2017), Cardiomyocyte specific overexpression of regulator of G protein signalling 2 inhibits cardiac hypertrophy and improves function in response to pressure overload in mice. J Mol Cell Cardiol 108: 194-202.

KNL, XL, QPF, and PC designed the experiments. CN generated mouse line, KNL managed all mice colonies. Animal surgeries were conducted by KNL and XL. KNL performed all other experiments and analyzed all data. KNL and PC wrote the manuscript, with revisions and approval from all authors.

Chapter 4: Lee KN, Lu X, Gros R, Xiang FL, Feng XP, Chidiac P (2017), Effects of transverse aortic constriction and drug induced experimental pressure overload hypertrophy on Rgs2-/- mice with cardiomyocyte specific overexpression of RGS2eb. In preparation.

KNL and PC designed the experiments. KNL, XL, and FLX performed TAC surgeries; KNL and RG conducted osmotic pump implantations. KNL performed all other experiments and analyzed all data. KNL and PC wrote the manuscript.

Chapter 5: Lee KN, Gros R, and Chidiac P (2017), Loss of regulator of G protein signalling 2 (RGS2) alters the effects of acute and chronic diet restriction on metabolic outcomes in C57 Bl/6 mice. Submitted to International Journal of Obesity. Manuscript number: 2017IJO01137.

KNL, RG, and PC designed the experiments. KNL and RG conducted CLAMS cage experiments. KNL performed all other experiments and analyzed all data. KNL and PC wrote the manuscript, with revisions and approval from all authors.

iii

Dedication

To my parents and grandparents

Acknowledgments

First, I am incredibly thankful to have had Dr. Peter Chidiac as my doctoral supervisor. The positive research environment that he continuously fosters has given me the opportunity to conduct high quality research, explore my own ideas, and develop as an independent scientist. He has, through his immeasurable patience and sage guidance, instilled within me a core set of technical and intangible skills which I will value for the foreseeable future, and for that I am forever grateful.

I would also like to thank my co-supervisor Dr. Qingping Feng for his guidance and in-depth knowledge of cardiovascular physiology, without which I could not have completed much of my doctoral work. In addition, I am grateful for the generous amount of time that Dr. Sharon Lu dedicated to train me in surgical and lab techniques, as well as for her surgery skills, which were critical for the delicate procedures that were required in our animal models. I am further thankful for the mentorship and experimental help from my advisory committee member Dr. Robert Gros, who was integral to the successful development of many of my projects. I also thank Dr. Thomas Drysdale, my advisory committee chair, who facilitated and contributed invaluable research advice.

I am fortunate to have completed my training within the collegial environment of the Department of Physiology and Pharmacology, and am thankful for the support and advice I have received from various faculty and staff including, among many others, Dr. Frank Beier, Dr. John DiGuglielmo, Murong Liu, Susan McMillan, Dr. Rithwik Ramachandran, Dr. Peter Stathopulos, Chris Webb, and Dr. Lin Zhao.

Many friends and past lab members have also made these years a wonderful experience. From the Feng lab, thank you to Dr. Carmen Leung, Dr. Jessica Blom, Anish Engineer, and Tana Saiyin for your friendship and support both inside and outside of the lab. Thank you also to the past and current members of the Chidiac lab, including Patrick Stockwell, Lylia Nini, and especially Dr. Elva Zhao. Dr. Thomas Velenosi, I value the constant support you have given me.

I would also like to thank the Heart and Stroke Foundation of Ontario, the Canadian Institutes of Health Research and its Institute of Circulatory and Respiratory Health, the Ontario v provincial government, and the Schulich School of Medicine and Dentistry for the financial support of this thesis.

Finally, I would like to thank my family. My grandparents, aunts, and uncles have always supported me, and I am so very grateful for their love. Ultimately, this thesis could not have been possible without my mother and father. My successes stem directly from their unconditional support, their hard work, and the sacrifices they have made for me. I am beyond fortunate to have them as my parents.

Table of Contents

Abstract ...... i

Co-Authorship Statement...... iii

Dedication ...... iv

Acknowledgments...... v

Table of Contents ...... vii

List of Tables ...... xv

List of Figures ...... xvi

List of Appendices ...... xviii

Abbreviations ...... xix

1 INTRODUCTION ...... 1

Regulator of G protein signalling (RGS) proteins ...... 2

Regulator of G protein signalling 2 (RGS2) ...... 3

1.2.1 Expression and regulation of RGS2 ...... 3

1.2.2 RGS2eb regulates mRNA translation ...... 4

Signalling pathways of cardiac hypertrophy...... 7

1.3.1 Physiological hypertrophy is regulated by PI3K-Akt signalling ...... 7

1.3.2 Pathological cardiac hypertrophy is regulated by GPCR signalling ...... 8

1.3.3 Prolonged Gαq/11 signalling leads to maladaptive cardiac hypertrophy ...... 8

1.3.4 Gαs signalling mediates β-adrenergic induced hypertrophy ...... 9

vii

Regulation of protein synthesis in cardiac hypertrophy ...... 10

1.4.1 Overview of protein synthesis ...... 10

1.4.2 Regulation of eIF2Bε ...... 10

RGS proteins in the heart ...... 11

1.5.1 Cardioprotective role of RGS2 ...... 13

Clinical aspects of pathological left ventricular hypertrophy (LVH) ...... 15

1.6.1 General characteristics cardiac hypertrophy ...... 15

1.6.2 General overview of LVH in patient populations ...... 18

1.6.3 LVH increases cardiovascular risk ...... 19

1.6.4 Non-pharmacological interventions ...... 20

1.6.5 Pharmacological treatments ...... 21

Altered RGS2 expression in humans is associated with cardiovascular dysfunction ...... 22

Animal models of cardiac hypertrophy ...... 23

1.8.1 Transverse aortic constriction ...... 23

1.8.2 Osmotic pump infusion ...... 24

Cardiovascular health and obesity ...... 25

Regulation of energy balance by GPCRs ...... 25

Altered G protein signalling in lean and obese phenotypes ...... 27

Skeletal tissue is a major site of energy metabolism via thyroid hormone (TH) regulation ...... 27

viii

TH regulation of metabolism and glucose homeostasis requires deiodinase type 2 (DIO2) for T4-T3 conversion ...... 29

Role for RGS2 in metabolic pathways...... 30

Rgs2-/- mice display a lean phenotype and are hyperphagic ...... 30

Diet-induced models of weight gain and loss ...... 31

1.16.1 High-fat diets ...... 31

1.16.2 Dietary restriction ...... 32

Summary ...... 32

References ...... 33

2 HYPOTHESES AND SPECIFIC AIMS ...... 70

Specific Aim 1 ...... 71

2.1.1 Study 1A: Protective effect of RGS2eb in animal models of cardiac hypertrophy ...... 71

2.1.2 Study 1B: Rescue effect of RGS2eb in RGS2 knockout animals ...... 72

Specific Aim 2 ...... 73

2.2.1 Study 2A: Baseline characterization of the i metabolic phenotype ...... 74

2.2.2 Study 2B: Chronic diet restriction model ...... 74

2.2.3 Study 2C: Acute diet restriction model ...... 75

References ...... 76

3 CARDIOMYOCYTE SPECIFIC OVEREXPRESSION OF A 37 AMINO ACID DOMAIN OF REGULATOR OF G PROTEIN SIGNALLING 2 INHIBITS

CARDIAC HYPERTROPHY AND IMPROVES FUNCTION IN RESPONSE TO PRESSURE OVERLOAD IN MICE ...... 78

Introduction ...... 79

Methods...... 81

3.2.1 Generation of myosin heavy chain promoter (MHC) – RGS2eb transgenic mice ...... 81

3.2.2 Transverse aortic constriction (TAC) ...... 82

3.2.3 Assessment of cardiac function ...... 82

3.2.4 Heart weight/body weight ratios ...... 82

3.2.5 Histological analysis ...... 83

3.2.6 Cardiomyocyte Cell Size and LV wall thickness ...... 83

3.2.7 Immunohistochemistry ...... 83

3.2.8 Dot blotting ...... 84

3.2.9 Quantitative reverse transcriptase qPCR ...... 84

3.2.10 Statistical analysis ...... 85

Results ...... 85

3.3.1 Generation of transgenic mice with cardiomyocyte specific expression of RGS2eb ...... 85

3.3.2 Improved cardiac function in RGS2eb transgenic mice following pressure overload...... 86

3.3.3 Cardiac hypertrophy is inhibited in RGS2eb transgenic mice following pressure overload ...... 87

3.3.4 Expression of cardiac hypertrophy markers is suppressed in RGS2eb transgenic mice ...... 88

Discussion ...... 97

Conclusions ...... 100

References ...... 102

4 EFFECTS OF TRANSVERSE AORTIC CONSTRICTION AND DRUG INDUCED EXPERIMENTAL PRESSURE OVERLOAD HYPERTROPHY ON i MICE WITH CARDIOMYOCYTE SPECIFIC OVEREXPRESSION OF RGS2eb ...... 110

Introduction ...... 111

Methods...... 113

4.2.1 Generation of Rgs2-/- mice with cardiac specific overexpression of RGS2eb ...... 113

4.2.2 Transverse aortic constriction (TAC) ...... 114

4.2.3 Drug treatments ...... 114

4.2.4 Assessment of blood pressure ...... 115

4.2.5 Assessment of cardiac function ...... 115

4.2.6 Tissue collection ...... 116

4.2.7 Quantitative reverse transcriptase qPCR ...... 116

4.2.8 Statistical analysis ...... 116

Results ...... 117

4.3.1 Generation of transgenic mice with cardiomyocyte-specific overexpression of RGS2eb ...... 117

4.3.2 Increased mortality in Rgs2-/- mice following pressure overload ...... 117

4.3.3 28 day angiotensin II treatment at 1.44 mg/kg/day...... 118

4.3.4 Decreased cardiac function in Rgs2-/- mice following 28 days of angiotensin II treatment ...... 119

4.3.5 Expression of fetal genes in LV tissue of 28 day 1.44 mg/kg/day chronic angiotensin II treated mice ...... 119

4.3.6 14 day angiotensin II treatment at 3.0 mg/kg/day...... 131

4.3.7 Effect of twice daily isoproterenol injections ...... 131

Discussion ...... 132

Conclusions ...... 138

References ...... 139

5 LOSS OF REGULATOR OF G PROTEIN SIGNALLING 2 (RGS2) ALTERS THE EFFECTS OF ACUTE AND CHRONIC DIET RESTRICTION ON METABOLIC OUTCOMES IN C57 BL/6 MICE ...... 145

Introduction ...... 146

Methods...... 148

5.2.1 Animals ...... 148

5.2.2 Study design ...... 148

5.2.3 Assessment of indirect calorimetry and activity ...... 148

5.2.4 Ad libitum studies ...... 149

5.2.5 Chronic diet restriction studies ...... 149

5.2.6 Acute diet restriction studies ...... 150

xii

5.2.7 Microarray analysis ...... 150

5.2.8 Quantitative reverse transcriptase qPCR ...... 150

5.2.9 Statistical analysis ...... 151

Results ...... 153

5.3.1 Increased metabolism over time in Rgs2-/- mice on ad libitum diet ...... 153

5.3.2 Chronic caloric restriction unmasks metabolic differences between Rgs2-/- and WT mice ...... 154

5.3.3 Decreased energy conservation in Rgs2-/- mice during and after acute fast ...... 155

5.3.4 Altered expression of metabolic genes in Rgs2-/- mice ...... 166

Discussion ...... 170

Conclusions ...... 173

References ...... 175

6 DISCUSSION AND CONCLUSIONS ...... 181

Summary and Discussion ...... 182

6.1.1 Chapter 3 – Cardiomyocyte specific overexpression of a 37 amino acid domain of RGS2 inhibits cardiac hypertrophy and improves function in response to pressure overload in mice ...... 182

6.1.2 Chapter 4 – Effects of transverse aortic constriction and drug induced experimental pressure overload hypertrophy on Rgs2-/- mice with cardiomyocyte specific overexpression of RGS2eb ...... 183

6.1.3 Chapter 5 – Loss of RGS2 alters the effects of acute and chronic diet restriction on metabolic outcomes in C57 BL.6 mice...... 184

xiii

Future directions ...... 185

Conclusions ...... 187

References ...... 189

APPENDICES ...... 195

Appendix A: Ethics approval ...... 196

Appendix B: Copyright approval ...... 198

Appendix C: Supplementary information ...... 199

Curriculum Vitae ...... 205

xiv

List of Tables

Table 3.1. Hemodynamic parameters in 4 week sham and TAC mice...... 92

Table 4.1. Heart rates for Ang II and saline treated WT, Rgs2+/+(eb) , Rgs2-/-, and Rgs2-/-(eb) mice (beats per minute) ...... 123

Table 5.1. Primers for qPCR of metabolism-related genes ...... 152

Table 5.2. Ambulatory activity and body weights, ad libitum diet ...... 159

Table 5.3. Ambulatory activity and body weights, chronic and fasting diets ...... 160

List of Figures

Figure 1.1. Characteristics of physiological and pathological hypertrophy...... 17

Figure 3.1. Generation of transgenic mice with cardiomyocyte specific expression of RGS2eb ...... 89

Figure 3.2. Dot blot detection of histidine-tagged RGS2eb ...... 90

Figure 3.3. Pressure overload model of cardiac hypertrophy ...... 91

Figure 3.4. Indices of systolic and diastolic function ...... 93

Figure 3.5. Cardiac hypertrophy is reduced in RGS2eb transgenic mice following pressure overload...... 94

Figure 3.6. LV cross sections and cardiomyocytes ...... 95

Figure 3.7. Markers of cardiac hypertrophy ...... 96

Figure 4.1. Breeding schematic for generation of Rgs2-/-(eb) mice ...... 120

Figure 4.2. Survival and cardiac hypertrophy following 28 days TAC in WT and ...... 121

Figure 4.3. Tail-cuff blood pressure measurements for basal, 14 day, and 28 days during saline of Ang II 1.44 mg/kg/day ...... 122

Figure 4.4. Heart weight/tibia length ratios and LV mass, 1.44 mg/kg/day Ang II or saline treatment ...... 124

Figure 4.5. LV internal diameters (LVID) at diastole and systole, 1.44 mg/kg/day Ang II or saline treatment ...... 125

Figure 4.6. Anterior wall (AW) thickness, diastole and systole, 1.44 mg/kg/day Ang II or saline treatment ...... 126

Figure 4.7. Posterior wall thickness (PW), diastole and systole, 1.44 mg/kg/day Ang II or saline treatment ...... 127

xvi

Figure 4.8. LV vol, diastole and systole, 1.44 mg/kg/day Ang II or saline treatment ...... 128

Figure 4.9. Ejection fraction and fractional shortening, 1.44 mg/kg/day Ang II or saline treatment ...... 129

Figure 4.10. Markers of cardiac hypertrophy ...... 130

Figure 4.11. Heart weight/tibia length, LVID, EF, and FS in 3.0 mg/kg/day Ang II or saline treated WT and Rgs2-/- mice ...... 133

Figure 4.12. ISO tests in WT mice, 15 mg/kg s.c. injections ...... 134

Figure 4.13. Lung weight/tibia length and heart weight/tibia length in 14 day saline or 50 mg/kg ISO treated mice ...... 135

Figure 5.1. Ad libitum diet, indirect calorimetry, VO2 and VCO2 ...... 156

Figure 5.2. Ad libitum diet, indirect calorimetry, RER and heat ...... 157

Figure 5.3. Ad libitum diet, food and water intake ...... 158

Figure 5.4. Chronic diet restriction, indirect calorimetry ...... 161

Figure 5.5. Chronic diet restriction ...... 162

Figure 5.6. Acute 16 h fast, indirect calorimetry ...... 163

Figure 5.7. Acute 16 h fast, indirect calorimetry ...... 164

Figure 5.8. 16 h fast, food and water intake...... 165

Figure 5.9. Gene expression, calcium signalling and metabolic markers ...... 167

Figure 5.10. Gene expression, metabolic markers ...... 168

Figure 5.11. GPCR-related gene expression ...... 169

xvii

List of Appendices

Appendix A: Ethics approval...... 196

Appendix B: Copyright approval ...... 198

Appendix C: Supplementary figures ...... 199

xviii

Abbreviations

ACE Angiotensin-converting enzyme Adcy2 and 5 Adenylyl cyclase 2 and 5 Adrb1 and 2 Beta-adrenergic receptor 1 and 2 Ang II Angiotensin II ANP Alpha natriuretic peptide ARB Angiotensin receptor blocker ATP Adenosine triphosphate ATP2A1 SERCA1 ATP5G1 ATP synthase subunit F(0) complex subunit C1 AW;d and AW;s Diastolic and systolic anterior wall thickness β-AR Beta adrenergic receptors β-MHC Beta myosin heavy chain BNP B-type natriuretic peptide BP Blood pressure BWT Body weight cAMP Cyclic adenosine monophosphate CLAMS Comprehensive laboratory animal monitoring system CO Cardiac output CS Citrate synthase DAB 3,3′-diaminobenzidine DAG Diacylglycerol DIO1, 2, 3 Iodothyronine deiodinases type I, II, and III Ea Effective arterial elastance EDP End diastolic pressure EDV End diastolic volume EF Ejection fraction EIF2 Eukaryotic initiation factor 2 EIF2B Eukaryotic initiation factor 2B EIF2Bε Eukaryotic initiation factor 2B epsilon subunit Emax Maximal elastance ESP End systolic pressure ESV End systolic volume FS Fractional shortening GAP GTPase activating protein GDP Guanosine diphosphate GEF Guanine nucleotide exchange factor GLUT4 Facilitated glucose transporter 4/solute carrier 2A4 (SLC2A4) GPCR G protein coupled receptor GSK3 Glycogen synthase kinase 3 GTP Guanosine triphosphate

xix

Gαi/o Gi alpha subunit

Gαq Gq alpha subunit

Gαs Gs alpha subunit

Gi/o Heterotrimeric G protein (Gαi/o + Gβγ)

Gs Heterotrimeric G protein (Gαs + Gβγ)

Gq Heterotrimeric G protein (Gαq+ Gβγ) H&E Hematoxylin & eosin hGH Human growth hormone His Histidine HK2 Hexokinase 2 HR Heart rate HWT Heart weight IP3 Inositol 1,4,5-trisphosphate ISO Isoproterenol Kcal Kilo calories KCl Potassium chloride LCA Left carotid artery LV Left ventricle LVH Left ventricular hypertrophy LVID;d and LVID;s Diastolic and systolic LV internal diameter MmHg Millimeter of mercury M-mode Motion mode mTOR Mammalian target of rapamycin NFAT Nuclear factor of activated T-cells PDK1 3-phosphoinositide-dependent protein kinase 1 PI3K Phosphoinositide-3-kinase PIP2 Phosphatidylinositol 4,5-bisphosphate PKA Protein kinase A PKB Protein kinase Akt PLCβ Phospholipase C-β PW;d and PW;s Diastolic and systolic posterior wall thickness PYGM Glycogen phosphorylase RCA Right carotid artery RER Respiratory exchange ratio RGS Regulator of G protein signalling RGS2 Regulator of G protein signalling 2 RGS2eb EIF2Bε binding domain of RGS2 RYR1 Ryanodine 1 S.C. Subcutaneous S.E.M Standard error of the mean SERCA1A and 2A Sarcoplasmic reticulum Ca2+ ATPase 1A and 2A xx

SLC16A2 Thyroid hormone-specific transporter MCT8 SNP Single nucleotide polymorphism SV Stroke volume SW Stroke work T3 3,5,3'-triiodothyronine T4 3,5,3',5'-tetraiodothyronine (thyroxine) TAC Transverse aortic constriction Tau Relaxation time constant TG Transgenic TH Thyroid hormone THRA Thyroid hormone receptor α TL Tibia length UCP3 Mitochondrial uncoupling protein 3 VCO2 Volume of carbon dioxide production VO2 Volume of oxygen consumption WT Wild-type

xxi

1 INTRODUCTION

Regulator of G protein signalling (RGS) proteins

Agonist binding of G protein coupled receptors (GPCRs) promotes G protein activation, which is achieved by catalyzing GDP–GTP exchange on the Gα subunit; a conformational change in the GTP–bound α subunit is thought to lead to the dissociation of Gα from the stable G-βγ- dimer, thus enabling the regulation of downstream effectors. These signalling events are terminated as a consequence of the intrinsic GTPase activity of the Gα subunit, which hydrolyzes GTP to GDP, resulting in a return to the inactive form of the G protein heterotrimer. The intrinsic GTPase activity of Gα subunits is generally insufficient to explain the observed physiological rates of G protein inactivation (Tang and Insel, 2004), and has been found to be accelerated by GTPase–activating proteins (GAPs) such as regulator of G–protein signalling (RGS) proteins.

RGS proteins are a family of GAPs that bind to G–proteins and inactivate them by increasing the intrinsic rate of GTP hydrolysis. They thus function to limit the intensity and duration of GPCR-initiated signalling, and this is mainly accomplished via a conserved, ~120 amino acid RGS domain that is responsible for their GAP activity (Popov et al., 1997; Ross and Wilkie,

2000). Most RGS proteins act as GAPs towards Gαi –mediated signalling and can be classified into four subfamilies (R4, RZ, R7, and R12) (Berman, Kozasa and Gilman, 1996; Abramow- Newerly et al., 2006; Jayaraman et al., 2009). There are currently no RGS proteins known to inhibit Gαs activity, although RGS2 has been shown to inhibit Gαs pathways in a GAP- independent manner (Salim et al., 2003; Roy, Baragli, et al., 2006). The GAP activity of RGS proteins is sensitive to a variety of factors such as cations and phospholipids (Wang et al., 1997; Tu, Woodson and Ross, 2001; Cladman and Chidiac, 2002; Ishii, Inanobe and Kurachi, 2002); post-translational modifications can also influence RGS intracellular localization as well as interactions with G proteins and other binding partners (Chidiac and Roy, 2003). Although the RGS domain is necessary and sufficient to confer GAP activity (Popov et al., 1997), other domains can also determine cellular localization, increase substrate specificity, and provide additional activities (Snow et al., 1998; Traver et al., 2004; Wang et al., 2005).

Regulator of G protein signalling 2 (RGS2)

RGS2 is part of the B/R4 subfamily of RGS proteins (RGS1-5, RGS8, RGS13, RGS16, RGS18, RGS21) which are relatively small and simple in structure (~20-30 kDa), and contain a conserved RGS domain flanked by short N- and C-terminal domains (Riddle et al., 2005).

While almost all RGS proteins function as GAPs on Gαi/o signalling, RGS2 is unique; it demonstrates a low affinity for Gαi/o, and instead selectively inhibits Gαq and Gαs–mediated signalling via GAP–dependent and GAP–independent mechanisms (Heximer et al., 1997,

1999; Bernstein et al., 2004; Hague et al., 2005; Roy, Baragli, et al., 2006). The Gαq selectivity 106 184 191 of RGS2 is largely due to three Gαq amino acid residues (Cys , Asn , and Glu ) which appear to reduce RGS2 affinity for Gαi by steric hindrance, whereas inhibition of Gαs signalling is due at least in part to direct interactions of RGS2 with adenylate cyclases I, II, and VI via its N-terminal domain. (Salim et al., 2003; Roy, Baragli, et al., 2006). In addition, the N-terminal domain of RGS2 can bind other proteins such as spinophilin, muscarinic receptors, α- adrenergic receptors, TRPV6 calcium channels, and tubulin (Bernstein et al., 2004; Hague et al., 2005; Wang et al., 2005; Heo et al., 2006; Schoeber et al., 2006); we have also demonstrated that RGS2 can inhibit protein synthesis in a GAP-independent manner, which will be addressed in detail further below (Nguyen et al., 2009; Chidiac et al., 2014).

1.2.1 Expression and regulation of RGS2

RGS2 is found ubiquitously, with its mRNA expressed in organs such as the heart, brain, lungs, and kidneys, as well as in cell types including pre-adipocytes, vascular smooth muscle cells, osteoblasts, and chondrocytes (Miles et al., 2000; Huang et al., 2003; Larminie et al., 2004). Various signalling pathways and stimuli can induce Rgs2 gene transcription. In human neuroblastoma cells, carbachol stimulation of muscarinic receptors, which are coupled to the phosphoinositide signal transduction system, results in rapid and lasting increases in Rgs2 mRNA levels (Song, De Sarno and Jope, 1999). Gq agonists such as angiotensin II and 2+ phenylephrine, as well as Gs agonists which increase cAMP levels or intracellular Ca , have also been shown to upregulate Rgs2 gene expression in multiple cell types including vascular smooth muscle cells, neonatal cardiomyocytes, and HEK293 cells lines (Grant et al., 2000; Zou et al., 2006). In addition, conserved cAMP response bindings elements in the RGS2 3

promoter are critical for cAMP-response element binding protein (CREB) binding and RGS2 promoter activation; three single nucleotide polymorphisms (SNPs) have been identified in the human RGS2 promoter CREB binding site in hypertensive patients, with the corresponding point mutations reducing the RGS2 inhibition of forskolin-stimulated adenylyl cyclase activity (Nunn et al., 2010; Xie et al., 2011; Nguyen et al., 2012).

Endogenous RGS2 protein is rapidly degraded via proteasomal mechanisms (Bodenstein, Sunahara and Neubig, 2007; Osei-Owusu et al., 2007). Polymorphisms which enhance RGS2 degradation have been associated with hypertension and cardiovascular dysfunction, and suggest that stabilizing RGS2 protein expression may result in beneficial effects (Bodenstein, Sunahara and Neubig, 2007; Gu, Tirgari and Heximer, 2008; Hahntow et al., 2009; Sjogren et al., 2012). Indeed, more than 30 RGS2 gene polymorphisms have been identified in human hypertensive patients (Yang et al., 2005; Riddle et al., 2006; Semplicini et al., 2006; Zhao et al., 2008); conversely, hypotensive patients with Bartter/Gitelman syndrome have increased RGS2 expression (Calò et al., 2004). In addition, RGS2 deficiency or dysfunction has been linked to anxiety disorders and airway hyper-responsiveness (Xie et al., 2012; Hettema et al., 2013), further highlighting the importance of RGS2 regulation.

1.2.2 RGS2eb regulates mRNA translation

1.2.2.1 Regulation of protein synthesis during translation initiation

The rate of global protein synthesis is controlled primarily at the initiation level, and is divided into multiple stages: (1) GTP-bound eukaryotic initiation factor 2 (eIF2) recognizes and binds initiator tRNA (Met-tRNAMeti), forming the ternary complex eIF2-GTP-Met-tRNAMeti, followed by binding of the complex to the 40S ribosomal subunit; (2) In cap-dependent initiation, the cap structure at the 5’end of mRNA is recognized and bound by eIF4F, which guides the activated 40S subunit to the 5’ end of the mRNA; (3) mRNA-bound 40S travels along the 5’–untranslated end of the mRNA, scanning until it reaches an AUG start codon; (4) Upon start codon detection, the 60S subunit binds to the 40S subunit, initiation factors are released, and the Met-tRNAMeti becomes positioned in the ribosomal P site in preparation for the elongation phase (Jackson, Hellen and Pestova, 2010) .

1.2.2.2 Rate limiting step of translation initiation: eIF2 and eIF2B

Of particular importance in the regulation of initiation is the heterotrimeric initiation factor eIF2 which, when bound to GTP, is active and recruits Met–tRNAMeti to the ribosomal initiation complex. eIF2 is inactivated by the hydrolysis of GTP; in order for reactivation to occur, GDP must first dissociate. This intrinsically slow process is sped up by the heteropentameric protein eIF2B (α – ε) , which acts as a guanine nucleotide exchange factor (GEF) by binding to eIF2, and catalyzing GDP/GTP exchange (Abbott and Proud, 2004). Thus, the rate limiting step of initiation is ultimately eIF2B-facilitated GDP/GTP exchange on eIF2 (Rolfe et al., 2005; Singh et al., 2006; Elsby et al., 2011). This makes the modulation of eIF2B activity an important aspect in the regulation of global protein synthesis. Stimuli that promote cell growth may do so by causing the dephosphorylation and consequent activation of eIF2B (Wek, Jiang and Anthony, 2006; Chidiac et al., 2014). Conversely, phosphorylation of eIF2B, as well as eIF2, inhibits their activity and results in the attenuation of cell growth (Hardt et al., 2004).

1.2.2.3 RGS2eb binds to eIF2B and inhibits protein translation

While the G-protein dependent effects of RGS2 are well established, studies have also shown that RGS2 can bind and regulate other targets (Wang et al., 2005; Heo et al., 2006; Schoeber et al., 2006; Zhang and Mende, 2011). Our lab has previously discovered a novel binding partner for RGS2. We have shown that RGS2 can bind to the ε subunit of eIF2B, resulting in the inhibition of mRNA translation (Nguyen et al., 2009). By binding to eIF2Bε, RGS2 inhibits its ability to facilitate GDP dissociation on eIF2, which ultimately leads to the attenuation of de novo protein synthesis. This novel, G-protein independent property of RGS2 has been mapped to a 37 amino acid domain (residues 79-115) that is homologous to a region in the β subunit of eIF2 that binds to eIF2Bε, suggesting that RGS2 may inhibit initiation by competing or otherwise interfering with binding between eIF2 and eIF2B.

We have shown that the eIF2Bε binding domain, RGS2eb, to be both necessary and sufficient for the inhibition of protein synthesis by RGS2; a corresponding 37-oligomer peptide based on this region also dose-dependently decreased in vitro mRNA translation (Nguyen et al., 2009).

In addition, the cellular expression via adenoviral infection of RGS2eb or full-length RGS2 decreased levels of protein synthesis to a comparable extent (Nguyen et al., 2009). Furthermore, the rate of protein synthesis was increased in cells from RGS2 knockout animals, which suggests that the effect of RGS2 on protein synthesis is physiologically relevant (Nguyen et al., 2009). Thus, RGS2, and more specifically its eIF2Bε binding domain, appears to be an important regulator of mRNA translation.

This novel mechanism of eIF2B inhibition adds to a group of studies which demonstrate that inhibition of eIF2B leads to decreased protein synthesis. Glycogen synthase kinase 3 (GSK3) can directly phosphorylate eIF2Bε at serine 540 in intact cells, which inhibits eIF2B GEF activity by up to 80% (Welsh et al., 1998). It has also been shown that the effects of eIF2B on eIF2 can be decreased by the binding of eIF2 to eIF5. The primary function of eIF5 is to promote GTP hydrolysis by eIF2; when present at elevated levels, eIF5 may act to sequester eIF2 from eIF2B, thereby impeding protein synthesis (Singh et al., 2006). Other groups have successfully used eIF2Bε siRNA (Deng et al., 2008) in vitro, as well as adeno-associated viruses (AAVs) in vivo to specifically inhibit eIF2Bε (Guo et al., 2016; Merentie et al., 2016). However, cardiac specific overexpression of full-length RGS2 (which contains the RGS2eb domain) does not appear to confer protective effects against hypertrophy in a pressure overload model (Park-Windhol et al., 2012). As previously mentioned, RGS2 possesses multiple properties not known to be shared by either RGS4 or RGS5, although the latter two are also able to inhibit cardiac hypertrophy when overexpressed (Heximer et al., 1999; Chidiac and Roy, 2003; Roy, Nunn, et al., 2006; Tokudome et al., 2008; Endale et al., 2010; Li et al., 2010; Sethakorn, Yau and Dulin, 2010; Chidiac et al., 2014). Since our studies suggest that the RGS2eb region specifically, and exclusively, inhibits eIF2/eIF2B interactions (and thus protein synthesis) (Nguyen et al., 2009), it is possible that the other properties of RGS2 may have confounded or attributed to the limited cardioprotection that was observed by groups expressing full-length RGS2. Thus in the context of cardiovascular health, the protein synthesis inhibitory effects of RGS2eb could be a major contributor to the reported beneficial effects of RGS2.

Signalling pathways of cardiac hypertrophy

1.3.1 Physiological hypertrophy is regulated by PI3K-Akt signalling

Physiological and pathological hypertrophies differ not only in terms of phenotype, but can be distinguished by the different signalling cascades that drive them. Exercise or developmentally-induced growth is primarily mediated by growth hormones, and a critical pathway for physiological hypertrophy is the phosphoinositide 3-kinase (PI3K)–Akt pathway (Hunter and Chien, 1999; McMullen and Jennings, 2007). When IGF-1, insulin, and other growth factors bind to their membrane tyrosine receptor kinases, the PI3K isoform p110α is activated, and phosphorylates membrane phosphatidylinositols at the 3' position of the inositol ring (Dorn and Force, 2005). This phosphorylation results in the recruitment of the protein kinase Akt (also known as PKB) and its activator 3-phosphoinositide-dependent protein kinase-1 (PDK1). Activation of Akt by PDK1 leads to the activation of mammalian target of rapamycin (mTOR), which is a central regulator of protein synthesis via its ability to activate translational machinery and ribosome biogenesis (Dorn and Force, 2005). In addition, Akt can phosphorylate and inhibit the activity of glycogen synthase kinase-3 (GSK-3), a constitutively active negative regulator of cardiac hypertrophy (Haq et al., 2000; Hardt and Sadoshima, 2004; Kerkelä, Woulfe and Force, 2007).

Several studies have demonstrated the importance of PI3K-p110α/PDK1/Akt signalling for adaptive cardiac hypertrophy. Transgenic mice constitutively overexpressing the p110α isoform of PI3K exhibited exercise-induced hypertrophy that did not transition into pathological growth (Shioi et al., 2000). Furthermore, cardiac expression of a mutant dominant-negative p110α prevented exercise-induced growth, but maladaptive hypertrophy still occurred in response to pressure overload (McMullen et al., 2003). Together, these studies demonstrate the critical role that PI3K-p110α/PDK1/Akt signalling plays in the regulation of physiological hypertrophy.

1.3.2 Pathological cardiac hypertrophy is regulated by GPCR signalling

While adaptive hypertrophy is mediated by receptor tyrosine signalling, the critical pathways for maladaptive growth are initiated by G-protein coupled receptors (Dorn and Force, 2005; Heineke and Molkentin, 2006; Hendriks-Balk et al., 2008). GPCRs are seven transmembrane domain proteins involved in signal transmission. With more than 800 members, they represent the largest and most diverse family of cell surface receptors existing in the mammalian genome (Oldham and Hamm, 2008); cardiovascular cells alone possess greater than 100 different GPCRs (Tang and Insel, 2004). GPCRs play a critical role in linking messages from extracellular ligands to signalling pathways within the cell. With a wide variety of activating ligands and with their localization at the cell membrane, GPCRs represent the largest class of drug targets – more than one-third of current drugs on the market act by binding to GPCRs (Ma and Zemmel, 2002; Wise, Gearing and Rees, 2002; Dror et al., 2011).

Isoforms of the Gα subunit result in four heterotrimeric G protein families: Gαs, Gαi/o, Gαq/11, and Gα12. While both Gq/11 and Gs signalling can result in cardiomyocyte growth, Gq in particular has been widely shown to play a crucial role in the development of pathological hypertrophy (D’Angelo et al., 1997; Mende et al., 1998; Bernardo et al., 2010).

1.3.3 Prolonged Gαq/11 signalling leads to maladaptive cardiac hypertrophy

Heterotrimeric Gq and the functionally similar G11 transduce signals from hypertrophic receptors for angiotensin, endothelin, norepinephrine, and other neurohormones (Rockman,

Koch and Lefkowitz, 2002). When activated, the Gαq/11 subunit recruits phospholipase C beta (PLCβ) to the cell membrane, where it hydrolyzes phosphatidylinositol 4,5-bisphosphate

(PIP2), resulting in the release of inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG).

IP3 can then bind to receptors in the sarcoplasmic reticulum (SR), causing calcium release into the cytosol. At this point, two pathways can contribute to a hypertrophic response. Calcium release along with DAG can activate protein kinase C (PKC), which leads to the subsequent inhibition of GSK-3. It can also affect MAP kinase (MAPK) signalling through proteins such

as ERK1/2, JNK and p38 (Frey and Olson, 2003). Alternatively, Ca2+ release can cause the messenger protein calmodulin to activate calcineurin, which dephosphorylates the transcription factor NFAT. Subsequently, NFAT can translocate to the nucleus, and activate the transcription of hypertrophic response genes (Dorn and Force, 2005).

The importance of Gαq/11 signalling in the maladaptive hypertrophic response has been demonstrated in several studies. Transgenic mice with cardiac-specific transgenic overexpression of Gαq/11 –linked receptors demonstrate severe cardiac hypertrophy and dysfunction, upregulation of the “fetal” gene response, and premature death (D’Angelo et al.,

1997; Mende et al., 1998). Conversely, mice overexpressing a dominant-negative Gαq/11 peptide or which lacked Gαq/11 were resistant to hypertrophy following pressure overload, but still exhibited exercise-induced physiological cardiac growth (Akhter et al., 1997;

Wettschureck et al., 2001). Altogether, these studies indicate that Gq/11 signalling is sufficient for pathophysiological hypertrophy to occur.

In addition to PLCβ-mediated hypertrophy, Gαq/11 signalling can also act through the PI3K-

Akt pathway that is normally associated with physiological growth. Gαq/11 stimulated PI3K differs from physiological PI3K in that the activated isoform is changed from p110γ to p110α. However, since both types of PI3K can go on to activate Akt and its downstream mTOR and GSK-3 pathways, it is not well understood how these events can result in different forms of hypertrophy (Dorn and Force, 2005).

1.3.4 Gαs signalling mediates β-adrenergic induced hypertrophy

Although Gαq/11 signalling is the major mediator of maladaptive hypertrophy, Gαs also plays a significant role in cardiomyocyte growth. In the heart, Gαs proteins are mainly coupled to β1- adrenergic receptors. Upon agonist binding (e.g. isoproterenol), the Gα subunit activates adenylyl cyclase (AC), which in turn catalyzes the conversion of ATP into the second messenger cAMP (Dorn and Force, 2005). Increased concentrations of cAMP can then activate protein kinase A (PKA) which, among other functions, inhibits GSK-3 and causes an increase in protein synthesis. Overexpression of β1-receptors in the hearts of transgenic mice has been shown to initially increase contractile function and responsiveness to isoproterenol, which can

initially be seen as beneficial during early heart failure (Bisognano et al., 2000; Engelhardt et al., 2002). However, chronic stimulation of these receptors results in progressive deterioration of cardiac function, as well as increased hypertrophy and fibrosis (Bisognano et al., 2000;

Engelhardt et al., 2002; Bernardo et al., 2010). Thus in addition to Gq signalling, Gs –mediated cell growth and heart function also contributes to the maladaptive hypertrophic response.

Regulation of protein synthesis in cardiac hypertrophy

1.4.1 Overview of protein synthesis

In order for either adaptive or maladaptive cardiac hypertrophy to occur, individual cardiomyocytes must increase in size, and such growth requires increased global protein synthesis. Thus, regardless of the initial stimuli and receptors involved, hypertrophic signals will ultimately result in increased mRNA translation/protein synthesis.

Protein synthesis consists of three main stages: initiation, elongation, and termination. During eukaryotic initiation, an initiator methionyl tRNA forms a complex with a 40S ribosomal subunit, and is then positioned at the start codon of an mRNA molecule (Jackson, Hellen and Pestova, 2010). Binding of the 60S ribosomal subunit allows for elongation to occur, during which amino acids are sequentially added to a growing polypeptide chain via specific tRNA molecules. When a stop codon is reached, protein synthesis is terminated by the release of the newly formed peptide chain and separation of the ribosomal-mRNA complex (Proud, 2007).

1.4.2 Regulation of eIF2Bε

As previously mentioned, regeneration of GTP-bound eIF2 requires eIF2B, and specifically the ε subunit, which contains the catalytic domain towards its C-terminus (Welsh and Proud, 1993; Wang et al., 2001; Gomez, Mohammad and Pavitt, 2002). eIF2B can be activated by multiple stimuli that increase mRNA translation, including insulin and growth factors (Welsh and Proud, 1992; Welsh et al., 1996; Kleijn et al., 1998). Overexpression of eIF2Bε has also been shown to enhance growth in neonatal cardiomyocytes (Hardt et al., 2004). The

importance of eIF2B regulation can be seen by the convergence of hypertrophic signals on constitutively active glycogen synthase kinase 3. GSK-3, and more specifically its β isoform (GSK-3β), has been shown to be the predominant kinase for mediating eIF2B phosphorylation (Hardt and Sadoshima, 2002; Hardt et al., 2004). Under resting conditions, GSK-3β phosphorylates the catalytic ε subunit of eIF2B at a highly conserved serine (Ser540), resulting in the inhibition of eIF2B activity (Hardt et al., 2004). In addition to Ser540, the epsilon subunit of eIF2B has several other regulatory phosphorylation sites (Wang et al., 2001; Proud, 2007), which suggests that its regulation, and consequently that of eIF2, is critical in the control of global protein synthesis.

Hypertrophic signals can promote the phosphorylation and deactivation of GSK-3β. As previously discussed, several pathways in both adaptive (e.g. IGF1-PI3K-Akt) and maladaptive cardiac hypertrophy (e.g. Gq and Gs-mediated) can result in the inhibition of GSK- 3β. Studies using β-receptor agonists have shown that inhibition of GSK-3β results in greater eIF2B activity and marked increases in cell size and protein synthesis; conversely, overexpression of GSK-3β decreases levels of eIF2B activity (Hardt et al., 2004). In addition,

GSK-3β has been found to block hypertrophy in response to the Gq-agonists endothelin and phenylephrine (Dorn and Force, 2005). Together, these studies not only suggest that GSK-3β is the predominant kinase in eIF2Bε regulation, but demonstrate that regardless of the initial stimuli, eIF2Bε is required for hypertrophy to occur. Thus, targeting eIF2B for inhibition could prevent or decrease the levels of protein synthesis associated with pathological cardiac hypertrophy.

RGS proteins in the heart

Several RGS proteins are expressed in mammalian hearts and have been detected in both cardiomyocytes and fibroblasts (Kardestuncer et al., 1998; Doupnik, Xu and Shinaman, 2001; Riddle et al., 2005; Zhang and Mende, 2011). In failing human hearts, variable expression results have been obtained, although the expression profiles of RGS2, RGS3, and RGS4 are noticeably altered (Riddle et al., 2005). Some groups have found RGS4 mRNA to be increased

but not RGS2 or RGS3 (Mittmann et al., 2002), whereas others have shown an apparent upregulation of RGS3 and RGS4 mRNA (Owen et al., 2001); other groups have identified decreases in RGS2 protein levels (Takeishi et al., 2000). Overall, it appears that RGS2 is normally highly expressed in the ventricles, whereas RGS4, RGS5, and RGS10 are mainly localized to the atria (Doupnik, Xu and Shinaman, 2001; Mittmann et al., 2002; Larminie et al., 2004; Gu et al., 2009; Miao et al., 2016), suggesting that targeting RGS2 is physiologically relevant.

Animal overexpression and knockout models have demonstrated the cardiovascular roles of various RGS proteins. Gene expression studies have found RGS2, RGS3, and RGS5 to be the most highly expressed RGS proteins in the myocardium, (Larminie et al., 2004), and RGS4 and RGS6 to be concentrated in the sinoatrial node (Grillet et al., 2005; Cifelli et al., 2008, Yang et al., 2010). A cardiac mouse model with transgenic overexpression of RGS4 transiently decreased cardiac hypertrophy and heart failure in Gαq– overexpressing mouse hearts (Rogers et al., 2001), although it should be noted that endogenous levels of RGS4 are virtually absent in the ventricular myocardium (Grillet et al., 2005; Cifelli et al., 2008). An overexpression model of RGS5 was protected against pressure overload-induced experimental cardiac hypertrophy and fibrosis, whereas marked cardiac hypertrophy, fibrosis, and dysfunction occurred in RGS5 knockout mice (Li et al., 2010). Recently, RGS10 was found to be downregulated in failing mouse hearts; similarly to RGS5, cardiac-specific overexpression led to decreased cardiac hypertrophy and fibrosis following experimentally induce pressure overload (Miao et al., 2016).

RGS proteins also play an essential role in regulating heart rate. Knock-in mice expressing a

RGS–resistant form of Gαi2 displayed enhanced carbachol–induced bradycardia (Fu et al., 2006, 2007). RGS4 and RGS6 knockout models also suggest key roles in regulating parasympathetic heart rate control, as their loss resulted in severe bradycardia in response to in vivo parasympathetic stimulation (Cifelli et al., 2008; Posokhova et al., 2010; Yang et al., 2010). RGS2 in particular has been shown to play a significant role in cardiovascular function.

