DOCSLIB.ORG

The Condensing Activities of the Mycobacterium Tuberculosis Type II

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Condensing Activities of the Mycobacterium Tuberculosis Type II The Condensing Activities of the Mycobacterium tuberculosis Type II Fatty Acid Synthase Are Differentially Regulated by Phosphorylation Virginie Molle, Alistair Brown, Gurdyal Besra, Alain Cozzone, Laurent Kremer To cite this version: Virginie Molle, Alistair Brown, Gurdyal Besra, Alain Cozzone, Laurent Kremer. The Condensing Activities of the Mycobacterium tuberculosis Type II Fatty Acid Synthase Are Differentially Regu- lated by Phosphorylation. Journal of Biological Chemistry, American Society for Biochemistry and Molecular Biology, 2006, 281 (40), pp.30094-30103. 10.1074/jbc.M601691200. hal-02282907 HAL Id: hal-02282907 https://hal.archives-ouvertes.fr/hal-02282907 Submitted on 27 May 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 40, pp. 30094–30103, October 6, 2006 © 2006 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. The Condensing Activities of the Mycobacterium tuberculosis Type II Fatty Acid Synthase Are Differentially Regulated by Phosphorylation* Received for publication, February 22, 2006, and in revised form, July 5, 2006 Published, JBC Papers in Press, July 27, 2006, DOI 10.1074/jbc.M601691200 Virginie Molle‡, Alistair K. Brown§, Gurdyal S. Besra§1, Alain J. Cozzone‡, and Laurent Kremer¶2 From the ‡Institut de Biologie et Chimie des Prote´ines (IBCP UMR 5086), CNRS, Universite´Lyon1, IFR128 BioSciences, Lyon-Gerland, 7 Passage du Vercors, 69367 Lyon Cedex 07, France, the §School of Biosciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, United Kingdom, and the ¶Laboratoire de Dynamique Mole´culaire des Interactions Membranaires, CNRS UMR 5539, Universite´de Montpellier II, case 107, Place Euge`ne Bataillon, 34095 Montpellier Cedex 05, France Phosphorylation of proteins by Ser/Thr protein kinases terial waxy coat: they represent key virulence factors required (STPKs) has recently become of major physiological importance for intracellular survival (3, 4) and contribute to the physiopa- because of its possible involvement in virulence of bacterial thology of tuberculosis. They consist of very long chains of ␣ ␤ pathogens. Although Mycobacterium tuberculosis has eleven -branched -hydroxy fatty acids (C60-C90), whose biosynthe- STPKs, the nature and function of the substrates of these sis is controlled by two elongation systems, the eukaryotic-type enzymes remain largely unknown. In this work, we have identi- fatty acid synthase (FAS-I)3 and the prokaryotic-like FAS-II (5, fied for the first time STPK substrates in M. tuberculosis form- 6). FAS-I consists of a single multifunctional polypeptide, cata- ing part of the type II fatty acid synthase (FAS-II) system lyzing de novo synthesis of medium length acyl-CoA chains involved in mycolic acid biosynthesis: the malonyl-CoA::AcpM (C16-C26), whereas FAS-II comprises several distinct enzymes. transacylase mtFabD, and the ␤-ketoacyl AcpM synthases KasA It catalyzes similar types of reactions to FAS-I, but functions on and KasB. All three enzymes were phosphorylated in vitro by acyl carrier protein (AcpM)-bound chains and is incapable of de different kinases, suggesting a complex network of interactions novo synthesis. The initial substrates of FAS-II are ␤-ketoacyl- between STPKs and these substrates. In addition, both KasA AcpM resulting from the condensation by mtFabH of the acyl- and KasB were efficiently phosphorylated in M. bovis BCG CoA products of FAS-I with malonyl-AcpM (7, 8). Following each at different sites and could be dephosphorylated by the reduction by MabA, elimination of water by a yet unidentified M. tuberculosis Ser/Thr phosphatase PstP. Enzymatic studies dehydratase, and reduction by the enoyl-AcpM reductase revealed that, whereas phosphorylation decreases the activity InhA, the ␤-ketoacyl-AcpM synthases KasA and KasB catalyze of KasA in the elongation process of long