1.5.1 Cardioprotective role of RGS2

Because of the critical roles that Gαq and Gαs signalling play in the induction of pathological hypertrophy, the inhibitory effects of RGS2 on these signals makes it a potential target in the study of cardiovascular disease (Heineke and Molkentin, 2006; Hendriks-Balk et al., 2008). In addition to the heart, RGS2 is expressed in the brain, vasculature and kidneys (Kehrl and Sinnarajah, 2002) . Along with RGS1, 4, and 5, RGS2 is detectable at both the mRNA or protein level in endothelial or vascular smooth muscles cells of the arterial system (Bondjers et al., 2003; Heximer et al., 2003; Wang et al., 2008; Timofeeva et al., 2009). Rgs2-/- mice have been reported to exhibit elevated blood pressures (Heximer et al., 2003), and Gq - mediated smooth muscle contraction is enhanced in several regions of the vasculature (e.g. mesenteric and renal arteries) (Hercule et al., 2007; Osei-Owusu et al., 2007; Osei-Owusu and Blumer, 2015). Interestingly, although global deletion of RGS2 has been observed to induce hypertension, vascular smooth muscle or endothelium-specific deletion of RGS2 does not appear to increase blood pressure (Osei-Owusu et al., 2012). However, transplanting Rgs2-/- kidneys into wild type recipient mice is sufficient to induce hypertension, with the reverse transplantation (i.e. WT kidneys transplanted in Rgs2-/- mice) “rescuing” Rgs2-/- animals from an observed hypertensive phenotype (Gurley et al., 2010), suggesting that renal RGS2 is important in maintaining normal levels of blood pressure.

RGS2 appears to be necessary for the antihypertrophic and vasodilatory effects of cGMP and nitric oxide (Sun et al., 2005; Takimoto et al., 2009). Studies in cultured cardiomyocytes have shown that hypertrophy caused by prolonged Gαq–coupled receptor stimulation, such as that induced by phenylephrine (PE), can be blocked by the overexpression of RGS2 (Hao et al., 2006; Zou et al., 2006). Moreover, RGS2 negatively regulates angiotensin II-induced signalling in cardiac fibroblasts (Zhang et al., 2011). RNAi–mediated knockdown of RGS2 also leads to increased endothelin and phenylephrine–induced cardiomyocyte hypertrophy (Zhang et al., 2006, Nunn et al., 2010, Zou et al., 2006). A similar effect has been seen against

Gαs mediated cardiomyocyte hypertrophy induced by isoproterenol (ISO) (Nunn et al., 2010).

The cardiovascular role of RGS2 has been further demonstrated in knockout animal studies. Under normal conditions, the absence of RGS2 appears to have minimal effects on cardiac 13

function, although studies have shown Rgs2-/- or Rgs2+/- mice to be hypertensive (Heximer et al., 2003; Tang et al., 2003). However, experimentally induced pressure overload causes marked hypertrophy, heart failure, and death, as well as increased expression of cardiac fetal genes in RGS2 knockout mice (Takimoto et al., 2009). In addition, Rgs2-/- mice have been shown to have increased susceptibility to atrial fibrillation (AF) via enhanced M3 muscarinic receptor activity, which is known to be involved in vagally induced atrial fibrillation (Tuomi, Chidiac and Jones, 2010; Jones, Tuomi and Chidiac, 2012).

Endogenous RGS2 protein is rapidly degraded via proteasomal mechanisms (Bodenstein, Sunahara and Neubig, 2007), and low RGS2 protein levels have been associated with cardiovascular dysfunction and hypertension in human patients (Heximer et al., 2003; Tsang et al., 2010); RGS2 is also selectively downregulated in pressure overload mouse models of cardiac hypertrophy and heart failure (Zhang et al., 2006), notwithstanding its acute upregulation in cardiomyocytes in response to hypertrophy-inducing Gq and Gs-coupled receptor stimulating agonists (Zou et al., 2006; Nunn et al., 2010) These observations suggest that overexpressing, or stabilizing RGS2 protein expression may result in cardioprotective effects. Digoxin and other cardiotonic steroids, which are used to treat atrial fibrillation and heart failure (Gheorghiade, Adams and Colucci, 2004), have been shown to act as selective stabilizers of RGS2 in vitro (Sjogren et al., 2012). Digoxin has also been shown to be cardioprotective in a drug–induced model of cardiac hypertrophy and injury, an effect which was lost in similarly treated RGS2 knockout mice (Sjögren et al., 2016).

Surprisingly, cardiac specific overexpression of full-length RGS2 does not appear to offer substantial cardioprotection against either hypertrophy or dysfunction in a pressure overload mouse model (Park-Windhol et al., 2012). RGS2 possesses multiple properties not known to be shared by either RGS4 or RGS5 (Chidiac et al., 2014), including low affinity for Gαi/o

(Heximer et al., 1999), ability to inhibit Gs-stimulated adenylyl cyclase signalling (Roy, Baragli, et al., 2006), nuclear localization (Chidiac and Roy, 2003), and the apparent ability to promote apoptosis (Endale et al., 2010). In addition, although RGS2 is selectively upregulated in cultured cardiomyocytes following Gαq or Gαs stimulation (Hao et al., 2006; Zou et al., 2006; Nunn et al., 2010), it is progressively downregulated in in vivo models of hypertrophy and

heart failure (Zhang et al., 2006). Since complete ablation of RGS2 signalling is unambiguously detrimental (Takimoto et al., 2009), it follows that optimal RGS2 levels under pathological conditions may be lower than those needed under basal conditions.

Our lab has also shown that expression of either full-length RGS2 or RGS2eb can both block increases in cardiomyocyte size induced by phenylephrine (PE) or isoproterenol (ISO) (Zou et al., 2006; Chidiac et al., 2014). In addition, the reactivation of “fetal” genes such as ANP and β-MHC, which are indicators of pathological hypertrophic growth, were suppressed in cardiomyocytes expressing RGS2eb (Chidiac et al., 2014). An important distinction between full length RGS2 and RGS2eb is that while the latter prevents hypertrophy, it does not have

GAP activity for Gαq, and also seems to have no inhibitory effect on ISO-induced Gαs signalling (Nguyen et al., 2009; Chidiac et al., 2014). This indicates that in addition to the established role of the RGS2 GAP domain as an inhibitor of G-protein and GPCR signalling, the RGS2eb region further regulates G-protein induced hypertrophy through its binding to eIF2Bε, which leads to the direct, G-protein independent inhibition of protein synthesis.

Clinical aspects of pathological left ventricular hypertrophy (LVH)

1.6.1 General characteristics cardiac hypertrophy

During fetal development, mammalian cardiomyocytes rapidly proliferate; this growth ceases during the perinatal period, and the heart is thus generally regarded as a post-mitotic organ, with further increases in heart mass thought to be mainly achieved through increases in cell size, i.e. hypertrophy (Ahuja, Sdek and MacLellan, 2007; Shimizu and Minamino, 2016). In the adult heart, various intrinsic and extrinsic stimuli can increase biomechanical stress and lead to a thickening of ventricular heart walls. Depending on the stimuli, either physiological or pathological hypertrophy can occur (Fig. 1.1). Physiological cardiac hypertrophy mainly develops in response to growth of the body (e.g. childhood growth) or chronic exercise

training, whereas pathological cardiac hypertrophy occurs in a disease setting (Levy et al., 1990).

Physiological and pathological hypertrophy can be further subclassified as either concentric or eccentric hypertrophy (McMullen and Jennings, 2007). During concentric hypertrophy, which is induced by pressure overload on the heart, sarcomeres in cardiomyocytes are added in parallel, leading to an increase in myocyte cell width and a subsequent increase in heart wall thickness; this results in hearts with thick walls and relatively small ventricular cavities (Grossman, Jones and McLaurin, 1975; Bernardo et al., 2010). In a physiological context, concentric hypertrophy develops following isometric or static exercise such as weight lifting, which involves developing muscular tension against resistance with little movement (Pluim et al., 2000; McMullen and Jennings, 2007). Pathological stimuli such as hypertension or aortic stenosis similarly cause pressure overload on the heart and the development of concentric hypertrophy (Frey and Olson, 2003). In contrast, eccentric hypertrophy results in sarcomeres being added in series to increase myocyte cell length, leading to relatively thinner walls and larger ventricular cavities (Bernardo et al., 2010). Isotonic exercise, such as running and swimming, involves the movement of large muscle groups; vasodilation of the skeletal vasculature produces eccentric hypertrophy due to increased venous return to the heart, which results in volume overload (Zak, 1984; McMullen and Jennings, 2007). Pathological stimuli such as aortic regurgitation and arteriovenous fistulas can increase diastolic wall stress, and also result in eccentric hypertrophy (Grossman, Jones and McLaurin, 1975; Pluim et al., 2000).

While both physiological and pathological hypertrophies are characterized by an increase in cardiomyocyte size due to increased global protein synthesis, the two conditions differ in multiple aspects. In physiological hypertrophy, cardiomyocytes increase in size but display a normal phenotype, and this is associated with normal cardiac function (Shimizu and Minamino, 2016). Fatty acid oxidation is the main metabolic pathway for ATP production, with the heart capable of switching to glucose and lactate metabolism depending on workload (van der Vusse et al., 1992). In contrast, pathological hypertrophy results in a switch to increased glucose metabolism and structural changes such as increased fibrosis, as well as functional abnormalities (Conrad et al., 1995; Bernardo et al., 2010). Pathological hypertrophy

Figure 1.1. Characteristics of physiological and pathological hypertrophy.

is also characterized by a return to the “fetal” gene program, which includes increased expression of atrial natriuretic peptide (ANP), B-type natriuretic peptide (BNP) and α-skeletal actin, as well as alterations in the cardiac contractile proteins α-and β-myosin heavy chain (Hannan et al., 2003; Bernardo et al., 2010; Taegtmeyer, Sen and Vela, 2010; Kuwahara, Nishikimi and Nakao, 2012). Maladaptive hypertrophy can drastically affect cardiovascular health. Aside from age, left ventricular hypertrophy is the most potent predictor of poor cardiovascular outcomes in hypertensive patients, and is an independent risk factor for sudden death, stroke, coronary heart disease, and heart failure (Levy et al., 1990; Cipriano et al., 2001; Gardin et al., 2001; Verdecchia, Carini, et al., 2001; Verdecchia, Porcellati, et al., 2001; Gradman and Alfayoumi, 2006). With cardiovascular disease as the leading cause of mortality in many nations (Schou et al., 2013), identifying regulators of pathological hypertrophy is of great interest and importance.

1.6.2 General overview of LVH in patient populations

Since the left ventricle is responsible for pumping oxygenated blood throughout the body, the majority of ventricular hypertrophy in a disease setting develops in the left myocardium. Most LVH develops in early response to chronic hypertension; patients with transient elevations in blood pressure, such as during mental stress or exercise, are also prone to hypertrophy (Daniels, Meyer and Loggie, 1990; Schnall et al., 1990). Although hypertension is the leading cause of LVH, factors other than blood pressure can also be important in the development of hypertrophy, including angiotensin II and catecholamine levels, body mass or obesity, genetic background, age of onset of high blood pressure, and insulin sensitivity (Simpson, 1983; Levy et al., 1988; Sasson et al., 1993; Schunkert et al., 1994; Ichikawa et al., 1996; Re, 2003). In addition, genetics may play a role in the development of LVH; mutations in genes encoding sarcomeric proteins have been shown to directly correlate with hypertrophic cardiomyopathy (Maron, 2002), and some patients with mild hypertension appear genetically predisposed to LVH development (Liebson et al., 1993; Martinez et al., 2003).

The test of choice for accurate estimation of patient LV heart mass comes from 2D echocardiography (Lorell and Carabello, 2000); although cardiac MRI is the gold standard test for LVH due to its accuracy and reproducibility, it is cost prohibitive for regular clinical use 18

(Bottini et al., 1995; Bauml and Underwood, 2010). In hypertensive patients, LVH usually presents as an increase in wall thickness, which may are may not be accompanied by an increase in the size of the LV cavity (Douglas and Kaplan, 2017). Interestingly, patients without an increase in absolute LV mass but with an increase in their wall thickness–to–cavity diameter ratio (concentric remodelling) have the same adverse risk for cardiovascular disease and death as patients who develop concentric hypertrophy (increase in both mass and wall thickness–to–cavity diameter ratio) (van Hoeven and Factor, 1990; Jain et al., 1996). While hypertension induces pressure overload on the heart, concurrent volume overload due to coronary artery disease or valvular conditions can further increase LVH and reduce cardiac function (Zabalgoitia et al., 2001).

1.6.3 LVH increases cardiovascular risk

Diagnosed left ventricular hypertrophy comes with an increased risk of multiple cardiac events including angina and myocardial infarction (MI), arrhythmias, stroke, heart failure, and death (Levy et al. 1990; Koren et al. 1991; Verdecchia, Porcellati, et al. 2001; Haider et al. 1998; Drazner et al. 2004; D Levy et al. 1989). Increases in cardiovascular risk have been found to be directly related to the degree of increase in LV mass; this effect is also independent from that of blood pressure (Levy et al. 1990; Koren et al. 1991). In a study of ~1000 patients over 50 years of age with primary hypertension and no previous cardiovascular events, LVH was associated with a 40% increased risk for a major cardiovascular event (e.g. MI, severe heart failure, severe kidney failure) even after adjustment for other risk factors (Verdecchia, Carini, et al., 2001). In the Framingham Heart Study, which originally followed more than 5000 men and women between the ages of 30 and 62 who had not yet developed overt symptoms of cardiovascular disease, a subset population of ~3000 individuals over the age of 44 were found to have a 22% prevalence of LVH; even after adjusting for other risk factors, these patients were found to be twice as likely to suffer from sudden death (Haider et al., 1998).

LVH can cause electrophysiological alterations such as altered repolarization of the heart, non- uniform action potential prolongation, and early afterpotentials; this can lead to an increased risk of atrial fibrillation, ventricular tachycardia, arrhythmias, and even sudden death (Gardin et al., 2001; Okin et al., 2006; Sarganas et al., 2014). Increases in cardiac risk associated with 19

LVH may also arise in part due to myocardial ischemia, which can be induced by multiple factors (Douglas and Kaplan, 2017). Enlarged cardiomyocytes, and thus increased muscle mass, can limit the ability of coronary arteries to properly dilate in response to vasodilatory stress (e.g. during exercise) or decreased perfusion (e.g. during an arrhythmic event); endocardial capillaries may also be directly compressed (Beache et al., 2001). These factors can result in adverse clinical implications as well as decreases in coronary flow reserve (the ratio between resting and maximal coronary artery blood flow), an important indicator of cardiovascular risk (Douglas and Kaplan, 2017). In patients with LVH, coronary occlusion events are associated with greater degrees of myocardial infarction and increased mortality rates (Carluccio et al., 2000). In cases of sudden cardiac death, patients with LVH and hypertension tend to have less extensive coronary artery disease than normotensive cases of sudden death, suggesting that hypertrophied myocardium may be more susceptible to the effects of ischemia (Burke et al., 1996). Progressive LVH results in deleterious ventricular remodelling as well as depressed systolic and diastolic ventricular functions (Norton et al., 2002). If improperly treated, LVH may ultimately lead to the development of irreversible heart failure, and is one of the greatest independent risk factors for this condition (Cipriano et al., 2001).

1.6.4 Non-pharmacological interventions

Strategies to manage hypertension and co-morbidities such as obesity can contribute to lowering LV mass by reducing pressure overload on the heart. A high prevalence of hypertension in obese patients (>60%) accounts for more than 60% of incident hypertension (a systolic/diastolic blood pressure greater than 140/90 mmHg) in women and almost 80% of incident hypertension in men. Regression of LVH in patients with primary hypertension has been shown to occur with weight loss and exercise. Sympathetic signalling mechanisms play a well-established role in the development of hypertrophy, and weight loss in obese patients has been reported to reduce indices of sympathetic activity (e.g. plasma and urinary norepinephrine excretion, resting heart rate) (Ostman-Smith, 1981; Reisin et al., 1983; Sen, 1983). Weight reduction also decreases plasma aldosterone levels and renin activity, components of the renin-angiotensin II system which have been implicated in the development

of hypertension and LVH (Iwai, Shimoike and Kinoshita, 1995; Lambert et al., 2014; Seravalle et al., 2014). In patients with hypertension and measurable LVH, calorie restriction-induced weight loss alone can decrease left ventricular mass by up to 20% (MacMahon, Wilcken and Macdonald, 1986). Thus, managing patient weight through diet and exercise can help limit the development of LVH. In addition to weight loss, sodium restriction can inhibit LVH progression. Obese patients often have hyperinsulinemia (excess levels of circulating insulin) leading to increased sodium reabsorption through the renal tubules, which can exacerbate already elevated blood pressures (Jula and Karanko, 1994; Kim et al., 2015). Recommended daily amounts of sodium range between 1000 – 1500 mg; average Canadians consume around ~3400mg of sodium daily, with many eating well in excess of 5000 mg per day (Government of Canada, 2013). Dietary sodium restriction (<1600 mg/day) has been shown to reduce LVH through decreases to blood pressure and body fluid retention in patients with moderate primary hypertension and above average LV mass (Jula and Karanko, 1994). However, although diet and weight loss may markedly benefit patients, clinical studies have demonstrated that such lifestyle modifications are difficult to maintain in the long term (Whelton et al., 1992; Stamler, 1997; Hedayati, Elsayed and Reilly, 2011). Thus, pharmacological intervention is often required to moderate the progression of LVH and associated hypertension.

1.6.5 Pharmacological treatments

Regression of LVH has been shown with multiple drugs including angiotensin-converting enzyme (ACE) inhibitors, angiotensin receptor blockers (ARBs), some calcium channel blockers (e.g. verapamil, amlodipine, and diltiazem), renin inhibitors (e.g. aliskiren), and some sympatholytic agents (e.g. alpha–blockers and methyldopa) (Franz, Tönnesmann and Müller, 1998; Okin et al., 2006; Cuspidi, Negri and Zanchetti, 2008; Os et al., 2008; Solomon et al., 2009). Direct vasodilators appear to be largely ineffective in regards to LVH regression, which may be due to reflex stimulation of angiotensin II and norepinephrine release (both of which can directly promote the development of LVH) (Klingbeil et al., 2003). Although ARBs, calcium channel blockers, and ACE inhibitors produce significantly more LVH regression than diuretics and beta blockers, there is currently no evidence that a more rapid regression of LVH is associated with improved long-term health outcomes (Kaplan and Douglas, 2017).

ARBs have been demonstrated to be the most efficacious class of drugs for reducing LV mass (11% reduction in LV mass), followed by calcium channel blockers (11%), ACE inhibitors (10%), diuretics (8%), and beta-blockers (6%) (Klingbeil et al., 2003; Bauml and Underwood, 2010). An important component in LVH development is myocardial fibrosis, which compromises cardiac function via initial diastolic dysfunction followed by progressive systolic dysfunction (Weber et al., 1990); angiotensin II has been shown to induce the development of fibrosis in the myocardium of hypertensive patients (González et al., 2002), and may be an additional mechanism of action by which ACE inhibitors and ARBs exhibit their beneficial effects in cardiac hypertrophy. As such, ACE inhibitors and ARBs are recommended as first- line treatments for LVH, unless contraindicated in the individual patient (Bauml and Underwood, 2010).

Altered RGS2 expression in humans is associated with cardiovascular dysfunction

Various studies have suggested a potential role of RGS2 dysfunction in human hypertension. Human skin fibroblasts and peripheral blood mononuclear cells from hypertensive patients display decreased RGS2 mRNA expression, increased Ang II-induced MAPK/ERK phosphorylation, and elevated Ca2+ release from internal stores (Semplicini et al., 2006). Multiple Rgs2 SNPs have been identified in genetic groups from China (Zhao et al., 2008; Zhang et al., 2010), Japan (Yang et al., 2005), the Netherlands (Riddle et al., 2006), and the United States (Hettema et al., 2013). Destabilizing N-terminal mutations appear to increase RGS2 susceptibility to arginylation/ubiquitination and subsequent proteasomal degradation (Bodenstein, Sunahara and Neubig, 2007), while other SNPs can affect RGS2 localization and impair GAP activity (Gu, Tirgari and Heximer, 2008). In contrast, RGS2 overexpression has been found in patients with Bartter/Gitelman syndrome, a kidney disorder caused by loss of function mutations of the thiazide-sensitive sodium-chloride symport that is characterized in part by hypotension and an increased risk for ventricular arrhythmia (Deschenes, Feldmann and Doucet, 2002; Foglia et al., 2004; Knoers and Levtchenko, 2008). The dysfunction of RGS2 in patients suggests that its study in relation to hypertension and hypertrophy may be 22

clinically relevant, and that stabilizing its expression or function may increase or decrease blood pressure; indeed, stabilizing RGS2 expression appears to be beneficial in in vitro and in animal models of cardiac hypertrophy (Sjögren, Blazer and Neubig, 2010; Sjogren et al., 2012; Sjögren et al., 2016), and suggests that RGS2 could be a potential target for drug discovery in cardiovascular disease.

Animal models of cardiac hypertrophy

1.8.1 Transverse aortic constriction Transverse aortic constriction (TAC) in murine animals is a well-established technique of experimental pressure overload on the heart to induce cardiac hypertrophy and dysfunction, and has been used in multiple studies to examine the role of RGS2 in cardiovascular health (Wang et al., 2008; Takimoto et al., 2009; Takimoto, 2011; Park-Windhol et al., 2012) Briefly, following anaesthesia and intubation, the chest cavity is entered via the second intercostal space through a small incision, and aortic constriction is performed by tying sutures against a needle to yield a narrowing of the aorta once the needle is removed (Rockman et al., 1991). Since its initial development (Rockman et al., 1991), TAC has been extensively used as a model of human cardiovascular disease and for the study of signalling processes involved in hypertrophic responses and heart failure. In comparison to other experimental models of heart failure, such as coronary artery ligation (which results in complete occlusion of the vessel), TAC provides a more gradual model of cardiac hypertrophy development (deAlmeida, van Oort and Wehrens, 2010), which can be modified by both the duration (Mohammed et al., 2012) and severity of the constriction (i.e. the gauge of the needle); TAC initially induces compensatory cardiac hypertrophy, which can often present as temporarily enhanced cardiac contractile function. Over time, chronic pressure overload leads to maladaptive cardiac hypertrophy and fibrosis, which can ultimately devolve into heart failure and cardiac dilation (Patten and Hall-Porter, 2009).

A major advantage of TAC is the ability to measure the pressure gradient that is created across the aortic stricture (Patten and Hall-Porter, 2009); since the constriction is performed on the

aorta between the left and right carotid arteries, arterial pressures (as measured by conductance catheters) should be measurably higher in the right carotid artery, thus validating the success of TAC surgery. The utility of this model can be seen from the promising and novel therapeutics targets that have been identified through its use (Braz et al., 2004; Wilkins et al., 2004; Takimoto et al., 2005; Jeong et al., 2006)

1.8.2 Osmotic pump infusion

Although the TAC method is a highly reproducible (Rockman et al., 1991) and useful model of cardiac hypertrophy and heart failure, the acute onset of severe hypertension via aortic stricture may lack direct clinical relevance (Patten and Hall-Porter, 2009). Multiple studies have used continuous drug infusion to induce systemic hypertension (and thus hypertrophy) via angiotensin II (Bueno et al., 2002; Freund et al., 2005; Kee et al., 2006), which is arguably a more clinically relevant model in light of the major role of the renin-angiotensin system (RAS) in the development of human hypertension and cardiac hypertrophy (Weber and Brilla, 1991; Dostal and Baker, 1999). Other groups have chronically infused isoproterenol to stimulate β-adrenergic signalling, and often do so in conjunction with angiotensin and/or TAC models (Soonpaa and Field, 1994; Kudej et al., 1997; Saadane, Alpert and Chalifour, 1999; De Windt et al., 2001; Bueno et al., 2002; Freund et al., 2005).

Following the initial development of an osmotic pump concept (Rose and Nelson, 1995), simplified mini-osmotic pumps have been designed which can systemically deliver sustained doses of desired drugs in a relatively non-invasive manner. Briefly, osmotic pumps operate via an osmotic pressure difference between a salt sleeve that surrounds a flexible and impermeable reservoir (containing a desired drug/solution) and the environment in which the pump is implanted (e.g. subcutaneous or intraperitoneal) (Alzet, 2017). The high osmolality of the salt sleeve draws water through a semipermeable membrane into the pump, leading to compression of the drug-containing reservoir; the drug/solution is thus displaced out of the pump (through a flow moderator) at a controlled rate which is predetermined by the water permeability of the pump’s outer membrane (Theeuwes and Yum, 1976).

Cardiovascular health and obesity

Cardiovascular dysfunction is known to be directly influenced by obesity and weight gain, which are major risk factors for cardiovascular diseases such as coronary heart disease, atrial fibrillation, hypertension, venous thromboembolisms, and congestive heart failure (Klein et al., 2004; Poirier et al., 2006; Tedrow et al., 2010; Wattanakit et al., 2012). In 2011 to 2012, only 65% of children and 31% of adults in the United States met body mass indexes (kg/m2) which correlated with ideal cardiovascular health (Lloyd-Jones et al., 2010). Conversely, 32% of US children and 69% of adults are currently estimated to be overweight or obese (Mozaffarian et al., 2016). The health and economic costs of obesity and its related co- morbidities, such as cardiovascular diseases, are substantial. In 2008, the estimated medical cost of obesity was $147 billion; costs related to the current prevalence of obesity and weight gain in children and adolescents is projected to be $254 billion ($46 billion in direct medical costs, and $208 billion in lost productivity due to morbidities and mortality) (Finkelstein et al., 2009; Lightwood et al., 2009). Although addressing obesity requires a multifactorial response involving clinical, biomedical, and socio-economic approaches, we will focus on examining the physiological mechanisms underlying weight regulation and metabolism, which may provide beneficial insights into treatments and novel drug targets.

Regulation of energy balance by GPCRs

Multiple GPCRs have been shown to be involved in energy metabolism. Adiposity is determined by energy intake (e.g. food intake) versus energy expenditure (e.g. physical activity, adaptive thermogenesis, basal metabolism), and possible sources of energy imbalance in cases of obesity or conversely, loss of body weight, could come from dysfunctions in food intake/nutrient absorption, lipid storage, metabolic rate, physical activity, or CNS-related changes.

Several studies have demonstrated the involvement of a vast range of GPCR signalling in appetite and satiation. Brain cannabinoid receptors play a physiological role in the control of

appetite and body weight, and cannabinoid CB1 receptor antagonists reduce appetite and decrease body weights in non-obese Wistar rats (Colombo et al., 1998). Patients with eating disorders exhibit several clinical features and biologic findings indicative of serotonin (5- hydroxytryptamine/5-HT) dysregulation (Brewerton, 1995), and ghrelin infusion has been shown to enhance appetite and increase food intake in humans (Wren et al., 2001). Furthermore, histamine, which acts as a central neurotransmitter, acts as an appetite suppressant via stimulation of histamine H1 receptors, thereby mediating the inhibitory effects of leptin on appetite (Jørgensen et al., 2007). In addition, amylin, a peptide secreted from the pancreas following a meal or in response to oral glucose ingestion, acts as a satiation factor, and has been found to be overexpressed in genetically obese animals due to receptor insensitivity (Morley et al., 1995). Oxyntomodulin (OXM) is another peptide released from the gut following food intake and binds to both glucagon-like peptide-1 receptor (GLP1R) and the glucagon receptor; both systemic and brain-specific injection of (OXM) in rats reduces food intake and weight gain (Cohen et al., 2003). Interestingly, some orphan GPCRs, including GPR61 and GPR82, appear to be involved in regulating food intake; loss of GRP61 and GPR82 in mice resulted in hyperphagia and lower food intake, respectively (Engel et al., 2011; Nambu et al., 2011).

Gastrointestinal (GI) motility, digestion, and nutrient sensing also involve GPCRs. Taste receptors belong to the T1R and T2R families of GPCRs; ligand (amino acid) binding triggers signal transduction and neurotransmitter release, and taste receptors can also be found in certain regions of the gut to regulate gastric inhibitory polypeptide (GIP) and GLP-1 stimulated insulin secretion (Chaudhari and Roper, 2010; Efeyan, Comb and Sabatini, 2015). The neuropeptide cholecystokinin (CCK) can slow gastric emptying (via induction of acetylcholine release from the GI tract) (Paton et al., 1971), and additionally acts as an appetite suppressant (Crawley and Corwin, 1994). In addition, endogenous opioids of three known classes have been found throughout the gastrointestinal tract (Kromer, 1988), and exogenous opioids are well known to depress GI motility (Schaumann, 1955); localization of peptide YY (PYY), a ligand for neuropeptide Y receptors, also decreases intestinal blood flow and motility (Lundberg et al., 1982). Overall, this non-exhaustive list of GPCRs and their related signalling

pathways demonstrates the fundamental role of these receptors in mediating energy metabolism.

Altered G protein signalling in lean and obese phenotypes

Alterations in G protein signalling can lead to both lean and obese phenotypes. Loss of melanocortin 4 signalling results in severe obesity that is associated with hyperphagia, hyperinsulinemia, and hyperglycemia (Huszar et al., 1997); a triple knockout of β1/2/3- adrenergic receptors in mice led to weight gain on a standard chow diet, and the development of massive high fat diet induced obesity, which was attributed to a failure to initiate diet- induced thermogenesis (Bachman et al., 2002). Conversely, mice without Gβ5, a G protein β subunit that dimerizes with RGS proteins of the R7 family instead of Gγ, displayed a lean phenotype, were resistant to a high-fat diet, and demonstrated increased thermogenesis (Wang et al., 2011). Mice lacking the M3 muscarinic acetylcholine receptor are lean and hypophagic, indicating M3 receptor-mediated facilitation of food intake (Yamada et al., 2001). Moreover, loss of the neuropeptide melanin-concentrating hormone (MCH), which normally promotes feeding, led to reduced body weight due to hypophagia (Shimada et al., 1998). In addition, full-body RGS4 (Grillet et al., 2005) and RGS5 (Cho et al., 2008) knockout mice weight significantly less than WT counterparts, although lack of RGS5 has also been reported to exacerbate obesity, inflammation, hepatic steatosis, and insulin resistance (Deng et al., 2012). Rgs2-/- mice are also lean and display a hyperphagic phenotype, which will be subsequently discussed in detail.

Skeletal tissue is a major site of energy metabolism via thyroid hormone (TH) regulation

Thyroid hormone (TH) signalling is critical for numerous biological functions including development and growth, energy expenditure, and thermogenesis. TH primarily acts through nuclear-receptor mediated stimulation or inhibition of gene transcription (Yen, 2001; Mebis et

al., 2009). This activity is mainly mediated by the alpha isoform of the thyroid hormone receptor in skeletal muscle. Thyroid hormone receptors in the unliganded state are usually bound to TH-responsive elements in various genes along with other proteins, leading to active repression of gene transcription (Yen, 2001); upon ligand binding, repression of the target gene is lifted and transcription is stimulated by co-activator recruitment to the complex (Brent, 2012). In skeletal tissue, proteins which are transcriptionally regulated by TH include SERCA1A (Simonides et al., 1996), SERCA2A (Hartong et al., 1994), GLUT-4 (glucose transporter) (Zorzano, Palacin and Guma, 2005) , UCP3 (muscle-specific) (Solanes et al., 2005), malic enzyme (ME1) (Desvergne, Petty and Nikodem, 1991), and glycerol – 3- phosphate dehydrogenase (Dümmler, Müller and Seitz, 1996). In addition to modifying the glycolytic and oxidative capacities of skeletal tissue, TH affects mitochondrial capacity via transcription of the gene for PGC1α, a regulator of mitochondrial biogenesis (Weitzel, Iwen and Seitz, 2003).

Resting metabolic rates in almost all tissues depend on thyroid hormone availability. TH has been shown to increases the rates of muscle contraction and relaxation, which is related to changes in the expression of proteins involved in intracellular Ca2+ flux (e.g. SERCA isoforms) (Salvatore et al., 2013). By promoting a shift from slow type I fibre phenotypes to the faster type II skeletal fibres, TH induces the increased expression of myosin and SERCA, leading to greater energy turnover and the generation of heat during activity (Thomas, Auwerx and Schoonjans, 2008). In skeletal muscle, TH signalling can alter the metabolic rate by uncoupling ATP synthesis in the mitochondria or by decreasing metabolic efficiency; a potential mechanism through which energy is “wasted” in the form of heat dissipation includes decreasing ATP synthesis efficiency via proton leak through skeletal tissue specific mitochondrial uncoupling protein 3 (UCP3) (de Lange et al., 2001). Since skeletal tissue comprises approximately 40-50% of total body mass, it is the largest single contributor to the metabolic resting state of an organism, as well as towards heat generation (Thomas, Auwerx and Schoonjans, 2008).

TH regulation of metabolism and glucose homeostasis requires deiodinase type 2 (DIO2) for T4-T3 conversion In order for thyroid hormone to regulate various metabolic processes, it must be converted from its inactive prohormone form T4/thyroxine (3,5,3',5'-tetraiodothyronine) to the active thyroid hormone/T3 (3,5,3'-triiodothyronine, T3). Thyroid hormone signalling in individual tissues can change even as serum T4 concentrations remain normal due to local activation or inactivation of thyroid hormone, the underlying mechanism of which is deiodination by the intracellular iodothyronine deiodinases type I, II, and III (DIO1, DIO2, and DIO3) (St. Germain and Galton, 1997; Bianco et al., 2002). DIO1, 2, and 3 regulate thyroid hormone activity via removal of iodine moieties from T4 (2); DIO2 converts T4 to T3, whereas DIO3 inactivates T3 (DIO1 function remains to be clarified) (Wondisford, 2003; Bianco and Kim, 2006). Thus, the deiodinases, and specifically DIO2, are critical determinants of intercellular T3 levels.

Glucose uptake into mammalian cells is mediated via the tissue specific transport proteins GLUT1-4, a process which is often a rate-limiting step in tissue glucose metabolism (Torrance et al., 1997). In skeletal muscle, insulin-sensitive GLUT-4 (or SLC2A4) is the main isoform expressed, and functions to rapidly remove circulating glucose from the blood following a meal; indeed, skeletal muscle accounts for more than 85% of whole body insulin-stimulated glucose uptake (Torrance et al., 1997). As previously mentioned, GLUT-4 protein and mRNA expression are regulated by TH (specifically T3); in conjunction, GLUT-4 translocation to the cell surface is an insulin-dependent event, and normal muscle responsiveness to insulin has been shown to require the DIO2-mediated conversion of T4 to T3 (Mills et al., 1987; Zorzano, Palacin and Guma, 2005; Grozovsky et al., 2009). The importance of DIO2 regulation of T3 production and insulin action can be seen through in vitro and animal models. Cultured myotubes lacking DIO2 have decreased phosphorylated Akt (a downstream effector of insulin) (Grozovsky et al., 2009), and mice with targeted deletion of Dio2 are insulin resistant and susceptible to diet-induced obesity (Marsili et al., 2011).

Role for RGS2 in metabolic pathways Human polymorphisms that result in the over- or under-expression of RGS2 point to the clinical relevance of RGS2 in the context of metabolism. A common polymorphism in the 3’ untranslated region of RGS2 has been shown to decrease RGS2 expression, and is considered to be a genetic marker that can predict male predisposition to weight gain and obesity (Sartori et al., 2008). Conversely, a C to G substitution in the RGS2 promoter region has been shown to increase RGS2 expression in adipocytes and is associated with the metabolic syndrome (Freson et al., 2007). RGS2 has been shown to have various effects on energy storage and usage; in vitro studies have demonstrated the role of RGS2 in mediating GLUT-4 (insulin- responsive glucose transporter) translocation in adipocytes (Imamura et al., 1999), as well as GIP (glucose-dependent insulinotropic polypetide)-induced insulin release from pancreatic β cells (Tseng and Zhang, 1998). Thus, RGS2 may be involved in glucose entrance in adipocytes. RGS2 may also regulate metabolism via inhibitory effects on thyroid stimulating hormone receptor (TSHR)-induced Gq signal transduction; the TSHR ligand TSH is a pituitary hormone which stimulates the thyroid gland to produce T4 (Eszlinger et al., 2004). RGS2 also appears to promote the differentiation of adipocytes and expression of adipogenic markers, and is transiently and rapidly upregulated in differentiating mouse preadipocyte cells (Imagawa, Tsuchiya and Nishihara, 1999; Nishizuka et al., 2001). Other energy-dependent processes affected by RGS2 include the regulation of protein synthesis (Nguyen et al., 2009; Chidiac et al., 2014), as well as ATP hydrolysis by PMCA (plasma membrane Ca2+ ATPase) and SERCA (sarco/endoplasmic reticulum Ca2+) pumps (Wang et al., 2004), which altogether suggests an important role for RGS2 in body metabolism.

Rgs2-/- mice display a lean phenotype and are hyperphagic

Rgs2-/- mice, which are a well-established strain, demonstrate normal circadian activity and motor function; phenotypes include increased anxiety, decreased male aggression, reduced T cell proliferation and heightened sensitivity to TAC-induced cardiac hypertrophy, as well as mild to moderate levels of hypertension. (Oliveira-Dos-Santos et al., 2000; Heximer et al., 2003; Takimoto et al., 2009). Our lab has previously reported a novel phenotype in Rgs2-/-

mice, such that they are resistant to age-related, normal body weight gain until their end-of- life (~24 months-old) (Nunn et al., 2011). In addition to decreased body weights, Rgs2-/- mice are hyperphagic, display increased insulin sensitivity, decreased serum lipids, smaller brown and white adipose tissue deposits, and smaller adipocytes. Since RGS2 appears to promote adipocyte differentiation (Nishizuka et al., 2001), it would follow that its loss would result in impaired adipocyte function. Surprisingly, Rgs2-/- mice were not resistant to high fat diet- induced obesity, and gained weight at similar rates to WT controls. Furthermore, the increased insulin sensitivity observed under ad libitum diet conditions was abrogated by the high fat diet (Nunn et al., 2011). Our observations suggest that even though adipocytes in Rgs2-/- animals are significantly smaller compared to WTs, lipid metabolism may not be impaired, and that it is rather carbohydrate or protein metabolism which is altered. Given that our characterization of the lean metabolic phenotype mainly focused on adipocyte-related functions, exploring potential alterations in Rgs2-/- skeletal tissue, a major metabolic contributor, could lead to a more in-depth understanding of the role of RGS2 in energy metabolism

Diet-induced models of weight gain and loss

1.16.1 High-fat diets

Surrogate animal models are important for studying the molecular aspects of obesity and its pathophysiological effects, as patient complications can often take years to develop (Wang and Liao, 2012). Since their introduction three decades ago (Surwit et al., 1988), high-fat diets have been used extensively to study the pathophysiologies of weight gain (e.g. glucose intolerance and type 2 diabetes) and for the development of novel obesity treatments (Ahrén et al., 2000; Reimer, Holst and Ahrén, 2002). Wild-type animals on a high fat diet (particularly the C57/Bl/6 strain) gradually gain weight over time, and progressively develop increased hyperinsulinemia, which is indicative of worsening insulin resistance (Winzell and Ahrén, 2004). While standard chow has an approximate composition of less than ~10% kcal from fat, high fat diets can range from ~40% to ~60% kcal from fat content (Wang and Liao, 2012). Numerous high-fat studies use either lard (animal fat) or shortening (hydrogenated vegetable

oil) (Silva et al., 2006; Lionetti et al., 2014; Fujiwara et al., 2015; Magri et al., 2015); vegetable shortening may also differ in their fatty acid composition depending on whether a partially hydrogenated soybean/palm oil or a partially hydrogenated soybean/cottonseed oil formulation is used (Kubant et al., 2015). Recent studies have found that lard-based high-fat diets increase weight gain and the development of obesity and insulin resistance to a greater extent than hydrogenated vegetable shortening diets (Kubant et al., 2015); this highlights the importance of identifying the fatty acid composition of diets used to examine the role of dietary fats.

1.16.2 Dietary restriction

Diet restriction models have most often been used in the context of aging and metabolism (Weindruch and Walford, 1982; Hursting et al., 2003; Bordone and Guarente, 2005); 30-50% food intake restrictions on ad libitum fed rats and mice have been shown to markedly increase longevity and delay the onset of age-associated diseases (Masoro, 2000). Intermittent fasting (e.g. 24 hours with/without access to food) has been shown to reduce serum glucose and insulin levels as well as neuronal resistance to injury (Anson et al., 2003). Chronic diet restriction, in which a group of animals is taken down to a set percentage of food intake (e.g. 70% of ad libitum intake), also has purported beneficial effects (McCarter, Masoro and Yu, 1985) Both chronic and acute (fasting) diet restriction conditions can be used to characterize mice with metabolic phenotypes; altered responses to dietary challenges compared to WT mice may reveal whether proteins or genes of interest are required for a normal response to caloric restriction (Boily et al., 2008).

Summary

Overall, RGS2 appears to play multiple roles in both cardiovascular disease and metabolism. The following chapters will explore novel ways in which the in vivo expression or lack of RGS2 impacts cardiovascular health and metabolism.

References Abbott, C. M. and Proud, C. G. (2004) ‘Translation factors: in sickness and in health’, Trends Biochem. Sci., 29(1), pp. 25–31.

Abramow-Newerly, M., Roy, A. A., Nunn, C. and Chidiac, P. (2006) ‘RGS proteins have a signalling complex: Interactions between RGS proteins and GPCRs, effectors, and auxiliary proteins’, Cell. Signal., 18(5), pp. 579–591.

Ahrén, B., Holst, J. J., Mårtensson, H. and Balkan, B. (2000) ‘Improved glucose tolerance and insulin secretion by inhibition of dipeptidyl peptidase IV in mice.’, Eur. J. Pharmacol., 404(1– 2), pp. 239–45.

Ahuja, P., Sdek, P. and MacLellan, W. R. (2007) ‘Cardiac myocyte cell cycle control in development, disease, and regeneration.’, Physiol. Rev. NIH Public Access, 87(2), pp. 521–44.

Akhter, S. A., Skaer, C. A., Kypson, A. P., McDonald, P. H., Peppel, K. C., Glower, D. D., Lefkowitz, R. J. and Koch, W. J. (1997) ‘Restoration of β-adrenergic signaling in failing cardiac ventricular myocytes via adenoviral-mediated gene transfer’, Proc. Natl. Acad. Sci., 94(22), pp. 12100–12105.

Alzet (2017) How Does It Work? Available at: http://www.alzet.com/products/ALZET_Pumps/howdoesitwork.html.

Anson, R. M., Guo, Z., de Cabo, R., Iyun, T., Rios, M., Hagepanos, A., Ingram, D. K., Lane, M. A. and Mattson, M. P. (2003) ‘Intermittent fasting dissociates beneficial effects of dietary restriction on glucose metabolism and neuronal resistance to injury from calorie intake.’, Proc. Natl. Acad. Sci. U. S. A. National Academy of Sciences, 100(10), pp. 6216–20.

Bachman, E. S., Dhillon, H., Zhang, C.-Y., Cinti, S., Bianco, A. C., Kobilka, B. K. and Lowell, B. B. (2002) ‘βAR Signaling Required for Diet-Induced Thermogenesis and Obesity Resistance’, Science (80-. )., 297(5582).

Bauml, M. A. and Underwood, D. A. (2010) ‘Left ventricular hypertrophy: An overlooked

cardiovascular risk factor’, Cleve. Clin. J. Med., 77(6), pp. 381–387.

Beache, G. M., Herzka, D. A., Boxerman, J. L., Post, W. S., Gupta, S. N., Faranesh, A. Z., Solaiyappan, M., Bottomley, P. A., Weiss, J. L., Shapiro, E. P. and Hill, M. N. (2001) ‘Attenuated myocardial vasodilator response in patients with hypertensive hypertrophy revealed by oxygenation-dependent magnetic resonance imaging.’, Circulation, 104(11), pp. 1214–7.

Berman, D. M., Kozasa, T. and Gilman, A. G. (1996) ‘The GTPase-activating protein RGS4 stabilizes the transition state for nucleotide hydrolysis.’, J. Biol. Chem. American Society for Biochemistry and Molecular Biology, 271(44), pp. 27209–12.

Bernardo, B. C., Weeks, K. L., Pretorius, L. and McMullen, J. R. (2010) ‘Molecular distinction between physiological and pathological cardiac hypertrophy: Experimental findings and therapeutic strategies’, Pharmacol. Ther., 128(1), pp. 191–227.

Bernstein, L. S., Ramineni, S., Hague, C., Cladman, W., Chidiac, P., Levey, A. I. and Hepler, J. R. (2004) ‘RGS2 binds directly and selectively to the M1 muscarinic acetylcholine receptor third intracellular loop to modulate Gq/11alpha signaling.’, J. Biol. Chem. American Society for Biochemistry and Molecular Biology, 279(20), pp. 21248–56.

Bianco, A. C. and Kim, B. W. (2006) ‘Deiodinases: implications of the local control of thyroid hormone action.’, J. Clin. Invest. American Society for Clinical Investigation, 116(10), pp. 2571–9.

Bianco, A. C., Salvatore, D., Gereben, B., Berry, M. J. and Larsen, P. R. (2002) ‘Biochemistry, Cellular and Molecular Biology, and Physiological Roles of the Iodothyronine Selenodeiodinases’, Endocr. Rev., 23(1), pp. 38–89.

Bisognano, J. D., Weinberger, H. D., Bohlmeyer, T. J., Pende, A., Raynolds, M. V, Sastravaha, A., Roden, R., Asano, K., Blaxall, B. C., Wu, S. C., Communal, C., Singh, K., Colucci, W., Bristow, M. R. and Port, D. J. (2000) ‘Myocardial-Directed Overexpression of the Human β1- Adrenergic Receptor in Transgenic Mice’, J. Mol. Cell. Cardiol., 32(5), pp. 817–830.

Bodenstein, J., Sunahara, R. K. and Neubig, R. R. (2007) ‘N-Terminal Residues Control Proteasomal Degradation of RGS2, RGS4, and RGS5 in Human Embryonic Kidney 293 Cells’, Mol. Pharmacol., 71(4).

Boily, G., Seifert, E. L., Bevilacqua, L., He, X. H., Sabourin, G., Estey, C., Moffat, C., Crawford, S., Saliba, S., Jardine, K., Xuan, J., Evans, M., Harper, M.-E. and McBurney, M. W. (2008) ‘SirT1 Regulates Energy Metabolism and Response to Caloric Restriction in Mice’, PLoS One, 3(3), p. e1759.

Bondjers, C., Kalén, M., Hellström, M., Scheidl, S. J., Abramsson, A., Renner, O., Lindahl, P., Cho, H., Kehrl, J. and Betsholtz, C. (2003) ‘Transcription profiling of platelet-derived growth factor-B-deficient mouse embryos identifies RGS5 as a novel marker for pericytes and vascular smooth muscle cells.’, Am. J. Pathol. American Society for Investigative Pathology, 162(3), pp. 721–9.

Bordone, L. and Guarente, L. (2005) ‘Calorie restriction, SIRT1 and metabolism: understanding longevity’, Nat Rev Mol Cell Biol, 6(4), pp. 298–305.

Bottini, P. B., Carr, A. A., Prisant, L. M., Flickinger, F. W., Allison, J. D. and Gottdiener, J. S. (1995) ‘Magnetic resonance imaging compared to echocardiography to assess left ventricular mass in the hypertensive patient’, Am. J. Hypertens., 8(3), pp. 221–228.

Braz, J. C., Gregory, K., Pathak, A., Zhao, W., Sahin, B., Klevitsky, R., Kimball, T. F., Lorenz, J. N., Nairn, A. C., Liggett, S. B., Bodi, I., Wang, S., Schwartz, A., Lakatta, E. G., DePaoli- Roach, A. A., Robbins, J., Hewett, T. E., Bibb, J. A., Westfall, M. V, Kranias, E. G. and Molkentin, J. D. (2004) ‘PKC-α regulates cardiac contractility and propensity toward heart failure’, Nat. Med., 10(3), pp. 248–254.

Brent, G. A. (2012) ‘Mechanisms of thyroid hormone action.’, J. Clin. Invest. American Society for Clinical Investigation, 122(9), pp. 3035–43.

Brewerton, T. D. (1995) ‘Toward a unified theory of serotonin dysregulation in eating and related disorders’, Psychoneuroendocrinolog, 20(6), pp. 561–590.

Bueno, O. F., Wilkins, B. J., Tymitz, K. M., Glascock, B. J., Kimball, T. F., Lorenz, J. N. and Molkentin, J. D. (2002) ‘Impaired cardiac hypertrophic response in Calcineurin Abeta - deficient mice.’, Proc. Natl. Acad. Sci. U. S. A. National Academy of Sciences, 99(7), pp. 4586–91.

Burke, A. P., Farb, A., Liang, Y., Smialek, J. and Virmani, R. (1996) ‘Effect of Hypertension and Cardiac Hypertrophy on Coronary Artery Morphology in Sudden Cardiac Death’, Circulation, 94(12).

Calò, L. A., Pagnin, E., Davis, P. A., Sartori, M., Ceolotto, G., Pessina, A. C. and Semplicini, A. (2004) ‘Increased Expression of Regulator of G Protein Signaling-2 (RGS-2) in Bartter’s/Gitelman’s Syndrome. A Role in the Control of Vascular Tone and Implication for Hypertension’, J. Clin. Endocrinol. Metab., 89(8), pp. 4153–4157.

Carluccio, E., Tommasi, S., Bentivoglio, M., Buccolieri, M., Filippucci, L., Prosciutti, L. and Corea, L. (2000) ‘Prognostic value of left ventricular hypertrophy and geometry in patients with a first, uncomplicated myocardial infarction.’, Int. J. Cardiol., 74(2–3), pp. 177–83.

Chaudhari, N. and Roper, S. D. (2010) ‘The cell biology of taste’, J. Cell Biol., 190(3), pp. 285–296.

Chidiac, P. and Roy, A. A. (2003) ‘Activity, regulation, and intracellular localization of RGS proteins.’, Receptors Channels. Taylor & Francis, 9(3), pp. 135–47.

Chidiac, P., Sobiesiak, A. J., Lee, K. N., Gros, R. and Nguyen, C. H. (2014) ‘The eIF2B- interacting domain of RGS2 protects against GPCR agonist-induced hypertrophy in neonatal rat cardiomyocytes’, Cell. Signal., 26(6), pp. 1226–1234.

Cho, H., Park, C., Hwang, I.-Y., Han, S.-B., Schimel, D., Despres, D. and Kehrl, J. H. (2008) ‘Rgs5 targeting leads to chronic low blood pressure and a lean body habitus.’, Mol. Cell. Biol. American Society for Microbiology, 28(8), pp. 2590–7.

Cifelli, C., Rose, R. A., Zhang, H., Voigtlaender-Bolz, J., Bolz, S.-S., Backx, P. H. and Heximer, S. P. (2008) ‘RGS4 Regulates Parasympathetic Signaling and Heart Rate Control in 36

the Sinoatrial Node’, Circ. Res., 103(5).

Cipriano, C., Gosse, P., Bemurat, L., Mas, D., Lemetayer, P., N’Tela, G. and Clementy, J. (2001) ‘Prognostic value of left ventricular mass and its evolution during treatment in the bordeaux cohort of hypertensive patients’, Am. J. Hypertens., 14(6), pp. 524–529.

Cladman, W. and Chidiac, P. (2002) ‘Characterization and Comparison of RGS2 and RGS4 as GTPase-Activating Proteins for m2 Muscarinic Receptor-Stimulated Gi’, Mol. Pharmacol., 62(3), pp. 654–659.

Cohen, M. A., Ellis, S. M., Le Roux, C. W., Batterham, R. L., Park, A., Patterson, M., Frost, G. S., Ghatei, M. A. and Bloom, S. R. (2003) ‘Oxyntomodulin Suppresses Appetite and Reduces Food Intake in Humans’, J. Clin. Endocrinol. Metab. Oxford University Press, 88(10), pp. 4696–4701.

Colombo, G., Agabio, R., Diaz, G., Lobina, C., Reali, R. and Gessa, G. L. (1998) ‘Appetite suppression and weight loss after the cannabinoid antagonist SR 141716’, Life Sci., 63(8), p. PL113-PL117.

Conrad, C. H., Brooks, W. W., Hayes, J. A., Sen, S., Robinson, K. G. and Bing, O. H. L. (1995) ‘Myocardial Fibrosis and Stiffness With Hypertrophy and Heart Failure in the Spontaneously Hypertensive Rat’, Circulation, 91(1).

Crawley, J. N. and Corwin, R. L. (1994) ‘Biological actions of cholecystokinin’, Peptides, pp. 731–755.

Cuspidi, C., Negri, F. and Zanchetti, A. (2008) ‘Angiotensin II receptor blockers and cardiovascular protection: focus on left ventricular hypertrophy regression and atrial fibrillation prevention.’, Vasc. Health Risk Manag. Dove Press, 4(1), pp. 67–73.

D’Angelo, D. D., Sakata, Y., Lorenz, J. N., Boivin, G. P., Walsh, R. A., Liggett, S. B. and Dorn, G. W. (1997) ‘Transgenic Galphaq overexpression induces cardiac contractile failure in mice.’, Proc. Natl. Acad. Sci. U. S. A., 94(15), pp. 8121–6.

Daniels, S. D., Meyer, R. A. and Loggie, J. M. (1990) ‘Determinants of cardiac involvement in children and adolescents with essential hypertension.’, Circulation, 82(4). deAlmeida, A. C., van Oort, R. J. and Wehrens, X. H. T. (2010) ‘Transverse aortic constriction in mice.’, J. Vis. Exp. MyJoVE Corporation, (38).

Deng, H., Dokshin, G. A., Lei, J., Goldsmith, A. M., Bitar, K. N., Fingar, D. C., Hershenson, M. B. and Bentley, J. K. (2008) ‘Inhibition of glycogen synthase kinase-3beta is sufficient for airway smooth muscle hypertrophy.’, J. Biol. Chem. American Society for Biochemistry and Molecular Biology, 283(15), pp. 10198–207.

Deng, W., Wang, X., Xiao, J., Chen, K., Zhou, H., Shen, D., Li, H. and Tang, Q. (2012) ‘Loss of Regulator of G Protein Signaling 5 Exacerbates Obesity, Hepatic Steatosis, Inflammation and Insulin Resistance’, PLoS One. Edited by G. Qin, 7(1), p. e30256.

Deschenes, G., Feldmann, D. and Doucet, A. (2002) ‘Primary molecular changes and secondary biological problems in Bartter and Gitelman syndrome’, Arch Pediatr, 9(4), pp. 406–416.

Desvergne, B., Petty, K. J. and Nikodem, V. M. (1991) ‘Functional characterization and receptor binding studies of the malic enzyme thyroid hormone response element.’, J. Biol. Chem., 266(2), pp. 1008–13.

Dorn, G. W. and Force, T. (2005) ‘Protein kinase cascades in the regulation of cardiac hypertrophy’, J. Clin. Invest., 115(3), pp. 527–537.

Dostal, D. E. and Baker, K. M. (1999) ‘The Cardiac Renin-Angiotensin System’, Circ. Res., 85(7).

Douglas, P. S. and Kaplan, N. M. (2017) ‘Definition and pathogenesis of left ventricular hypertrophy in hypertension’, UptoDate.

Doupnik, C. A., Xu, T. and Shinaman, J. M. (2001) ‘Profile of RGS expression in single rat atrial myocytes’, Biochim. Biophys. Acta - Gene Struct. Expr., 1522(2), pp. 97–107.

Drazner, M. H., Rame, J. E., Marino, E. K., Gottdiener, J. S., Kitzman, D. W., Gardin, J. M., Manolio, T. A., Dries, D. L. and Siscovick, D. S. (2004) ‘Increased left ventricular mass is a risk factor for the development of a depressed left ventricular ejection fraction within five years: the Cardiovascular Health Study.’, J. Am. Coll. Cardiol., 43(12), pp. 2207–15.

Dror, R. O., Pan, A. C., Arlow, D. H., Borhani, D. W., Maragakis, P., Shan, Y., Xu, H. and Shaw, D. E. (2011) ‘Pathway and mechanism of drug binding to G-protein-coupled receptors.’, Proc. Natl. Acad. Sci. U. S. A. National Academy of Sciences, 108(32), pp. 13118–23.

Dümmler, K., Müller, S. and Seitz, H. J. (1996) ‘Regulation of adenine nucleotide translocase and glycerol 3-phosphate dehydrogenase expression by thyroid hormones in different rat tissues.’, Biochem. J. Portland Press Ltd, 317 ( Pt 3)(Pt 3), pp. 913–8.

Efeyan, A., Comb, W. C. and Sabatini, D. M. (2015) ‘Nutrient-sensing mechanisms and pathways.’, Nature. NIH Public Access, 517(7534), pp. 302–10.

Elsby, R., Heiber, J. F., Reid, P., Kimball, S. R., Pavitt, G. D. and Barber, G. N. (2011) ‘The Alpha Subunit of Eukaryotic Initiation Factor 2B (eIF2B) Is Required for eIF2-Mediated Translational Suppression of Vesicular Stomatitis Virus’, J. Virol., 85(19), pp. 9716–9725.

Endale, M., Kim, S. D., Lee, W. M., Kim, S., Suk, K., Cho, J. Y., Park, H. J., Wagley, Y., Kim, S., Oh, J.-W. and Rhee, M. H. (2010) ‘Ischemia induces regulator of G protein signaling 2 (RGS2) protein upregulation and enhances apoptosis in astrocytes’, Am. J. Physiol. - Cell Physiol., 298(3), pp. C611–C623.

Engel, K. M. Y., Schröck, K., Teupser, D., Holdt, L. M., Tönjes, A., Kern, M., Dietrich, K., Kovacs, P., Krügel, U., Scheidt, H. A., Schiller, J., Huster, D., Brockmann, G. A., Augustin, M., Thiery, J., Blüher, M., Stumvoll, M., Schöneberg, T. and Schulz, A. (2011) ‘Reduced Food Intake and Body Weight in Mice Deficient for the G Protein-Coupled Receptor GPR82’, PLoS One. Edited by S. Gaetani. Public Library of Science, 6(12), p. e29400.

Engelhardt, S., Hein, L., Keller, U., Klämbt, K. and Lohse, M. J. (2002) ‘Inhibition of Na+- H+ Exchange Prevents Hypertrophy, Fibrosis, and Heart Failure in β1-Adrenergic Receptor

Transgenic Mice’, Circ. Res., 90(7).

Eszlinger, M., Holzapfel, H.-P., Voigt, C., Arkenau, C. and Paschke, R. (2004) ‘RGS 2 expression is regulated by TSH and inhibits TSH receptor signaling’, Eur. J. Endocrinol., 151(3), pp. 383–390.

Finkelstein, E. A., Trogdon, J. G., Cohen, J. W. and Dietz, W. (2009) ‘Annual Medical Spending Attributable To Obesity: Payer-And Service-Specific Estimates’, Health Aff., 28(5), pp. w822–w831.

Foglia, P. E. G., Bettinelli, A., Tosetto, C., Cortesi, C., Crosazzo, L., Edefonti, A. and Bianchetti, M. G. (2004) ‘Cardiac work up in primary renal hypokalaemia-hypomagnesaemia (Gitelman syndrome)’, Nephrol. Dial. Transplant., 19(6), pp. 1398–1402.

Franz, I. W., Tönnesmann, U. and Müller, J. F. (1998) ‘Time course of complete normalization of left ventricular hypertrophy during long-term antihypertensive therapy with angiotensin converting enzyme inhibitors.’, Am. J. Hypertens., 11(6 Pt 1), pp. 631–9.

Freson, K., Stolarz, K., Aerts, R., Brand, E., Brand-Herrmann, S.-M., Kawecka-Jaszcz, K., Kuznetsova, T., Tikhonoff, V., Thijs, L., Vermylen, J., Staessen, J. A. and Van Geet, C. (2007) ‘−391 C to G substitution in the regulator of G-protein signalling-2 promoter increases susceptibility to the metabolic syndrome in white European men: consistency between molecular and epidemiological studies’, J. Hypertens., 25(1), pp. 117–125.

Freund, C., Schmidt-Ullrich, R., Baurand, A., Dunger, S., Schneider, W., Loser, P., El-Jamali, A., Dietz, R., Scheidereit, C. and Bergmann, M. W. (2005) ‘Requirement of Nuclear Factor- κB in Angiotensin II– and Isoproterenol-Induced Cardiac Hypertrophy In Vivo’, Circulation, 111(18).

Frey, N. and Olson, E. N. (2003) ‘Cardiac Hypertrophy: The Good, the Bad, and the Ugly’, Annu. Rev. Physiol., 65(1), pp. 45–79.

Fu, Y., Huang, X., Piao, L., Lopatin, A. N. and Neubig, R. R. (2007) ‘Endogenous RGS proteins modulate SA and AV nodal functions in isolated heart: implications for sick sinus 40

syndrome and AV block’, Am. J. Physiol. - Hear. Circ. Physiol., 292(5).

Fu, Y., Huang, X., Zhong, H., Mortensen, R. M., D’Alecy, L. G. and Neubig, R. R. (2006) ‘Endogenous RGS Proteins and Gα Subtypes Differentially Control Muscarinic and Adenosine-Mediated Chronotropic Effects’, Circ. Res., 98(5).

Fujiwara, M., Miyoshi, M., Sakai, S., Nishiokada, A., Aoyama-Ishikawa, M., Maeshige, N., Usami, Y., Hamada, Y., Takahashi, M. and Usami, M. (2015) ‘Lard-based high-fat diet increases secretory leukocyte protease inhibitor expression and attenuates the inflammatory response of acute lung injury in endotoxemic rats’, Clin. Nutr., 34(5), pp. 997–1009.

Gardin, J. M., McClelland, R., Kitzman, D., Lima, J. A., Bommer, W., Klopfenstein, H. S., Wong, N. D., Smith, V. E. and Gottdiener, J. (2001) ‘M-mode echocardiographic predictors of six- to seven-year incidence of coronary heart disease, stroke, congestive heart failure, and mortality in an elderly cohort (the Cardiovascular Health Study).’, Am. J. Cardiol., 87(9), pp. 1051–7.

St. Germain, D. L. and Galton, V. a (1997) ‘The deiodinase family of selenoproteins’, Thyroid, 7(4), pp. 655–668.

Gheorghiade, M., Adams, K. F. and Colucci, W. S. (2004) ‘Digoxin in the Management of Cardiovascular Disorders’, Circulation, 109(24).

Gomez, E., Mohammad, S. S. and Pavitt, G. D. (2002) ‘Characterization of the minimal catalytic domain within eIF2B: the guanine-nucleotide exchange factor for translation initiation.’, EMBO J. European Molecular Biology Organization, 21(19), pp. 5292–301.

González, A., López, B., Querejeta, R. and Díez, J. (2002) ‘Regulation of myocardial fibrillar collagen by angiotensin II. A role in hypertensive heart disease?’, J. Mol. Cell. Cardiol., 34(12), pp. 1585–93.

Government of Canada, H. C. (2013) ‘Sodium in Canada - Food and Nutrition - Health Canada’.

Gradman, A. H. and Alfayoumi, F. (2006) ‘From Left Ventricular Hypertrophy to Congestive Heart Failure: Management of Hypertensive Heart Disease’, Prog. Cardiovasc. Dis., 48(5), pp. 326–341.

Grant, S. L., Lassègue, B., Griendling, K. K., Ushio-Fukai, M., Lyons, P. R. and Alexander, R. W. (2000) ‘Specific regulation of RGS2 messenger RNA by angiotensin II in cultured vascular smooth muscle cells.’, Mol. Pharmacol., 57(3), pp. 460–7.

Grillet, N., Pattyn, A., Contet, C., Kieffer, B. L., Goridis, C. and Brunet, J.-F. (2005) ‘Generation and characterization of Rgs4 mutant mice.’, Mol. Cell. Biol. American Society for Microbiology, 25(10), pp. 4221–8.

Grossman, W., Jones, D. and McLaurin, L. P. (1975) ‘Wall stress and patterns of hypertrophy in the human left ventricle.’, J. Clin. Invest. American Society for Clinical Investigation, 56(1), pp. 56–64.

Grozovsky, R., Ribich, S., Rosene, M. L., Mulcahey, M. A., Huang, S. A., Patti, M. E., Bianco, A. C. and Kim, B. W. (2009) ‘Type 2 Deiodinase Expression Is Induced by Peroxisomal Proliferator-Activated Receptor-γ Agonists in Skeletal Myocytes’, Endocrinology, 150(4), pp. 1976–1983.

Gu, S., Cifelli, C., Wang, S. and Heximer, S. P. (2009) ‘RGS proteins: identifying new GAPs in the understanding of blood pressure regulation and cardiovascular function.’, Clin. Sci. (Lond). Portland Press Limited, 116(5), pp. 391–9.

Gu, S., Tirgari, S. and Heximer, S. P. (2008) ‘The RGS2 Gene Product from a Candidate Hypertension Allele Shows Decreased Plasma Membrane Association and Inhibition of Gq’, Mol. Pharmacol., 73(4).

Guo, X., Snider, W. D., Chen, B., Wu, Y.-H., Snider, W., Jiao, Z., Zhou, F.-Q., Selzer, M., Hu, Y., Lewcock, J., He, Z., He, Z., Zhong, J., Zheng, B. and He, Z. (2016) ‘GSK3β regulates AKT-induced central nervous system axon regeneration via an eIF2Bε-dependent, mTORC1- independent pathway’, Elife. eLife Sciences Publications Limited, 5, p. e11903.

Gurley, S. B., Griffiths, R. C., Mendelsohn, M. E., Karas, R. H. and Coffman, T. M. (2010) ‘Renal actions of RGS2 control blood pressure.’, J. Am. Soc. Nephrol. American Society of Nephrology, 21(11), pp. 1847–51.

Hague, C., Bernstein, L. S., Ramineni, S., Chen, Z., Minneman, K. P. and Hepler, J. R. (2005) ‘Selective inhibition of alpha1A-adrenergic receptor signaling by RGS2 association with the receptor third intracellular loop.’, J. Biol. Chem. American Society for Biochemistry and Molecular Biology, 280(29), pp. 27289–95.

Hahntow, I. N., Mairuhu, G., van Valkengoed, I. G. M., Baas, F., Alewijnse, A. E., Koopmans, R. P. and Michel, M. C. (2009) ‘Are RGS2 Gene Polymorphisms Associated With High Blood Pressure in an Ethnicity- and Gender-Specific Manner?’, Am. J. Hypertens., 22(1), pp. 80–86.

Haider, A. W., Larson, M. G., Benjamin, E. J. and Levy, D. (1998) ‘Increased left ventricular mass and hypertrophy are associated with increased risk for sudden death.’, J. Am. Coll. Cardiol., 32(5), pp. 1454–9.

Hannan, R., Jenkins, A., Jenkins, A. and Brandenburger, Y. (2003) ‘Cardiac hypertrophy: A matter of translation’, Clin. Exp. Pharmacol. Physiol., 30(8), pp. 517–527.

Hao, J., Michalek, C., Zhang, W., Zhu, M., Xu, X. and Mende, U. (2006) ‘Regulation of cardiomyocyte signaling by RGS proteins: Differential selectivity towards G proteins and susceptibility to regulation’, J. Mol. Cell. Cardiol., 41(1), pp. 51–61.

Haq, S., Choukroun, G., Kang, Z. Bin, Ranu, H., Matsui, T., Rosenzweig, A., Molkentin, J. D., Alessandrini, A., Woodgett, J., Hajjar, R., Michael, A. and Force, T. (2000) ‘Glycogen Synthase Kinase-3β Is a Negative Regulator of Cardiomyocyte Hypertrophy’, J. Cell Biol., 151(1), pp. 117–130.

Hardt, S. E. and Sadoshima, J. (2002) ‘Glycogen Synthase Kinase-3β A Novel Regulator of Cardiac Hypertrophy and Development’, Circ. Res., 90(10), pp. 1055–1063.

Hardt, S. E. and Sadoshima, J. (2004) ‘Negative regulators of cardiac hypertrophy’, Cardiovasc. Res., 63(3), pp. 500–509. 43

Hardt, S. E., Tomita, H., Katus, H. A. and Sadoshima, J. (2004) ‘Phosphorylation of Eukaryotic Translation Initiation Factor 2Bε by Glycogen Synthase Kinase-3β Regulates β-Adrenergic Cardiac Myocyte Hypertrophy’, Circ. Res., 94(7), pp. 926–935.

Hartong, R., Wang, N., Kurokawa, R., Lazar, M. A., Glass, C. K., Apriletti, J. W. and Dillmann, W. H. (1994) ‘Delineation of three different thyroid hormone-response elements in promoter of rat sarcoplasmic reticulum Ca2+ATPase gene. Demonstration that retinoid X receptor binds 5’ to thyroid hormone receptor in response element 1.’, J. Biol. Chem., 269(17), pp. 13021–9.

Hedayati, S. S., Elsayed, E. F. and Reilly, R. F. (2011) ‘Non-pharmacological aspects of blood pressure management: what are the data?’, Kidney Int. NIH Public Access, 79(10), pp. 1061– 70.

Heineke, J. and Molkentin, J. D. (2006) ‘Regulation of cardiac hypertrophy by intracellular signalling pathways.’, Nat. Rev. Mol. Cell Biol. Nature Publishing Group, 7(8), pp. 589–600.

Hendriks-Balk, M. C., Peters, S. L. M., Michel, M. C. and Alewijnse, A. E. (2008) ‘Regulation of G protein-coupled receptor signalling: Focus on the cardiovascular system and regulator of G protein signalling proteins’, Eur. J. Pharmacol., 585(2–3), pp. 278–291.

Heo, K., Ha, S. H., Chae, Y. C., Lee, S., Oh, Y.-S., Kim, Y.-H., Kim, S.-H., Kim, J. H., Mizoguchi, A., Itoh, T. J., Kwon, H. M., Ryu, S. H. and Suh, P.-G. (2006) ‘RGS2 promotes formation of neurites by stimulating microtubule polymerization’, Cell. Signal., 18(12), pp. 2182–2192.

Hercule, H. C., Tank, J., Plehm, R., Wellner, M., da Costa Goncalves, A. C., Gollasch, M., Diedrich, A., Jordan, J., Luft, F. C. and Gross, V. (2007) ‘Regulator of G protein signalling 2 ameliorates angiotensin II-induced hypertension in mice.’, Exp. Physiol., 92(6), pp. 1014–22.

Hettema, J. M., Sun, C., Chen, X. and Kendler, K. S. (2013) ‘Genetic association study between RGS2 and anxiety-related phenotypes.’, Psychiatr. Genet., 23(2), p. 92.

Heximer, S. P., Knutsen, R. H., Sun, X., Kaltenbronn, K. M., Rhee, M.-H., Peng, N., Oliveira- 44

dos-Santos, A., Penninger, J. M., Muslin, A. J., Steinberg, T. H., Wyss, J. M., Mecham, R. P. and Blumer, K. J. (2003) ‘Hypertension and prolonged vasoconstrictor signaling in RGS2- deficient mice’, J. Clin. Invest., 111(4), pp. 445–452.

Heximer, S. P., Srinivasa, S. P., Bernstein, S., Bernard, J. L., Maurine, E., Hepler, J. R., Blumer, K. J., Bernstein, L. S. and Linder, M. E. (1999) ‘G protein selectivity is a determinant of RGS2 function’, J. Biol. Chem., 274(48), pp. 34253–34259.

Heximer, S. P., Watson, N., Linder, M. E., Blumer, K. J. and Hepler, J. R. (1997) ‘RGS2/G0S8 is a selective inhibitor of Gqalpha function.’, Proc. Natl. Acad. Sci. U. S. A., 94(26), pp. 14389– 93. van Hoeven, K. H. and Factor, S. M. (1990) ‘A comparison of the pathological spectrum of hypertensive, diabetic, and hypertensive-diabetic heart disease.’, Circulation, 82(3), pp. 848– 55.

Huang, Z.-P., Ni, H., Yang, Z.-M., Wang, J., Tso, J.-K. and Shen, Q.-X. (2003) ‘Expression of regulator of G-protein signalling protein 2 (RGS2) in the mouse uterus at implantation sites.’, Reproduction, 126(3), pp. 309–16.

Hunter, J. J. and Chien, K. R. (1999) ‘Signaling Pathways for Cardiac Hypertrophy and Failure’, N. Engl. J. Med., 341(17), pp. 1276–1283.

Hursting, S. D., Lavigne, J. A., Berrigan, D., Perkins, S. N. and Barrett, J. C. (2003) ‘Calorie Restriction, Aging, and Cancer Prevention: Mechanisms of Action and Applicability to Humans’, Annu. Rev. Med. Annual Reviews 4139 El Camino Way, P.O. Box 10139, Palo Alto, CA 94303-0139, USA , 54(1), pp. 131–152.

Huszar, D., Lynch, C. A., Fairchild-Huntress, V., Dunmore, J. H., Fang, Q., Berkemeier, L. R., Gu, W., Kesterson, R. A., Boston, B. A., Cone, R. D., Smith, F. J., Campfield, L. A., Burn, P. and Lee, F. (1997) ‘Targeted Disruption of the Melanocortin-4 Receptor Results in Obesity in Mice’, Cell, 88(1), pp. 131–141.

Ichikawa, K. I., Hidai, C., Okuda, C., Kimata, S. I., Matsuoka, R., Hosoda, S., Quertermous, 45

T. and Kawana, M. (1996) ‘Endogenous endothelin-1 mediates cardiac hypertrophy and switching of myosin heavy chain gene expression in rat ventricular myocardium.’, J. Am. Coll. Cardiol., 27(5), pp. 1286–91.

Imagawa, M., Tsuchiya, T. and Nishihara, T. (1999) ‘Identification of inducible genes at the early stage of adipocyte differentiation of 3T3-L1 Cells’, Biochem. Biophys. Res. Commun., 254(2), pp. 299–305.

Imamura, T., Vollenweider, P., Egawa, K., Clodi, M., Ishibashi, K., Nakashima, N., Ugi, S., Adams, J. W., Brown, J. H. and Olefsky, J. M. (1999) ‘G Alpha-q/11 protein plays a key role in insulin-induced glucose transport in 3T3-L1 adipocytes’, Mol. Cell. Biol., 19(10), pp. 6765– 6774.

Ishii, M., Inanobe, A. and Kurachi, Y. (2002) ‘PIP3 inhibition of RGS protein and its reversal by Ca2+/calmodulin mediate voltage-dependent control of the G protein cycle in a cardiac K+ channel.’, Proc. Natl. Acad. Sci. U. S. A. National Academy of Sciences, 99(7), pp. 4325–30.

Iwai, N., Shimoike, H. and Kinoshita, M. (1995) ‘Cardiac Renin-Angiotensin System in the Hypertrophied Heart’, Circulation, 92(9).

Jackson, R. J., Hellen, C. U. T. and Pestova, T. V. (2010) ‘The mechanism of eukaryotic translation initiation and principles of its regulation’, Nat. Rev. Mol. Cell Biol., 11(2), pp. 113– 127.

Jain, A., Avendano, G., Dharamsey, S., Dasmahapatra, A., Agarwal, R., Reddi, A. and Regan, T. (1996) ‘Left Ventricular Diastolic Function in Hypertension and Role of Plasma Glucose and Insulin’, Circulation, 93(7).

Jayaraman, M., Zhou, H., Jia, L., Cain, M. D. and Blumer, K. J. (2009) ‘R9AP and R7BP: traffic cops for the RGS7 family in phototransduction and neuronal GPCR signaling’, Trends Pharmacol. Sci., 30(1), pp. 17–24.

Jeong, D., Cha, H., Kim, E., Kang, M., Yang, D. K., Kim, J. M., Yoon, P. O., Oh, J. G., Bernecker, O. Y., Sakata, S., Le, T. T., Cui, L., Lee, Y.-H., Kim, D. H., Woo, S.-H., Liao, R., 46

Hajjar, R. J. and Park, W. J. (2006) ‘PICOT Inhibits Cardiac Hypertrophy and Enhances Ventricular Function and Cardiomyocyte Contractility’, Circ. Res., 99(3), pp. 307–314.

Jones, D. L., Tuomi, J. M. and Chidiac, P. (2012) ‘Role of Cholinergic Innervation and RGS2 in Atrial Arrhythmia.’, Front. Physiol., 3, p. 239.

Jørgensen, E. A., Knigge, U., Warberg, J. and Kjaer, A. (2007) ‘Histamine and the regulation of body weight.’, Neuroendocrinology. Karger Publishers, 86(3), pp. 210–4.

Jula, A. M. and Karanko, H. M. (1994) ‘Effects on left ventricular hypertrophy of long-term nonpharmacological treatment with sodium restriction in mild-to-moderate essential hypertension.’, Circulation, 89(3), pp. 1023–31.

Kaplan, N. M. and Douglas, P. S. (2017) ‘Clinical implications and treatment of left ventricular hypertrophy in hypertension’, UptoDate.

Kardestuncer, T., Wu, H., Lim, A. L. and Neer, E. J. (1998) ‘Cardiac myocytes express mRNA for ten RGS proteins: changes in RGS mRNA expression in ventricular myocytes and cultured atria’, FEBS Lett., 438(3), pp. 285–288.

Kee, H. J., Sohn, I. S., Nam, K. Il, Park, J. E., Qian, Y. R., Yin, Z., Ahn, Y., Jeong, M. H., Bang, Y.-J., Kim, N., Kim, J.-K., Kim, K. K., Epstein, J. A. and Kook, H. (2006) ‘Inhibition of Histone Deacetylation Blocks Cardiac Hypertrophy Induced by Angiotensin II Infusion and Aortic Banding’, Circulation, 113(1).

Kehrl, J. H. and Sinnarajah, S. (2002) ‘RGS2: a multifunctional regulator of G-protein signaling.’, Int. J. Biochem. Cell Biol., 34(5), pp. 432–8.

Kerkelä, R., Woulfe, K. and Force, T. (2007) ‘Glycogen Synthase Kinase-3β—Actively Inhibiting Hypertrophy’, Trends Cardiovasc. Med., 17(3), pp. 91–96.

Kim, M. K., Reaven, G. M., Chen, Y.-D. I., Kim, E. and Kim, S. H. (2015) ‘Hyperinsulinemia in individuals with obesity: Role of insulin clearance’, Obesity, 23(12), pp. 2430–2434.

Kleijn, M., Welsh, G. I., Scheper, G. C., Voorma, H. O., Proud, C. G. and Thomas, A. A. 47

(1998) ‘Nerve and epidermal growth factor induce protein synthesis and eIF2B activation in PC12 cells.’, J. Biol. Chem. American Society for Biochemistry and Molecular Biology, 273(10), pp. 5536–41.

Klein, S., Burke, L. E., Bray, G. A., Blair, S., Allison, D. B., Pi-Sunyer, X., Hong, Y., Eckel, R. H. and American Heart Association Council on Nutrition, Physical Activity, and Metabolism (2004) ‘Clinical Implications of Obesity With Specific Focus on Cardiovascular Disease: A Statement for Professionals From the American Heart Association Council on Nutrition, Physical Activity, and Metabolism: Endorsed by the American College of Cardiology Foundation’, Circulation, 110(18), pp. 2952–2967.

Klingbeil, A. U., Schneider, M., Martus, P., Messerli, F. H. and Schmieder, R. E. (2003) ‘A meta-analysis of the effects of treatment on left ventricular mass in essential hypertension.’, Am. J. Med., 115(1), pp. 41–6.

Knoers, N. V. A. M. and Levtchenko, E. N. (2008) ‘Gitelman syndrome.’, Orphanet J. Rare Dis. BioMed Central, 3, p. 22.

Koren, M. J., Devereux, R. B., Casale, P. N., Savage, D. D. and Laragh, J. H. (1991) ‘Relation of left ventricular mass and geometry to morbidity and mortality in uncomplicated essential hypertension.’, Ann. Intern. Med., 114(5), pp. 345–52.

Kromer, W. (1988) ‘Endogenous and exogenous opioids in the control of gastrointestinal motility and secretion.’, Pharmacol. Rev., 40(2).

Kubant, R., Poon, A. N., Sánchez-Hernández, D., Domenichiello, A. F., Huot, P. S. P., Pannia, E., Cho, C. E., Hunschede, S., Bazinet, R. P. and Anderson, G. H. (2015) ‘A comparison of effects of lard and hydrogenated vegetable shortening on the development of high-fat diet- induced obesity in rats’, Nutr. Diabetes. Nature Publishing Group, 5(12), p. e188.

Kudej, R. K., Iwase, M., Uechi, M., Vatner, D. E., Oka, N., Ishikawa, Y., Shannon, R. P., Bishop, S. P. and Vatner, S. F. (1997) ‘Effects of Chronicβ-Adrenergic Receptor Stimulation in Mice’, J. Mol. Cell. Cardiol., 29(10), pp. 2735–2746.

Kuwahara, K., Nishikimi, T. and Nakao, K. (2012) ‘Transcriptional Regulation of the Fetal Cardiac Gene Program’, J. Pharmacol. Sci., 119(3), pp. 198–203.

Lambert, E. A., Rice, T., Eikelis, N., Straznicky, N. E., Lambert, G. W., Head, G. A., Hensman, C., Schlaich, M. P. and Dixon, J. B. (2014) ‘Sympathetic Activity and Markers of Cardiovascular Risk in Nondiabetic Severely Obese Patients: The Effect of the Initial 10% Weight Loss’, Am. J. Hypertens., 27(10), pp. 1308–1315. de Lange, P., Lanni, A., Beneduce, L., Moreno, M., Lombardi, A., Silvestri, E. and Goglia, F. (2001) ‘Uncoupling Protein-3 Is a Molecular Determinant for the Regulation of Resting Metabolic Rate by Thyroid Hormone’, Endocrinology, 142(8), pp. 3414–3420.

Larminie, C., Murdock, P., Walhin, J.-P., Duckworth, M., Blumer, K. J., Scheideler, M. A. and Garnier, M. (2004) ‘Selective expression of regulators of G-protein signaling (RGS) in the human central nervous system’, Mol. Brain Res., 122(1), pp. 24–34.

Levy, D., Anderson, K. M., Savage, D. D., Kannel, W. B., Christiansen, J. C. and Castelli, W. P. (1988) ‘Echocardiographically Detected Left Ventricular Hypertrophy: Prevalence and Risk Factors’, Ann. Intern. Med. American College of Physicians, 108(1), p. 7.

Levy, D., Garrison, R. J., Savage, D. D., Kannel, W. B. and Castelli, W. P. (1989) ‘Left ventricular mass and incidence of coronary heart disease in an elderly cohort. The Framingham Heart Study.’, Ann. Intern. Med., 110(2), pp. 101–7.

Levy, D., Garrison, R. J., Savage, D. D., Kannel, W. B. and Castelli, W. P. (1990) ‘Prognostic Implications of Echocardiographically Determined Left Ventricular Mass in the Framingham Heart Study’, N. Engl. J. Med., 322(22), pp. 1561–1566.

Li, H., He, C., Feng, J., Zhang, Y., Tang, Q., Bian, Z., Bai, X., Zhou, H., Jiang, H., Heximer, S. P., Qin, M., Huang, H., Liu, P. P. and Huang, C. (2010) ‘Regulator of G protein signaling 5 protects against cardiac hypertrophy and fibrosis during biomechanical stress of pressure overload.’, Proc. Natl. Acad. Sci. U. S. A. National Academy of Sciences, 107(31), pp. 13818– 23.

Liebson, P. R., Grandits, G., Prineas, R., Dianzumba, S., Flack, J. M., Cutler, J. A., Grimm, R. and Stamler, J. (1993) ‘Echocardiographic correlates of left ventricular structure among 844 mildly hypertensive men and women in the Treatment of Mild Hypertension Study (TOMHS).’, Circulation, 87(2), pp. 476–86.

Lightwood, J., Bibbins-Domingo, K., Coxson, P., Wang, Y. C., Williams, L. and Goldman, L. (2009) ‘Forecasting the Future Economic Burden of Current Adolescent Overweight: An Estimate of the Coronary Heart Disease Policy Model’, Am. J. Public Health, 99(12), pp. 2230–2237.

Lionetti, L., Mollica, M. P., Donizzetti, I., Gifuni, G., Sica, R., Pignalosa, A., Cavaliere, G., Gaita, M., De Filippo, C., Zorzano, A. and Putti, R. (2014) ‘High-Lard and High-Fish-Oil Diets Differ in Their Effects on Function and Dynamic Behaviour of Rat Hepatic Mitochondria’, PLoS One. Edited by M. Jekabsons. Public Library of Science, 9(3), p. e92753.

Lloyd-Jones, D. M., Hong, Y., Labarthe, D., Mozaffarian, D., Appel, L. J., Van Horn, L., Greenlund, K., Daniels, S., Nichol, G., Tomaselli, G. F., Arnett, D. K., Fonarow, G. C., Ho, P. M., Lauer, M. S., Masoudi, F. A., Robertson, R. M., Roger, V., Schwamm, L. H., Sorlie, P., Yancy, C. W. and Rosamond, W. D. (2010) ‘Defining and Setting National Goals for Cardiovascular Health Promotion and Disease Reduction’, Circulation, 121(4).

Lorell, B. H. and Carabello, B. A. (2000) ‘Left Ventricular Hypertrophy Pathogenesis, Detection, and Prognosis’, Circulation, 102(4), pp. 470–479.

Lundberg, J. M., Tatemoto, K., Terenius, L., Hellstrom, P. M., Muttr, V., Hokfelti, T. and Hambergerii, B. (1982) ‘Localization of peptide YY (PYY) in gastrointestinal endocrine cells and effects on intestinal blood flow and motility (distal intestine/pancreatic polypeptides)’, 79, pp. 4471–4475.

Ma, P. and Zemmel, R. (2002) ‘From the analyst’s couch: Value of novelty?’, Nat. Rev. Drug Discov. Nature Publishing Group, 1(8), pp. 571–572.

MacMahon, S. W., Wilcken, D. E. L. and Macdonald, G. J. (1986) ‘The Effect of Weight

Reduction on Left Ventricular Mass’, N. Engl. J. Med. Massachusetts Medical Society , 314(6), pp. 334–339.

Magri, T. P. R., Fernandes, F. S., Souza, A. S., Langhi, L. G. P., Barboza, T., Misan, V., Mucci, D. B., Santos, R. M., Nunes, T. F., Souza, S. A. L., de Mello Coelho, V. and Tavares do Carmo, M. das G. (2015) ‘Interesterified fat or palm oil as substitutes for partially hydrogenated fat in maternal diet can predispose obesity in adult male offspring’, Clin. Nutr., 34(5), pp. 904–910.

Maron, B. J. (2002) ‘Hypertrophic cardiomyopathy: a systematic review.’, JAMA, 287(10), pp. 1308–20.

Marsili, A., Aguayo-Mazzucato, C., Chen, T., Kumar, A., Chung, M., Lunsford, E. P., Harney, J. W., Van-Tran, T., Gianetti, E., Ramadan, W., Chou, C., Bonner-Weir, S., Larsen, P. R., Silva, J. E. and Zavacki, A. M. (2011) ‘Mice with a Targeted Deletion of the Type 2 Deiodinase Are Insulin Resistant and Susceptible to Diet Induced Obesity’, PLoS One. Edited by A. Bartolomucci, 6(6), p. e20832.

Martinez, M. A., Sancho, T., Armada, E., Rubio, J. M., Antón, J. L., Torre, A., Palau, J., Seguido, P., Gallo, J., Saenz, I., Polo, E., Torres, R., Oliver, J., Puig, J. G. and Vascular Risk Working Group Grupo Monitorizacíon Ambulatoria de la Presión Arterial (MAPA)-Madrid (2003) ‘Prevalence of left ventricular hypertrophy in patients with mild hypertension in primary care: impact of echocardiography on cardiovascular risk stratification.’, Am. J. Hypertens., 16(7), pp. 556–63.

Masoro, E. J. (2000) ‘Caloric restriction and aging: an update’, Exp. Gerontol., 35(3), pp. 299– 305.

McCarter, R., Masoro, E. J. and Yu, B. P. (1985) ‘Does food restriction retard aging by reducing the metabolic rate?’, Am. J. Physiol. - Endocrinol. Metab., 248(4).

McMullen, J. R. and Jennings, G. L. (2007) ‘Differences between pathological and physiological cardiac hypertrophy: novel therapeutic strategies to treat heart failure.’, Clin. Exp. Pharmacol. Physiol., 34(4), pp. 255–62.

McMullen, J. R., Shioi, T., Zhang, L., Tarnavski, O., Sherwood, M. C., Kang, P. M. and Izumo, S. (2003) ‘Phosphoinositide 3-kinase(p110 ) plays a critical role for the induction of physiological, but not pathological, cardiac hypertrophy’, Proc. Natl. Acad. Sci., 100(21), pp. 12355–12360.