chain fatty acids further condensations with malonyl-AcpM in the FAS-II cycle synthesis, this modification enhances that of KasB. Such a (9, 10). Although changes in the mycolic acid profile seem to be differential effect of phosphorylation may represent an regulated by various environmental stimuli, such as those unusual mechanism of FAS-II system regulation, allowing encountered within the infected macrophage, very little is pathogenic mycobacteria to produce full-length mycolates, known at a molecular basis about how pathogenic mycobacte- which are required for adaptation and intracellular survival ria modulate mycolate composition in response to these in macrophages. changes. Whether regulation of FAS-II enzymes occurs at the transcriptional and/or the translational level is not known. Elu- cidation of mechanisms modulating mycolic acid biosynthesis Mycobacterium tuberculosis has a unique cell wall structure would shed some light on the capacity of M. tuberculosis to that accounts for the ability of the bacterium to grow in several adapt and survive within the infected host. contrasting environments and which is responsible for its low Reversible protein phosphorylation is a key mechanism by membrane permeability, contributing to its resistance to com- which environmental signals are transmitted to cause mon chemotherapeutic agents (1). The cell wall has been impli- changes in protein expression or activity in both eukaryotes cated as a direct modulator of interactions between mycobac- and prokaryotes. Genes encoding functional serine/threo- teria and the environment (2). This envelope, characterized by nine protein kinases (STPKs) are ubiquitous in prokaryotic its high lipid content, comprises an inner membrane barrier genomes, but little is known regarding their physiological composed of mycolic acids anchored to arabinogalactan, linked substrates and their participation in bacterial signal trans- to peptidoglycan. Mycolic acids are a hallmark of the mycobac- duction pathways (11). Understanding prokaryotic kinase biology has been seriously hampered by the failure to iden- * The costs of publication of this article were defrayed in part by the payment tify relevant kinase substrates. Signaling through Ser/Thr of page charges. This article must therefore be hereby marked “advertise- ment” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 A Lister-Jenner Research Fellow supported by a grant from the Medical 3 The abbreviations used are: FAS-I, eukaryotic-type fatty acid synthase; Research Council (MRC). AcpM, mycobacterial acyl carrier protein; FAS-II, prokaryotic type II fatty 2 Supported by a grant from the CNRS (ATIP Microbiologie Fondamentale). To acid synthase; FHA, forkhead-associated domain; STPK, Ser/Thr protein whom correspondence should be addressed. Tel.: 33-4-67-14-33-81; Fax: kinase; NTA, nitrilotriacetic acid; PVDF, polyvinylidene difluoride; IPTG, 33-4-67-14-42-86; E-mail: [email protected]. isopropyl-1-thio-␤-D-galactopyranoside; GST, glutathione S-transferase. 30094 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281•NUMBER 40•OCTOBER 6, 2006 This is an Open Access article under the CC BY license. Phosphorylation of M. tuberculosis Condensing Enzymes TABLE 1 Primers used in this study Kinase Primera 5؅ to 3؅ sequenceb,c Primers pair PknA-(1–338) 132 (ϩ) TATGGATCCATGAGCCCCCGAGTTGGCGTGACGC 132/184 184 (Ϫ) TATAAGCTTCAACGCTGACCGGACGAAAACGTGCG PknB-(1–331) 133 (ϩ) TATGGATCCATGACCACCCCTTCCCACCTGTCCG 133/86 86 (Ϫ) TATAAGCTTCAACGGCCCACCGAACCGATGCTGCG PknD-(1–378) 206 (ϩ) TATGGATCCGTGAGCGATGCCGTTCCGCAG 206/207 207 (Ϫ) TATAAGCTTTTACCGTTTGTTGCCGGCCGGCGG PknE-(1–337) 220 (ϩ) TATGGATCCATGGATGGCACCGCGGAATCG 220/222 222 (Ϫ) TATAAGCTTTTACCAGGGCTGGCGGGCTGA PknF-(1–300) 212 (ϩ) TATGGATCCATGCCGCTCGCGGAAGGTTCGACGTTCGCCGGC 212/141 TTCACCATCGTCCGGCAGTTGGGGTCC 141 (Ϫ) TATAAGCTTTTACGGTTGCGACACCCGCGT PknG-(1–360) 200 (ϩ) TATGGATCCATGGCCAAAGCGTCAGAGACC PCR1 ϭ 200/201 201 (Ϫ) GTAGCCGACCGGGTCCCCGTGCCT PCR2 ϭ PCR1/273 273 (Ϫ) TATAAGCTTTTACAGCACCGGGTCGTCTTC