Mebis, L., Paletta, D., Debaveye, Y., Ellger, B., Langouche, L., D’Hoore, A., Darras, V. M., Visser, T. J. and Van den Berghe, G. (2009) ‘Expression of thyroid hormone transporters during critical illness’, Eur. J. Endocrinol., 161(2), pp. 243–250.

Mende, U., Kagen, A., Cohen, A., Aramburu, J., Schoen, F. J. and Neer, E. J. (1998) ‘Transient cardiac expression of constitutively active Galphaq leads to hypertrophy and dilated cardiomyopathy by calcineurin-dependent and independent pathways.’, Proc. Natl. Acad. Sci. U. S. A., 95(23), pp. 13893–8.

Merentie, M., Lottonen-Raikaslehto, L., Parviainen, V., Huusko, J., Pikkarainen, S., Mendel, M., Laham-Karam, N., Kärjä, V., Rissanen, R., Hedman, M. and Ylä-Herttuala, S. (2016) ‘Efficacy and safety of myocardial gene transfer of adenovirus, adeno-associated virus and lentivirus vectors in the mouse heart’, Gene Ther. Nature Publishing Group, 23(3), pp. 296– 305.

Miao, R., Lu, Y., Xing, X., Li, Y., Huang, Z., Zhong, H., Huang, Y., Chen, A. F., Tang, X., Li, H., Cai, J. and Yuan, H. (2016) ‘Regulator of G-Protein Signaling 10 Negatively Regulates Cardiac Remodeling by Blocking Mitogen-Activated Protein Kinase-Extracellular Signal- Regulated Protein Kinase 1/2 Signaling.’, Hypertension, 67(1), pp. 86–98.

Miles, R. R., Sluka, J. P., Santerre, R. F., Hale, L. V, Bloem, L., Boguslawski, G., Thirunavukkarasu, K., Hock, J. M. and Onyia, J. E. (2000) ‘Dynamic regulation of RGS2 in bone: potential new insights into parathyroid hormone signaling mechanisms’, Endocrinology, 141(1), pp. 28–36.

Mills, I., Barge, R. M., Silva, J. E. and Larsen, P. R. (1987) ‘Insulin stimulation of iodothyronine 5′-deiodinase in rat brown adipocytes’, Biochem. Biophys. Res. Commun., 143(1), pp. 81–86.

Mittmann, C., Chung, C. H., Höppner, G., Michalek, C., Nose, M., Schüler, C., Schuh, A., Eschenhagen, T., Weil, J., Pieske, B., Hirt, S. and Wieland, T. (2002) ‘Expression of ten RGS proteins in human myocardium: Functional characterization of an upregulation of RGS4 in heart failure’, Cardiovasc. Res., 55(4), pp. 778–786.

Mohammed, S. F., Storlie, J. R., Oehler, E. A., Bowen, L. A., Korinek, J., Lam, C. S. P., Simari, R. D., Burnett, J. C. and Redfield, M. M. (2012) ‘Variable phenotype in murine transverse aortic constriction’, Cardiovasc. Pathol., 21(3), pp. 188–198.

Morley, J. E., Flood, J. F., Farr, S. A., Perry, H. J. rd, Kaiser, F. E. and Morley, P. M. (1995) ‘Effects of amylin on appetite regulation and memory’, Can. J. Physiol. Pharmacol., 73(7), pp. 1042–1046.

Mozaffarian, D., Benjamin, E. J., Go, A. S., Arnett, D. K., Blaha, M. J., Cushman, M., Das, S. R., de Ferranti, S., Després, J.-P., Fullerton, H. J., Howard, V. J., Huffman, M. D., Isasi, C. R., Jiménez, M. C., Judd, S. E., Kissela, B. M., Lichtman, J. H., Lisabeth, L. D., Liu, S., Mackey, R. H., Magid, D. J., McGuire, D. K., Mohler, E. R., Moy, C. S., Muntner, P., Mussolino, M. E., Nasir, K., Neumar, R. W., Nichol, G., Palaniappan, L., Pandey, D. K., Reeves, M. J., Rodriguez, C. J., Rosamond, W., Sorlie, P. D., Stein, J., Towfighi, A., Turan, T. N., Virani, S. S., Woo, D., Yeh, R. W. and Turner, M. B. (2016) ‘Heart Disease and Stroke Statistics—2016 Update’, Circulation, 133(4).

Nambu, H., Fukushima, M., Hikichi, H., Inoue, T., Nagano, N., Tahara, Y., Nambu, T., Ito, J., Ogawa, Y., Ozaki, S. and Ohta, H. (2011) ‘Characterization of metabolic phenotypes of mice lacking GPR61, an orphan G-protein coupled receptor’, Life Sci., 89(21–22), pp. 765–772.

Nguyen, C. H., Ming, H., Zhao, P., Hugendubler, L., Gros, R., Kimball, S. R. and Chidiac, P. (2009) ‘Translational control by RGS2’, J. Cell Biol., 186(5), pp. 755–765.

Nguyen, C. H., Zhao, P., Sobiesiak, A. J. and Chidiac, P. (2012) ‘RGS2 is a component of the cellular stress response’, Biochem. Biophys. Res. Commun., 426(1), pp. 129–134.

Nishizuka, M., Honda, K., Tsuchiya, T., Nishihara, T. and Imagawa, M. (2001) ‘RGS2

promotes adipocyte differentiation in the presence of ligand for peroxisome proliferator- activated receptor γ’, J. Biol. Chem. American Society for Biochemistry and Molecular Biology, 276(32), pp. 29625–29627.

Norton, G. R., Woodiwiss, A. J., Gaasch, W. H., Mela, T., Chung, E. S., Aurigemma, G. P. and Meyer, T. E. (2002) ‘Heart failure in pressure overload hypertrophy. The relative roles of ventricular remodeling and myocardial dysfunction.’, J. Am. Coll. Cardiol., 39(4), pp. 664–71.

Nunn, C., Zhao, P., Zou, M.-X., Summers, K., Guglielmo, C. G. and Chidiac, P. (2011) ‘Resistance to age-related, normal body weight gain in RGS2 deficient mice’, Cell. Signal., 23(8), pp. 1375–1386.

Nunn, C., Zou, M.-X., Sobiesiak, A. J., Roy, A. A., Kirshenbaum, L. A. and Chidiac, P. (2010) ‘RGS2 inhibits β-adrenergic receptor-induced cardiomyocyte hypertrophy’, Cell. Signal., 22(8), pp. 1231–1239.

Okin, P. M., Wachtell, K., Devereux, R. B., Harris, K. E., Jern, S., Kjeldsen, S. E., Julius, S., Lindholm, L. H., Nieminen, M. S., Edelman, J. M., Hille, D. A. and Dahlöf, B. (2006) ‘Regression of Electrocardiographic Left Ventricular Hypertrophy and Decreased Incidence of New-Onset Atrial Fibrillation in Patients With Hypertension’, JAMA, 296(10), p. 1242.

Oldham, W. M. and Hamm, H. E. (2008) ‘Heterotrimeric G protein activation by G-protein- coupled receptors’, Nat. Rev. Mol. Cell Biol., 9(1), pp. 60–71.

Oliveira-Dos-Santos, A. J., Matsumoto, G., Snow, B. E., Bai, D., Houston, F. P., Whishaw, I. Q., Mariathasan, S., Sasaki, T., Wakeham, A., Ohashi, P. S., Roder, J. C., Barnes, C. A., Siderovski, D. P. and Penninger, J. M. (2000) ‘Regulation of T cell activation, anxiety, and male aggression by RGS2.’, Proc. Natl. Acad. Sci. U. S. A., 97(22), pp. 12272–7.

Os, I., Franco, V., Kjeldsen, S. E., Manhem, K., Devereux, R. B., Gerdts, E., Hille, D. A., Lyle, P. A., Okin, P. M., Dahlof, B. and Oparil, S. (2008) ‘Effects of Losartan in Women With Hypertension and Left Ventricular Hypertrophy: Results From the Losartan Intervention For Endpoint Reduction in Hypertension Study’, Hypertension, 51(4), pp. 1103–1108.

Osei-Owusu, P. and Blumer, K. J. (2015) ‘Regulator of G Protein Signaling 2: A Versatile Regulator of Vascular Function.’, Prog. Mol. Biol. Transl. Sci. NIH Public Access, 133, pp. 77–92.

Osei-Owusu, P., Sabharwal, R., Kaltenbronn, K. M., Rhee, M.-H., Chapleau, M. W., Dietrich, H. H. and Blumer, K. J. (2012) ‘Regulator of G protein signaling 2 deficiency causes endothelial dysfunction and impaired endothelium-derived hyperpolarizing factor-mediated relaxation by dysregulating Gi/o signaling’, J. Biol. Chem., 287(15), pp. 12541–12549.

Osei-Owusu, P., Sun, X., Drenan, R. M., Steinberg, T. H. and Blumer, K. J. (2007) ‘Regulation of RGS2 and second messenger signaling in vascular smooth muscle cells by cGMP-dependent protein kinase.’, J. Biol. Chem. American Society for Biochemistry and Molecular Biology, 282(43), pp. 31656–65.

Ostman-Smith, I. (1981) ‘Cardiac sympathetic nerves as the final common pathway in the induction of adaptive cardiac hypertrophy.’, Clin. Sci. (Lond)., 61(3), pp. 265–72.

Owen, V., Burton, P. B. ., Mullen, A. ., Birks, E. ., Barton, P. and Yacoub, M. . (2001) ‘Expression of RGS3, RGS4 and Gi alpha 2 in acutely failing donor hearts and end-stage heart failure’, Eur. Heart J. Oxford University Press, 22(12), pp. 1015–1020.

Park-Windhol, C., Zhang, P., Zhu, M., Su, J., Chaves, L., Maldonado, A. E., King, M. E., Rickey, L., Cullen, D. and Mende, U. (2012) ‘Gq/11-Mediated Signaling and Hypertrophy in Mice with Cardiac-Specific Transgenic Expression of Regulator of G-Protein Signaling 2’, PLoS One, 7(7), p. e40048.

Paton, W., Vizi, E., Zar, A. and al., et (1971) ‘The mechanism of acetylcholine release from parasympathetic nerves’, J Physiol. Academic Publishing House, Budapest, 215(2), pp. 819– 848.

Patten, R. D. and Hall-Porter, M. R. (2009) ‘Small Animal Models of Heart Failure’, Circ. Hear. Fail., 2(2).

Pluim, B. M., Zwinderman, A. H., van der Laarse, A. and van der Wall, E. E. (2000) ‘The 55

athlete’s heart. A meta-analysis of cardiac structure and function.’, Circulation, 101(3), pp. 336–44.

Poirier, P., Giles, T. D., Bray, G. A., Hong, Y., Stern, J. S., Pi-Sunyer, F. X., Eckel, R. H., American Heart Association and Obesity Committee of the Council on Nutrition, Physical Activity, and Metabolism (2006) ‘Obesity and Cardiovascular Disease: Pathophysiology, Evaluation, and Effect of Weight Loss: An Update of the 1997 American Heart Association Scientific Statement on Obesity and Heart Disease From the Obesity Committee of the Council on Nutrition, Physical Activity, and Metabolism’, Circulation, 113(6), pp. 898–918.

Popov, S., Yu, K., Kozasa, T. and Wilkie, T. M. (1997) ‘The regulators of G protein signaling (RGS) domains of RGS4, RGS10, and GAIP retain GTPase activating protein activity in vitro.’, Proc. Natl. Acad. Sci. U. S. A., 94(14), pp. 7216–20.

Posokhova, E., Wydeven, N., Allen, K. L., Wickman, K. and Martemyanov, K. A. (2010) ‘RGS6/Gβ5 Complex Accelerates IKACh Gating Kinetics in Atrial Myocytes and Modulates Parasympathetic Regulation of Heart RateNovelty and Significance’, Circ. Res., 107(11).

Proud, C. G. (2007) ‘Signalling to translation: how signal transduction pathways control the protein synthetic machinery’, Biochem. J., 403(2), p. 217.

Re, R. N. (2003) ‘Intracellular renin and the nature of intracrine enzymes.’, Hypertens. (Dallas, Tex. 1979), 42(2), pp. 117–22.

Reimer, M. K., Holst, J. J. and Ahrén, B. (2002) ‘Long-term inhibition of dipeptidyl peptidase IV improves glucose tolerance and preserves islet function in mice.’, Eur. J. Endocrinol., 146(5), pp. 717–27.

Reisin, E., Frohlich, E. D., Messerli, F. H., Dreslinski, G. R., Dunn, F. G., Jones, M. M. and Batson, H. M. (1983) ‘Cardiovascular changes after weight reduction in obesity hypertension.’, Ann. Intern. Med., 98(3), pp. 315–9.

Riddle, E. L., Rana, B. K., Murthy, K. K., Rao, F., Eskin, E., O’Connor, D. T., Insel, P. A., O’Connor, D. T. and Insel, P. A. (2006) ‘Polymorphisms and Haplotypes of the Regulator of 56

G Protein Signaling-2 Gene in Normotensives and Hypertensives’, Hypertension, 47(3), pp. 415–420.

Riddle, E. L., Schwartzman, R. A., Bond, M. and Insel, P. A. (2005) ‘Multi-Tasking RGS Proteins in the Heart’, Circ. Res., 96(4).

Rockman, H. A., Koch, W. J. and Lefkowitz, R. J. (2002) ‘Seven-transmembrane-spanning receptors and heart function’, Nature, 415(6868), pp. 206–212.

Rockman, H. A., Ross, R. S., Harris, A. N., Knowlton, K. U., Steinhelper, M. E., Field, L. J., Ross, J. and Chien, K. R. (1991) ‘Segregation of atrial-specific and inducible expression of an atrial natriuretic factor transgene in an in vivo murine model of cardiac hypertrophy.’, Proc. Natl. Acad. Sci. U. S. A., 88(18), pp. 8277–81.

Rogers, J. H., Tsirka, A., Kovacs, A., Blumer, K. J., Dorn, G. W. and Muslin, A. J. (2001) ‘RGS4 reduces contractile dysfunction and hypertrophic gene induction in Galpha q overexpressing mice.’, J. Mol. Cell. Cardiol., 33(2), pp. 209–18.

Rolfe, M., McLEOD, L. E., Pratt, P. F. and Proud, C. G. (2005) ‘Activation of protein synthesis in cardiomyocytes by the hypertrophic agent phenylephrine requires the activation of ERK and involves phosphorylation of tuberous sclerosis complex 2 (TSC2)’, Biochem. J., 388(3), p. 973.

Rose, S. and Nelson, J. (1995) ‘A continuous long-term injector’, Immunol. Cell Biol., 33, pp. 415–420.

Ross, E. M. and Wilkie, T. M. (2000) ‘GTPase-activating proteins for heterotrimeric G proteins: Regulators of G protein signaling (RGS) and RGS-like proteins’, Annu Rev Biochem, 69(1), pp. 795–827.

Roy, A. A., Baragli, A., Bernstein, L. S., Hepler, J. R., Hébert, T. E. and Chidiac, P. (2006) ‘RGS2 interacts with Gs and adenylyl cyclase in living cells’, Cell. Signal., 18(3), pp. 336– 348.

Roy, A. A., Nunn, C., Ming, H., Zou, M.-X. X., Penninger, J., Kirshenbaum, L. A., Dixon, S. J. and Chidiac, P. (2006) ‘Up-regulation of endogenous RGS2 mediates cross-desensitization between Gs and Gq signaling in osteoblasts.’, J. Biol. Chem., 281(43), pp. 32684–93.

Saadane, N., Alpert, L. and Chalifour, L. E. (1999) ‘Expression of immediate early genes, GATA-4, and Nkx-2.5 in adrenergic-induced cardiac hypertrophy and during regression in adult mice’, Br. J. Pharmacol., 127(5), pp. 1165–1176.

Salim, S., Sinnarajah, S., Kehrl, J. H. and Dessauer, C. W. (2003) ‘Identification of RGS2 and type V adenylyl cyclase interaction sites.’, J. Biol. Chem. American Society for Biochemistry and Molecular Biology, 278(18), pp. 15842–9.

Salvatore, D., Larsen, P. R., Salvatore, D., Simonides, W. S., Dentice, M., Zavacki, A. M. and Larsen, P. R. (2013) ‘Thyroid hormones and skeletal muscle —new insights and potential implications’, Nat. Rev. Endocrinol, 10, pp. 206–214.

Sarganas, G., Garbe, E., Klimpel, A., Hering, R. C., Bronder, E. and Haverkamp, W. (2014) ‘Epidemiology of symptomatic drug-induced long QT syndrome and torsade de pointes in Germany’, Europace. Oxford University Press, 16(1), pp. 101–108.

Sartori, M., Ceolotto, G., Dorigatti, F., Mos, L., Santonastaso, M., Bratti, P., Papparella, I., Semplicini, A., Palatini, P. and HARVEST Group (2008) ‘RGS2 C1114G polymorphism and body weight gain in hypertensive patients’, 57(3), pp. 421–427.

Sasson, Z., Rasooly, Y., Bhesania, T. and Rasooly, I. (1993) ‘Insulin resistance is an important determinant of left ventricular mass in the obese.’, Circulation, 88(4).

Schaumann, W. (1955) ‘The paralysing action of morphine on the guinea-pig ileum’, J. Pharmacol, 10, pp. 456–461.

Schnall, P. L., Pieper, C., Schwartz, J. E., Karasek, R. A., Schlussel, Y., Devereux, R. B., Ganau, A., Alderman, M., Warren, K. and Pickering, T. G. (1990) ‘The Relationship Between “Job Strain,” Workplace Diastolic Blood Pressure, and Left Ventricular Mass Index’, JAMA. American Medical Association, 263(14), p. 1929. 58

Schoeber, J. P., Topala, C. N., Wang, X., Diepens, R. J., Lambers, T. T., Hoenderop, J. G. and Bindels, R. J. (2006) ‘RGS2 inhibits the epithelial Ca 2+ channel TRPV6’, J. Biol. Chem., 281(40), pp. 29669–29674.

Schou, M., Gustafsson, F., Videbaek, L., Tuxen, C., Keller, N., Handberg, J., Knudsen, A. S., Espersen, G., Markenvard, J., Egstrup, K., Ulriksen, H. and Hildebrandt, P. R. (2013) ‘Extended heart failure clinic follow-up in low-risk patients: a randomized clinical trial (NorthStar)’, Eur. Heart J., 34(6), pp. 432–442.

Schunkert, H., Hense, H. W., Holmer, S. R., Stender, M., Perz, S., Keil, U., Lorell, B. H. and Riegger, G. A. (1994) ‘Association between a deletion polymorphism of the angiotensin- converting-enzyme gene and left ventricular hypertrophy.’, N. Engl. J. Med., 330(23), pp. 1634–8.

Semplicini, A., Lenzini, L., Sartori, M., Papparella, I., Calò, L. A., Pagnin, E., Strapazzon, G., Benna, C., Costa, R., Avogaro, A., Ceolotto, G. and Pessina, A. C. (2006) ‘Reduced expression of regulator of G-protein signaling 2 (RGS2) in hypertensive patients increases calcium mobilization and ERK1/2 phosphorylation induced by angiotensin II’, J. Hypertens., 24(6), pp. 1115–1124.

Sen, S. (1983) ‘Regression of cardiac hypertrophy. Experimental animal model.’, Am. J. Med., 75(3A), pp. 87–93.

Seravalle, G., Colombo, M., Perego, P., Giardini, V., Volpe, M., Dell’Oro, R., Mancia, G. and Grassi, G. (2014) ‘Long-Term Sympathoinhibitory Effects of Surgically Induced Weight Loss in Severe Obese PatientsNovelty and Significance’, Hypertension, 64(2).

Sethakorn, N., Yau, D. M. and Dulin, N. O. (2010) ‘Non-canonical functions of RGS proteins.’, Cell. Signal., 22(9), pp. 1274–81.

Shimada, M., Tritos, N. A., Lowell, B. B., Flier, J. S. and Maratos-Flier, E. (1998) ‘Mice lacking melanin-concentrating hormone are hypophagic and lean.’, Nature. Plenum, 396(December), pp. 670–674.

Shimizu, I. and Minamino, T. (2016) ‘Physiological and pathological cardiac hypertrophy’, J. Mol. Cell. Cardiol., 97, pp. 245–262.

Shioi, T., Kang, P. M., Douglas, P. S., Hampe, J., Yballe, C. M., Lawitts, J., Cantley, L. C. and Izumo, S. (2000) ‘The conserved phosphoinositide 3-kinase pathway determines heart size in mice.’, EMBO J. European Molecular Biology Organization, 19(11), pp. 2537–48.

Silva, A. P. S., Guimarães, D. E. D., Mizurini, D. M., Maia, I. C., Ortiz-Costa, S., Sardinha, F. L. and Tavares do Carmo, M. G. (2006) ‘Dietary fatty acids early in life affect lipid metabolism and adiposity in young rats’, Lipids. Springer-Verlag, 41(6), pp. 535–541.

Simonides, W. S., Brent, G. A., Thelen, M. H., van der Linden, C. G., Larsen, P. R. and van Hardeveld, C. (1996) ‘Characterization of the promoter of the rat sarcoplasmic endoplasmic reticulum Ca2+-ATPase 1 gene and analysis of thyroid hormone responsiveness.’, J. Biol. Chem., 271(50), pp. 32048–56.

Simpson, P. (1983) ‘Norepinephrine-stimulated hypertrophy of cultured rat myocardial cells is an alpha 1 adrenergic response.’, J. Clin. Invest., 72(2), pp. 732–738.

Singh, C. R., Lee, B., Udagawa, T., Mohammad-Qureshi, S. S., Yamamoto, Y., Pavitt, G. D. and Asano, K. (2006) ‘An eIF5/eIF2 complex antagonizes guanine nucleotide exchange by eIF2B during translation initiation’, EMBO J., 25(19), pp. 4537–4546.

Sjögren, B., Blazer, L. L. and Neubig, R. R. (2010) ‘Regulators of G protein signaling proteins as targets for drug discovery.’, Prog. Mol. Biol. Transl. Sci., 91, pp. 81–119.

Sjögren, B., Parra, S., Atkins, K. B., Karaj, B., Neubig, R. R., Sjogren, B., Parra, S., Atkins, K. B., Karaj, B. and Neubig, R. R. (2016) ‘Digoxin-mediated up-regulation of RGS2 protein protects against cardiac injury’, J. Pharmacol. Exp. Ther., 357(2).

Sjogren, B., Parra, S., Heath, L. J., Atkins, K. B., Xie, Z. and Neubig, R. (2012) ‘Cardiotonic Steroids Stabilize RGS2 Protein Levels’, Mol. Pharmacol., p. mol.112.079293.

Snow, B. E., Krumins, A. M., Brothers, G. M., Lee, S.-F., Wall, M. A., Chung, S., Mangion,

J., Arya, S., Gilman, A. G. and Siderovski, D. P. (1998) ‘A G protein ␥ subunit-like domain shared between RGS11 and other RGS proteins specifies binding to G ␥5 subunits’, Pharmacology, 95, pp. 13307–13312.

Solanes, G., Pedraza, N., Calvo, V., Vidal-puig, A., Lowell, bradford b. and Villarroya, F. (2005) ‘Thyroid hormones directly activate the expression of the human and mouse uncoupling protein-3 genes through a thyroid response element in the proximal promoter region’, Biochem. J., 386(3), pp. 505–513.

Solomon, S. D., Appelbaum, E., Manning, W. J., Verma, A., Berglund, T., Lukashevich, V., Cherif Papst, C., Smith, B. A., Dahlof, B. and Aliskiren in Left Ventricular Hypertrophy (ALLAY) Trial Investigators (2009) ‘Effect of the Direct Renin Inhibitor Aliskiren, the Angiotensin Receptor Blocker Losartan, or Both on Left Ventricular Mass in Patients With Hypertension and Left Ventricular Hypertrophy’, Circulation, 119(4), pp. 530–537.

Song, L., De Sarno, P. and Jope, R. S. (1999) ‘Muscarinic receptor stimulation increases regulators of G-protein signaling 2 mRNA levels through a protein kinase C-dependent mechanism.’, J. Biol. Chem., 274(42), pp. 29689–93.

Soonpaa, M. H. and Field, L. J. (1994) ‘Assessment of cardiomyocyte DNA synthesis during hypertrophy in adult mice’, Am. J. Physiol. - Hear. Circ. Physiol., 266(4), pp. H1439–H1445.

Stamler, J. (1997) ‘Effects of Weight Loss and Sodium Reduction Intervention on Blood Pressure and Hypertension Incidence in Overweight People With High-Normal Blood Pressure’, Arch. Intern. Med. American Medical Association, 157(6), p. 657.

Sun, X., Kaltenbronn, K. M., Steinberg, T. H. and Blumer, K. J. (2005) ‘RGS2 Is a Mediator of Nitric Oxide Action on Blood Pressure and Vasoconstrictor Signaling’, Mol. Pharmacol., 67(3).

Surwit, R. S., Kuhn, C. M., Cochrane, C., McCubbin, J. A. and Feinglos, M. N. (1988) ‘Diet- Induced Type II Diabetes in C57BL/6J Mice’, Diabetes, 37(9).

Taegtmeyer, H., Sen, S. and Vela, D. (2010) ‘Return to the fetal gene program: a suggested 61

metabolic link to gene expression in the heart.’, Ann. N. Y. Acad. Sci. NIH Public Access, 1188, pp. 191–8.

Takeishi, Y., C.R., B., B., R., K.B., M., E.A., R., D., B. and Walsh, R. A. (2000) ‘Alterations in Ca2+ cycling proteins and Gαq signaling after left ventricular assist device support in failing human hearts’, Cardiovasc. Res. Oxford University Press, 45(4), pp. 883–888.

Takimoto, E. (2011) ‘cGMP-PKG upregulates PGC1α and improves cardiac function in advanced cardiac hypertrophy independently of RGS2’, BMC Pharmacol. BioMed Central, 11(Suppl 1), p. O18.

Takimoto, E., Champion, H. C., Li, M., Belardi, D., Ren, S., Rodriguez, E. R., Bedja, D., Gabrielson, K. L., Wang, Y. and Kass, D. A. (2005) ‘Chronic inhibition of cyclic GMP phosphodiesterase 5A prevents and reverses cardiac hypertrophy’, Nat. Med., 11(2), pp. 214– 222.

Takimoto, E., Koitabashi, N., Hsu, S., Ketner, E. A., Zhang, M., Nagayama, T., Bedja, D., Gabrielson, K. L., Blanton, R., Siderovski, D. P., Mendelsohn, M. E. and Kass, D. A. (2009) ‘Regulator of G protein signaling 2 mediates cardiac compensation to pressure overload and antihypertrophic effects of PDE5 inhibition in mice’, J. Clin. Invest., 119(2), pp. 408–420.

Tang, C.-M. and Insel, P. A. (2004) ‘GPCR Expression in the Heart: “New” Receptors in Myocytes and Fibroblasts’, Trends Cardiovasc. Med., 14(3), pp. 94–99.

Tang, M., Wang, G., Lu, P., Karas, R. H., Aronovitz, M., Heximer, S. P., Kaltenbronn, K. M., Blumer, K. J., Siderovski, D. P., Zhu, Y. and Mendelsohn, M. E. (2003) ‘Regulator of G- protein signaling-2 mediates vascular smooth muscle relaxation and blood pressure’, Nat. Med., 9(12), pp. 1506–1512.

Tedrow, U. B., Conen, D., Ridker, P. M., Cook, N. R., Koplan, B. A., Manson, J. E., Buring, J. E. and Albert, C. M. (2010) ‘The long- and short-term impact of elevated body mass index on the risk of new atrial fibrillation the WHS (women’s health study).’, J. Am. Coll. Cardiol. NIH Public Access, 55(21), pp. 2319–27.

Theeuwes, F. and Yum, S. (1976) ‘Principles of the Design and Operation of Generic Osmotic Pumps for the Delivery of Semisolid or liquid Drug Formulations’, Ann. Biomed. Eng., 4, pp. 343–353.

Thomas, C., Auwerx, J. and Schoonjans, K. (2008) ‘Thyroid economy–regulation, cell biology, thyroid hormone metabolism and action: the special edition: metabolic effects of thyroid hormones’, Thyroid, 18, pp. 167–174.

Timofeeva, A. V, Goriunova, L. E., Khaspekov, G. L., Il’inskaia, O. P., Sirotkin, V. N., Andreeva, E. R., Tararak, E. M., Bulkina, O. S., Buza, V. V, Britareva, V. V, Karpov, I. A. and Bibilashvili, R. S. (2009) ‘[Comparative transcriptome analysis of human aorta atherosclerotic lesions and peripheral blood leukocytes from essential hypertension patients].’, Kardiologiia, 49(9), pp. 27–38.

Tokudome, T., Kishimoto, I., Horio, T., Arai, Y., Schwenke, D. O., Hino, J., Okano, I., Kawano, Y., Kohno, M., Miyazato, M., Nakao, K. and Kangawa, K. (2008) ‘Regulator of G- protein signaling subtype 4 mediates antihypertrophic effect of locally secreted natriuretic peptides in the heart’, Circulation, 117(18), pp. 2329–2339.

Torrance, C. J., deVente, J. E., Jones, J. P. and Dohm, G. L. (1997) ‘Effects of Thyroid Hormone on GLUT4 Glucose Transporter Gene Expression and NIDDM in Rats’, Endocrinology. Oxford University Press, 138(3), pp. 1204–1214.

Traver, S., Splingard, A., Gaudriault, G. and De Gunzburg, J. (2004) ‘The RGS (regulator of G-protein signalling) and GoLoco domains of RGS14 co-operate to regulate Gi-mediated signalling.’, Biochem. J. Portland Press Ltd, 379(Pt 3), pp. 627–32.

Tsang, S., Yiu, A., Woo, -Ho, Zhu, W., Xiao, R.-P., Woo, A. Y.-H., Zhu, W. and Xiao, R.-P. (2010) ‘Deregulation of RGS2 in cardiovascular diseases.’, Front. Biosci. (Schol. Ed)., 2, pp. 547–57.

Tseng, C. C. and Zhang, X. Y. (1998) ‘Role of regulator of G protein signaling in desensitization of the glucose-dependent insulinotropic peptide receptor.’, Endocrinology.

Oxford University Press, 139(11), pp. 4470–5.

Tu, Y., Woodson, J. and Ross, E. M. (2001) ‘Binding of regulator of G protein signaling (RGS) proteins to phospholipid bilayers. Contribution of location and/or orientation to Gtpase- activating protein activity.’, J. Biol. Chem. American Society for Biochemistry and Molecular Biology, 276(23), pp. 20160–6.

Tuomi, J. M., Chidiac, P. and Jones, D. L. (2010) ‘Evidence for enhanced M3 muscarinic receptor function and sensitivity to atrial arrhythmia in the RGS2-deficient mouse.’, Am. J. Physiol. Heart Circ. Physiol., 298(2), pp. H554-61.

Verdecchia, P., Carini, G., Circo, A., Dovellini, E., Giovannini, E., Lombardo, M., Solinas, P., Gorini, M., Maggioni, A. P. and MAVI (MAssa Ventricolare sinistra nell’Ipertensione) Study Group (2001) ‘Left ventricular mass and cardiovascular morbidity in essential hypertension: the MAVI study.’, J. Am. Coll. Cardiol., 38(7), pp. 1829–35.

Verdecchia, P., Porcellati, C., Reboldi, G., Gattobigio, R., Borgioni, C., Pearson, T. A. and Ambrosio, G. (2001) ‘Left ventricular hypertrophy as an independent predictor of acute cerebrovascular events in essential hypertension.’, Circulation, 104(17), pp. 2039–44. van der Vusse, G. J., Glatz, J. F., Stam, H. C. and Reneman, R. S. (1992) ‘Fatty acid homeostasis in the normoxic and ischemic heart’, Physiol. Rev., 72(4).

Wang, C.-Y. and Liao, J. K. (2012) ‘A mouse model of diet-induced obesity and insulin resistance.’, Methods Mol. Biol. NIH Public Access, 821, pp. 421–33.

Wang, J., Tu, Y., Woodson, J., Song, X. and Ross, E. M. (1997) ‘A GTPase-activating protein for the G protein Galphaz. Identification, purification, and mechanism of action.’, J. Biol. Chem. American Society for Biochemistry and Molecular Biology, 272(9), pp. 5732–40.

Wang, Q., Levay, K., Chanturiya, T., Dvoriantchikova, G., Anderson, K. L., Bianco, S. D. C., Ueta, C. B., Molano, R. D., Pileggi, A., Gurevich, E. V, Gavrilova, O. and Slepak, V. Z. (2011) ‘Targeted deletion of one or two copies of the G protein β subunit Gβ5 gene has distinct effects on body weight and behavior in mice.’, FASEB J. Federation of American Societies for 64

Experimental Biology, 25(11), pp. 3949–57.

Wang, X., Adams, L. D., Pabón, L. M., Mahoney, W. M., Beaudry, D., Gunaje, J., Geary, R. L., Deblois, D. and Schwartz, S. M. (2008) ‘RGS5, RGS4, and RGS2 expression and aortic contractibility are dynamically co-regulated during aortic banding-induced hypertrophy.’, J. Mol. Cell. Cardiol., 44(3), pp. 539–50.

Wang, X., Huang, G., Luo, X., Penninger, J. M. and Muallem, S. (2004) ‘Role of regulator of G protein signaling 2 (RGS2) in Ca(2+) oscillations and adaptation of Ca(2+) signaling to reduce excitability of RGS2-/- cells’, J. Biol. Chem. American Society for Biochemistry and Molecular Biology, 279(40), pp. 41642–41649.

Wang, X., Paulin, F. E., Campbell, L. E., Gomez, E., O’Brien, K., Morrice, N. and Proud, C. G. (2001) ‘Eukaryotic initiation factor 2B: identification of multiple phosphorylation sites in the epsilon-subunit and their functions in vivo.’, EMBO J. European Molecular Biology Organization, 20(16), pp. 4349–59.

Wang, X., Zeng, W., Soyombo, A. A., Tang, W., Ross, E. M., Barnes, A. P., Milgram, S. L., Penninger, J. M., Allen, P. B., Greengard, P. and Muallem, S. (2005) ‘Spinophilin regulates Ca2+ signalling by binding the N-terminal domain of RGS2 and the third intracellular loop of G-protein-coupled receptors’, Nat. Cell Biol., 7(4), pp. 405–411.

Wattanakit, K., Lutsey, P. L., Bell, E. J., Gornik, H., Cushman, M., Heckbert, S. R., Rosamond, W. D. and Folsom, A. R. (2012) ‘Association between cardiovascular disease risk factors and occurrence of venous thromboembolism’, Thromb. Haemost., 108(3), pp. 508–515.

Weber, K. T. and Brilla, C. G. (1991) ‘Pathological hypertrophy and cardiac interstitium. Fibrosis and renin-angiotensin-aldosterone system.’, Circulation, 83(6), pp. 1849–1865.

Weber, K. T., Janicki, J. S., Pick, R., Capasso, J. and Anversa, P. (1990) ‘Myocardial fibrosis and pathologic hypertrophy in the rat with renovascular hypertension.’, Am. J. Cardiol., 65(14), p. 1G–7G.

Weindruch, R. and Walford, R. (1982) ‘Dietary restriction in mice beginning at 1 year of age: 65

effect on life-span and spontaneous cancer incidence’, Science (80-. )., 215(4538).

Weitzel, J. M., Iwen, K. A. H. and Seitz, H. J. (2003) ‘Regulation of mitochondrial biogenesis by thyroid hormone.’, Exp. Physiol., 88(1), pp. 121–8.

Wek, R. C., Jiang, H.-Y. and Anthony, T. G. (2006) ‘Coping with stress: eIF2 kinases and translational control’, Biochem. Soc. Trans., 34(1), p. 7.

Welsh, G. I., Miller, C. M., Loughlin, A. J. and Price, N. T. (1998) ‘Regulation of eukaryotic initiation factor eIF2B: glycogen synthase kinase-3 phosphorylates a conserved serine which undergoes dephosphorylation in response to insulin’, FEBS Lett., 421(2), pp. 125–130.

Welsh, G. I., Miyamoto, S., Price, N. T., Safer, B. and Proud, C. G. (1996) ‘T-cell activation leads to rapid stimulation of translation initiation factor eIF2B and inactivation of glycogen synthase kinase-3.’, J. Biol. Chem. American Society for Biochemistry and Molecular Biology, 271(19), pp. 11410–3.

Welsh, G. I. and Proud, C. G. (1992) ‘Regulation of protein synthesis in Swiss 3T3 fibroblasts. Rapid activation of the guanine-nucleotide-exchange factor by insulin and growth factors.’, Biochem. J. Portland Press Ltd, (Pt 1), pp. 19–23.

Welsh, G. I. and Proud, C. G. (1993) ‘Glycogen synthase kinase-3 is rapidly inactivated in response to insulin and phosphorylates eukaryotic initiation factor eIF-2B.’, Biochem. J. Portland Press Ltd, (Pt 3), pp. 625–9.

Wettschureck, N., Rütten, H., Zywietz, A., Gehring, D., Wilkie, T. M., Chen, J., Chien, K. R. and Offermanns, S. (2001) ‘Absence of pressure overload induced myocardial hypertrophy after conditional inactivation of Galphaq/Galpha11 in cardiomyocytes’, Nat. Med., 7(11), pp. 1236–1240.

Whelton, P. K., Appel, L., Charleston, J., Dalcin, A. T., Ewart, C., Fried, L., Blethen, E., et al. (1992) ‘The Effects of Nonpharmacologic Interventions on Blood Pressure of Persons With High Normal Levels’, JAMA. American Medical Association, 267(9), p. 1213.

Wilkins, B. J., Dai, Y.-S., Bueno, O. F., Parsons, S. A., Xu, J., Plank, D. M., Jones, F., Kimball, T. R. and Molkentin, J. D. (2004) ‘Calcineurin/NFAT Coupling Participates in Pathological, but not Physiological, Cardiac Hypertrophy’, Circ. Res., 94(1).

De Windt, L. J., Lim, H. W., Bueno, O. F., Liang, Q., Delling, U., Braz, J. C., Glascock, B. J., Kimball, T. F., del Monte, F., Hajjar, R. J. and Molkentin, J. D. (2001) ‘Targeted inhibition of calcineurin attenuates cardiac hypertrophy in vivo.’, Proc. Natl. Acad. Sci. U. S. A. National Academy of Sciences, 98(6), pp. 3322–7.

Winzell, M. S. and Ahrén, B. (2004) ‘The high-fat diet-fed mouse: a model for studying mechanisms and treatment of impaired glucose tolerance and type 2 diabetes.’, Diabetes, 53 Suppl 3(suppl 3), pp. S215-9.

Wise, A., Gearing, K. and Rees, S. (2002) ‘Target validation of G-protein coupled receptors’, Drug Discov. Today, 7(4), pp. 235–246.

Wondisford, F. E. (2003) ‘Thyroid Hormone Action: Insight from Transgenic Mouse Models’, J. Investig. Med., 51(4), pp. 215–220.

Wren, A. M., Seal, L. J., Cohen, M. A., Brynes, A. E., Frost, G. S., Murphy, K. G., Dhillo, W. S., Ghatei, M. A. and Bloom, S. R. (2001) ‘Ghrelin Enhances Appetite and Increases Food Intake in Humans’, J. Clin. Endocrinol. Metab., 86(12), pp. 5992–5992.

Xie, Y., Jiang, H., Nguyen, H., Jia, S., Berro, A., Panettieri, R. A., Wolff, D. W., Abel, P. W., Casale, T. B. and Tu, Y. (2012) ‘Regulator of G protein signaling 2 is a key modulator of airway hyperresponsiveness’, J. Allergy Clin. Immunol., 130(4), p. 968–976.e3.

Xie, Z., Liu, D., Liu, S., Calderon, L., Zhao, G., Turk, J. and Guo, Z. (2011) ‘Identification of a cAMP-response Element in the Regulator of G-protein Signaling-2 (RGS2) Promoter as a Key Cis-regulatory Element for RGS2 Transcriptional Regulation by Angiotensin II in Cultured Vascular Smooth Muscles’, J. Biol. Chem., 286(52), pp. 44646–44658.

Yamada, M., Miyakawa, T., Duttaroy, A., Yamanakak, A., Moriguchi, T., Makita, R., Ogawa, M., Chou#, C. J., Xia, B., Crawley, J. N., Felder, C. C., Deng, C.-X. and Rgen Wess, J. (2001) 67

‘Mice lacking the M3 muscarinic acetylcholine receptor are hypophagic and lean’, Nat. www.nature.com, 410(8).

Yang, J., Huang, J., Maity, B., Gao, Z., Lorca, R. A., Gudmundsson, H., Li, J., Stewart, A., Swaminathan, P. D., Ibeawuchi, S.-R., Shepherd, A., Chen, C.-K., Kutschke, W., Mohler, P. J., Mohapatra, D. P., Anderson, M. E. and Fisher, R. A. (2010) ‘RGS6, a Modulator of Parasympathetic Activation in HeartNovelty and Significance’, Circ. Res., 107(11).

Yang, J., Kamide, K., Kokubo, Y., Takiuchi, S., Tanaka, C., Banno, M., Miwa, Y., Yoshii, M., Horio, T., Okayama, A., Tomoike, H., Kawano, Y. and Miyata, T. (2005) ‘Genetic variations of regulator of G-protein signaling 2 in hypertensive patients and in the general population.’, J. Hypertens., 23(8), pp. 1497–505.

Yen, P. M. (2001) ‘Physiological and molecular basis of thyroid hormone action.’, Physiol. Rev., 81(3), pp. 1097–142.

Zabalgoitia, M., Berning, J., Koren, M. J., Støylen, A., Nieminen, M. S., Dahlöf, B., Devereux, R. B. and LIFE Study Investigators (2001) ‘Impact of coronary artery disease on left ventricular systolic function and geometry in hypertensive patients with left ventricular hypertrophy (the LIFE study).’, Am. J. Cardiol., 88(6), pp. 646–50.

Zak, R. (1984) Growth of the heart in health and disease. Raven Press.

Zhang, J., Li, N., Yan, Z., Guo, Y., Zhou, L., Wang, H., Yang, J., Luo, W. and Chang, J. (2010) ‘Association between the regulator of G-protein signaling 2 gene 1891-1892del TC polymorphism with hypertension in Xinjiang Kazakh population’, Zhonghua Yi Xue Yi Chuan Xue Za Zhi, 27(1), pp. 29–33.

Zhang, P. and Mende, U. (2011) ‘Regulators of G-Protein Signaling in the Heart and Their Potential as Therapeutic Targets’, Circ. Res., 109(3), pp. 320–333.

Zhang, P., Su, J., King, M. E., Maldonado, A. E., Park, C. and Mende, U. (2011) ‘Regulator of G protein signaling 2 is a functionally important negative regulator of angiotensin II-induced cardiac fibroblast responses.’, Am. J. Physiol. Heart Circ. Physiol. American Physiological 68

Society, 301(1), pp. H147-56.

Zhang, W., Anger, T., Su, J., Hao, J., Xu, X., Zhu, M., Gach, A., Cui, L., Liao, R. and Mende, U. (2006) ‘Selective Loss of Fine Tuning of Gq/11 Signaling by RGS2 Protein Exacerbates Cardiomyocyte Hypertrophy’, J. Biol. Chem., 281(9), pp. 5811–5820.

Zhao, Q., Wang, L., Yang, W., Chen, S., Huang, J., Fan, Z., Li, H., Lu, X. and Gu, D. (2008) ‘Interactions among genetic variants from contractile pathway of vascular smooth muscle cell in essential hypertension susceptibility of Chinese Han population’, Pharmacogenet. Genomics, 18(6), pp. 459–466.

Zorzano, A., Palacin, M. and Guma, A. (2005) ‘Mechanisms regulating GLUT4 glucose transporter expression and glucose transport in skeletal muscle’, Acta Physiol. Scand., 183(1), pp. 43–58.

Zou, M.-X., Roy, A. A., Zhao, Q., Kirshenbaum, L. A., Karmazyn, M. and Chidiac, P. (2006) ‘RGS2 is upregulated by and attenuates the hypertrophic effect of α1-adrenergic activation in cultured ventricular myocytes’, Cell. Signal., 18(10), pp. 1655–1663.

2 HYPOTHESES AND SPECIFIC AIMS

Specific Aim 1

To determine if RGS2eb is cardioprotective against experimentally-induced cardiac hypertrophy

Based on our previous studies and the findings of others, RGS2 is known to play a protective role against cardiac hypertrophy (Chidiac et al. 2014). In addition, loss of RGS2 in cell and animals studies is characterized by increased protein synthesis and severe cardiac hypertrophy (Takimoto et al. 2009). In conjunction with our previously reported cell data, in vivo studies would provide a more comprehensive view of the antihypertrophic and possible cardioprotective effects of RGS2eb under both pathological and physiological conditions.

Our principle goal is to study the effects of RGS2eb in animal models, and thus establish its in vivo importance as a protective mechanism against cardiac hypertrophy and heart failure. Our specific objectives are:

i) To determine whether expression of RGS2eb protects against experimentally-induced cardiac hypertrophy (Study 1A),

ii) To perform loss of function studies to determine in vivo mechanisms of RGS2eb cardioprotection (Study 1B),

2.1.1 Study 1A: Protective effect of RGS2eb in animal models of cardiac hypertrophy

Regardless of the initial stimulus, de novo protein synthesis is required for cardiomyocyte hypertrophy. We have previously shown that expression of RGS2eb in cultured neonatal rat cardiomyocytes can inhibit hypertrophy via the attenuation of mRNA translation (Chidiac et al. 2014). However, it is unknown whether the protective effect of RGS2eb extends to whole animals with experimentally-induced cardiac hypertrophy.

The objectives of this study are:

i) To determine whether animals with targeted myocardial expression of RGS2eb show resistance to the development of pressure overload induced cardiac hypertrophy in comparison to wild-type controls.

ii) To determine whether animals with targeted myocardial expression of RGS2eb demonstrate improved cardiovascular function in an experimental pressure overload model in comparison to wild-type controls.

We hypothesize that due to the ability of RGS2eb to inhibit protein synthesis, transgenic mice will show decreased severity of cardiac hypertrophy and potentially improved cardiac function in comparison to wild type mice.

2.1.2 Study 1B: Rescue effect of RGS2eb in RGS2 knockout animals

Rgs2-/- mice are characterized by severe cardiac hypertrophy and heart failure following experimentally induced pressure overload (Takimoto et al. 2009). This demonstrates the protective cardiac effects of RGS2. However, the degree to which the inhibition of global protein synthesis by RGS2eb contributes to this effect is unknown. In addition, the possible protective effect of RGS2eb against drug-induced hypertrophy has not been explored.

The objectives of this study are:

i) To determine whether expression of RGS2eb in Rgs2-/- mice can compensate for the loss of the full length RGS2 protein in comparison to null RGS2 mice following experimentally-induced pressure overload.

ii) To characterize the effects of drug-induced hypertrophy in Rgs2-/- with cardiac- specific expression of RGS2eb.

We hypothesize that via its inhibition of protein synthesis, RGS2eb will, to some extent, decrease the severity of cardiac hypertrophy and heart failure resulting from experimentally

induced pressure overload or drug-induced hypertension and hypertrophy, thereby compensating for the absence of full-length RGS2.

Specific Aim 2

To determine the metabolic effects of RGS2 under multiple diet modalities

Aside from an increased sensitivity to pressure-induced cardiac hypertrophy (Takimoto et al. 2009), Rgs2-/- mice display several additional phenotypes, including decreased male aggression, increased anxiety, elevated blood pressure, and reduced T-cell proliferation (Oliveira-Dos-Santos et al. 2000; Heximer et al. 2003). Our lab has previously determined that Rgs2-/- mice exhibit a weight-related phenotype, such that they fail to develop the gains in body fat that normally occur in freely-feeding laboratory mice (Nunn et al. 2011). We demonstrated that resistance to age-related body weight gain was accompanied by smaller adipose tissue deposits and adipocytes, lower levels of serum lipids, and increased insulin sensitivity; these data suggest that RGS2 may play a novel role in the regulation of fat production and energy metabolism. Rgs2-/- mice were found to be slightly hyperphagic over time in comparison to WT controls, and did not have impaired nutrient absorption. However, measurements of resting

O2 consumption (VO2) using a basic open flow respirometry system suggested a lower metabolic rate in Rgs2-/- mice compared to WT animals (Nunn et al. 2010). Thus, it would seem that although Rgs2-/- mice expend less energy at rest, eat more, and absorb the same amount of nutrients, they still weigh less in comparison to WT controls. Furthermore, we were -/- not able in our previous studies to detect any increase in resting VO2 in Rgs2 mice using a basic open flow respirometry system. Our previous studies have provided contradictory evidence for the reduction of weight gain in RGS2 KO mice. To resolve this seeming paradox, extended and acute measurements of metabolic indicators may provide a more comprehensive understanding of RGS2 and its role in metabolism and weight gain.

Our principle goal is to understand the effects of loss of RGS2 on body metabolism, and thus establish its in vivo role. Our specific objectives are:

i) To determine baseline metabolic characteristics of Rgs2-/- mice in comparison to age- matched WT controls (Study 2A),

ii) To perform diet restriction studies to further characterize the Rgs2-/- metabolic phenotype (Studies 2B and 2C)

2.2.1 Study 2A: Baseline characterization of the Rgs2-/- metabolic phenotype

In comparison to WT controls, Rgs2-/- mice are resistant to age-related weight gain. However, previous measurements of metabolic activity have offered paradoxical evidence on the potential reasons for this lean phenotype. The objective of this study is:

i) To determine whether metabolism in Rgs2-/- is altered, particularly during the dark phase of a 12 hour light-dark cycle in comparison to WT controls, as measured via Comprehensive Laboratory Animal Monitoring System (CLAMS) metabolic cages

We hypothesize that Rgs2-/- will display increased metabolism as demonstrated by various metabolic and biological indices in comparison to WT controls.

2.2.2 Study 2B: Chronic diet restriction model

We have previously shown that while Rgs2-/- mice are resistant to age-related weight gain on a standard rodent diet (Teklad Global 18% Protein Rodent Diet), they still gain at least as much weight as WT mice when placed on a high fat diet. However, it is currently unknown how Rgs2-/- mice would respond metabolically to a diet restriction. The objective of this study is:

i) To determine whether metabolism in Rgs2-/- mice is altered in response to dietary restriction in comparison to WT controls.

We hypothesize that Rgs2-/- mice will display greater metabolism than their counterpart WT controls, as demonstrated by various metabolic and biological indices. 74

2.2.3 Study 2C: Acute diet restriction model

It is also currently unknown how Rgs2-/- mice would respond metabolically to acute dietary restriction (i.e. fasting conditions); this may also potentially offer insight into the resistance of Rgs2-/- mice to age related weight gain. The objective of this study is:

i) To determine whether Rgs2-/- metabolism is altered after acute fasting in comparison to WT controls.

We hypothesize that Rgs2-/- mice will display greater metabolism under acute caloric restriction than corresponding WT controls.

References

Blumer, Joe B., Kevin Lord, Thomas L. Saunders, Alejandra Pacchioni, Cory Black, EricLazartigues, Kurt J. Varner, Thomas W. Gettys, and Stephen M. Lanier. 2008. “Activator of G Protein Signaling 3 Null Mice: I. Unexpected Alterations in Metabolic and Cardiovascular Function.” Endocrinology 149 (8).

Chidiac, Peter, Alina J. Sobiesiak, Katherine N. Lee, Robert Gros, and Chau H. Nguyen. 2014. “The eIF2B-Interacting Domain of RGS2 Protects against GPCR Agonist-Induced Hypertrophy in Neonatal Rat Cardiomyocytes.” Cell. Signal. 26 (6).

Heximer, Scott P., Russell H. Knutsen, Xiaoguang Sun, Kevin M. Kaltenbronn, Man-Hee Rhee, Ning Peng, Antonio Oliveira-dos-Santos, et al. 2003. “Hypertension and Prolonged Vasoconstrictor Signaling in RGS2-Deficient Mice.” J. Clin. Invest. 111 (4).

Kohsaka, Akira, Aaron D. Laposky, Kathryn Moynihan Ramsey, Carmela Estrada, Corinne Joshu, Yumiko Kobayashi, Fred W. Turek, and Joseph Bass. 2007. “High-Fat Diet Disrupts Behavioral and Molecular Circadian Rhythms in Mice.” Cell Metab. 6 (5).

Laposky, Aaron D., Joseph Bass, Akira Kohsaka, and Fred W. Turek. 2008. “Sleep and Circadian Rhythms: Key Components in the Regulation of Energy Metabolism.” FEBS Lett. 582 (1).

Nunn, Caroline, Peishen Zhao, Min-Xu Zou, Kelly Summers, Christopher G. Guglielmo, and Peter Chidiac. 2011. “Resistance to Age-Related, Normal Body Weight Gain in RGS2 Deficient Mice.” Cell. Signal. 23 (8).

Nunn, Caroline, Min-Xu Zou, Alina J. Sobiesiak, Anju A. Roy, Lorrie A. Kirshenbaum, and Peter Chidiac. 2010. “RGS2 Inhibits β-Adrenergic Receptor-Induced Cardiomyocyte Hypertrophy.” Cell. Signal. 22 (8).

Oliveira-Dos-Santos, A J, G Matsumoto, B E Snow, D Bai, F P Houston, I Q Whishaw, S Mariathasan, et al. 2000. “Regulation of T Cell Activation, Anxiety, and Male Aggression by RGS2.” Proc. Natl. Acad. Sci. U. S. A. 97 (22).

Takimoto, Eiki, Norimichi Koitabashi, Steven Hsu, Elizabeth A. Ketner, Manling Zhang, Takahiro Nagayama, Djahida Bedja, et al. 2009. “Regulator of G Protein Signaling 2 Mediates Cardiac Compensation to Pressure Overload and Antihypertrophic Effects of PDE5 Inhibition in Mice.” J. Clin. Invest. 119 (2).

3 CARDIOMYOCYTE SPECIFIC OVEREXPRESSION OF A 37 AMINO ACID DOMAIN OF REGULATOR OF G PROTEIN SIGNALLING 2 INHIBITS CARDIAC HYPERTROPHY AND IMPROVES FUNCTION IN RESPONSE TO PRESSURE OVERLOAD IN MICE

Reproduced (adapted) with permission from: Lee KN, Lu X, Feng QP, Chidiac P (2017), Cardiomyocyte specific overexpression of regulator of G protein signalling 2 inhibits cardiac hypertrophy and improves function in response to pressure overload in mice. J Mol Cell Cardiol 108: 194-202. 78

Introduction

Pathological cardiac hypertrophy is a maladaptive growth response of the heart to a variety of disease stimuli. Induced by factors such as hypertension or valvular diseases, prolonged pathological hypertrophy has been associated with an increased risk of sudden death, as well as myocardial infarctions and arrhythmias (Levy et al., 1990; Weber and Brilla, 1991; Heineke and Molkentin, 2006). Moreover, maladaptive hypertrophy is a major risk factor for heart failure (Heineke and Molkentin, 2006). Given the high mortality rates following heart failure diagnoses and the current lack of a cure, reducing risk factors such as pathological cardiac hypertrophy may prove therapeutically beneficial.

G protein-coupled receptors (GPCRs) which signal via heterotrimeric Gαq and Gαs proteins are well established as critical players in the induction of pathological hypertrophy (Dorn and Force, 2005; Heineke and Molkentin, 2006; Hendriks-Balk et al., 2008). Clinically effective treatments for heart failure, such as angiotensin II converting enzyme (ACE) inhibitors and beta-adrenergic receptor antagonists, demonstrate the effectiveness of targeting Gq- and Gs- coupled receptors (Campbell et al., 2001). However, the effectiveness of these drugs is limited to slowing, rather than reversing, the progression of heart failure. Regulator of G protein signalling 2 (RGS2) is a GTPase accelerating protein (GAP) found ubiquitously throughout the body. RGS2 selectively inhibits Gq- and Gs-mediated signalling (some effects on Gi/o signalling have also been reported (Anger et al., 2007; Chakir et al., 2011), thus making it an important target in the study of cardiovascular disease (Heximer et al., 1997, 1999; Roy, Baragli, et al., 2006). Studies in vivo and in cardiomyocytes have shown that hypertrophy caused by prolonged Gq-coupled receptor stimulation, such as that induced by phenylephrine, can be blocked by the overexpression of RGS2 (Roy, Nunn, et al., 2006; Zou et al., 2006). A similar effect has been seen against Gs-mediated cardiomyocyte hypertrophy induced by isoproterenol (Nunn et al., 2010). These observations suggest that RGS2 plays an important role in the regulation of hypertrophy; This has been further demonstrated in knockout animal studies. In RGS2 null mice, experimentally induced pressure overload causes marked hypertrophy, heart failure, and death, as well as increased expression of cardiac fetal genes

(Takimoto et al., 2009). Thus, RGS2 is an essential element in the prevention of pathological cardiac hypertrophy.

While the G protein inhibitory effects of RGS2 are well established, studies have also shown that RGS2 can bind to and regulate other targets, including TRPV6 calcium channels and tubulin (Wang et al., 2005; Heo et al., 2006; Schoeber et al., 2006). We have previously shown that RGS2 can bind to the ε subunit of eukaryotic initiation factor 2B (eIF2B), a component of the rate-limiting step of the initiation of mRNA translation (Nguyen et al., 2009). By interacting with eIF2Bε, RGS2 limits GDP dissociation on eukaryotic initiation factor 2 (eIF2), which ultimately leads to the attenuation of de novo protein synthesis. This property of RGS2 has been mapped to a 37 amino acid domain (residues 79-115) termed RGS2eb, that is homologous to a region in the β subunit of eIF2 (Nguyen et al., 2009).

Since the heart is considered to be a post-mitotic organ (Anversa et al., 2007), hypertrophic growth is thought to be dependent on the enlargement of a pre-existing cardiomyocyte population rather than cell division (Carvalho, 2010). Therefore, regardless of the initial stimuli and receptors involved, all hypertrophic signals will ultimately result in increased mRNA translation and de novo protein synthesis. Our previous studies have shown that RGS2eb expression in cultured neonatal cardiomyocytes is able to inhibit both protein synthesis and agonist induced hypertrophy at levels comparable to full-length RGS2 (Chidiac et al., 2014). Based on these previous findings, we hypothesized that the in vivo expression of RGS2eb in the murine heart could attenuate the development of pathological cardiac hypertrophy.

To determine whether RGS2eb could act as an in vivo anti-hypertrophic agent, we developed a line of transgenic mice with cardiomyocyte-specific overexpression of RGS2eb, and used transverse aortic constriction (TAC) to induce pressure overload on the heart. Here we report that following 4 weeks of aortic constriction, RGS2eb transgenic mice were protected not only from pressure overload-induced cardiac hypertrophy, but were able to maintain heart function at significantly improved levels compared to WT TAC mice. Moreover, reactivation of the “fetal gene program”, an indicator of hypertrophy and heart failure, was suppressed. Notably, cardiomyocyte size was decreased in RGS2eb TG compared to WT TAC controls, further supporting our earlier in vitro studies which showed RGS2eb inhibition of de novo protein 80

synthesis. Together, these findings suggest that in addition to its G-protein inhibitory actions, the RGS2eb region may be contributing to the cardioprotective effects of full-length RGS2 in vivo via the inhibition of de novo protein synthesis.

Methods

3.2.1 Generation of myosin heavy chain promoter (MHC) – RGS2eb transgenic mice

The RGS2eb gene was targeted to the heart using the mouse α-MHC promoter (kindly provided by Jeffrey Robbins, Cincinnati Children’s Hospital Medical Center)(Subramaniam et al., 1991). Transgenic mice were generated in the FVB background (London Regional Transgenic and Gene Targeting Facility) and identified by polymerase chain reaction (PCR). Briefly, ear biopsies were taken from three-week old mice and purified for genomic DNA using the QIAquick PCR purification kit (Qiagen). PCR was performed using DreamTaq Green PCR Master Mix (Thermo Scientific). Primers for detection of transgenic mice (CTGCTAGCCAGCAAATATGGTC forward, CCTACAGGTTGTCTTCCCAACT reverse) and control primers for endogenous RGS2 expression (CCGAGTTCTGTGAAGAAAACATTG forward, ATGCTACATGAGACCAGGAGTCCC reverse) were designed using the OligoPerfect Designer (ThermoFisher), OligoCalc (Kibbe, 2007), and Primer-BLAST (NCBI) programs, resulting in a 293 bp and 342 bp fragment, respectively. RGS2eb TG transgenic mice were back-crossed with C57Bl/6 mice (Charles River) for at least seven generations before animal experiments were performed. Animals were maintained in accordance with the Institute of Laboratory Animal Research Guide for the Care and Use of Laboratory Animals. These studies were approved by the Animal Care Committee at the University of Western Ontario, and complied with the guidelines of the Canadian Council on Animal Care.

3.2.2 Transverse aortic constriction (TAC)

TAC was used to induce pressure overload on the hearts of 12 week old male C57BL/6 wildtype mice and RGS2eb TG littermates. Mice were anaesthetized with a ketamine (50 mg/kg) and xylazine (12.5 mg/kg) cocktail intramuscularly, intubated, and ventilated with a respirator (SAR-830, CWE, Ardmore, PA, USA). To access the chest cavity, thoracotomy was performed at the second intercostal space under a surgical microscope (Rockman et al., 1991). A 6-0 silk suture was placed between the brachiocephalic and left carotid arteries. Two knots were tied against a 25-gauge blunt needle placed parallel to the transverse aorta. The needle was removed immediately after the second tied knot followed by closure of the chest. Control WT and RGS2eb TG mice were subjected to sham operations without aortic constriction.

3.2.3 Assessment of cardiac function

Hemodynamic measurements were performed as previously described (Detombe et al., 2008; Pacher et al., 2008) : four weeks post-surgery, mice were again anaesthetized with a ketamine and xylazine cocktail and ventilated. A Millar micro-tip pressure catheter was inserted into the left carotid artery to assess carotid artery pressure, followed by removal of the catheter and insertion into the right carotid artery for pressure readings, and then advanced into the left ventricle (LV) to measure LV pressures, volumes, and heart rate at steady state and during transient preload reduction via mechanical occlusion of the inferior vena cava. All data were recorded using a PowerLab data acquisition system and analysed by LabChart 7.0 (ADInstruments) and PVAN 3.4 software (Millar).

3.2.4 Heart weight/body weight ratios

Upon completion of hemodynamic recordings, mice were immediately euthanized via a 10% KCl injection into the left jugular vein to ensure cardiac arrest in the diastolic state. Hearts were excised, weighed after removal of the atria, then cut transversely into three equal sections, with the middle section reserved for histological analysis, and the remaining tissue sections stored at -80°C for subsequent RNA isolation.

3.2.5 Histological analysis

Heart samples were fixed in 4% paraformaldehyde overnight at 4°C, dehydrated, and paraffin embedded. Samples were sectioned into 5 µm thick slices with a Leica RM2255 microtome, mounted onto positively charged slides, and then stained with haematoxylin and eosin. Images of left ventricles were captured at 400X magnification with a Zeiss Observer D1 microscope using AxioVision 4.7 software (Zeiss) for cardiomyocyte size measurements and immunohistochemical imaging; images of the LV for wall thickness measurements were captured at 100X magnification.

3.2.6 Cardiomyocyte Cell Size and LV wall thickness

Haematoxylin and eosin stained tissue sections were used to determine left ventricular cardiomyocyte cell size and wall thickness of LV free walls and septum. The size of an individual cardiomyocyte was determined by measuring its cross-sectional area. All cardiomyocytes with a well-defined border were manually outlined and then filled in the open source GNU Image Manipulation Program (GIMP). Images were then opened in the image processing program ImageJ and analyzed after setting the threshold. Cardiomyocytes with a circularity ratio of ≥1.2 were excluded to eliminate cells sectioned tangentially (Helms et al., 2010). Areas of at least 33 cells per animal were measured, and were scored blind to surgeries and strain.

Heart wall thickness of the LV free wall was measured using AxioVision 4.7 software (Zeiss) in three distinct areas within and between the anterior and posterior regions of the free wall; three measurements were taken from each area for a total of 9 averaged measurements per sample. For the septal wall, single measurements were taken from three distinct areas of the wall and averaged for each sample.

3.2.7 Immunohistochemistry

Immunohistochemical staining was performed on 5 µm thick paraffin heart sections. Samples underwent a deparaffinisation process and antigen retrieval was carried out in sodium citrate buffer (pH 6.0) at 92°C using a BP-111 laboratory microwave (Microwave Research and

Applications). Sections were incubated with primary antibody anti-6X His tag-ChIP Grade (Abcam) overnight followed by biotinylated secondary antibody, and signal was detected using avidin-biotin complex (ImmunoCruz ABC staining kit, Santa Cruz). Diaminobenzidine (DAB) substrate solution was used for antigen visualization with haematoxylin as a counterstain. Following staining, the LV free wall was imaged in three distinct locations within and between the anterior and posterior walls. Slides were imaged at 400X magnification with a Zeiss Observer D1 microscope using AxioVision 4.7 software. To ensure accurate comparisons of antigen visualization, sections from WT and RGS2eb TG genotypes were stained simultaneously and all images were captured using the same microscopic parameters.

3.2.8 Dot blotting

Using mechanical disruption (Sonic Dismembrator Model 100, Fisher Scientific), LV heart and kidney tissues from RGS2eb TG and WT mice were lysed in 20mM, pH 7.5 Tris-HCl buffer containing cOmplete Mini protease inhibitor cocktail (Sigma). Samples were centrifuged at 100,000 g for 1 hour at 4°C in an Optima TLX micro-ultracentrifuge (Beckman Coulter), and supernatants were kept for experiments. Following protein concentration determination by Bradford assay, equal amounts of sample protein were spotted directly on to Amersham Protran 0.2 µm pore size nitrocellulose membrane (GE Healthcare Life Sciences). Purified histidine-tagged RGS-16 (His-RGS16) was also dotted on to membranes to serve as a positive control. Dried membranes were blocked in 5% milk-TBST, followed by overnight incubation in 1:2000 ChIP grade anti-6X Histidine primary antibody (Abcam) and then 1:5000 goat anti- rabbit secondary antibody HRP conjugate (Invitrogen). Signal was detected using SuperSignal West Pico chemiluminescent substrate (Thermo Fisher Scientific) and imaged with the Versadoc MP 5000 system and Quantity One software (Bio-Rad).

3.2.9 Quantitative reverse transcriptase qPCR

Total RNA was isolated from heart tissue using the TriZol (Invitrogen) extraction method. Reverse transcription reaction was performed using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Invitrogen). SensiFAST SYBR No-ROX Kit mastermix (FroggaBio) was used for real-time thermal cycling. Primers for RGS2

(TGGGATTATGTGGCCTTAGC forward, AAGAACGTCAACACCCTTGC reverse), hGH (TGGGAAGACAACCTGTAGGG forward, AATCGCTTGAACCCAGGAG reverse), β- MHC (CTGAGACGGAGAATGGCAAGAC forward, ACTTGTTAGGGGTTGACGGTGAC reverse), ANP (ATTCCTGAGACGTCCCCTTT forward, CATTTCCATCCACAGCTCCT reverse), and BNP (TGGGAATTAGCCATGTGAGAG forward, TTTGGGTGTTCTTTTGTGAGG reverse) were designed using the OligoPerfect Designer (ThermoFisher), OligoCalc (Kibbe, 2007) and Primer-BLAST (NCBI) programs. Samples were amplified for 35 cycles using the Eppendorf Mastercycler Realplex Real-Time PCR machine. The mRNA quantity for each gene of interest was determined using standard curve analysis and normalized to 28S ribosomal expression.

3.2.10 Statistical analysis

All data were analyzed using GraphPad Prism 6.01 (GraphPad). All statistical analyses were performed using two-way ANOVA followed by Bonferroni post-tests and presented as mean ± SEM. Differences were considered significant at P<0.05.

Results

3.3.1 Generation of transgenic mice with cardiomyocyte specific expression of RGS2eb

We previously demonstrated that the in vitro expression of RGS2eb was sufficient to inhibit drug-induced hypertrophy in isolated neonatal rat cardiomyocytes (Chidiac et al., 2014). To elucidate the potential in vivo protective role of RGS2eb, we developed a novel strain of transgenic mice with targeted myocardial overexpression of polyhistidine-tagged RGS2eb under the control of the α-myosin heavy chain promoter (Fig. 3.1A). Genotyping with primers for a portion of the hGH polyA region, which was only present in the transgenic sequence of RGS2eb mice, was used to differentiate between RGS2eb TG and wildtype mice. Both RGS2eb TG and WT controls displayed a band at 342 bp indicating the presence of endogenous full- length RGS2 (Fig. 3.1B); Only RGS2eb transgenic mice displayed an additional 293 bp band, 85

which indicated the presence of the hGH poly A region. Due to the short length of the RGS2eb transgene and difficulty in immunoblotting (Chidiac et al., 2014) , immunohistochemical staining, qPCR for RGS2 and the human growth hormone (hGH), as well as dot blot visualization for the polyhistidine tag was used to confirm expression of the RGS2eb transgene. Following DAB visualization, WT mice showed an absence of staining for polyhistidine, whereas RGS2eb TG mice displayed positive antigen staining (Fig. 3.1C). Endogenous RGS2 appears to be decreased in both WT and RGS2eb TG mice following TAC (Fig. 3.1D), which has been previously demonstrated (Zhang et al., 2006); Expression of a region of hGH, which should only be present in transgenic mice, is significantly higher in RGS2eb TG mice than in WT animals (Fig 1E). In addition, LV heart tissues from RGS2eb TG mice showed positive signal for polyhistidine when visualized on dot blots, whereas no signal was detected in non- cardiac tissue (i.e. kidney) and LV samples from WT mice (Fig. 3.2F). Together, these results indicate successful generation of transgenic mice with cardiomyocyte specific overexpression of RGS2eb.

3.3.2 Improved cardiac function in RGS2eb transgenic mice following pressure overload

Transverse aortic constriction (TAC) was used to induce experimental pressure overload on wildtype and RGS2eb TG hearts. Following 4 weeks of constriction, systolic pressure was significantly increased in the right carotid artery, but significantly reduced downstream of the TAC site in the left carotid artery in both WT and RGS2eb TG mice (Fig. 3.3A and 3.3B. This resulted in a 61 mmHg difference in maximal systolic pressure between the left and right carotid arteries of WT sham and TAC mice, and a 65 mmHg difference between RGS2eb TG sham and TAC mice (Fig. 3.3C). These data, as well as summary hemodynamic parameters in Table 3.1, confirm that pressure overload had indeed been induced upon TAC hearts. Increased vascular resistance was reflected by significantly higher end-systolic pressures in TAC mice; increased afterload as well as cardiac dilation or hypertrophy in TAC mice was also suggested by significant increases in the end systolic and end diastolic volumes (Table 3.1). Heart rate under anaesthesia was maintained at similar levels in all surgery groups (Fig. 3.3D). Following pressure-volume loop analysis, RGS2eb TG mice demonstrated improved cardiac function as

measured by various systolic and diastolic indices. Summary data for contractility and relaxation (maximal elastance, ejection fraction, left ventricular systolic pressure, arterial elastance, LV +dP/dt, LV –dP/dt, and time constant tau) are provided in Figure 3. Notably, Millar catheter measurements of the maximal and minimal rates of pressure change in the left ventricle (LV +dP/dt and LV –dP/dt, respectively), which are important indices of cardiac contractility, were significantly greater in RGS2eb TG TAC mice compared to WT TAC counterparts (Fig. 3.4F and 3.4G). In addition, WT TAC mice had significant increases in the Tau relaxation constant (Fig. 3.4H), indicating impairment of active properties of diastolic relaxation. These data suggest that RGS2eb TG mice demonstrated improved compensation following 4 weeks of TAC compared to WT TAC animals.

3.3.3 Cardiac hypertrophy is inhibited in RGS2eb transgenic mice following pressure overload

Following 4 weeks of TAC, heart weight/body weight (HWT/BWT) ratios, LV and septal wall thickness, and the cross-sectional areas of cardiomyocytes were used to evaluate the development of cardiac hypertrophy. Although WT TAC mice developed significant cardiac hypertrophy (as measured by HWT/BWT) compared to sham controls, RGS2eb TG mice displayed limited hypertrophic growth compared to WT TAC animals (Fig 3.5A). Some hypertrophy does still appear to have occurred, as both WT and RGS2eb TG mice had significantly increased LV free wall thickness compared to sham controls (Fig. 3.5B, 3.5F and Fig. 3.6A (representatives)); Septal wall thickness was not significantly changed in TAC surgery groups compared to sham controls (Fig 3.5D). In addition, RGS2eb TG TAC mice did not show marked changes in LV free wall cardiomyocyte size compared to TG sham controls, and were significantly smaller in size than cardiomyocytes from WT TAC mice (Fig. 3.5E and 3.6B (representative)). No changes were observed in measured cardiomyocytes from the septal wall (Fig. 3.5F). These data suggest that RGS2eb may confer a protective effect in cardiomyocytes against pressure-induced cardiomyocyte hypertrophy.

3.3.4 Expression of cardiac hypertrophy markers is suppressed in RGS2eb transgenic mice

Induction of “fetal” cardiac genes is often a common feature in animal models of pathological hypertrophy and heart failure (Parker, Packer and Schneider, 1990; Razeghi et al., 2001). RNA was isolated from left ventricular tissue after 4 weeks of TAC or sham surgery, and qPCR was performed to determine expression levels of β-myosin heavy chain (β-MHC), atrial natriuretic peptide (ANP), and brain natriuretic peptide (BNP). WT mice which underwent TAC showed significantly increased levels of both β-MHC and ANP compared to sham controls (Fig. 3.7A and B). In contrast, β-MHC and ANP expression in RGS2eb TG mice after TAC was comparable to sham levels (Fig. 3.7A and B). BNP expression demonstrated a similar trend to that seen with β-MHC and ANP, but this did not attain statistical significance between RGS2eb TG and WT mice after TAC (Fig. 3.7C). Since the expression of fetal cardiac genes is postulated to be indicator of cardiac dysfunction, the absence of elevated levels in RGS2eb TG mice after TAC suggests that the presence of RGS2eb is cardioprotective in a pressure overload model of cardiac hypertrophy.

C D

Figure 3.1. Generation of transgenic mice with cardiomyocyte specific expression of

RGS2eb (A) Construct used for the generation of mice with cardiomyocyte-specific overexpression of RGS2eb under the control of α-myosin heavy chain. (B) Genotyping for a region which includes the hGH PolyA sequence results in a positive band for RGS2eb TG mice and the absence of a band in WT controls (lanes 8 and 10), while genotyping for endogenous RGS2 resulted in bands for both RGS2eb TG and WT controls (lanes 1, 3, 5, 7, and 9). (C) Representative immunostaining in the left ventricle of WT mice shows an absence of polyhistidine staining, whereas RGS2eb TG mice display positive immunostaining for polyhistidine. (D) RGS2 and (E) hGH qPCR expression in WT and RGS2eb TG mice following sham or TAC surgery. Data represent means ± SEM, n = 5-6 per group. **P<0.01, and ***P<0.001 using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons.

Figure 3.2. Dot blot detection of histidine-tagged RGS2eb

Signal for polyhistidine was only detected in the LV tissue of RGS2eb TG mice and His-RGS16 positive controls, with no signal detected in non-cardiac tissue or WT mice.

A B

C D

Figure 3.3. Pressure overload model of cardiac hypertrophy

(A) Following 4 weeks of aortic constriction between the left and right carotid arteries, systolic pressure in the LCA was reduced while (B) systolic pressure in the RCA was significantly increased. (C) Change in systolic pressure between the RCA and LCA following 4 weeks TAC was significantly increased in both WT and RGS2eb TG mice. (D) Heart rate remained at similar levels for all experimental and genotype groups. Data represent means ± SEM, n = 7- 9 per group. *P<0.05 and ***P<0.001 using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons.

Table 3.1. Hemodynamic parameters in 4 week sham and TAC mice.

Data represent means ± SEM **P<0.05 and **P<0.001 vs. sham controls using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons.

A B

C D E

F G H

Figure 3.4. Indices of systolic and diastolic function (A) Representative PV loops during preload reduction by inferior vena cava occlusion in sham (solid line) and 4 week TAC animals (dotted line). (B) Slope of left upper relation (maximal elastance [Emax]) reflected contractile function. (C) Ejection fraction was significantly reduced in WT but not RGS2eb TG mice following pressure overload, while (D) LV systolic pressure (LVSP) was significantly elevated following TAC in both WT and RGS2eb mice. (E) Effective arterial elastance (Ea; an index of total ventricular afterload) was also increased following TAC. (F) LV +dP/dt and (G) –dP/dt were significantly improved in RGS2eb mice following TAC, and (H) Tau relaxation time constant remained comparable to sham groups. Data represent means ± SEM, n = 6-9 per group. *P<0.05 and ***P<0.001 using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons.

A B

C D

E F

Figure 3.5. Cardiac hypertrophy is reduced in RGS2eb transgenic mice following pressure overload

(A) After 4 weeks of aortic constriction, cardiac hypertrophy in RGS2eb TG mice was significantly less than WT TAC. (B) Representative whole hearts for WT and RGS2eb TG mice following 4 weeks of sham or TAC surgery; (C) LV free wall thickness was increased in both TAC groups; (D) septal wall thickness did not increase. (E) Cardiomyocyte size was significantly reduced in RGS2eb TG mice compared to WT TAC in the LV free wall, with (F) no noticeable changes to size in the septal wall.

Figure 3.6. LV cross sections and cardiomyocytes

A) Representative H&E staining of WT and RGS2eb LV cross sections of WT and RGS2eb TG cardiomyocytes following sham or TAC surgery. (B) Representative H&E staining of WT and RGS2eb cardiomyocytes.

A B

Figure 3.7. Markers of cardiac hypertrophy

(A) β-MHC expression was significantly increased in WT TAC but not RGS2eb TG mice after 4 weeks of aortic constriction. (B) ANP expression was also significantly elevated in WT TAC mice, while RGS2eb TG mice maintained near-sham levels of expression. (C) BNP expression. Data represent means ± SEM, n = 4-8 per group. *P<0.05, **P<0.01, and ***P<0.001 using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons.

Discussion

In order for maladaptive cardiac hypertrophy to occur, individual cardiomyocytes must increase in size; such growth requires increased global protein synthesis, the rate of which is controlled primarily at the initiation level (Sugden et al., 2009). Of particular importance is the heterotrimeric initiation factor eIF2, which is activated by the heteropentameric protein eIF2B (Abbott and Proud, 2004). Notably, eIF2B has been shown to play a critical role in the development of -adrenergic receptor induced hypertrophy in cultured cardiomyocytes (Hardt et al., 2004). A major role for eIF2Bε in controlling cell size is also evident from its regulation by glycogen synthase kinase 3β (GSK3β), which constitutively phosphorylates eIF2Bε at serine 540 in intact cells, thereby inhibiting its GEF activity by up to 80% (Welsh et al., 1998). In a cultured cardiomyocyte model, overexpression of a mutant eIF2Bε which could not be phosphorylated by GSK3β increased cell size and abolished the antihypertrophic effects of GSK3β, suggesting that eIF2Bε is a direct mediator of cardiac myocyte hypertrophy (Hardt et al., 2004). Importantly, further expression of a dominant-negative mutant of eIF2Bε inhibited isoproterenol-induced cardiac hypertrophy, indicating the critical role of eIF2Bε in protein synthesis and cell growth (Hardt et al., 2004).

We have previously shown that the cellular effects of eIF2Bε are blocked by RGS2eb as well as by full length RGS2 (Nunn et al., 2010; Chidiac et al., 2014). The goal of the present study was to determine whether the ability of RGS2 to inhibit protein synthesis and cardiomyocyte growth in vitro could be extended to an animal model of pathological cardiac hypertrophy. We therefore developed a mouse line with cardiomyocyte specific expression of RGS2eb, and examined the functional, histological, and biochemical consequences of experimental pressure overload in our transgenic mice and WT littermates. To the best of our knowledge, this is the first study to demonstrate that expression of a portion of RGS2, namely the RGS2eb binding domain, can reduce pathogenic growth without adversely affecting in vivo cardiac function. Although a random insertion effect cannot be entirely excluded, expression of this transgene inhibited TAC-induced increases in heart weight/body weight ratio (Fig. 3.5A) and expression of hypertrophy-related gene markers (Fig. 3.7), as well as associated functional loss (Fig. 3.4).

These results likely reflect the ability of RGS2eb to inhibit protein synthesis in vivo, and the consequent suppression of the hypertrophic response and cardioprotective effects.

Using qPCR, immunohistochemistry and dot blotting methods, we have demonstrated the cardiac-specific expression of RGS2eb in our transgenic mice (Fig. 3.1). However, due to the short length of the RGS2eb transgene and difficulty in immunoblotting (Chidiac et al., 2014), a limitation of our study is our inability to fully demonstrate an eIF2B-RGS2eb complex. Although RGS2eb expression is associated with a decrease in cardiac hypertrophy and improved cardiac function, and our previous in vitro studies suggest that this is due to the inhibition of eIF2Bε, we cannot definitively attribute our in vivo observations to the direct inhibition of protein synthesis, and thus cannot exclude other off target effects as the mechanism behind our observed cardioprotection.

Although LV free wall thickness was significantly increased in both WT and RGS2eb TG mice following 4 weeks of TAC (Fig. 3.5C), HWT/BWT ratios indicated the development of significant TAC-associated cardiac hypertrophy in WT, but not RGS2eb TG mice (Fig. 3.5A). Furthermore, measurements of cardiomyocyte cross-sectional after area showed a corresponding increase in cell size for WT TAC but not RGS2eb TG mice (Fig. 3.5E). These data suggest that de novo protein synthesis in response to pressure overload, and thus hypertrophy, is inhibited in RGS2eb TG mice.

Our previous work showed that the adenoviral expression of RGS2eb in neonatal ventricular myocytes was able to attenuate the expression of genetic markers of hypertrophy to a comparable extent as full-length RGS2 (Chidiac et al., 2014). Thus, we examined whether RGS2eb could also attenuate in vivo increases in the “fetal gene program”, a group of molecular markers associated with the hypertrophy phenotype, including β-MHC, ANP, and BNP (Molkentin and Dorn, 2001; Frey and Olson, 2003; Petrich and Wang, 2004). Four weeks of aortic constriction induced an increase in the levels of β-MHC and ANP in WT mice (Fig. 3.7). These increases were completely abrogated in RGS2eb TG animals. Reactivation of fetal gene expression during cardiac hypertrophy is initially an adaptive process which increases the excitability, contractility, and plasticity of cardiac myocytes in response to pathological stress (Kuwahara, Nishikimi and Nakao, 2012). However, sustained fetal gene expression plays a 98

causative role in maladaptive cardiac remodelling, leading to cardiac dysfunction and often the pathogenesis of heart failure (Hannenhalli et al., 2006). In addition, our assessment of cardiac function obtained from pressure-volume loop analyses also suggests that RGS2eb TG mice were able to maintain significantly improved cardiac function after TAC compared to WT mice, as evidenced by both systolic and diastolic indices (Fig. 3.4). Our data suggest that the expression of RGS2eb appears to not only inhibit cardiac hypertrophy, but also improves cardiac function without activation of fetal cardiac genes after 4 weeks of TAC, although the effect on fetal gene expression may more likely be due to an indirect effect of the inhibition of cardiac hypertrophy and apparent improvement in cardiac function, rather than a direct mechanistic connection between RGS2eb and the re-expression of fetal genes. Further studies, such as prolonged exposure to TAC, may clarify the extent to which these effects are sustained.

Following transverse aortic constriction, RGS2 knockout mice have been found to develop severe cardiac hypertrophy and heart failure, as well as increased mortality compared to corresponding controls (Takimoto et al., 2009). Although this clearly indicates that the presence of RGS2 is cardioprotective in vivo, many details of this beneficial effect remain to be elucidated (Chidiac et al., 2014). In cultured ventricular myocytes, RGS2 is acutely and selectively upregulated in response to activators of Gq and Gs signalling (Hao et al., 2006; Zou et al., 2006; Nunn et al., 2010). However, RGS2 has been found to be ultimately downregulated in vivo following experimentally-induced hypertrophy and heart failure (Zhang et al., 2006). Furthermore, cardiac-specific overexpression of full-length RGS2 does not result in demonstrable cardioprotective effects in mice subjected to TAC (Park-Windhol et al., 2012). Conversely, the overexpression of either RGS4, RGS5, or RGS10 has been shown to reduce cardiac hypertrophy (Rogers et al., 1999, 2001; Li et al., 2010; Miao et al., 2016), although it may be noted that unlike RGS2, these proteins tend to localize to the atria rather than the ventricles (Doupnik, Xu and Shinaman, 2001; Mittmann et al., 2002; Larminie et al., 2004; Gu et al., 2009; Miao et al., 2016) . It is possible that the optimal level of RGS2 is decreased under conditions of hypertrophic stress, however a complete lack of RGS2 is clearly detrimental under pressure overload (Takimoto et al., 2009).

The lack of an observable protective effect of full-length RGS2 overexpression in the myocardium (Park-Windhol et al., 2012) stands in contrast to the present findings that expression of its isolated eIF2B-interacting domain (RGS2eb) can protect against pathological cardiac hypertrophy and dysfunction in vivo. We have previously shown that the ability of RGS2eb to inhibit drug-induced cell hypertrophy is independent of the G-protein inhibitory effects of full-length RGS2 (Chidiac et al., 2014). Along with our current findings, it follows that the RGS2eb region may be an important contributor to the reported beneficial cardiac effects of RGS2. Since our previous studies suggest that the RGS2eb region specifically binds to eIF2B and thereby inhibits protein synthesis (Nguyen et al., 2009), it is possible that some function of full length RGS2 may produce detrimental effects in the context of pathological hypertrophy, consistent with its observed downregulation in the latter condition (Zhang et al., 2006). Negative RGS2 effects could conceivably arise from its inhibition of beneficial G protein-mediated signals (e.g. the protective effects of adenosine) or alternatively via its effects on non-G protein targets such as tubulin or TRP channels (Heo et al., 2006; Schoeber et al., 2006). To examine the importance of the RGS2eb region per se, future studies would be in order, with expression of this truncated form targeted to the myocardium of full-body or cardiac-specific RGS2 knockout mice.

Conclusions

The present results suggest that expression of the eIF2B-interacting domain of RGS2, RGS2eb, can protect against pathological cardiac hypertrophy and dysfunction in vivo, and that this may be via the direct inhibition of protein synthesis. We have previously shown the ability of RGS2eb to inhibit drug-induced cardiomyocyte hypertrophy; along with our current findings, this suggests that the RGS2eb region is an important contributor to the reported beneficial cardiac effects of RGS2.

Currently, the majority of drugs for cardiovascular diseases target GPCRs. Although these medications can offer significant benefits to patients, heart failure continues to be a global leading cause of morbidity and mortality. A better understanding of the various components

100

that are part of the GPCR signaling pathways may lead to improved therapeutics, and interest in RGS2 and other RGS proteins as possible drug targets is on the rise (Le and Coffman, 2003; Sjögren and Neubig, 2010; Sjögren, Blazer and Neubig, 2010; Sjogren et al., 2012; Turner et al., 2012; Go et al., 2013; Sjögren et al., 2016). In summary, this study has demonstrated that RGS2eb is important in regulating in vivo cardiac hypertrophy and physiology, and suggests that this region of full-length RGS2 may be a key component of its reported cardioprotective effects.

101

References

Abbott, C. M. and Proud, C. G. (2004) ‘Translation factors: in sickness and in health’, Trends Biochem. Sci., 29(1), pp. 25–31.

Anger, T., Klintworth, N., Stumpf, C., Daniel, W. G., Mende, U. and Garlichs, C. D. (2007) ‘RGS protein specificity towards Gq- and Gi/o-mediated ERK 1/2 and Akt activation, in vitro.’, J. Biochem. Mol. Biol., 40(6), pp. 899–910.

Anversa, P., Leri, A., Rota, M., Hosoda, T., Bearzi, C., Urbanek, K., Kajstura, J. and Bolli, R. (2007) ‘Concise review: stem cells, myocardial regeneration, and methodological artifacts.’, Stem Cells, 25(3), pp. 589–601.

Campbell, D. J., Aggarwal, A., Esler, M. and Kaye, D. (2001) ‘beta-blockers, angiotensin II, and ACE inhibitors in patients with heart failure.’, Lancet (London, England). Elsevier, 358(9293), pp. 1609–10.

Carvalho, A. B. (2010) ‘Heart regeneration: Past, present and future’, World J. Cardiol. Baishideng Publishing Group Inc, 2(5), p. 107.

Chakir, K., Zhu, W., Tsang, S., Woo, A. Y. H., Yang, D., Wang, X., Zeng, X., Rhee, M. H., Mende, U., Koitabashi, N., Takimoto, E., Blumer, K. J., Lakatta, E. G., Kass, D. A. and Xiao, R. P. (2011) ‘RGS2 is a primary terminator of β2-adrenergic receptor-mediated Gi signaling’, J. Mol. Cell. Cardiol., 50(6), pp. 1000–1007.

Detombe, S. A., Ford, N. L., Xiang, F., Lu, X., Feng, Q. and Drangova, M. (2008) ‘Longitudinal follow-up of cardiac structure and functional changes in an infarct mouse model 102

using retrospectively gated micro-computed tomography.’, Invest. Radiol., 43(7), pp. 520–9. Dorn, G. W. and Force, T. (2005) ‘Protein kinase cascades in the regulation of cardiac hypertrophy’, J. Clin. Invest., 115(3), pp. 527–537.

Doupnik, C. A., Xu, T. and Shinaman, J. M. (2001) ‘Profile of RGS expression in single rat atrial myocytes’, Biochim. Biophys. Acta - Gene Struct. Expr., 1522(2), pp. 97–107. Frey, N. and Olson, E. N. (2003) ‘Cardiac Hypertrophy: The Good, the Bad, and the Ugly’, Annu. Rev. Physiol., 65(1), pp. 45–79.

Go, A. S., Mozaffarian, D., Roger, V. L., Benjamin, E. J., Berry, J. D., Borden, W. B., Bravata, D. M., Dai, S., Ford, E. S., Fox, C. S., Franco, S., Fullerton, H. J., Gillespie, C., Hailpern, S. M., Heit, J. A., Howard, V. J., Huffman, M. D., Kissela, B. M., Kittner, S. J., Lackland, D. T., Lichtman, J. H., Lisabeth, L. D., Magid, D., Marcus, G. M., Marelli, A., Matchar, D. B., McGuire, D. K., Mohler, E. R., Moy, C. S., Mussolino, M. E., Nichol, G., Paynter, N. P., Schreiner, P. J., Sorlie, P. D., Stein, J., Turan, T. N., Virani, S. S., Wong, N. D., Woo, D. and Turner, M. B. (2013) ‘Heart Disease and Stroke Statistics—2013 Update A Report From the American Heart Association’, Circulation, 127(1), pp. e6–e245.

Hannenhalli, S., Putt, M. E., Gilmore, J. M., Wang, J., Parmacek, M. S., Epstein, J. A., Morrisey, E. E., Margulies, K. B. and Cappola, T. P. (2006) ‘Transcriptional genomics associates FOX transcription factors with human heart failure.’, Circulation, 114(12), pp. 1269–76.

103

Heineke, J. and Molkentin, J. D. (2006) ‘Regulation of cardiac hypertrophy by intracellular signalling pathways.’, Nat. Rev. Mol. Cell Biol. Nature Publishing Group, 7(8), pp. 589–600.

Helms, S. A., Azhar, G., Zuo, C., Theus, S. A., Bartke, A. and Wei, J. Y. (2010) ‘Smaller cardiac cell size and reduced extra-cellular collagen might be beneficial for hearts of Ames dwarf mice’, Int. J. Biol. Sci., 6(5), pp. 475–490.

Kibbe, W. A. (2007) ‘OligoCalc: an online oligonucleotide properties calculator.’, Nucleic

104

Acids Res., 35(Web Server issue), pp. W43-6.

Kuwahara, K., Nishikimi, T. and Nakao, K. (2012) ‘Transcriptional Regulation of the Fetal Cardiac Gene Program’, J. Pharmacol. Sci., 119(3), pp. 198–203. Larminie, C., Murdock, P., Walhin, J.-P., Duckworth, M., Blumer, K. J., Scheideler, M. A. and Garnier, M. (2004) ‘Selective expression of regulators of G-protein signaling (RGS) in the human central nervous system’, Mol. Brain Res., 122(1), pp. 24–34.

Le, T. H. and Coffman, T. M. (2003) ‘RGS2: a “turn-off” in hypertension.’, J. Clin. Invest., 111(4), pp. 441–3.

105

Molkentin, J. D. and Dorn, G. W. (2001) ‘Cytoplasmic signaling pathways that regulate cardiac hypertrophy.’, Annu. Rev. Physiol. Annual Reviews 4139 El Camino Way, P.O. Box 10139, Palo Alto, CA 94303-0139, USA, 63, pp. 391–426.

Nguyen, C. H., Ming, H., Zhao, P., Hugendubler, L., Gros, R., Kimball, S. R. and Chidiac, P. (2009) ‘Translational control by RGS2’, J. Cell Biol., 186(5), pp. 755–765.

Pacher, P., Nagayama, T., Mukhopadhyay, P., Bátkai, S. and Kass, D. A. (2008) ‘Measurement of cardiac function using pressure-volume conductance catheter technique in mice and rats.’, Nat. Protoc. NIH Public Access, 3(9), pp. 1422–34.

Parker, T. G., Packer, S. E. and Schneider, M. D. (1990) ‘Peptide growth factors can provoke “fetal” contractile protein gene expression in rat cardiac myocytes.’, J. Clin. Invest. American Society for Clinical Investigation, 85(2), pp. 507–14.

Petrich, B. G. and Wang, Y. (2004) ‘Stress-activated MAP kinases in cardiac remodeling and heart failure; new insights from transgenic studies.’, Trends Cardiovasc. Med., 14(2), pp. 50– 5.

Razeghi, P., Young, M. E., Alcorn, J. L., Moravec, C. S., Frazier, O. H. and Taegtmeyer, H.

106

(2001) ‘Metabolic Gene Expression in Fetal and Failing Human Heart’, Circulation, 104(24), pp. 2923–2931.

Rogers, J. H., Tamirisa, P., Kovacs, A., Weinheimer, C., Courtois, M., Blumer, K. J., Kelly, D. P. and Muslin, A. J. (1999) ‘RGS4 causes increased mortality and reduced cardiac hypertrophy in response to pressure overload.’, J. Clin. Invest. American Society for Clinical Investigation, 104(5), pp. 567–76.

Sjögren, B., Blazer, L. L. and Neubig, R. R. (2010) ‘Regulators of G protein signaling proteins

107

as targets for drug discovery.’, Prog. Mol. Biol. Transl. Sci., 91, pp. 81–119.

Sjögren, B. and Neubig, R. R. (2010) ‘Thinking Outside of the “RGS Box”: New Approaches to Therapeutic Targeting of Regulators of G Protein Signaling’, Mol. Pharmacol., 78(4), pp. 550–557.

Sjogren, B., Parra, S., Heath, L. J., Atkins, K. B., Xie, Z. and Neubig, R. (2012) ‘Cardiotonic Steroids Stabilize RGS2 Protein Levels’, Mol. Pharmacol., p. mol.112.079293.

Subramaniam, A., Jones, W. K., Gulick, J., Wert, S., Neumann, J. and Robbins, J. (1991) ‘Tissue-specific regulation of the alpha-myosin heavy chain gene promoter in transgenic mice.’, J. Biol. Chem., 266(36), pp. 24613–20.

Sugden, P. H., Fuller, S. J., Weiss, S. C. and Clerk, A. (2009) ‘Glycogen synthase kinase 3 (GSK3) in the heart: a point of integration in hypertrophic signalling and a therapeutic target? A critical analysis’, Br. J. Pharmacol. Blackwell Publishing Ltd, 153(S1), pp. S137–S153.

Turner, E. M., Blazer, L. L., Neubig, R. R. and Husbands, S. M. (2012) ‘Small Molecule Inhibitors of Regulator of G Protein Signalling (RGS) Proteins.’, ACS Med. Chem. Lett., 3(2), pp. 146–150.

108

Weber, K. T. and Brilla, C. G. (1991) ‘Pathological hypertrophy and cardiac interstitium. Fibrosis and renin-angiotensin-aldosterone system.’, Circulation, 83(6), pp. 1849–1865.

109

4 EFFECTS OF TRANSVERSE AORTIC CONSTRICTION AND DRUG INDUCED EXPERIMENTAL PRESSURE OVERLOAD HYPERTROPHY ON Rgs2-/- MICE WITH CARDIOMYOCYTE SPECIFIC OVEREXPRESSION OF RGS2eb

110

Introduction

Regulator of G protein signalling (RGS) proteins function as GTPase activating proteins (GAPs) to limit the intensity and duration of GPCR-mediated signalling. RGS2 is a member of the R4 subfamily of RGS proteins, and selectively inhibits Gq-mediated signalling via its GAP activity and also via a GAP-independent mechanism (Abramow-Newerly et al., 2006).

RGS2 can also inhibit Gs signalling through its direct binding to some adenylyl cyclase isoforms and possibly also via its binding to Gαs (Abramow-Newerly et al., 2006).

Additionally, effects on Gi/o have also been reported (Chakir et al., 2011) notwithstanding the relatively low affinity of RGS2 for Gαi/o proteins (Heximer et al., 1999) . Since Gq- and Gs- mediated signalling play well established roles in the development of cardiovascular disease, the ability of RGS2 to selectively inhibit these pathways makes it an important target of study (Heximer et al., 1997, 1999; Roy, Baragli, et al., 2006).

Pathological cardiac hypertrophy, which often results from chronic hypertension, is a leading risk factor for various cardiovascular conditions (Levy et al., 1990; Cipriano et al., 2001); aside from age, left ventricular hypertrophy is the most reliable predictor of poor cardiovascular outcomes in hypertensive patients, and is an independent risk factor for sudden death, stroke, coronary heart disease, and heart failure (Gardin et al., 2001; Verdecchia et al., 2001; Gradman and Alfayoumi, 2006). Thus, identifying regulators of pathological hypertrophy is of great interest and importance. Studies in vivo and in cardiomyocyte models of hypertrophy have shown that increased cell growth caused by prolonged Gq-coupled receptor stimulation, such as that induced by phenylephrine, can be inhibited by RGS2 overexpression (Roy, Nunn, et al., 2006; Zou et al., 2006), with a similar effect seen against Gs-mediated cardiomyocyte hypertrophy induced by isoproterenol (Nunn et al., 2010). The importance of RGS2 in the regulation of hypertrophy has been further demonstrated in knockout animal studies. In Rgs2- /- mice, experimentally induced pressure overload via transverse aortic constriction causes severe hypertrophy, heart failure, and death (Takimoto et al., 2009). In addition, chronic angiotensin II infusion has been shown to significantly increase blood pressures in Rgs2-/- mice compared to WT controls (Hercule et al., 2007)

111

While the G protein inhibitory effects of RGS2 are well established, RGS2 can also bind to and regulate other targets, including TRPV6 calcium channels and tubulin (Wang et al., 2005; Heo et al., 2006; Schoeber et al., 2006). We have previously shown that RGS2 can also bind to the ε subunit of eukaryotic initiation factor 2B (eIF2B), a component of the rate-limiting step of the initiation of mRNA translation (Nguyen et al., 2009). This property of RGS2 has been mapped to a 37 amino acid domain (residues 79-115) termed RGS2eb that is homologous to a region in the β subunit of eIF2 (Nguyen et al., 2009), and we have also demonstrated that RGS2eb expression in cultured neonatal cardiomyocytes is able to inhibit both protein synthesis and agonist induced hypertrophy at levels comparable to full-length RGS2 (Chidiac et al., 2014).

Recently, we reported that following four weeks of transverse aortic constriction (TAC), mice with cardiomyocyte specific overexpression of RGS2eb (herein referred to as Rgs2+/+(eb) mice) were protected from pressure overload-induced cardiac hypertrophy, and maintained heart function at significantly improved levels compared to WT counterparts (see Chapter 3) (Lee et al., 2017). Reactivation of the fetal gene response was suppressed in Rgs2+/+(eb) mice following TAC, and cardiomyocyte size was decreased in Rgs2+/+(eb) mice compared to WT TAC controls. These findings suggest that in addition to its G-protein inhibitory actions, the RGS2eb region may contribute to the cardioprotective effects of full-length RGS2 in vivo via the inhibition of de novo protein synthesis.

Since full-length RGS2 was still being endogenously expressed in the Rgs2+/+(eb) mice from our previous studies (Lee et al., 2017), the use of Rgs2-/- mice would provide further insights into the cardioprotective role of the RGS2eb region. Based on our previous findings, we hypothesized that the cardiomyocyte-specific overexpression of RGS2eb in Rgs2-/- mice could decrease the severity of cardiac hypertrophy and heart failure resulting from experimentally induced pressure overload, thereby compensating for the absence of full-length RGS2. Here we report the generation of novel transgenic Rgs2-/- mice with cardiomyocyte specific overexpression of RGS2eb (Rgs2-/-(eb)). Unexpectedly, we observed that the mortality rate for Rgs2-/- animals significantly exceeded that of WT controls following 28 days of transverse aortic constriction (TAC), suggesting an impaired ability to recover from cardiovascular insult.

112

Due to the unexpectedly high mortality rate of Rgs2-/ - mice, the TAC-induced model of pressure overload was determined to be unsuitable for the evaluation of cardiac hypertrophy, and discontinued before the addition of Rgs2-/-(eb) mice to the study. The effects of drug- induced models of hypertension on Rgs2-/- mice were also evaluated. Chronic infusion of angiotensin II via osmotic pumps for 28 days (1.44 mg/kg/day) significantly increased blood pressures of experimental animals (Rgs2+/+(eb), Rgs2-/-, and Rgs2-/-(eb)), except for WT mice. Although cardiac function was impaired in Rgs2-/- animals compared to basal levels, cardiac hypertrophy was not observed in any experimental groups compared to saline controls. Further studies with angiotensin II infusion at higher concentrations (3.0 mg/kg/day for 14 days) in WT and Rgs2-/- mice also failed to induce clearly detectable cardiac hypertrophy. Additional pilot studies were subsequently performed using twice daily injections of isoproterenol (ISO) for 14 days, with preliminary results suggesting that a full study with prolonged injections beyond 14 days may result in cardiac hypertrophy. Overall, owing in large part to the general lack of efficacy and/or safety of established methods with respect to the induction of cardiac hypertrophy in our experimental animals, our results do not support our original hypothesis that RGS2eb expression in an RGS2 null background would provide a “rescue” effect. In addition, the present findings provide little if any support for the notion that mice lacking RGS2 exhibit greater levels of experimentally-induced cardiac hypertrophy.

Methods

4.2.1 Generation of Rgs2-/- mice with cardiac specific overexpression of RGS2eb

Rgs2+/+(eb) were crossed with Rgs2−/− mice to produce heterozygous Rgs2+/- animals with or without the expression of RGS2eb (Rgs2+/- (eb) or Rgs2+/-, respectively). Rgs2+/- (eb) mice were then crossed with Rgs2−/− mice to obtain RGS2 knockout animals expressing RGS2eb (Rgs2-/- (eb)). Subsequent crosses of Rgs2-/-(eb) with Rgs2−/− animals enabled the establishment of a mouse colony which produced Rgs2-/-(eb) mice and Rgs2−/− littermates (Fig. 4.1).

113

Colonies for Rgs2-/- and Rgs2+/+(eb) mice are well established in our laboratory (Roy, Nunn, et al., 2006; Lee et al., 2017). Briefly, during our initial generation of Rgs2+/+(eb) mice, the RGS2eb gene was targeted to the heart using the mouse α-MHC promoter (kindly provided by Jeffrey Robbins, Cincinnati Children’s Hospital Medical Center) (Subramaniam et al., 1991). Primers for the detection of transgenic Rgs2+/+(eb) mice and control primers for endogenous RGS2 expression have been previously described in Chapter 3 (Lee et al., 2017); the genotyping of Rgs2−/− mice has also been previously described (Oliveira-Dos-Santos et al., 2000). Three to five month old male mice were used for experimental studies; all mouse lines are in C57Bl/6 backgrounds. Animals were maintained in accordance with the Institute of Laboratory Animal Research Guide for the Care and Use of Laboratory Animals. These studies were approved by the Animal Care Committee at the University of Western Ontario, and complied with the guidelines of the Canadian Council on Animal Care.

4.2.2 Transverse aortic constriction (TAC)

TAC was used to induce pressure overload on the hearts of 12 week old male C57BL/6 wildtype (i.e., Rgs2+/+) and Rgs2-/- mice, and as described in Chapter 3 (Lee et al., 2017). Briefly, two knots were tied against a 25-gauge blunt needle placed parallel to the transverse aorta, which was immediately removed after the second tied knot followed by closure of the chest. Control WT and Rgs2-/- mice were subjected to sham operations without aortic constriction.

4.2.3 Drug treatments

28 day angiotensin (Ang) II infusion: Ang II (A9525, Sigma-Aldrich, Canada) was dissolved in sterile saline and added to osmotic pumps (Model 1004, Alzet, New York, NY, USA) as per manufacturer’s protocols (Alzet, 2017a); control pumps were filled with saline. The pump filling concentration of Ang II required to deliver the drug at a dose of 1.44 mg/kg/d was calculated using the mean pumping rates for each lot of osmotic pumps and the Alzet drug concentration calculator (Alzet, 2017b). Pumps were implanted subcutaneously under isoflurane anaesthesia. Echocardiography and blood pressure measurements were performed for pre-implantation (basal), 14 day, and 28 day time points. Experimental animals included

114

Rgs2-/- and Rgs2-/-(eb) animals, as well as control WT and Rgs2+/+(eb) mice. Animals were sacrificed after 28 days for tissue collection.

14 day angiotensin II infusion: Ang II (12-1-34, American Peptide Company, CA, USA) was dissolved in sterile saline and added to osmotic pumps (Model 1002, Alzet); control pumps were filled with saline. The pump filling concentration of Ang II required to deliver the drug at a dose of 3.0 mg/kg/d was as described above. Echocardiography was performed on day 14, followed by animal sacrifice and tissue collection. Only Rgs2-/- and WT mice were used for this study.

Isoproterenol (ISO) injections: ISO (I6504, Sigma-Aldrich) was dissolved in sterile saline and injected subcutaneously at a dose of 15 mg/kg or 50 mg/kg twice daily (at 0900 h and 2100 h) for 12 days or 14 days, respectively; control mice were injected with sterile saline. Experimental animals included Rgs2-/- and Rgs2-/-(eb)animals, as well as control WT and Rgs2+/+(eb) mice. Mice were weighed daily and sacrificed on day 12 or day 14 for tissue collection.

4.2.4 Assessment of blood pressure

Non-invasive tail-cuff blood pressures and heart rates were measured using the CODA tail- cuff blood pressure system (Kent Scientific, USA) as previously described (Tutunea-Fatan et al., 2015). For angiotensin II osmotic pump studies, heart rates and tail-cuff blood pressures were recorded in conscious mice for basal, 14 day, and 28 day time points.

4.2.5 Assessment of cardiac function

M-mode (motion mode) echocardiography was performed after Ang II or saline treatments as previously described (Liu et al., 2014; Roy et al., 2016). Briefly, cardiac function was measured using the Vevo 2100 imaging system (VisualSonics, Canada). Using a dynamically focused 40MHz probe, 2-dimensional heart images were obtained in short-axis view for the left ventricle (LV).

M-mode recordings were assessed for the determination of various cardiovascular parameters using the Cardiac Measurement Package (PSLAX protocol) and averaged from 3 cycles 115

(VisualSonics, 2008). Anterior and posterior wall thickness, as well as LV internal diameter were directly measured from M-mode recordings for both systolic and diastolic phases. Ejection fraction, fractional shortening, LV volume, and corrected LV mass were derived from established formulas calculated by the VisualSonics analysis report function (VisualSonics, 2008). Detailed measurement and calculation definitions from VisualSonics are described in Supplemental Table C1.

4.2.6 Tissue collection

Upon completion of studies, anaesthetized mice were euthanized via a 10% KCl injection into the left jugular vein to ensure cardiac arrest in the diastolic state. Hearts were excised, weighed after removal of the atria, and stored at -80°C for subsequent RNA isolation. For 50 mg/kg ISO experiments, lungs were also excised and rinsed in saline, then weighed. Tibias from each animal were excised, cleaned, and measured for heart weight/tibia length calculations.

4.2.7 Quantitative reverse transcriptase qPCR

Total RNA was isolated from LV heart tissue using the TriZol (Invitrogen) extraction method for 1.44 mg/kg/day Ang II experiments. Reverse transcription reaction was performed using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Invitrogen, Canada). SensiFAST SYBR No-ROX Kit mastermix (FroggaBio, Canada) was used for real- time thermal cycling. Primers for β-MHC, ANP, and BNP were previously described in Chapter 3 (Lee et al., 2017), and were designed using the OligoPerfect Designer (ThermoFisher, Canada), OligoCalc (Kibbe, 2007) and Primer-BLAST (NCBI) programs. Samples were amplified for 35 cycles using a CFX384 real-time thermal cycler (Bio-Rad, Canada). The mRNA quantity for each gene of interest was determined using standard curve analysis and normalized to 28S ribosomal expression.

4.2.8 Statistical analysis

All data were analyzed using GraphPad Prism 6.01 (GraphPad). Statistical analyses were performed using two-way ANOVA followed by Bonferroni post-tests, Log rank test (for

116

survival curves), or Student’s t-test and presented as mean ± SEM. Differences were considered significant at P<0.05.

Results

4.3.1 Generation of transgenic mice with cardiomyocyte-specific overexpression of RGS2eb

We previously demonstrated that the vivo expression of RGS2eb inhibited pressure overload induced cardiac hypertrophy and improved cardiac function (Lee et al., 2017). Since endogenous RGS2 was still present in our previous studies, we used well established Rgs2-/- and Rgs2+/+(eb) mouse lines in our laboratory to develop a novel strain of Rgs2-/- mice with targeted myocardial overexpression of RGS2eb (Rgs2-/-(eb)) (Fig. 4.2A). As previously mentioned in Chapter 3, genotyping with primers for a portion of the hGH polyA region, which was only present in the transgenic sequence of Rgs2+/+(eb) mice, was used to identify mice expressing RGS2eb. Primers for endogenous RGS2 and a region of the RGS2 knockout construct (Oliveira-Dos-Santos et al., 2000), were used to identify wildtype and Rgs2-/- animals, respectively. Together, these results indicate the successful generation of Rgs2-/- mice with cardiomyocyte specific overexpression of RGS2eb.

4.3.2 Increased mortality in Rgs2-/- mice following pressure overload Transverse aortic constriction (TAC) was used to induce experimental pressure overload on wildtype and Rgs2-/- mice. Since Rgs2-/- mice have been previously reported to be highly sensitive to pressure overload induced hypertrophy and heart failure (Takimoto et al., 2009), initial TAC studies were performed with Rgs2-/- animals to establish whether the previous surgery conditions used in Chapter 3 were suitable. Survival rates for Rgs2-/- mice subjected to TAC surgery were found to be significantly lower than sham controls, with 70% of Rgs2-/- mice dying within two days of TAC surgery (Fig. 4.2A); a similar effect was not observed for WT TAC mice (Fig. 4.2B). Due to the low survival rate of Rgs2-/- mice, we concluded that TAC was too severe of a procedure for our goal of producing a hypertrophy model. Due to

117

these observations, we did not continue this study with our remaining experimental groups (i.e. with Rgs2+/+(eb) and Rgs2-/-(eb) mice).

4.3.3 28 day angiotensin II treatment at 1.44 mg/kg/day As an alternative to TAC, we investigated the effects of drug-induced hypertension in Rgs2-/- (eb) and Rgs2-/- mice. Chronic Ang II infusion has been previously shown to reproducibly increase blood pressure and induce the development of cardiac hypertrophy in C57Bl/6 mice (Francois et al., 2004; Crowley et al., 2006). Tail cuff systolic and diastolic blood pressure measurements as well as HR were taken one to five days prior to pump implantation (basal) and at 14 days and 28 days following infusion of saline or Ang II at a dose of 1.44 mg/kg/day in WT, Rgs2+/+(eb), Rgs2-/-, and Rgs2-/-(eb) mice. In Ang II treated Rgs2+/+(eb) mice, significant increases in systolic BP were observable by day 14 and remained elevated through day 28 compared to basal levels (Fig. 4.3A) Similar significant systolic BP changes were observed at day 28 in Rgs2-/- and Rgs2-/-(eb) mice (Fig. 4.3A). However, WT systolic BP Ang II treatment at 28 days was not significantly increased compared to basal (P=0.062, Fig. 4.3A). Significant elevations in diastolic BP were observed at 28 days in Rgs2-/- and Rgs2-/-(eb) mice (Fig. 4.3B). No changes in systolic or diastolic BPs occurred in saline controls (Fig. 4.3C and D), and heart rates were comparable between all genotypes and treatment groups (Table 4.2).

Although hypertension was evident in WT, Rgs2+/+(eb), Rgs2-/-, and Rgs2-/-(eb) mice following chronic Ang II treatment, cardiac hypertrophy was not observed in any strains or treatment groups following the 28 day time point, as measured by either heart weight/tibia length (Fig. 4.4A and C) or echocardiography for LV mass (Fig. 4.4C and D). In addition, echocardiography measurements for LV diastolic and systolic internal diameters (LVID) in saline and Ang II treated groups did not provide evidence for chamber dilation or hypertrophy (Figure 4.5). Echocardiography measurements for posterior and anterior LV wall thickness during diastole and systole provided further evidence for a lack of cardiac hypertrophy (Figure 4.6 and 4.7); LV volume was also comparable to basal levels (Figure 4.8). Overall, these results suggest that experimental hypertension induced by Ang II infusion was insufficient for the development of cardiac hypertrophy in any of the groups tested.

118

4.3.4 Decreased cardiac function in Rgs2-/- mice following 28 days of angiotensin II treatment In addition to hypertrophy parameters, cardiac function was also assessed in WT, Rgs2+/+(eb), Rgs2-/-, and Rgs2-/-(eb) mice following 28 days of saline of Ang II infusion. Ejection fraction (EF) and fractional shortening (FS) in Rgs2-/- mice were significantly decreased compared to Rgs2-/- basal values (Fig. 4.9A and C). No significant decreases in EF or FS were observed in WT, Rgs2+/+(eb), or Rgs2-/-(eb) following Ang II or saline treatment (Fig. 4.9).

4.3.5 Expression of fetal genes in LV tissue of 28 day 1.44 mg/kg/day chronic angiotensin II treated mice Induction of “fetal” cardiac genes is often a common feature in animal models of pathological hypertrophy and heart failure (Parker, Packer and Schneider, 1990; Razeghi et al., 2001). RNA was isolated from left ventricular tissue after 28 days of Ang II or saline, and qPCR was performed to determine expression levels of β-myosin heavy chain (β-MHC), atrial natriuretic peptide (ANP), and brain natriuretic peptide (BNP) in WT and Rgs2-/- mice. Surprisingly, WT mice treated with Ang II were found to express significantly lower levels of β-MHC compared to Ang II Rgs2-/- animals and saline controls (Fig. 4.10 A). ANP was significantly increased in Rgs2-/- compared to WT Ang II mice (Fig. 4.10B), while BNP was significantly decreased in Rgs2-/- compared to WT saline mice (Fig. 4.10 C).

119

Figure 4.1. Breeding schematic for generation of Rgs2-/-(eb) mice

Rgs2-/- and Rgs2+/+(eb) mouse lines were crossed to obtain heterozygous mice with transgene expression (Rgs2+/-(eb)). Subsequent crosses with Rgs2-/- mice produced a colony of Rgs2-/- and Rgs2-/-(eb) littermates.

120

A B

1 0 0 1 0 0 8 0

) 8 0

)

(

l S h a m , n = 9 l

a 6 0

v S h a m , n = 2 0 v

i T A C , n = 2 2

i v

v T A C , n = 1 3

r r

u 4 0

u 4 0 S S

2 0 2 0 K O , p = 0 .0 0 8 W T , p = 0 .6 7

0 0 0 1 2 5 7 1 4 2 1 2 8 0 1 2 5 7 1 4 2 1 2 8 D a y s p o s t-s u rg e r y D a y s p o s t-s u rg e r y

S u rv iv a l p ro p o rtio n s : S u rv iv a l p ro p o rtio n s : Days post-surgery KO sham (%) KO TAC (%) Days post-surgery WT Sham (%) WT TAC (%) 0 100.0 100.0 0 100.0 100.0 1 87.5 39.1 1 92.3 2 30.4 5 84.6 28 87.5 30.4 8 95.0 20 85.0 28 85.0 84.6

Figure 4.2. Survival and cardiac hypertrophy following 28 days TAC in WT and Rgs2-/- mice

(A) Significantly lower survival was observed for Rgs2-/- TAC mice compared to sham controls, which was not seen in (B) WT TAC animals. WT survival data is based on sham and TAC surgeries completed for Chapter 3 studies. Data represent means ± SEM, n = 5-22 per group. *P<0.05 and ***P<0.001 using Log rank test for survival curves.

121

A B

2 0 0 2 0 0

A n g II A n g II ) ) *

* g

g 1 8 0 * 1 8 0

m 1 6 0 1 6 0 m

(

** P P *

1 4 0 1 4 0

i l

l 1 2 0 1 2 0

a y

1 0 0 i 1 0 0 S D 8 0 8 0 W T T G K O K O T W T T G K O K O T

C) D)

1 6 0 1 6 0 S a lin e S a lin e

) 2 8 d

)

g g

H 1 4 d

1 4 0 1 4 0 m

m B a sa l

( (

P 1 2 0 1 2 0

l l

o t

t 1 0 0 1 0 0

S D

8 0 8 0 W T T G K O K O T W T T G K O K O T

Figure 4.3. Tail-cuff blood pressure measurements for basal, 14 day, and 28 days during saline of Ang II 1.44 mg/kg/day

TG and KOT designations indicate Rgs2+/+(eb) and Rgs2-/-(eb) mice, respectively. (A) Systolic and (B) diastolic blood pressures (BP) were significantly altered at multiple time points in Ang II treated mic. (C) Systolic and (D) diastolic BPs for saline treated mice remained stable throughout the 28 days. Data represent means ± SEM, n=8-18 per genotype group for Ang II, and n=2 per genotype group for saline treated. *P<0.05 and ***P<0.001 using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons.

122

Table 4.1. Heart rates for Ang II and saline treated WT, Rgs2+/+(eb) , Rgs2-/-, and Rgs2-/-(eb) mice (beats per minute)

Saline WT TG KO KOT n 2 2 2 2

Basal 673 670 639 636

14 day 687 645 641 617

28 day 632 672 671 607

Ang II WT TG KO KOT n 5-16 6-9 5-15 7-9

Basal 690± 14 670± 12 639± 19 636± 47

14 day 704± 25 660± 31 651± 22 607± 27

28 day 681± 42 707± 42 653± 43 604± 23

TG and KOT columns indicate Rgs2+/+(eb) and Rgs2-/-(eb) mice, respectively.

123

A B W T TG 1 0 1 0

K O K O T

)

) m m

8 8

/ g

g m

m 6 6

(

T /

/ 4 4

T T

W W

H 2 H 2

0 0

S a lin e An g II S a lin e An g II

C D

1 4 0 1 4 0 B a sa l B a sa l 1 4 d 1 4 d 1 2 0

2 8 d 1 2 0 2 8 d

)

g g

1 0 0 m

( 1 0 0

(

t c

c 8 0 8 0

r r

c c

6 0

s s

a m

4 0 m 4 0

L V

L 2 0 2 0

0 0 W T K O W T K O T G K O T T G K O T S A L IN E A N G II S A L IN E A N G II

Figure 4.4. Heart weight/tibia length ratios and LV mass, 1.44 mg/kg/day Ang II or saline

treatment

Heart weight/tibia length was measured for WT, Rgs2+/+(eb) (TG) , Rgs2-/- (KO) and Rgs2-/-(eb) (KOT) mice in Ang II and saline treated after 28 days. LV mass was also measured from echocardiography images at basal, 14 days, and 28 days of treatment. Data represent means ± SEM, n=3 (saline) or 8 (Ang II-treated) per genotype group. Statistical analysis was performed using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons.

124

A B

6 6 B a sa l B a sa l 1 4 d 1 4 d

5 2 8 d 5 2 8 d

)

4 ) 4

(

3 d 3

;

I V

V L 2 L 2

1 1

0 0

W T K O W T K O T G K O T T G K O T S A L IN E A N G II S A L IN E A N G II

C D

5 5 B a sa l B a sa l 1 4 d 1 4 d 2 8 d 2 8 d 4 4

)

) m

m 3 3 m

(

;

D I

I 2 2

L L

1 1

0 0 W T K O W T K O T G K O T T G K O T S A L IN E A N G II S A L IN E A N G II

(A) (B) LVID;d and (C Figure 4.5. LV internal diameters (LVID) at diastole and systole, 1.44 mg/kg/day Ang II or

saline treatment

(A)(B) LVID;d (C)(D) LVID;s were comparable between both Ang II and saline treatment groups, as well as between genotypes for WT, Rgs2+/+(eb) (TG) , Rgs2-/- (KO) and Rgs2-/-(eb) (KOT) mice. LVID was measured from echocardiography images at basal, 14 days, and 28 days of treatment. Data represent means ± SEM, n=3 (saline) or 8 (Ang II treated) per genotype group. Statistical analysis was performed using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons.

125

A B

1 .2 1 .2 B a sa l B a sa l 1 4 d 1 4 d 2 8 d 1 .0 2 8 d 1 .0

0 .8 0 .8 )

)

(

0 .6 0 .6

d ;

;

A A 0 .4 0 .4

0 .2 0 .2

0 .0 0 .0 W T K O W T K O T G K O T T G K O T

S A L IN E A N G II S A L IN E A N G II C D

1 .4 1 .4 B a sa l B a sa l 1 4 d 1 4 d 1 .2 1 .2 2 8 d 2 8 d

1 .0 1 .0 )

m 0 .8 0 .8

m ;

(

s ;

0 .6 A 0 .6 W

0 .4 0 .4

0 .2 0 .2

0 .0 0 .0 W T K O W T K O T G K O T T G K O T S A L IN E A N G II S A L IN E A N G II

Figure 4.6. Anterior wall (AW) thickness, diastole and systole, 1.44 mg/kg/day Ang II or saline treatment

(A) (B) AW;d and (C) (D) AW;s were comparable between both Ang II and saline treatment groups, as well as between genotypes for WT, Rgs2+/+(eb) (TG) , Rgs2-/- (KO) and Rgs2-/-(eb) (KOT) mice. AW was measured from echocardiography images at basal, 14 days, and 28 days of treatment. Data represent means ± SEM, n=3 (saline) or 8 (Ang II treated) per genotype group. Statistical analysis was performed using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons.

126

A B

1 .2 1 .2 B a sa l B a sa l 1 4 d 1 4 d 1 .0 2 8 d 1 .0 2 8 d

0 .8 0 .8

)

(

0 .6 0 .6

;

P P 0 .4 0 .4

0 .2 0 .2

0 .0 0 .0 W T K O W T K O T G K O T T G K O T S A L IN E A N G II S A L IN E A N G II

C D

1 .8 B a sa l 1 .8 B a sa l 1 4 d 1 4 d 2 8 d 2 8 d

1 .2 1 .2 )

)

(

;

P W

P 0 .6 0 .6

0 .0 0 .0 T G K O T T G K O T W T K O W T K O S A L IN E A N G II S A L IN E A N G II

Figure 4.7. Posterior wall thickness (PW), diastole and systole, 1.44 mg/kg/day Ang II or saline treatment (A) (B) PW;d and (C) (D) PW;s were comparable between both Ang II and saline treatment groups, as well as between genotypes for WT, Rgs2+/+(eb) (TG) , Rgs2-/- (KO) and Rgs2-/-(eb) (KOT) mice. PW was measured from echocardiography images at basal, 14 days, and 28 days of treatment. Data represent means ± SEM, n=3 (saline) or 8 (Ang II treated) per genotype group. Statistical analysis was performed using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons.

127

A B

1 4 0 1 4 0 B a sa l B a sa l 1 4 d 1 4 d 1 2 0 2 8 d 1 2 0 2 8 d

1 0 0 1 0 0

) ) L

m m (

( 8 0 8 0

d d

; ;

l l o

o v

v 6 0 6 0

V V

L L 4 0 4 0

2 0 2 0

0 0 W T K O W T K O T G K O T T G K O T

S A L IN E A N G II S A L IN E A N G II

C D

6 0 6 0 B a sa l B a sa l 1 4 d 1 4 d

2 8 d 2 8 d )

) 4 0 4 0 L

m m

( (

s s

; ;

l l o

v v

V V L L 2 0 2 0

0 0 W T K O W T K O T G K O T T G K O T S A L IN E A N G II S A L IN E A N G II

Figure 4.8. LV vol, diastole and systole, 1.44 mg/kg/day Ang II or saline treatment

(A) (B) LV;d and (C) (D) LV;s were comparable between both Ang II and saline treatment groups, as well as between genotypes for WT, Rgs2+/+(eb) (TG) , Rgs2-/- (KO) and Rgs2-/-(eb) (KOT) mice. LV was measured from echocardiography images at basal, 14 days, and 28 days of treatment. Data represent means ± SEM, n=3 (saline) or 8 (Ang II treated) per genotype group. Statistical analysis was performed using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons.

128

A B

B a sa l B a sa l 8 0 1 4 d 8 0 1 4 d 2 8 d 2 8 d 7 0 7 0 6 0 * 6 0

) 5 0

(

F 4 0

E E 3 0 3 0 2 0 2 0

1 0 1 0

0 0 W T K O W T K O T G K O T T G K O T S A L IN E A N G II S A L IN E A N G II C D

5 0 5 0 B a sa l B a sa l 1 4 d 1 4 d 2 8 d 2 8 d 4 0 4 0

3 0 3 0

)

(

S F 2 0 F 2 0

1 0 1 0

0 0

W T K O W T K O T G K O T T G K O T S A L IN E A N G II S A L IN E A N G II

Figure 4.9. Ejection fraction and fractional shortening, 1.44 mg/kg/day Ang II or saline treatment (A) EF in Rgs2-/- (KO) was significantly reduced after 28 days of ang compared to basal Rgs2- /- (KO) levels. Changes to EF compared to basal were not observed for WT, (B) Rgs2+/+(eb) (TG) or Rgs2-/-(eb) (KOT) mice. Similarly, (C) FS was significantly reduced in Rgs2-/- (KO) was significantly reduced after 28 days of ang compared to basal, with no changes observed in WT, (D) Rgs2+/+(eb) (TG) or Rgs2-/-(eb) (KOT) mice. EF and FS were calculated from LV vol and LVID parameters (see Suppl. Table C1 for equations) at basal, 14 days, and 28 days of treatment. Data represent means ± SEM, n=3 (saline) or 8 (Ang II treated) per genotype group. Statistical analysis was performed using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons.

129

A W T S 0 .8

8 K O

2 /

n ** * o

i 0 .6

s s

e r

p 0 .4 x

H 0 .2

-  0 .0 S a lin e An g II

B C

2 .0 1 .0

W T * W T S

S K O K O 8

8 0 .8

2 /

/ 1 .5

n o

o * i i

0 .6

s e

e 1 .0 r

r p

p 0 .4

P 0 .5 P

0 .2

N A B 0 .0 0 .0 S a lin e An g II S a lin e An g II

Figure 4.10. Markers of cardiac hypertrophy

(A) After 28 days of Ang II or saline, WT mice treated with Ang II were found to express significantly lower levels of β-MHC compared to Ang II Rgs2-/- animals and saline controls. (B) ANP was significantly increased in Rgs2-/- compared to WT Ang II mice, while (C) BNP was significantly decreased in Rgs2-/- compared to WT saline mice (Fig. 4.10 C). Data represent means ± SEM, n=6 per group. *P<0.05 and **P<0.01 using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons.

130

4.3.6 14 day angiotensin II treatment at 3.0 mg/kg/day Since Ang II treatment at 1.44 mg/kg/day was sufficient to increase blood pressure, but did not appear to induce cardiac hypertrophy, 3.0 mg/kg/day of Ang II was tested in WT and Rgs2-/- mice for 14 days to determine whether an increase in drug dosage could produce a hypertrophic response. Significant cardiac hypertrophy did not occur in either WT or Rgs2-/- mice compared to saline controls (Fig. 4.11A). Furthermore, echocardiography for systolic and diastolic diameters (Fig. 4.11 B and C), as well as EF and FS (Fig. 4.11D and E), were similar between all treatment groups and strains.

4.3.7 Effect of twice daily isoproterenol injections Due to a lack of inducible cardiac hypertrophy in our Ang II models, we tested whether a different drug and mode of delivery could improve our attempts to characterize the Rgs2-/-(eb) mouse. Isoproterenol was injected subcutaneously at a dose of 15 mg/kg for 12 days. To determine feasibility, initial tests were performed only in WT mice. Following ISO injection, WT heart rates (under anaesthesia) rapidly increased from approximately 400 bpm to 700 bpm thirty seconds after injection and plateaued at that level (Fig. 4.12A), indicating that a pharmacologically relevant dose was used. HR measurements 8 hours and 24 hours after ISO delivery showed a gradual return to baseline, suggesting that twice daily doses of ISO would be appropriate to maintain animal HRs at elevated levels (Fig. 4.12A). Following twelve days of ISO or saline injections, statistically significant levels of hypertrophy were not observed (data not shown). Therefore, ISO dosage was subsequently increased to 50 mg/kg twice daily for 14 days to WT, Rgs2+/+(eb), Rgs2-/-, and Rgs2-/-(eb) mice; body weights were recorded daily and animals were tracked for survival (Suppl. Fig. C1). Wet lung weight/tibia length was similar between all strains and conditions, and did not suggest the development of congestion (Fig. 4.13A). Similar to the twelve day ISO studies, the development of hypertrophy in Rgs2- /- mice compared to saline controls was not statistically significant (P=0.08) (Fig. 4.13B).

131

Discussion

Maladaptive cardiac hypertrophy is a common condition that often develops in settings of hypertension, and is a major risk factor for heart failure and sudden death. Since the heart is thought to be an essentially post mitotic organ, cardiomyocyte growth requires de novo protein synthesis, which is controlled primarily at the initiation of mRNA translation stage (Sugden et al., 2009). We have previously shown that the in vitro expression of RGS2eb, a region of full- length RGS2, can block protein synthesis and cultured cardiomyocyte growth by inhibiting eIF2B, a key component of the rate-limiting step of protein synthesis initiation (Nguyen et al., 2009; Chidiac et al., 2014). Furthermore, we recently developed a transgenic mouse line with cardiomyocyte specific overexpression of RGS2eb (i.e. Rgs2+/+(eb) mice). Using a pressure overload model, we demonstrated that expression of RGS2eb inhibited TAC-induced increases in cardiac hypertrophy and the expression of hypertrophy-related gene markers, as well as associated functional loss (Lee et al., 2017). These results likely reflected the ability of RGS2eb to inhibit protein synthesis in vivo, and the consequent suppression of the hypertrophic response and cardioprotective effects. In the present studies, we attempted to extend our earlier work to study the potential protective effect of RGS2eb expression targeted to the myocardium in whole body RGS2 knockout mice, but this effort was abandoned due to unacceptably high mortality of the TAC procedure in Rgs2-/- animals. We also were unable to establish whether the hypothesized protective/rescue effect could be observed with drug-induced experimental cardiac hypertrophy due to generally poor efficacies of established hypertrophy-inducing drug treatments in our experimental animals. Finally, the majority of our results do not support the notion the Rgs2-/- mice are prone to more severe experimental hypertrophy, in contrast to the previous findings of Takimoto and colleagues (Takimoto et al., 2009).

Our previous work demonstrated the anti-hypertrophic effects of RGS2eb expression in a C57Bl/6 background where endogenous expression of full-length RGS2 (which contains the RGS2eb region) was still present. The goal of the present study was to determine whether the apparent ability of RGS2eb to confer cardioprotection could be extended in part to Rgs2-/- mice, which have previously been reported to be highly sensitive to TAC induced pressure

132

A S a lin e A n g II 1 0 3 .0 m g /k g /d a y

) A n g II

/ g

m 6 (

L T

/ 4

T W

H 2

0 W T K O

6 6 B B a s a l C B a s a l

1 4 d 1 4 d

)

) m 4 m 4

(

;

I V

2 V 2

L L

0 0 W T K O W T K O W T K O W T K O D S A L IN E A N G II E S A L IN E A N G II 1 0 0 5 0 B a s a l B a s a l 1 4 d 1 4 d

8 0 4 0 )

6 0 ) 3 0

(

S E 4 0 F 2 0

2 0 1 0

0 0 W T K O W T K O W T K O W T K O S A L IN E A N G II S A L IN E A N G II

Figure 4.11. Heart weight/tibia length, LVID, EF, and FS in 3.0 mg/kg/day Ang -/- II or saline treated WT and Rgs2 mice (A) Significant cardiac hypertrophy did not occur in WT or Rgs2-/- mice compared to saline controls. Echocardiography for (B) diastolic and (C) systolic parameters, as well as (D) ejection fraction (EF) and (E) fractional shortening (FS) were similar between all treatment groups and strains. Data represent means ± SEM, n=3-8 per group. Statistical analysis was performed using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons.

133

8 0 0

)

m 6 0 0

b (

t 4 0 0

r a

e 2 0 0 W T 1 H W T 2

0 0s 5s 1 0 s 1 5 s 3 0 s 6 0 s 8 h 2 4 h

T im e p o s t-in je c tio n

Figure 4.12. ISO tests in WT mice, 15 mg/kg s.c. injections

Following ISO injection, WT heart rates (under anaesthesia) rapidly increased from approximately 400 bpm to 700 bpm thirty seconds after injection, and plateaued at that level. HR measurements 8 hours and 24 hours after ISO delivery showed a gradual return to baseline, suggesting that twice daily doses of ISO would be appropriate to maintain animal HRs at elevated levels. Data points represent individual animals.

134

A 1 2 S a lin e IS O

) 1 0

m m

/ 8

g m

(

6 L

/ 4 T

L 2

0 W T T G K O K O T

B 1 2 S a lin e

) 1 0 IS O

m m

/ 8

m (

L T / 4

T W

H 2

W T T G K O K O T

Figure 4.13. Lung weight/tibia length and heart weight/tibia length in 14 day saline or 50 mg/kg ISO treated mice

(A) Wet lung weight/tibia length was similar between all strains and conditions, and did not suggest the development of congestion. (B) Although statistical significance was not attained, heart weight/tibia length ratios indicated the development of hypertrophy in Rgs2-/- (KO) and Rgs2-/-(eb) (KOT) mice. Data represent means ± SEM, n=3-8 per group. Statistical analysis was performed using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons.

135

overload (Takimoto et al., 2009). In order to develop a line of Rgs2-/- mice with cardiomyocyte specific overexpression of RGS2eb (Rgs2-/-(eb)), we crossed Rgs2+/+(eb) and Rgs2-/- mice from well-established mouse lines in our laboratory to obtain intermediate animals with heterozygous RGS2 expression. Mice were genotyped to identify those with expression of the RGS2eb transgene, then crossed back with Rgs2-/- animals to obtain Rgs2-/-(eb) mice, which were subsequently crossed with Rgs2-/- animals to establish a novel Rgs2-/-(eb) / Rgs2-/- mouse line (Figure 4.1).

High mortality rates of Rgs2-/- mice after TAC led to the discontinuation of our initial TAC studies. However, this was an interesting observation in itself (Fig. 4.2B). Previous studies using a more severe TAC model have also demonstrated lower survival rates in Rgs2-/- animals, albeit to a much smaller extent than our observations (60% survival versus 30%, respectively) (Takimoto et al., 2009). A possible explanation for these low survival rates is that Rgs2-/- mice have been shown to have increased susceptibility to atrial fibrillation (AF) via enhanced M3 muscarinic receptor activity, which is known to be involved in vagally induced atrial fibrillation (Tuomi, Chidiac and Jones, 2010; Jones, Tuomi and Chidiac, 2012). Studies have also shown that AF can be induced more frequently via electrical stimulation in wild-type TAC hearts compared to sham surgeries, and that this may be due to mast cell infiltration and fibrosis in the atrium following TAC (Liao et al., 2010). In addition, the use of a ketamine/xylazine anaesthetic mix, which depresses cardiac function (Kohn, 1997; Roth et al., 2002), may have also had an adverse effect. Thus, it is possible that after TAC surgery, a combination of the loss of RGS2 and additional physiological stressors induced atrial fibrillation and cardiac dysfunction, from which a majority of our Rgs2-/- animals did not recover.

Chronic Ang II infusion via osmotic pumps at both pressor and sub-pressor doses has been shown to induce hypertension and cardiac hypertrophy in various mouse lines including C57 Bl/6 mice (Griffin et al., 1991; Bendall et al., 2002; Schultz et al., 2002; Choi et al., 2016; Tsuruda et al., 2016). Although we observed hypertension in our experimental mice after 28 days of Ang II at 1.44 mg/kg/day (Fig. 4.3), we did not observe cardiac hypertrophy in any of our experimental or control mice (WT, Rgs2+/+(eb), Rgs2-/-, and Rgs2-/-(eb)). However, functional echocardiography data suggested significantly decreased ejection fraction and fractional

136

shortening in Rgs2-/-Ang II animals compared to basal Rgs2-/- levels, which was not observed in the other experimental groups (Fig. 4.9). Levels of ANP were also significantly elevated in Rgs2-/- mice compared to WT controls (Fig. 4.10B). These data suggested that although Ang II infusion was sufficient to increase blood pressure over 28 days, it was not, at least in our hands, able to reliably deliver a robust hypertension-induced model of cardiac hypertrophy. Therefore, we tested approximately double the concentration of Ang II (3.0 mg/kg/day) in WT and Rgs2-/- mice for 14 days to assess whether a higher dose could induce cardiac hypertrophy and thus be used for additional studies; no statistically significant increases in heart weight were observed (Fig. 4.11). It is possible that our Rgs2-/- (and potentially WT) mouse strains are, for currently unknown reasons, resistant to the development of cardiac hypertrophy, as the pressure overload and hypertrophy models used in our experiments are well established in the literature and in our own laboratories (Roy et al., 2016; Lee et al., 2017). Further studies, such as prolonged or higher doses of Ang II, may clarify the parameters required for a robust model of Ang II-induced cardiac hypertrophy.

Following a lack of significant hypertrophy in all our mouse strains after chronic Ang II treatment, we hypothesized that acute delivery of a hypertrophic agent could potentially result in the development of cardiac hypertrophy. Since our previous study used Ang II, which activates Gq-stimulated hypertrophic signalling pathways, we selected isoproterenol, a Gs activating agonist (via β-adrenergic receptors), to ultimately administer in a pilot study at twice daily doses of 50 mg/kg for 14 days to WT, Rgs2+/+(eb), Rgs2-/-, and Rgs2-/-(eb) mice. Initial heart weight/tibia length ratios following ISO treatment demonstrated no statistically significant differences between genotype or treatment groups, although ISO (Fig. 4.13B) has been previously shown to induce cardiac hypertrophy at concentrations ranging from 15 mg/kg to 100mg/kg (Zhang et al., 2005; Brooks and Conrad, 2009; Sjögren et al., 2016). Future studies with blood pressure monitoring as well as echocardiography analysis may help determine whether an isoproterenol model is the appropriate drug of choice for a hypertrophy model in our studies with Rgs2-/-(eb) mice.

137

Conclusions

The present results are generally consistent with studies in the literature that suggest impaired cardiovascular function in Rgs2-/- mice may be due to enhanced susceptibility to atrial fibrillation. However, our objective of determining whether the expression of RGS2eb in Rgs2- /- mice (Rgs2-/-(eb)) could decrease previously reported deleterious outcomes following pressure overload was limited by our inability to achieve a robust cardiac hypertrophy model with appropriate experimental controls. Subsequent studies using well-established angiotensin and isoproterenol hypertrophy models also did not produce significant increases in heart weight in any of our mouse strains. It is possible that future studies with prolonged isoproterenol or angiotensin II treatment could result in conditions leading to a robust cardiac hypertrophy model in which the role of RGS2eb in Rgs2-/- mice could be appropriately characterized.

138

References

Alzet (2017a) Filling & Priming ALZET Pumps. Available at: http://www.alzet.com/products/guide_to_use/filling.html.

Alzet (2017b) Formulating the Solution. Available at: http://www.alzet.com/products/guide_to_use/formulating.html.

Bendall, J. K., Cave, A. C., Heymes, C., Gall, N. and Shah, A. M. (2002) ‘Pivotal Role of a gp91phox-Containing NADPH Oxidase in Angiotensin II-Induced Cardiac Hypertrophy in Mice’, Circulation, 105(3), pp. 293–296.

Brooks, W. W. and Conrad, C. H. (2009) ‘Isoproterenol-induced myocardial injury and diastolic dysfunction in mice: structural and functional correlates’, Comp Med. American Association for Laboratory Animal Science, 59(4), pp. 339–343.

Choi, Y. S., de Mattos, A. B. M., Shao, D., Li, T., Nabben, M., Kim, M., Wang, W., Tian, R. and Kolwicz, S. C. (2016) ‘Preservation of myocardial fatty acid oxidation prevents diastolic dysfunction in mice subjected to angiotensin II infusion’, J. Mol. Cell. Cardiol., 100, pp. 64– 71.

139

Crowley, S. D., Gurley, S. B., Herrera, M. J., Ruiz, P., Griffiths, R., Kumar, A. P., Kim, H.-S., Smithies, O., Le, T. H. and Coffman, T. M. (2006) ‘Angiotensin II causes hypertension and cardiac hypertrophy through its receptors in the kidney.’, Proc. Natl. Acad. Sci. U. S. A., 103(47), pp. 17985–90.

Francois, H., Athirakul, K., Mao, L., Rockman, H. and Coffman, T. M. (2004) ‘Role for Thromboxane Receptors in Angiotensin-II–Induced Hypertension’, Hypertension, 43(2).

Gradman, A. H. and Alfayoumi, F. (2006) ‘From Left Ventricular Hypertrophy to Congestive Heart Failure: Management of Hypertensive Heart Disease’, Prog. Cardiovasc. Dis., 48(5), pp. 326–341.

Griffin, S. A., Brown, W. C., MacPherson, F., McGrath, J. C., Wilson, V. G., Korsgaard, N., Mulvany, M. J. and Lever, A. F. (1991) ‘Angiotensin II causes vascular hypertrophy in part by a non-pressor mechanism.’, Hypertension, 17(5).

Hercule, H. C., Tank, J., Plehm, R., Wellner, M., da Costa Goncalves, A. C., Gollasch, M., Diedrich, A., Jordan, J., Luft, F. C. and Gross, V. (2007) ‘Regulator of G protein signalling 2

140

ameliorates angiotensin II-induced hypertension in mice.’, Exp. Physiol., 92(6), pp. 1014–22.

Jones, D. L., Tuomi, J. M. and Chidiac, P. (2012) ‘Role of Cholinergic Innervation and RGS2 in Atrial Arrhythmia.’, Front. Physiol., 3, p. 239.

Kibbe, W. A. (2007) ‘OligoCalc: an online oligonucleotide properties calculator.’, Nucleic Acids Res., 35(Web Server issue), pp. W43-6.

Kohn, D. F. (1997) Anesthesia and analgesia in laboratory animals. Academic Press.

Lee, K. N., Lu, X., Nguyen, C., Feng, Q. and Chidiac, P. (2017) ‘Cardiomyocyte specific overexpression of a 37 amino acid domain of regulator of G protein signalling 2 inhibits cardiac hypertrophy and improves function in response to pressure overload in mice’, J. Mol. Cell. Cardiol., 108, pp. 194–202.

Liao, C., Akazawa, H., Tamagawa, M., Ito, K., Yasuda, N., Kudo, Y., Yamamoto, R., Ozasa, Y., Fujimoto, M., Wang, P., Nakauchi, H., Nakaya, H. and Komuro, I. (2010) ‘Cardiac mast cells cause atrial fibrillation through PDGF-A-mediated fibrosis in pressure-overloaded mouse hearts.’, J. Clin. Invest. American Society for Clinical Investigation, 120(1), pp. 242–53.

Liu, Y., Lu, X., Xiang, F.-L., Poelmann, R. E., Gittenberger-de Groot, A. C., Robbins, J. and Feng, Q. (2014) ‘Nitric oxide synthase-3 deficiency results in hypoplastic coronary arteries

141

and postnatal myocardial infarction’, Eur. Heart J. Oxford University Press, 35(14), pp. 920– 931.

Nguyen, C. H., Ming, H., Zhao, P., Hugendubler, L., Gros, R., Kimball, S. R. and Chidiac, P. (2009) ‘Translational control by RGS2’, J. Cell Biol., 186(5), pp. 755–765.

Razeghi, P., Young, M. E., Alcorn, J. L., Moravec, C. S., Frazier, O. H. and Taegtmeyer, H. (2001) ‘Metabolic Gene Expression in Fetal and Failing Human Heart’, Circulation, 104(24), pp. 2923–2931.

Roth, D. M., Swaney, J. S., Dalton, N. D., Gilpin, E. A. and Ross, J. (2002) ‘Impact of anesthesia on cardiac function during echocardiography in mice’, Am. J. Physiol. - Hear. Circ. Physiol., 282(6).

Roy, A., Dakroub, M., Tezini, G. C. S. V, Liu, Y., Guatimosim, S., Feng, Q., Salgado, H. C., Prado, V. F., Prado, M. A. M. and Gros, R. (2016) ‘Cardiac acetylcholine inhibits ventricular remodeling and dysfunction under pathologic conditions.’, FASEB J. Federation of American Societies for Experimental Biology, 30(2), pp. 688–701.

Schultz, J. E. J., Witt, S. A., Glascock, B. J., Nieman, M. L., Reiser, P. J., Nix, S. L., Kimball, T. R. and Doetschman, T. (2002) ‘TGF-beta1 mediates the hypertrophic cardiomyocyte growth induced by angiotensin II.’, J. Clin. Invest. American Society for Clinical Investigation, 109(6), pp. 787–96.

Tsuruda, T., Sekita-Hatakeyama, Y., Hao, Y., Sakamoto, S., Kurogi, S., Nakamura, M., Udagawa, N., Funamoto, T., Sekimoto, T., Hatakeyama, K., Chosa, E., Kato, J., Asada, Y. and

143

Kitamura, K. (2016) ‘Angiotensin II Stimulation of Cardiac Hypertrophy and Functional Decompensation in Osteoprotegerin-Deficient Mice’, Hypertension.

Tutunea-Fatan, E., Caetano, F. A., Gros, R. and Ferguson, S. S. G. (2015) ‘GRK2 targeted knock-down results in spontaneous hypertension, and altered vascular GPCR signaling.’, J. Biol. Chem., 290(8), pp. 5141–55.

VisualSonics (2008) Vevo 2100 Imaging System Operator Manual. Available at: https://bcf.technion.ac.il/wp-content/uploads/2015/10/Vevo-2100-Operator-Manual.pdf.

Zhang, R., Khoo, M. S. C., Wu, Y., Yang, Y., Grueter, C. E., Ni, G., Price, E. E., Thiel, W., Guatimosim, S., Song, L.-S., Madu, E. C., Shah, A. N., Vishnivetskaya, T. A., Atkinson, J. B., Gurevich, V. V., Salama, G., Lederer, W. J., Colbran, R. J. and Anderson, M. E. (2005) ‘Calmodulin kinase II inhibition protects against structural heart disease’, Nat. Med., 11, pp. 409–417.

144

5 LOSS OF REGULATOR OF G PROTEIN SIGNALLING 2 (RGS2) ALTERS THE EFFECTS OF ACUTE AND CHRONIC DIET RESTRICTION ON METABOLIC OUTCOMES IN C57 BL/6 MICE

The material in this chapter is based on a manuscript: Lee KN, Gros R, and Chidiac P (2017), Loss of regulator of G protein signalling 2 (RGS2) alters the effects of acute and chronic diet restriction on metabolic outcomes in C57 Bl/6 mice. Submitted to International Journal of Obesity. Manuscript number: 2017IJO01137.

145

Introduction

Regulator of G protein signalling (RGS) proteins are a family of GTPase-activating proteins (GAPs) that bind to G proteins and inactivate them by increasing the intrinsic rate of GTP hydrolysis and/or act as “effector antagonists”, thus limiting the intensity and duration of GPCR-initiated signalling (Popov et al., 1997; Ross and Wilkie, 2000; Abramow-Newerly et al., 2006). RGS2 is part of the B/R4 family of RGS proteins and is found ubiquitously throughout the body (Schoeber et al., 2006). RGS2 selectively inhibits Gαq- and Gαs-mediated signalling (some effects on Gαi/o signalling have also been reported) (Heximer et al., 1999; Anger et al., 2007; Chakir et al., 2011), and can bind to and regulate other non-G protein targets including eIF2B, TRPV6 calcium channels and tubulin (Wang et al., 2005; Heo et al., 2006; Schoeber et al., 2006). RGS2 has also been shown to modulate adipocyte differentiation and proliferation (Imagawa, Tsuchiya and Nishihara, 1999; Nishizuka et al., 2001; Cheng et al., 2008), and may also regulate basal metabolism via the inhibition of thyroid hormone receptor- induced Gαq signalling (Eszlinger et al., 2004). Furthermore, human polymorphisms leading to increased RGS2 expression have been associated with metabolic syndrome and an increased risk for weight gain or obesity in hypertensive patients (Freson et al., 2007; Sartori et al., 2008). Conversely, Rgs2 deficiency in mice leads to impaired T cell activation, increased anxiety, reduced male aggression, and moderate hypertension under basal conditions (Oliveira-Dos- Santos et al., 2000; Heximer et al., 2003).

We have previously reported that Rgs2-/- mice exhibit a lean phenotype, and demonstrated that resistance to age-related weight gain was accompanied by reduced adipose tissue deposits and smaller adipocytes, lower levels of serum lipids, and increased insulin sensitivity; a subset of genes involved in adipocyte differentiation and proliferation were also reduced (Nunn et al., 2011). In addition, Rgs2-/- mice were found to be hyperphagic in comparison to C57 Bl/6 wildtype (WT) controls, and the two strains exhibited equivalent nutrient absorption (Nunn et al., 2011). A lean phenotype in the presence of hyperphagia and normal nutrient absorption would appear to suggest increased physical activity and/or metabolism, however we were not -/- able in our previous study to detect any increase in resting VO2 in Rgs2 mice using a basic

146

open flow respirometry system where animals were held in a small chamber and had limited mobility (Nunn et al., 2011).

Although the lean Rgs2-/- habitus was maintained throughout the mouse lifespan on an ad libitum standard rodent diet, these animals nonetheless became obese and insulin-resistant under high-fat diet conditions (Nunn et al., 2011). This suggests that Rgs2-/- mice do not have a major impairment with respect to their ability to accumulate adipose tissue (evidence for a role of RGS2 in adipocyte differentiation notwithstanding). It follows that the observed lean phenotype may reflect underlying changes in energy utilization that limit substrate availability with respect to adipose formation under normal dietary conditions.

To better understand the role of RGS2 in metabolism and body weight regulation Comprehensive Laboratory Animal Monitoring System (CLAMS, Columbus Instruments, Columbus, OH, USA) metabolic cages were used in the present study to simultaneously assess indirect calorimetry parameters and ambulatory activity in freely moving age-matched control and Rgs2-/- mice under normal and diet-restricted conditions. Here we report that Rgs2-/- mice displayed significantly increased metabolism compared to WT controls, and that these differences were exacerbated both by chronic and by acute caloric restriction. No changes in ambulatory activity were observed, suggesting that internal metabolism, rather than overt physical activity, is the major contributor to the lean Rgs2-/- phenotype. On ad libitum diets, although metabolic parameters were observed to decrease over time as mice aged, Rgs2-/- mice displayed consistently higher rates of metabolism compared to WT animals. In combination with our previous findings which extensively evaluated the effects of the loss of RGS2 on various physiological parameters, collectively our data resolve the erstwhile paradox concerning nutrient intake and metabolic rates in Rgs2-/- mice, and demonstrate an important role for RGS2 in the regulation of weight and body metabolism.

147

Methods

5.2.1 Animals

The generation and genotyping of Rgs2−/− mice have been previously described(Oliveira-Dos- Santos et al., 2000; Roy et al., 2006). Briefly, Rgs2-/- mice used for experimental procedures came from congenic Rgs2-/- and WT control (rgs2+/+) colonies that are well established in our laboratory(Roy et al., 2006). Prior to CLAMS metabolic cage measurements and diet restriction studies, animals were housed in individual standard shoebox cages and provided ad libitum access to standard rodent chow pellets containing 18.6% protein, 6.2% fat, and 44.2% carbohydrates (2018 Teklad global 18% protein diet, Envigo, United Kingdom) and water on a standard 12:12 h light-dark cycle (light period: 0700 – 1900 h). Male Rgs2-/- and WT controls in C57 Bl/6 backgrounds were used for all studies. Animals were maintained in accordance with the Institute of Laboratory Animal Research Guide for the Care and Use of Laboratory Animals. These studies were approved by the Council on Animal Care at the University of Western Ontario, and complied with the guidelines of the Canadian Council on Animal Care.

5.2.2 Study design

Animals were monitored using Oxymax CLAMS metabolic cages (Columbus Instruments, Columbus, OH, USA). During diet studies, individually housed mice were maintained in CLAMS cages at 24 ± 1°C on a standard 12:12 h light-dark cycle (light period: 0700–1900 h) with airflow of 0.35L/min(Guzman et al., 2013). Water was available ad libitum in all studies, while powdered standard rodent chow (2018 Teklad) was available depending on the diet study performed. Animals were individually housed in plexiglass cages and were acclimatized to their CLAMS cages for 16-24 hours prior to data acquisition (Guzman et al., 2013).

5.2.3 Assessment of indirect calorimetry and activity

Volume of oxygen consumption (VO2), volume of carbon dioxide production (VCO2), respiratory exchange ratio (RER), cumulative food and water intake, and physical (ambulatory) activity were simultaneously measured using CLAMS and Oxymax software (Columbus Instruments). Measurements for all described parameters were taken every 10 minutes for 24

148

hours on a standard 12:12hr light-dark cycle (light period: 0700 – 1900h), and collected data were averaged to produce both one hour time points as well as 12 hour light and dark averages.

VO2 and VCO2 were normalized to body mass (mL/kg/hr). Cumulative food and water intake were normalized to 1900 h starting values. RER, an indicator of which macronutrients are being metabolized, was calculated by dividing VCO2/VO2. An RER of ~1.0 or ~0.8 indicates almost complete carbohydrate or fat oxidation, respectively, while values that fall between these extremes suggest a mixture of the energy sources are being metabolized (Richardson,

1929). Energy expenditure (heat) was calculated from RER and VO2, and corrected for body mass (kcal/hr/kg). Ambulatory activity was obtained using Opto-M3 Activity Monitor and Oxymax software algorithms (Columbus Instruments). Infrared photo beam breaks were monitored as counts on the X- and Y-axes; consecutive beam breaks were assessed as ambulatory activity.

5.2.4 Ad libitum studies

1 month, 3 month, and 12 month-old Rgs2-/- and WT controls were placed on ad libitum standard chow diets (2018 Teklad) following weaning. Animals were placed in CLAMS cages for 12 hours of acclimatization followed by 24 hours of data acquisition (start time: 1900 h) on a standard 12:12 h light-dark cycle (light period: 0700 – 1900 h). Ad libitum diet in CLAMS cages was provided in powdered form via a freely accessible center feeder.

5.2.5 Chronic diet restriction studies

Individual food intake for 8 week old Rgs2-/- and WT mice was measured daily for two consecutive weeks to determine average consumption of standard rodent diet (2018 Teklad) for each animal. Based on measured daily amounts, food intake was reduced by 10% every two weeks to reach a final daily diet restriction of 30% after six weeks (i.e. 2 weeks each of 10%, 20%, and 30% reduction); body weights were measured weekly. Daily food allowance was provided in pellet form to all mice at 1100 h. Daily food intake over time was measured by weighing food pellets at 30 min and 1 to 24 hours after introduction of food. During 30% diet restriction, blood glucose levels were measured using a glucometer (OneTouch UltraMini system, Johnson & Johnson, Canada) on tail snip collected blood immediately prior to the

149

introduction of food, as well as 15 min, 30 min, 1 h, 2 h, and 3 h after the introduction of food. Following two weeks of 30% restriction, at which time mice were 3.5 month (14 weeks) old, animals were placed in CLAMS cages for 12 hours of acclimatization followed by 24 hours of data acquisition (start time: 1900 h), with access to pre-weighed food pellets at 1100 h.

5.2.6 Acute diet restriction studies

3 month-old Rgs2-/- and WT mice on standard ad libitum rodent diet (2018 Teklad) were placed in CLAMS cages for 16 hours of acclimatization followed by 36 hours of data acquisition. Cage feeders with powdered food were replaced with empty feeders for 12 hours (start time: 1900 h), with ad libitum food access returned at 1100 h the following day for another 20 hours (end time: 1900 h).

5.2.7 Microarray analysis

Total RNA was isolated from the gastrocnemius tissue of ad libitum fed 12 week old male Rgs2-/- (n=2) and WT (n=2) mice using the TriZol (Invitrogen) extraction method; RNA integrity was confirmed with Agilent 2100 BioAnalyzer Data Review Software (Agilent, USA) at the London Regional Genomics Centre. Samples with RNA integrity number (RIN) values greater than 8 were used for microarray, which was performed at the London Regional Genomics Centre as previously described (Ratneswaran et al., 2017). Briefly, total RNA was hybridized to the Affymetrix GeneChip® Mouse Gene 2.0 ST Array containing 35 240 probes. Gene level, ANOVA p values, and fold changes were calculated using Partek Genomics Suite version 6.6. Genes with at least a 1.4 fold change and with p<0.05 were used to generate gene ontology biological processes and cellular component processes diagrams through the PANTHER gene list analysis program (http://pantherdb.org/) (Mi et al., 2013). In addition, all genes with p<0.05 were analyzed to identify potential metabolic differences between Rgs2-/- and WT animals.

5.2.8 Quantitative reverse transcriptase qPCR

Total RNA was isolated from the gastrocnemius tissue of ad libitum fed 12 week old male mice using the TriZol (Invitrogen) extraction method. Reverse transcription reaction was

150

performed using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Invitrogen, Canada). SensiFAST SYBR No-ROX Kit mastermix (FroggaBio, Canada) was used for real-time thermal cycling. Primers for genes of interest (Table 5.3) were designed using the OligoPerfect Designer (ThermoFisher, Canada), OligoCalc (Kibbe, 2007) and Primer-BLAST (NCBI) programs. Samples were amplified for 35 cycles using a CFX384 real- time thermal cycler (Bio-Rad, Canada). The mRNA quantity for each gene of interest was determined using standard curve analysis and normalized to 28S ribosomal expression.

5.2.9 Statistical analysis

All data were analyzed using GraphPad Prism 6.01 (GraphPad Software, San Diego, CA, USA) and presented as mean ± SEM. Statistical analyses were performed using two-way analysis of variance (ANOVA) followed by Bonferroni’s post-test and unpaired Student’s two-tailed t- test. Differences were considered significant at P < 0.05.

151

Table 5.1. Primers for qPCR of metabolism-related genes

Gene Forward primer 5'-3' Reverse primer 5'-3' serca1 GACGTTTGTTGGTGTTGTGG GCAATGGCTGTACCCTTGTT adcy2 GGAGATCGAAACCATGGAGA TGGAGGCAAACATGACACA adcy5 TCGTGCTGGCTCTGTATCTG GTCCTTGGGCAGAATGTTGT adrb1 CAGGCGCTGAGTCTCTCTCT TGCCGTCTTTGTTTTTAGCC adrb2 AAAGAGCACAAAGCCCTCAA GTTGACGTAGCCCAACCAGT atp5g1 AGGAACCCATCTCTCAAGCA AGGCGACCATCAAACAGAAG cs AGGATCCCATGTTCAAGCTG TTCATCTCCGTCATGCCATA dio2 GATGCTCCCAATTCCAGTGT TGAACCAAAGTTGACCACCA hk2 GGGTAGCCACGGAGTACAAA TGGATTGAAAGCCAACTTCC pygm GACATGGAGGAGTTGGAGGA CATAGCGAAGCCAGTCATCA ryr1 CTCCTGGTGATGGGTGTCTT TTCCTTCTCGTGTGCCTCTT slc16a2 TCCCTTCCTCATCAAAATGC GCCGGTAAGTGAGTGAGAGC slc2a4 GATTCTGCTGCCCTTCTGTC ATTGGACGCTCTCTCTCCAA thra CAAGATCACCCGGAATCAGT TGCAGTGAGCGAATCATCTC ucp3 TCAAAGCAGCAGGACTCAGA GAGAGCAGGAGGAAGTGTGG

152

Results

5.3.1 Increased metabolism over time in Rgs2-/- mice on ad libitum diet

To determine the effects of loss of RGS2 on basal metabolism, indirect calorimetry, activity, as well as food and water intake were measured in 1 month, 3 month, and 12 month-old Rgs2- /- -/- and WT mice. In newly weaned 1 month-old Rgs2 and WT animals, VO2, VCO2, energy expenditure (heat), ambulatory activity, as well as food and water intake were comparable between phenotypes (Fig. 1A, B, C, D and Fig. 2A and B). Although both groups were more metabolically and physically active during the 12 hour dark cycle (due to the nocturnal nature of mice), there was no significant difference between the described parameters. Interestingly, RER during the 12 hour light cycle was noticeably increased in Rgs2-/- mice (Fig. 1A), suggesting increased carbohydrate metabolism compared to WT controls. Body weights at 1 month were still similar between groups, with significant weight separation observed at the 3 month and 12 month time points (Table 1).

Consistent with our previous observations (Nunn et al., 2011), lean 3 month-old Rgs2-/- mice were found to be hyperphagic in comparison to WT controls (Fig. 2A,), and were also found to consume significantly more water during the 12 hour dark cycle (Figure 2B). If increased metabolism is to account for the lean phenotype of Rgs2-/- mice, it would be expected that both

O2 consumption (VO2) and CO2 production (VCO2) would be elevated to some extent. In both strains of mice, these parameters were increased compared to levels during the light cycle, indicative of the nocturnal activity of mice (Fig. 1A and B). However, Rgs2-/- mice displayed additional increases in dark cycle VO2 and VCO2 levels compared to WT mice. Interestingly, significant increases in energy expenditure (heat) between the light and dark cycles were detected only in Rgs2-/- mice (Fig. 1D). RER also appeared to be higher in Rgs2-/- mice at 3 months, again suggesting increased carbohydrate metabolism (Fig. 1C). Similar to 1 month old mice, changes in ambulatory activity were not found between strains, implying that observed metabolic differences do not arise from increased physical activity (Table 1).

Further strain separation of several metabolic parameters was observed in 12 month old animals. VO2, VCO2, and energy expenditure were significantly elevated during the dark cycle

153

in Rgs2-/- compared to WT animals (Fig. 1A, B, and D), although food intake was not statistically different at 12 months (Fig. 2A). Patterns in RER (Fig. 1C) and ambulatory activity (Table 1) were similar to those observed for 3 month old mice. Overall, these ad libitum data suggest that Rgs2-/- mice may have a higher basal metabolic demand than WT animals, and that this is maintained throughout their lifespan.

5.3.2 Chronic caloric restriction unmasks metabolic differences between Rgs2-/- and WT mice

Given that some but not all measured parameters pointed to higher metabolic demand in Rgs2- /- mice under normal ad libitum diet conditions and the observed lean phenotype, we reasoned that reducing food intake via a chronic 30% diet restriction might reveal further differences between Rgs2-/- animals and WT controls. Caloric restriction was introduced gradually, with provided daily food reduced by 10% for the first two weeks and then 20% for two subsequent weeks prior to the 30% reduction (Figure 3G). Animals were weighed weekly to ensure they did not drop below acceptable protocol levels. Similar to other diet restriction studies (Weindruch et al., 1986; Faulks et al., 2006), body weights remained essentially constant in both Rgs2-/- and WT mice (Figure 3G). Since WT Bl/6 mice tend to steadily gain weight as they age (Nunn et al., 2011), the lack of such an increase over six weeks indicated that the diet restriction regimen was successful. All indirect calorimetry parameters were significantly altered in Rgs2-/- animals compared to WT controls following 30% diet restriction, with Rgs2- /- mice exhibiting higher levels of VO2, VCO2, RERs, and energy expenditure (heat) (Fig. 3A, B, C, and D). Notably, RER increased substantially in both strains following the introduction of food and reached an elevated plateau, which was significantly higher in Rgs2-/- than WT mice; RER reached and remained at 1.0 or greater in Rgs2-/- mice, a level indicative of energy metabolism based almost entirely on carbohydrate usage (Fig. 3C). Similar to 3 month-old ad libitum studies, physical activity did not appear to play a role in the increased energy expenditure of Rgs2-/- mice (c.f. Tables 1 and 2).

During the 30% diet restriction, the rate of food consumption by Rgs2-/- mice was more than 4 times the rate of the WT diet-restricted mic (Figure 3E). All mice finished their food prior to the next daily feeding, and consequently knockout mice were essentially fasted for 154

approximately 20 hours before their next meal versus about 12 hours for WT animals, with significantly lower blood glucose levels than WT mice directly prior to food introduction (Figure 3H). Although there were clear strain-related differences evident under caloric restriction, it is possible that the unexpected difference in the duration of fasting might have had a distorting effect on the measurement of metabolic parameters. To control for behavioural differences in food consumption, in further experiments we subjected both WT and KO mice to an acute 16 hour fast and acquired CLAMS data to assess metabolic and physical activity.

5.3.3 Decreased energy conservation in Rgs2-/- mice during and after acute fast

Fasting typically results in energy conservation, which can be demonstrated via decreased VO2 and VCO2 levels, and indeed such changes were observed in both WT and Rgs2-/- animals following food removal (Figure 4A and B, respectively), along with a sustained decrease in RER in both strains to a level consistent with primarily fat metabolism (Fig. 4C). During this fasting period, Rgs2-/- mice consumed more oxygen than WT controls (Fig. 4A) indicating a greater metabolic rate. Upon food reintroduction, Rgs2-/- animals shifted from fat metabolism back towards almost complete carbohydrate metabolism (as indicated by RER) more rapidly than their WT counterparts (Fig. 4C), with significant difference between

VO2, VCO2 and energy expenditure (Fig. 4A, B, and D).

The rapid increases in VO2, VCO2, RER, energy expenditure (heat), as well as food and water intake that were observed in our chronic diet restriction Rgs2-/- mice were less pronounced than in our fasting study, suggesting that chronic caloric deprivation and/or prolonged and unequal fasting times may have increased strain-related metabolic differences. Similar to our ad libitum and chronic diet results, there was no discernable difference between genotypes for ambulatory activity (Table 2), suggesting again that weight loss in RGS2 knockout mice is due to internal energy metabolism rather than overt physical activity. Taken together, these findings collectively suggest that Rgs2-/- plays an important role in the regulation of basal metabolism and energy expenditure.

155

Figure 5.1. Ad libitum diet, indirect calorimetry, VO2 and VCO2 Indirect calorimetry was performed in 1 month, 3 month, and 12 month old mice to measure

(A) VO2, and (B) VCO2. White and black bars under time course tracings denote 12 h light and dark cycles, respectively. Bar graphs below time course tracings represent average 12 h light/dark cycles for WT and KO mice. Data represent means ± SEM, n=4, 7-8, and 7 for in 1 month, 3 month, and 12 month old animals, respectively. Data within each graph were analyzed using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons, *P<0.05 and **P<0.01.

156

Figure 5.2. Ad libitum diet, indirect calorimetry, RER and heat

Indirect calorimetry was performed in 1 month, 3 month, and 12 month old mice to measure

(A) energy expenditure (heat). (B) RER was calculated from VCO2/VO2. White and black bars under time course tracings denote 12 h light and dark cycles, respectively. Bar graphs below time course tracings represent average 12 h light/dark cycles for WT and KO mice. Data represent means ± SEM, n=4, 7-8, and 7 for in 1 month, 3 month, and 12 month old animals, respectively. Data within each graph were analyzed using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons, *P<0.05 and **P<0.01.

157

Figure 5.3. Ad libitum diet, food and water intake

(A) Food and (B) water intake were measured simultaneously with indirect calorimetry in CLAMS cages. White and black bars under time course tracings denote 12 h light and dark cycles, respectively. Bar graphs below time course tracings represent average 12h light/dark cycles for WT and KO mice. Data represent means ± SEM, n=4, 7-8, and 7 for in 1 month, 3 month, and 12 month old animals, respectively. Data within each graph were analyzed using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons, *P<0.05 and **P<0.01.

158

Table 5.2. Ambulatory activity and body weights, ad libitum diet

159

Table 5.3. Ambulatory activity and body weights, chronic and fasting diets

WT rgs2 -/- 30% restriction: n 4 4 BWT (g) 26.0 ± 0.9 18.8± 0.7*** Light activity (counts x 103) 9.9 ± 2.1 13.9± 0.3 Dark activity (counts x 103) 22.1 ± 2.6 17.2 ± 3.1

16hr fast: n 11 11 BWT (g) 26.8 ± 1.0 23.5 ± 0.9* 16hr fast activity (counts x 103) 38.3 ± 1.5 45.8 ± 8.6 16hr post fast activity (counts x 103) 16.7 ± 0.4** 19.9 ± 2.7** Abbreviations: BWT, body weight. Ambulatory activity represents combined counts from x and y axes. Data represent means ± s.e.m. Body weights were compared using Student’s t-test. Ambulatory activities were compared using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons, dark vs. light cycle within genotypes and 16 h fast vs. 16 h post-fast within genotypes,**P<0.05, **P<0.01 and ***P<0.001.

160

A B

C D

Figure 5.4. Chronic diet restriction, indirect calorimetry 3 month old male Rgs2-/- and WT mice were subjected to 30% chronic diet restriction following 2 weeks each of 10% and 20% restriction. Indirect calorimetry was performed to measure (A) VO2, (B) VCO2, and (D) energy expenditure (heat), which were normalized to body weight. (C) RER was calculated from VCO2/VO2. White and black bars under time course tracings denote 12 h light and dark cycles, respectively. Bar graphs below time course tracings represent average 12 h light/dark cycles for WT and KO mice. Data represent means ± SEM, n=4 per group. Data in individual graphs were analyzed using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons, *P<0.05, **P<0.01 and ***P<0.001. 161

A B

C D

Figure 5.5. Chronic diet restriction

(A) Food and (B) water intake were measured simultaneously with indirect calorimetry in CLAMS cages. (C) Body weights were recorded weekly to monitor effects of 10%, 20% and 30% caloric restriction. (D) Glucose levels under 30% caloric restriction were recorded immediately prior and 15 min, 30 min, 1 h, 2 h, and 3 h post-feeding. White and black bars under time course tracings denote 12 h light and dark cycles, respectively. Bar graphs below time course tracings represent average 12 h light/dark cycles for WT and KO mice. Data represent means ± SEM, n=4 per group. Data in individual graphs were analyzed using two- way ANOVA with Bonferroni’s post hoc test for multiple comparisons, *P<0.05, **P<0.01 and ***P<0.001. 162

Figure 5.6. Acute 16 h fast, indirect calorimetry 3 month old male Rgs2-/- and WT mice were subjected to a 16 h fast followed by reintroduction of ad libitum diet. Indirect calorimetry was performed to measure (A) VO2 and (B) VCO2. White and black bars under time course tracings denote 12 h light and dark cycles, respectively. Bar graphs below time course tracings represent average 12h light/dark cycles for WT and KO mice. Data represent means ± SEM, n=11 per group. Data within each graph were analyzed using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons, *P<0.05, **P<0.01 and ***P<0.001.

163

Figure 5.7. Acute 16 h fast, indirect calorimetry

(A) energy expenditure (heat), was normalized to body weight, and (B) RER was calculated from VCO2/VO2. White and black bars under time course tracings denote 12 h light and dark cycles, respectively. Bar graphs below time course tracings represent average 12h light/dark cycles for WT and KO mice. Data represent means ± SEM, n=11 per group. Data within each graph were analyzed using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons, *P<0.05, **P<0.01 and ***P<0.001.

164

Figure 5.8. 16 h fast, food and water intake

(A) Food and (B) water intake were measured simultaneously with indirect calorimetry in CLAMS cages, and normalized to body weight. White and black bars under time course tracings denote 12 h light and dark cycles, respectively. Bar graphs below time course tracings represent average 12h light/dark cycles for WT and KO mice. Data represent means ± SEM, n=11 per group. Data within each graph were analyzed using two-way ANOVA with Bonferroni’s post hoc test for multiple comparisons, *P<0.05, **P<0.01 and ***P<0.001.

165

5.3.4 Altered expression of metabolic genes in Rgs2-/- mice

Genes involved with calcium signalling and metabolism were examined in gastrocnemius tissue to determine potential differences in expression between Rgs2-/- and WT mice on an ad libitum diet. Metabolic genes to analyze with qPCR were chosen based on reviews of the current literature involving skeletal tissue metabolism (Salvatore et al., 2013), and purported expression changes from the performed microarray. A majority of genes reported to be significantly different or unchanged in the micro array could not be validated by qPCR (Suppl. Table C2); thus, microarray data has not been included in the results or discussion in this chapter, but can be viewed (along with PANTHER analysis of biological and cellular processes) in the Appendix (Suppl. Table C2, Suppl. Fig. C2 and C3).

Following qPCR of selected genes, ryanodine1 (ryr1), glycogen phosphorylase (pygm), and glucose transporter 4 (Glut4/Slc2a4) gene expression were all significantly increased in Rgs2- /- mice compared to WTs (Fig. 5.9B, E, and F). Furthermore, deiodinase type 2 (Dio2) expression was significantly enhanced in Rgs2-/- mice (Fig. 5.10A). Gene expression for serca1 (Atp2a1), hexokinase 2 (Hk2), citrate synthase (Cs), thyroid hormone receptor alpha (Thra), thyroid hormone-specific transporter MCT8 (Slc16a2), ATP synthase subunit F(0) complex subunit C1 (Atp5g1), mitochondrial uncoupling protein 3 (Ucp3), β1 and β2-adrenergic receptors, and adenylyl cyclase 2 and 5 were not found to be significantly altered in Rgs2-/- mice compared to WT animals (Fig. 5.9, 5.10, and 5.11).

166

A B C

2 /

n 4

r p

x 2

S C

0 W T K O

D E F

Figure 5.9. Gene expression, calcium signalling and metabolic markers

(A) Serca2a (Atp2a1), (B) ryanodine receptor type 1 (Ryr1), (C) citrate synthase (Cs), (D) hexokinase II (Hk2), (E) glycogen phosphorylase (Pygm), and (F) glut-4 (Slc2a4) gene expression was assessed by qPCR in gastrocnemius tissue of Rgs2-/- and WT mice. Data represent means ± SEM, n=4-6 per group. Data were analyzed by Student’s t-test, *P<0.05.

167

A B

C D E

n o

i 2

x e

C U

0 W T K O

Figure 5.10. Gene expression, metabolic markers

(A) Deiodinase type 2 (Dio2), (B) thyroid hormone receptor alpha (Thra) and (C) thyroid hormone-specific transporter MCT8 (Slc16a2), (D) ATP synthase subunit F (0) complex subunit C1 (Atp5g1), and (E) mitochondrial uncoupling protein 3 (Ucp3) gene expression was assessed by qPCR in gastrocnemius tissue of Rgs2-/- and WT mice. Data represent means ± SEM, n=4-6 per group. Data were analyzed by Student’s t-test, *P<0.05.

168

A B C

Figure 5.11. GPCR-related gene expression

(A) beta-1 adrenergic receptor (Adrb1), (B) beta 2 adrenergic receptor (Adrb2), (C) adenylyl cyclase 2 (Adcy2), and D) adenylyl cyclase 5 (Adcy5) gene expression was assessed by qPCR in gastrocnemius tissue of Rgs2-/- and WT mice. Data represent means ± SEM, n=4-6 per group. Data were analyzed by Student’s t-test.

169

Discussion

The present study expands on our previous work, in which we found Rgs2-/- mice to be resistant to normal, age-related weight gain (Nunn et al., 2011). This observed decrease in body weight was also accompanied by increased insulin sensitivity, smaller adipocytes, decreased adipose tissue deposits, and lower levels of serum lipids. In addition, nutrient absorption was comparable to WT controls (Nunn et al., 2011). We were previously unable to reconcile obvious changes in lipid metabolism and body weight with measured metabolic rates; using the more sensitive CLAMS cages, we demonstrate in this study that metabolic rates as measured by indirect calorimetry are increased in Rgs2-/- mice. These effects are further enhanced by both chronic and acute diet restrictions, and also suggest that Rgs2-/- mice may have enhanced carbohydrate metabolism. To our knowledge, we are the first group to report a metabolic phenotype in Rgs2-/- mice.

Our ad libitum studies demonstrate that basal metabolic indices in 3 month and 12 month old -/- Rgs2 mice were elevated compared to WT controls. A lack of observable differences in VO2,

VCO2, and energy expenditure at the 1 month time point may be age related; at this stage, both WT and Rgs2-/- animals are still in a rapid growth phase (Somerville et al., 2004), which could obscure the slight differences seen in the older age groups. When viewed collectively over time, VO2 and VCO2 values do fall with increasing age (Figure 1A and B), which is expected as body metabolism slows (LeBrasseur et al., 2009). However, Rgs2-/- mice consistently displayed higher VO2 and VCO2 levels compared to WT controls (Fig. 1A and B). Since changes in the 2-5% range can induce significant long term alterations in energy balance (Even and Nadkarni, 2012), the small, but sustained elevations in VO2 and VCO2, particularly during dark cycles, may contribute to the observed lean phenotype.

In our previous studies, we determined that although Rgs2-/- mice had reduced fat stores and smaller adipocytes, they were not resistant to high fat diet-induced obesity, and developed insulin resistance to a similar degree as WT mice (Nunn et al., 2011). This suggested that Rgs2- /- mice do not have major impairments with respect to their ability to accumulate adipose tissue, and that alterations to carbohydrate or protein rather than fat metabolism could be additional factors in the development of the lean phenotype. Since our ad libitum RER calculations 170

suggested that carbohydrate metabolism was slightly increased in Rgs2-/- mice (Fig. 1C), we challenged adult, 3 month-old animals to a chronic 30% diet restriction to further evaluate metabolic parameters. Both strains did not lose substantial body weight (Fig. 3G); final body weights after two weeks of 30% diet restriction (which was also preceded by two weeks each of 10% and 20% restrictions) were approximately 3% and 6% higher in Rgs2-/- and WT controls compared to initial starting ad libitum body weights, respectively. Although this suggested that a 30% restriction can be handled by both strains, and that ad libitum diet well exceeds necessary caloric requirements, Rgs2-/- feeding behaviour rapidly changed on the restricted diet, such that hyperphagia was exacerbated to such an extent that feeding and fasting times were significantly altered compared to control mice. RER recordings indicated that upon food consumption, KO mice quickly reached an almost full carbohydrate metabolizing state (RER around 1.0) versus WT mice who continued to demonstrate some fat metabolism (RER around 0.9) (Fig. 3C). Even though increased fasting length due to rapid food consumption may have affected indirect calorimetry readings, the differences between strains is still a relevant observation. VO2, VCO2, RER, and energy expenditure (heat) parameters rapidly increased and were sustained at elevated levels for several hours during and after food consumption; these rapid shifts in metabolism were not observed in WT controls (Fig. 3A, B, C, and D).

To rule out potential confounding effects of the unexpected strain-related difference in food consumption patterns in our chronic restriction studies, food intake was controlled via 16 hour acute fasting studies (Fig. 4). Overall, strain-related differences were of a similar nature under both caloric restriction protocols, albeit less pronounced under acute conditions. Indirect calorimetry recordings during the acute fasting period furthermore suggested a delay in the ability of Rgs2-/- mice to lower their metabolism (for energy conservation) compared to WT animals. Conversely, it appears that Rgs2-/- mice are able to shift to carbohydrate metabolism in the presence of food at a faster rate than WT mice, as evidenced by higher RERs (Fig. 4C), although it is possible that due to their decreased adiposity, increased carbohydrate metabolism is a compensatory, rather than causative response of the observed lean phenotype (Sun et al., 2012).

171

Since physical activity was found to be similar across strains, our metabolic parameters across multiple diet modalities suggest that decreased body weights in Rgs2-/- mice arise instead from internal metabolism. qPCR analysis of gastrocnemius tissue suggests that several metabolically-relevant genes may be altered in Rgs2-/- compared to WT mice. Skeletal ryanodine receptor type 1 (Ryr1) mediates calcium release; as the main ion channel in the sarcoplasmic reticulum, it is a key determinant of muscle force (Beard, Wei and Dulhunty, 2009). Cells overexpressing Ryr1 have been shown to have higher mitochondrial ATP concentrations, as well as increased ATP production in response to cytosolic Ca2+ elevations. Thus, the observed increases in Ryr1 gene expression in Rgs2-/- mice could indicate increased levels of ATP production, and indirectly suggest increased ATP utilization in skeletal tissue, which could contribute to the lean phenotype. In addition, increased Rgs2-/- gene expression of glycogen phosphorylase (Pygm) (the rate-limiting enzyme of glycogenolysis) (Fig. 5.9D) correlates with previous studies which have demonstrated that cultured human muscle cells overexpressing glycogen phosphorylase display increased glucose transporter (GLUT-4) (slc2a4) expression with no changes in hexokinase II (the rate limiting enzyme in glycolysis) (Baqué et al., 1998), expression patterns which we also observed in Rgs2-/- mice compared to WT controls (Fig. 5.9C and E).

Changes in Dio2 gene expression also suggest increased metabolism in Rgs2-/- mice (Fig. 5.10A). Since DIO2 catalyzes the conversion of the inactive prohormone thyroxine (3,5,3',5'- tetraiodothyronine, T4) to the active thyroid hormone (3,5,3'-triiodothyronine, T3) (Gereben et al., 2008; Arrojo e Drigo et al., 2013), it would follow that local cellular production of T3 could increase due to elevated levels of DIO2. Thyroid hormone plays a major role in energy expenditure and glucose homeostasis; thyroid hormone signalling can modulate metabolic rate by either uncoupling the ATP synthesis in the mitochondria or decreasing the metabolic efficiency of skeletal muscle (Salvatore et al., 2013), effectively “wasting” energy as dissipated heat (de Lange et al., 2001; Silva, 2006). In addition, GLUT-4 expression (and therefore glucose uptake in cells) is T3 dependent; in conjunction, GLUT-4 translocation to the cell surface is an insulin-dependent event, and normal muscle responsiveness to insulin has been shown to require the DIO2-mediated conversion of T4 to T3 (Mills et al., 1987; Zorzano, Palacin and Guma, 2005; Grozovsky et al., 2009). Altogether, the observed increases in gene 172

expression for Ryr1, Pygm, Slc2a4 (GLUT-4), and Dio2 suggest that both glucose metabolism and resting metabolic rate may be altered in Rgs2-/- mice compared to WT animals.

Although the exact mechanisms behind the lean phenotype are yet to be determined, RGS2 has been shown to have various effects on energy storage and usage; in vitro studies have demonstrated the role of RGS2 in mediating GIP (glucose-dependent insulinotropic polypetide)-induced insulin release from pancreatic β cells (Tseng and Zhang, 1998), as well as GLUT-4 (insulin-responsive glucose transporter) translocation in adipocytes (Imamura et al., 1999). Thus, RGS2 may be involved in glucose entrance in adipocytes. RGS2 is also transiently and rapidly upregulated in differentiating mouse preadipocyte cells, and appears to promote the differentiation of adipocytes and expression of adipogenic markers (Imagawa, Tsuchiya and Nishihara, 1999; Nishizuka et al., 2001). Other energy-dependent processes affected by RGS2 include the regulation of protein synthesis (Nguyen et al., 2009; Chidiac et al., 2014), as well as ATP hydrolysis by PMCA (plasma membrane Ca2+ ATPase) and SERCA (sarco/endoplasmic reticulum Ca2+) pumps (Wang et al., 2004). Human polymorphisms which result in the over or under expression of RGS2 have demonstrated the clinical relevance of RGS2 in the context of metabolism. A common polymorphism in the 3’ untranslated region of RGS2 has been shown to decrease RGS2 expression, has been associated with hypertension, and is considered to be a genetic marker that can predict male predisposition to weight gain and obesity (Sartori et al., 2008). Conversely, a C to G substitution in the RGS2 promoter region has been shown to increase RGS2 expression in adipocytes and is associated with the metabolic syndrome (Freson et al., 2007). Altogether, our current findings suggest an important role for RGS2 in weight regulation and body metabolism.

Conclusions

Using simultaneous measurements of indirect calorimetry and activity, we have demonstrated increased metabolism in Rgs2-/- mice compared to WT controls in both ad libitum and diet restriction studies. Obesity is a common, costly, and serious disease, with more than 2/3 of US adults considered to be overweight or obese (Flegal et al., 2012). This growing epidemic makes

173

the study of potential regulators of metabolic signaling both timely and necessary. Given that increased RGS2 expression may be involved in obesity and metabolic disease in humans, and our findings that a lack of RGS2 leads to decreased body weight and improved metabolic profiles, RGS2 may be an important target for the future development of anti-obesity strategies.

174

References

Arrojo e Drigo, R., Fonseca, T. L., Werneck-de-Castro, J. P. S. and Bianco, A. C. (2013) ‘Role of the type 2 iodothyronine deiodinase (D2) in the control of thyroid hormone signaling’, Biochim. Biophys. Acta - Gen. Subj., 1830(7), pp. 3956–3964.

Baqué, S., Montell, E., Camps, M., Guinovart, J. J., Zorzano, A. and Gòmez-Foix, A. M. (1998) ‘Overexpression of Glycogen Phosphorylase Increases GLUT4 Expression and Glucose Transport in Cultured Skeletal Human Muscle’, Diabetes, 47(8).

Beard, N. A., Wei, L. and Dulhunty, A. F. (2009) ‘Control of muscle ryanodine receptor calcium release channels by proteins in the sarcoplasmic reticulum lumen: Proceedings of the australian physiological society symposium: EC coupling and fatigue’, in Clin. Exp. Pharmacol. Physiol., pp. 340–345.

Cheng, Y.-S., Lee, T.-S., Hsu, H.-C., Kou, Y. R. and Wu, Y.-L. (2008) ‘Characterization of the transcriptional regulation of the regulator of G protein signaling 2 (RGS2) gene during 3T3-L1 preadipocyte differentiation’, J. Cell. Biochem. Wiley Subscription Services, Inc., A Wiley Company, 105(3), pp. 922–930.

175

Even, P. C. and Nadkarni, N. A. (2012) ‘Indirect calorimetry in laboratory mice and rats: principles, practical considerations, interpretation and perspectives’, Am. J. Physiol. - Regul. Integr. Comp. Physiol., 303(5), pp. R459–R476.

Faulks, S. C., Turner, N., Else, P. L. and Hulbert, A. J. (2006) ‘Calorie restriction in mice: Effects on body composition, daily activity, metabolic rate, mitochondrial reactive oxygen species production, and membrane fatty acid composition’, Journals Gerontol. Ser. A- Biological Sci. Med. Sci., 61(8), pp. 781–794.

Flegal, K. M., Carroll, M. D., Kit, B. K. and Ogden, C. L. (2012) ‘Prevalence of obesity and trends in the distribution of body mass index among US adults, 1999-2010’, JAMA, 307(5), p. 491.

Gereben, B., Zavacki, A. M., Ribich, S., Kim, B. W., Huang, S. A., Simonides, W. S., Zeöld, A. and Bianco, A. C. (2008) ‘Cellular and molecular basis of deiodinase-regulated thyroid hormone signaling’, Endocr. Rev. William Heinemann, London, pp. 898–938.

Grozovsky, R., Ribich, S., Rosene, M. L., Mulcahey, M. A., Huang, S. A., Patti, M. E., Bianco, A. C. and Kim, B. W. (2009) ‘Type 2 Deiodinase Expression Is Induced by Peroxisomal

176

Proliferator-Activated Receptor-γ Agonists in Skeletal Myocytes’, Endocrinology, 150(4), pp. 1976–1983.

Guzman, M. S., De Jaeger, X., Drangova, M., Prado, M. A. M., Gros, R. and Prado, V. F. (2013) ‘Mice with selective elimination of striatal acetylcholine release are lean, show altered energy homeostasis and changed sleep/wake cycle’, J. Neurochem., 124(5), pp. 658–669.

Heximer, S. P., Knutsen, R. H., Sun, X., Kaltenbronn, K. M., Rhee, M.-H., Peng, N., Oliveira- dos-Santos, A., Penninger, J. M., Muslin, A. J., Steinberg, T. H., Wyss, J. M., Mecham, R. P. and Blumer, K. J. (2003) ‘Hypertension and prolonged vasoconstrictor signaling in RGS2- deficient mice’, J. Clin. Invest., 111(4), pp. 445–452.

Kibbe, W. A. (2007) ‘OligoCalc: an online oligonucleotide properties calculator.’, Nucleic Acids Res., 35(Web Server issue), pp. W43-6. de Lange, P., Lanni, A., Beneduce, L., Moreno, M., Lombardi, A., Silvestri, E. and Goglia, F. 177

(2001) ‘Uncoupling Protein-3 Is a Molecular Determinant for the Regulation of Resting Metabolic Rate by Thyroid Hormone’, Endocrinology, 142(8), pp. 3414–3420.

LeBrasseur, N. K., Schelhorn, T. M., Bernardo, B. L., Cosgrove, P. G., Loria, P. M. and Brown, T. A. (2009) ‘Myostatin inhibition enhances the effects of exercise on performance and metabolic outcomes in aged mice’, Journals Gerontol. - Ser. A Biol. Sci. Med. Sci., 64(9), pp. 940–948.

Mi, H., Muruganujan, A., Casagrande, J. T. and Thomas, P. D. (2013) ‘Large-scale gene function analysis with the PANTHER classification system’, Nat. Protoc. Nature Research, 8(8), pp. 1551–1566.

Mills, I., Barge, R. M., Silva, J. E. and Larsen, P. R. (1987) ‘Insulin stimulation of iodothyronine 5′-deiodinase in rat brown adipocytes’, Biochem. Biophys. Res. Commun., 143(1), pp. 81–86.

Nguyen, C. H., Ming, H., Zhao, P., Hugendubler, L., Gros, R., Kimball, S. R. and Chidiac, P. (2009) ‘Translational control by RGS2’, J. Cell Biol., 186(5), pp. 755–765.

Nishizuka, M., Honda, K., Tsuchiya, T., Nishihara, T. and Imagawa, M. (2001) ‘RGS2 promotes adipocyte differentiation in the presence of ligand for peroxisome proliferator- activated receptor γ’, J. Biol. Chem. American Society for Biochemistry and Molecular Biology, 276(32), pp. 29625–29627.

Popov, S., Yu, K., Kozasa, T. and Wilkie, T. M. (1997) ‘The regulators of G protein signaling 178

(RGS) domains of RGS4, RGS10, and GAIP retain GTPase activating protein activity in vitro.’, Proc. Natl. Acad. Sci. U. S. A., 94(14), pp. 7216–20.

Ratneswaran, A., Sun, M. M.-G., Dupuis, H., Sawyez, C., Borradaile, N. and Beier, F. (2017) ‘Nuclear receptors regulate lipid metabolism and oxidative stress markers in chondrocytes’, J. Mol. Med. Springer Berlin Heidelberg, pp. 1–14.

Richardson, H. B. (1929) ‘The respiratory quotient’, Physiol. Rev., 9(1), pp. 61–125.

Silva, J. E. (2006) ‘Thermogenic Mechanisms and Their Hormonal Regulation’, Physiol. Rev., 86(2), pp. 435–464.

Somerville, J. M., Aspden, R. M., Armour, K. E., Armour, K. J. and Reid, D. M. (2004) ‘Growth of C57Bl/6 mice and the material and mechanical properties of cortical bone from the

179

tibia’, Calcif. Tissue Int., 74(5), pp. 469–475.

Sun, C., Tian, L., Nie, J., Zhang, H., Han, X. and Shi, Y. (2012) ‘Inactivation of MARK4, an AMP-activated protein kinase (AMPK)-related kinase, leads to insulin Hypersensitivity and resistance to diet-induced obesity’, J. Biol. Chem., 287(45), pp. 38305–38315.

Tseng, C. C. and Zhang, X. Y. (1998) ‘Role of regulator of G protein signaling in desensitization of the glucose-dependent insulinotropic peptide receptor.’, Endocrinology. Oxford University Press, 139(11), pp. 4470–5.

Weindruch, R., Walford, R. L., Fligiel, S. and Guthrie, D. (1986) ‘The retardation of aging in mice by dietary restriction: longevity, cancer, immunity and lifetime energy intake.’, J. Nutr., 116(4), pp. 641–654.

Zorzano, A., Palacin, M. and Guma, A. (2005) ‘Mechanisms regulating GLUT4 glucose transporter expression and glucose transport in skeletal muscle’, Acta Physiol. Scand., 183(1), pp. 43–58.

180

6 DISCUSSION AND CONCLUSIONS

181

Summary and Discussion

6.1.1 Chapter 3 – Cardiomyocyte specific overexpression of a 37 amino acid domain of RGS2 inhibits cardiac hypertrophy and improves function in response to pressure overload in mice

Cardiac hypertrophy is a known risk factor for cardiovascular diseases such as heart failure, and involves de novo protein synthesis in the post-mitotic cardiomyocyte population of the heart (Anversa et al. 2007; Carvalho 2010). RGS2 has been well established as an inhibitor of cardiomyocyte hypertrophy via its inhibitory effects on Gq and Gs-mediated signalling (Roy et al. 2006; Zou et al. 2006; Nunn et al. 2010; Zhang et al. 2011). We have previously reported that RGS2 can also inhibit protein synthesis through a 37 amino acid domain within its RGS domain (Nguyen et al. 2009), which we have termed RGS2eb. We observed these effects in both cell lines and cultured neonatal cardiomyocytes (Chidiac et al. 2014; Nguyen et al. 2009), and thus hypothesized that the cardiomyocyte-specific overexpression of RGS2eb could result in the in vivo inhibition of protein synthesis, and potentially offer protection against the development of hypertrophy in an experimental model of pressure overload. The aim of the studies described in Chapter 3 of this thesis was to determine the extent of cardiac hypertrophy in transgenic RGS2eb (RGS2eb TG) mice compared to WT sham and transverse aortic constriction (TAC) animals, and whether there were associated benefits to cardiovascular function.

Following 28 days of TAC, mice with cardiomyocyte specific overexpression of RGS2eb were resistant to the development of significant cardiac hypertrophy compared to WT TAC mice. At the cellular level, measurements of cardiomyocyte cross-sectional area showed a corresponding increase in cell size for WT but not RGS2eb TG mice after TAC. In addition, systolic and diastolic indices of cardiac function via pressure-volume loop analyses suggested that RGS2eb TG animals were able to maintain significantly improved cardiac function following TAC compared to WT animals. Furthermore, the expression of the “fetal” genes β- MHC and ANP, which are often upregulated during conditions of hypertrophy and heart failure, was completely abrogated in RGS2eb TG compared to WT TAC mice. These results

182

are consistent with our overall hypothesis that expression of the eIF2B-interacting domain of RGS2, RGS2eb, can protect against pathological cardiac hypertrophy and dysfunction in vivo, and that this may be via the direct inhibition of protein synthesis. Along with our previous studies, which showed the ability of RGS2eb to inhibit drug-induced cardiomyocyte hypertrophy, our current findings suggest that the RGS2eb region is an important contributor to the reported beneficial cardiac effects of RGS2.

6.1.2 Chapter 4 – Effects of transverse aortic constriction and drug induced experimental pressure overload hypertrophy on Rgs2-/- mice with cardiomyocyte specific overexpression of RGS2eb

The aim of Chapter 4 was to explore whether the cardioprotective effects of RGS2eb that we observed in Chapter 3 could be extended to an Rgs2-/- model of experimentally-induced cardiac hypertrophy. Rgs2-/- mice are highly sensitive to TAC-induced cardiac hypertrophy and heart failure (Takimoto et al. 2009), and have been shown to have mild to moderate levels of hypertension (Oliveira-Dos-Santos et al. 2000; Heximer et al. 2003). The use of Rgs2-/- mice could provide further clarity into the cardioprotective role of the RGS2eb region, endogenous RGS2 was still present in the Rgs2+/+(eb) mice from our earlier studies (Lee et al. 2017). Based on our observations in Chapter 3, we hypothesized that the cardiomyocyte specific expression of RGS2eb in Rgs2-/- mice (Rgs2-/-(eb)) could potentially decrease the severity of cardiac hypertrophy and heart failure resulting from experimentally induced pressure overload, thereby compensating for the absence of full-length RGS2. For our Chapter 4 studies, we generated novel transgenic Rgs2-/- mice with cardiomyocyte specific overexpression of RGS2eb (Rgs2-/-(eb)). However, when we initially began our TAC studies with Rgs2-/- and WT mice, we found that the mortality rate for Rgs2-/- animals significantly exceeded that of WT controls following TAC surgery, suggesting an impaired ability to recover from cardiovascular insult. Due to the unexpectedly high mortality rate of Rgs2-/ - mice, the TAC model was determined to be unsuitable for the evaluation of cardiac hypertrophy, and was discontinued before the addition of Rgs2-/-(eb)mice to the study. We thus proceeded to examine the effects of drug-induced models of hypertension on Rgs2-/- mice. Starting with an angiotensin II model of chronic agonist infusion via osmotic pumps

183

(1.44mg/kg/day), we observed that although there was hypertension in our angiotensin II treated animals, significantly detectable cardiac hypertrophy did not develop in any experimental angiotensin II groups (WT, Rgs2+/+(eb), Rgs2-/-, and Rgs2-/-(eb)) compared to saline control mice. Further studies with angiotensin II infusion at higher concentrations (3.0 mg/kg/day for 14 days) using WT and Rgs2-/- mice also failed to induce clearly detectable cardiac hypertrophy. Thus, we went on to perform pilot studies with twice daily injections of isoproterenol (ISO) for 14 days; our preliminary results suggest that a full study with prolonged injections beyond 14 days may result in cardiac hypertrophy. Such a reproducible model of cardiac hypertrophy would then allow for the effective examination of whether the inhibitory effects of RGS2eb on protein translation is sufficient to provide cardioprotection in a null RGS2 background.

6.1.3 Chapter 5 – Loss of RGS2 alters the effects of acute and chronic diet restriction on metabolic outcomes in C57 BL.6 mice

Cardiovascular dysfunction, including pathological cardiac hypertrophy, is known to be directly influenced by obesity and weight gain, which are major risk factors for cardiovascular diseases such as coronary heart disease, atrial fibrillation, hypertension, venous thromboembolisms, and congestive heart failure (Klein et al. 2004; Poirier et al. 2006; Tedrow et al. 2010; Wattanakit et al. 2012). Adiposity is determined by energy expenditure versus energy intake, and possible sources of energy imbalance in cases of obesity or weight loss could come from the dysregulation of food intake/nutrient absorption, lipid storage, metabolic rate, physical activity, or CNS-related changes.

Multiple GPCRs have been shown to be involved in energy metabolism, and alterations in G protein signalling (which is regulated by RGS proteins) can lead to both lean and obese phenotypes (Colombo et al. 1998; Nambu et al. 2011; Grillet et al. 2005; Cho et al. 2008). We have previously reported that Rgs2-/- mice exhibit a lean phenotype, are hyperphagic, have smaller adipose tissue deposits and adipocytes, and are ultimately resistant to age-related weight gain (Nunn et al. 2011). In addition, comparable nutrient absorption suggested that increased physical activity and/or metabolism could be underlying factors to the observed lean phenotype. However, although the lean phenotype was present throughout the Rgs2-/- mouse 184

lifespan on an ad libitum standard rodent diet, these animals nonetheless became obese and insulin-resistant under high-fat diet conditions (Nunn et al. 2011), suggesting that Rgs2-/- mice do not have a major impairment with respect to their ability to accumulate adipose. Thus, we hypothesized that the observed lean phenotype may reflect underlying changes in energy utilization. The aim of our studies in Chapter 4 was to understand the role of RGS2 in metabolism and body weight regulation using CLAMS metabolic cages to simultaneously assess indirect calorimetry parameters and ambulatory activity in freely moving age-matched control and Rgs2-/- mice under normal and diet-restricted conditions. Analysis of ad libitum data showed Rgs2-/- mice had significantly increased metabolism compared to WT controls, and that these differences were exacerbated both by chronic and acute caloric restriction. Since no changes in ambulatory activity were observed, these observations suggest that internal metabolism, rather than overt physical activity, is the major contributor to the lean Rgs2-/- phenotype. Furthermore, since skeletal muscle is a major site of metabolism (Salvatore et al. 2013) qPCR for metabolically-related genes in the gastrocnemius tissue of WT and Rgs2- /-- mice suggest that both glucose metabolism and resting metabolic rate may be altered in Rgs2- /- mice compared to WT animals. Altogether, our current findings in combination with our previous reports demonstrate an important role for RGS2 in the regulation of weight and body metabolism.

Future directions

In Chapter 3, we demonstrated the cardioprotective potential of RGS2eb in an in vivo model of cardiac hypertrophy. Currently, the majority of drugs for cardiovascular diseases target GPCRs (Rask-Andersen, Almén, and Schiöth 2011). Although these medications can offer significant benefits to patients, heart failure continues to be a global leading cause of morbidity and mortality. In addition, inhibiting GPCR signalling often results in “off-target” effects due to the broad cascade of signalling pathways that they control (Allen and Roth 2011). The specificity of RGS2eb for the inhibition of protein synthesis at the level of translation initiation could potentially mitigate such issues and lead to improved therapeutics. Indeed, interest in RGS2 and other RGS proteins as possible drug targets is on the rise (Sjogren et al. 2012; 185

Sjögren and Neubig 2010; Sjögren, Blazer, and Neubig 2010; Le and Coffman 2003; Go et al. 2013; Turner et al. 2012; Sjögren et al. 2016). Future steps in characterizing the potential of RGS2eb as a cardioprotective factor could involve its direct delivery to the heart after experimentally-induced cardiac injury in lieu of our current cardiac-specific overexpression model, where activation of the RGS2eb transgene in the heart occurs soon after birth. Recombinant adeno-associated viruses (rAAVs) could be a potential avenue for RGS2eb delivery to the heart, as they are currently the most widely used vectors for safe, long-term gene delivery and expression in the heart due to their ability to transduce post-mitotic cells such as cardiomyocytes (Zsebo et al. 2014). rAAVs are unique among viruses used for gene therapy in that the wild-type (AAV) virus has not been shown to cause human disease (Thomas, Ehrhardt, and Kay 2003). In addition to their low immunogenicity, rAAVs demonstrate efficient long-term transgene expression and low rates of insertional mutagenesis; previous experiments using various combinations of AAV capsids (which control receptor-mediated cellular entry) and rAAV pseudotypes have established rAAV2/1, rAAV2/6, rAAV2/8, rAAV2/9, and rAAV2/10 as the most cardiotropic (Pacak and Byrne 2011). Multiple in vivo studies and clinical trials lend credence to the use of rAAVs as a delivery system for RGS2eb to the heart (Zsebo et al. 2014; Li et al. 2003; Hoshijima et al. 2002; Asfour et al. 2002; Kawase et al. 2008; McTiernan et al. 2007), which could be explored in future studies.

In Chapter 4, the substantially lower survival rates of Rgs2-/- mice compared to WT counterparts following TAC surgery support studies in the literature that suggest that impaired cardiovascular function in Rgs2-/- mice may be due to enhanced susceptibility to atrial fibrillation (Jones, Tuomi, and Chidiac 2012). Although our specific aims and hypotheses for this chapter focused on cardiac hypertrophy and related functional effects, the observed Rgs2- /- mortality rates suggest that further exploration of this reaction to TAC surgery could prove interesting. In terms of understanding any potential roles of RGS2eb in Rgs2-/- mice, protocol optimization is certainly required for our studies. Although cardiac hypertrophy was not induced in our experimental angiotensin II animals, the presence of hypertension reflected successful infusion of the drug into agonist-treated mice. Since hypertension-induced hypertrophy via angiotensin II is a less severe model of hypertrophy compared to TAC surgeries, prolonged angiotensin II infusion beyond our current 28 day study design may 186

clarify the timeline for cardiac hypertrophy development in our mouse strains; similar studies would extend to our pilot isoproterenol models.

The Chapter 5 studies expand on our previous work, in which we found Rgs2-/- mice to be resistant to normal, age-related weight gain (Nunn et al. 2011). We were previously unable to reconcile obvious changes in lipid metabolism and body weight with measured lower metabolic rates; using the more sensitive CLAMS cages, we demonstrate in this study that metabolic rates as measured by indirect calorimetry are in actuality increased in Rgs2-/- mice. These effects are further enhanced by both chronic and acute diet restrictions, and also suggest that Rgs2-/- mice may have enhanced carbohydrate metabolism. To our knowledge, we are the first group to report a metabolic phenotype in Rgs2-/- mice. Future studies to fully characterize this phenotype could examine the effects of various physical activity modalities; since skeletal muscle is one of the most metabolically active tissues, and we observed the upregulation of several genes which regulate glucose and basal metabolism, studies using physical activity as a variable (e.g. treadmill running) could prove interesting. Furthermore, a detailed assessment of additional metabolic genes (perhaps via RNA-seq analysis) is warranted given the currently observed effects of Dio2, Glut-4, Ryr1, and Pygm gene expression, and could ultimately lead to a clearer understanding of the specific mechanisms and key GPCRs which drive the Rgs2-/- lean phenotype.

Conclusions

Cardiovascular diseases and metabolic dysregulation affect millions around the world, and the study of their underlying factors and mechanisms could lead to the identification of novel drug targets for improved treatment. The first part of this thesis examined the cardioprotective potential of RGS2eb, and we determined that cardiac hypertrophy could indeed be inhibited following TAC by the targeted expression of this truncated protein, with accompanying improvements in cardiac function. Although we were limited in our characterization of the Rgs2-/-(eb) mouse line in the second part of our thesis, the poor survival rates that we observed in Rgs2-/- animals following TAC surgery may lead to additional studies examining RGS2

187

activity in the context of cardiac electrophysiology. The metabolic role of RGS2 is explored in the third part of this thesis, and reveals that loss of RGS2 leads to significant upregulation in metabolic genes and basal metabolism. Altogether, these studies provide new insights into the role of RGS2 in cardiovascular health and metabolism.

188

References

Allen, J. A. and Roth, B. L. (2011) ‘Strategies to Discover Unexpected Targets for Drugs Active at G Protein–Coupled Receptors’, Annu. Rev. Pharmacol. Toxicol., 51(1), pp. 117–144.

Asfour, B., Baba, H. A., Scheld, H. H., Hruban, R. H., Hammel, D. and Byrne, B. J. (2002) ‘Uniform long-term gene expression using adeno-associated virus (AAV) by ex vivo recirculation in rat-cardiac isografts’, Thorac. Cardiovasc. Surg., 50(6), pp. 347–350.

Carvalho, A. B. (2010) ‘Heart regeneration: Past, present and future’, World J. Cardiol. Baishideng Publishing Group Inc, 2(5), p. 107.

189

Schreiner, P. J., Sorlie, P. D., Stein, J., Turan, T. N., Virani, S. S., Wong, N. D., Woo, D. and Turner, M. B. (2013) ‘Heart Disease and Stroke Statistics—2013 Update A Report From the American Heart Association’, Circulation, 127(1), pp. e6–e245.

Hoshijima, M., Ikeda, Y., Iwanaga, Y., Minamisawa, S., Date, M., Gu, Y., Iwatate, M., Li, M., Wang, L., Wilson, J. M., Wang, Y., Ross, J. and Chien, K. R. (2002) ‘Chronic suppression of heart-failure progression by a pseudophosphorylated mutant of phospholamban via in vivo cardiac rAAV gene delivery’, Nat. Med., 8(8), pp. 864–871.

Jones, D. L., Tuomi, J. M. and Chidiac, P. (2012) ‘Role of Cholinergic Innervation and RGS2 in Atrial Arrhythmia.’, Front. Physiol., 3, p. 239.

Kawase, Y., Ly, H. Q., Prunier, F., Lebeche, D., Shi, Y., Jin, H., Hadri, L., Yoneyama, R., Hoshino, K., Takewa, Y., Sakata, S., Peluso, R., Zsebo, K., Gwathmey, J. K., Tardif, J.-C., Tanguay, J.-F. and Hajjar, R. J. (2008) ‘Reversal of cardiac dysfunction after long-term expression of SERCA2a by gene transfer in a pre-clinical model of heart failure’, J. Am. Coll. Cardiol., 51(11), pp. 1112–1119.

190

Le, T. H. and Coffman, T. M. (2003) ‘RGS2: a “turn-off” in hypertension.’, J. Clin. Invest., 111(4), pp. 441–3.

Li, J., Wang, D., Qian, S., Chen, Z., Zhu, T. and Xiao, X. (2003) ‘Efficient and long-term intracardiac gene transfer in delta-sarcoglycan-deficiency hamster by adeno-associated virus- 2 vectors’, Gene Ther., 10(21), pp. 1807–1813.

McTiernan, C. F., Mathier, M. A., Zhu, X., Xiao, X., Klein, E., Swan, C. H., Mehdi, H., Gibson, G., Trichel, A. M., Glorioso, J. C., Feldman, A. M., McCurry, K. R. and London, B. (2007) ‘Myocarditis following adeno-associated viral gene expression of human soluble TNF receptor (TNFRII-Fc) in baboon hearts’, Gene Ther., 14(23), pp. 1613–1622.

Nguyen, C. H., Ming, H., Zhao, P., Hugendubler, L., Gros, R., Kimball, S. R. and Chidiac, P. (2009) ‘Translational control by RGS2’, J. Cell Biol., 186(5), pp. 755–765.

Oliveira-Dos-Santos, A. J., Matsumoto, G., Snow, B. E., Bai, D., Houston, F. P., Whishaw, I. Q., Mariathasan, S., Sasaki, T., Wakeham, A., Ohashi, P. S., Roder, J. C., Barnes, C. A., 191

Siderovski, D. P. and Penninger, J. M. (2000) ‘Regulation of T cell activation, anxiety, and male aggression by RGS2.’, Proc. Natl. Acad. Sci. U. S. A., 97(22), pp. 12272–7.

Pacak, C. A. and Byrne, B. J. (2011) ‘AAV Vectors for Cardiac Gene Transfer: Experimental Tools and Clinical Opportunities’, Mol. Ther., 19(9), pp. 1582–1590.

Rask-Andersen, M., Almén, M. S. and Schiöth, H. B. (2011) ‘Trends in the exploitation of novel drug targets’, Nat. Rev. Drug Discov., 10(8), pp. 579–590.

Sjögren, B., Blazer, L. L. and Neubig, R. R. (2010) ‘Regulators of G protein signaling proteins as targets for drug discovery.’, Prog. Mol. Biol. Transl. Sci., 91, pp. 81–119.

Sjögren, B. and Neubig, R. R. (2010) ‘Thinking Outside of the “RGS Box”: New Approaches to Therapeutic Targeting of Regulators of G Protein Signaling’, Mol. Pharmacol., 78(4), pp. 550–557.

Sjogren, B., Parra, S., Heath, L. J., Atkins, K. B., Xie, Z. and Neubig, R. (2012) ‘Cardiotonic Steroids Stabilize RGS2 Protein Levels’, Mol. Pharmacol., p. mol.112.079293.

Thomas, C. E., Ehrhardt, A. and Kay, M. A. (2003) ‘Progress and problems with the use of viral vectors for gene therapy’, Nat. Rev. Genet., 4(5), pp. 346–358.

Turner, E. M., Blazer, L. L., Neubig, R. R. and Husbands, S. M. (2012) ‘Small Molecule Inhibitors of Regulator of G Protein Signalling (RGS) Proteins.’, ACS Med. Chem. Lett., 3(2), pp. 146–150.

Zsebo, K., Yaroshinsky, A., Rudy, J. J., Wagner, K., Greenberg, B., Jessup, M. and Hajjar, R. 193

J. (2014) ‘Long-Term Effects of AAV1/SERCA2a Gene Transfer in Patients With Severe Heart Failure Analysis of Recurrent Cardiovascular Events and Mortality’, Circ. Res., 114(1), pp. 101–108.

194

APPENDICES

195

Appendix A: Ethics approval

AUP Number: 2015-079 PI Name: Chidiac, Peter AUP Title: Understanding Rgs Proteins

Approval Date: 02/16/2016

Official Notice of Animal Use Subcommittee (AUS) Approval: Your new Animal Use Protocol (AUP) entitled "Understanding Rgs Proteins

" has been APPROVED by the Animal Use Subcommittee of the University Council on Animal Care. This approval, although valid for four years, and is subject to annual Protocol Renewal.2015-079::1

1. This AUP number must be indicated when ordering animals for this project. 2. Animals for other projects may not be ordered under this AUP number. 3. Purchases of animals other than through this system must be cleared through the ACVS office. Health certificates will be required.

The holder of this Animal Use Protocol is responsible to ensure that all associated safety components (biosafety, radiation safety, general laboratory safety) comply with institutional safety standards and have received all necessary approvals. Please consult directly with your institutional safety officers.

Submitted by: Copeman, Laura on behalf of the Animal Use Subcommittee University Council on Animal Care

From: eSiriusWebServer Date: Wed, No

196

AUP Number: 2015-079 PI Name: Chidiac, Peter AUP Title: Understanding RGS Proteins

Official Notification of AUS Approval: A MODIFICATION to Animal Use Protocol 2015-079 has been approved.

Submitted by: Kinchlea, Will D on behalf of the Animal Use Subcommittee

197

Appendix B: Copyright approval

198

Appendix C: Supplementary information

Table C1. Measurement and calculation definitions for VisualSonics analysis of cardiac function

Measurement definitions: Label Description Units LVAW;d Left ventricular anterior wall (diastole) mm LVAW;s Left ventricular anterior wall (systole) mm LVPW;d Left ventricular posterior wall (diastole) mm LVPW;s Left ventricular posterior wall (systole) mm LVID;d Left ventricular internal diameter (diastole) mm LVID;s Left ventricular internal diameter (systole) mm

Calculation definitions: Name Description Units Formula LV Vol;d (M-Mode) Left ventricle volume diastole µL ((7.0 / (2.4 + LVID;d)) * LVID;d3 ) LV Vol;s (M-Mode) Left ventricle volume systole µL ((7.0 / (2.4 + LVID;s)) * LVID;s3) %EF (M-Mode) LV ejection fraction % 100 * ((LV Vol;d – LV Vol;s) / LV Vol;d) %FS (M-Mode) LV fractional shortening % 100 * ((LVID;d – LVID;s) / LVID;d) LV Mass (M-Mode) LV mass uncorrected mg 1.053 * ((LVID;d + LVPW;d + IVS;d)3– LVID;d3) LV Mass Cor (M-Mode) LV mass corrected mg LV Mass (M-Mode) * 0.8

199

A B

4 0 4 0

3 0 3 0

)

(

T T

W 2 0

B B W T W T TG 1 0 TG S a lin e 1 0 IS O , 5 0 m g /k g K O K O K O T K O T

0 0 0 2 4 6 8 1 0 1 2 1 4 0 2 4 6 8 1 0 1 2 1 4 D a y s D a y s C D

1 0 0 1 0 0

)

(

v i

5 0 i 5 0

v r

W T r W T u u

TG TG S S a lin e S IS O K O K O K O T K O T 0 0 0 2 4 6 8 1 0 1 2 1 4 0 2 4 6 8 1 0 1 2 1 3 1 4 D a y s D a y s

S u rv iv a l p ro p o rtio n s : S u rv iv a l p ro p o rtio n s : Days WT TG KO KOT Days WT TG KO KOT 0 100 100 100 100 0 100 100 100.0 100.0 14 100 100 100 100 13 85.7 14 100 100 83.3 85.7

Figure C1. Body weights and survival, 14 days of twice daily saline or 50 mg/kg ISO

14 day (A) Saline and (B) ISO-treated mice were weighed daily, with (C)(D) survival recorded for each treatment and genotype. Data represent means ± SEM, n=3-8 per group using two way ANOVA with Bonferroni’s post hoc test for body weight data and Log rank test for survival curves.

200

Table C2. Selected microarray genes, fold change, and significance

Of the genes below, only Dio2 expression and significance were validated by qPCR. Gastrocnemius tissue, n=2 per group (WT and KO).

Gene p-value fold change fold change description

Adcy2 0.380 3.428 KO up vs WT

Adcy5 0.001 -1.478 KO down vs WT

Adrb1 0.011 1.239 KO up vs WT

Adrb2 0.507 1.785 KO up vs WT

Atp2a1 0.414 17.464 KO up vs WT

Atp5g1 0.074 1.434 KO up vs WT

Cs 0.287 1.930 KO up vs WT

Dio2 0.036 1.343 KO up vs WT

Hk2 0.355 5.699 KO up vs WT

Pygm 0.419 20.016 KO up vs WT

Ryr1 0.430 11.336 KO up vs WT

Slc16a2 0.440 -3.300 KO down vs WT

Slc2a4 0.378 7.765 KO up vs WT

Thra 0.477 1.402 KO up vs WT

201

A B

cellular process (GO:0009987) (19; 24.4%) metabolic process (GO:0008152) (14; 17.9%) developmental process (GO:0032502) (9; 11.5%) multicellular organismal process (GO:0032501)(8; 10.3%) localization (GO:0051179) (6; 7.7%) response to stimulus (GO:0050896) (6; 7.7%) biological regulation (GO:0065007) (5; 6.4%) immune system process (GO:0002376) (4; 5.1%) cellular component organization or biogenesis (GO:0071840) (3; 3.8%) biological adhesion (GO:0022610) (2; 2.6%) reproduction (GO:0000003) (1; 1.3%) locomotion (GO:0040011) (1; 1.3%)

Figure C2. Biological processes, Rgs2-/- down vs. WT

(A) Microarray genes with a higher expression in Rgs2-/- mice vs. WT (1.4 fold or higher and P<0.05) were analyzed by the PANTHER gene list program for functional classifications. (B) The metabolic process section was further expanded for secondary level process details. Chart legends are read as: category name (accession) (# genes; percent of gene hit against total # process hits).

202

A B

Figure C3. Biological processes, Rgs2-/- up vs. WT

(A) Microarray genes with a lower expression in Rgs2-/- mice vs. WT (1.4 fold or higher and P<0.05) were analyzed by the PANTHER gene list program for functional classifications. (B) The metabolic process section was further expanded for secondary level process details. Chart legends are read as: category name (accession) (# genes; percent of gene hit against total # process hits).

203

Figure C4. Cellular components and molecular function for microarray genes, Rgs2- /- genes up or down vs. WT

(A) Microarray genes with a higher expression in Rgs2-/- mice vs. WT (1.4 fold or higher and P<0.05) were analyzed by the PANTHER gene list program for cellular components and molecular function, as were (B) genes with lower expression. Chart legends are read as: category name (accession) (# genes; percent of gene hit against total # process hits). 204

Curriculum Vitae

Name: Katherine N. Lee

Post-secondary University of Western Ontario Education and London, Ontario, Canada Degrees: 2011-2017 Ph.D. Pharmacology & Toxicology

Queen’s University Kingston, ON 2007-2011 BSc.H. Life Sciences

Honours and Awards:

2015 – CIHR Travel Award, Institute of Circulatory and Respiratory Health (ICRH)

2015 – Ontario Graduate Scholarship (OGS)

2014 – CIHR Travel Award, Institute of Circulatory and Respiratory Health (ICRH)

2014 – Clinical and Basic Pharmacology category, UWO Department of Physiology and Pharmacology Research Day, 2nd place

2013 – Platform Presentation award, Great Lakes GPCR Retreat, Cleveland OH

2013 – 3 Minute Thesis Competition finals, UWO, honourable mention

2013 – Graduate Thesis Research Award, Schulich School of Medicine and Dentistry, UWO

205

Related Work Teaching Assistant Experience The University of Western Ontario 2012-2013, Clinical Pharmacology 2013-2014, Pharmacology Lab 2014-2015, Molecular Techniques

Publications:

1. Lee KN, Lu X, Feng QP, Chidiac P. (2017) ‘Cardiomyocyte specific overexpression of regulator of G protein signalling 2 inhibits cardiac hypertrophy and improves function in response to pressure overload in mice.’ J Mol Cell Cardiol, 108: 194-202.

2. Lee KN, Gros R, and Chidiac P. (2017) ‘Loss of regulator of G protein signalling 2 (RGS2) alters the effects of acute and chronic diet restriction on metabolic outcomes in C57 Bl/6 mice’. Submitted to International Journal of Obesity. Manuscript number: 2017IJO01137.

3. Bernhardt ML, Lowther KM, Padilla-Bank E, McDonough CE, Lee KN, Eviskov AV, Uliasz TF, Chidiac P, Williams CJ, Mehlmann LM. (2015) ‘Regulator of G-Protein Signaling 2 (RGS2) Suppresses Premature Calcium Release in Mouse Eggs’. Development, 142(15): 2633-2640.

4. Chidiac P, Sobiesiak AJ, Lee KN, Gros R, Nguyen CH. (2014) ‘The eIF2B-Interacting Domain of RGS2 Protects against GPCR Agonist-Induced Hypertrophy in Neonatal Rat Cardiomyocytes’. Cell Signal, 26(6): 1266-1234

206