PknH-(1–399) 187 (ϩ) TATGGATCCATGAGCGACGCACAGGAC 187/88 88 (Ϫ) TATAAGCTTGAGTTGGTTTTGCGCGGGGTCTG PknI-(1–351) 198 (ϩ) TATGGATCCATGGCGTTGGCCAGCGGCGTG PCR1 ϭ 198/199 199 (Ϫ) GGCCAACAGAATCCGTTGGTC PCR2 ϭ PCR1/211 211 (Ϫ) TATAAGCTTTTAGCGTGGCCGGCGCCTGGTGGG PknJ-(1–340) 208 (ϩ) GCGATGGCCAAGGACCCCATGCGT PCR1 ϭ 209/210 210 (Ϫ) TATAAGCTTTTAGTAGCGGCGCGGTCGTCTCGG PCR2 ϭ PCR1/209 209 (ϩ) TATGGATCCGTGGCCCACGAGTTGAGT PknK-(1–300) 274 (ϩ) TATGGATCCATGACCGACGTTGATCCGCAC 274/275 275 (Ϫ) TATAAGCTTTTAGACGGGCAGGGGCATCTCGTC PknL-(1–369) 196 (ϩ) TATGGATCCGTGGTCGAAGCTGGCACG 196/197 197 (Ϫ) TATAAGCTTTTATCGACGGGCGTGCTGTCG a Forward and reverse primers are represented by plus (ϩ) or minus (Ϫ), respectively. b Restriction sites are italicized. c The bases mutated from those present in the wild type are underlined. phosphorylation has emerged as a critical regulatory mech- EXPERIMENTAL PROCEDURES anism in various bacteria, including pathogenic mycobacte- Bacterial Strains and Growth Conditions—Strains used for ria. The genome of M. tuberculosis contains eleven coding
Load more

Recommended publications
  • Investigation of Antibiotic Targets in the Decaprenyl
    INVESTIGATION OF ANTIBIOTIC TARGETS IN THE DECAPRENYL-PHOSPHORYLARABINOSE BIOSYNTHESIS IN M. TUBERCULOSIS by SZILVIA TÓTH a thesis submitted to University of Birmingham for the degree of DOCTOR OF PHILOSOPHY School of Biosciences College of Life and Environmental Sciences University of Birmingham July 2018 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. Declaration The work presented in this thesis is original except where citing relevant references. Studies were conducted from 2014 to 2017 in the School of Biosciences, University of Birmingham, B15 2TT, UK and also in research and development facility of GlaxoSmithKline, laboratory for Diseases of the Developing World, Tres Cantos, Spain. No part of this work has been submitted for a degree or a diploma to this or any other university. ii Abstract An estimated 1.67 million people died of tuberculosis (TB) in 2016 and it is a threat to human life on a global-scale. To shorten current treatments and battle drug resistant strains it is important to discover and develop new drugs against the causative agent, Mycobacterium tuberculosis. Phenotypic screens have delivered potent hit and lead molecules in the past but the need to target new pathways in M.
    [Show full text]
  • Cell Activation Dictates Localization in Vivo the Mechanism of Splenic Invariant
    The Mechanism of Splenic Invariant NKT Cell Activation Dictates Localization In Vivo Irah L. King, Eyal Amiel, Mike Tighe, Katja Mohrs, Natacha Veerapen, Gurdyal Besra, Markus Mohrs and This information is current as Elizabeth A. Leadbetter of September 27, 2021. J Immunol 2013; 191:572-582; Prepublished online 19 June 2013; doi: 10.4049/jimmunol.1300299 http://www.jimmunol.org/content/191/2/572 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2013/06/17/jimmunol.130029 Material 9.DC1 http://www.jimmunol.org/ References This article cites 46 articles, 16 of which you can access for free at: http://www.jimmunol.org/content/191/2/572.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 27, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology The Mechanism of Splenic Invariant NKT Cell Activation Dictates Localization In Vivo Irah L.
    [Show full text]
  • Wellcome Investigators March 2011
    Wellcome Trust Investigator Awards Feedback from Expert Review Group members 28 March 2011 1 Roughly 7 months between application and final outcome The Expert Review Groups 1. Cell and Developmental Biology 2. Cellular and Molecular Neuroscience (Zaf Bashir) 3. Cognitive Neuroscience and Mental Health 4. Genetics, Genomics and Population Research (George Davey Smith) 5. Immune Systems in Health and Disease (David Wraith) 6. Molecular Basis of Cell Function 7. Pathogen Biology and Disease Transmission 8. Physiology in Health and Disease (Paul Martin) 9. Population and Public Health (Rona Campbell) 2 Summary Feedback from ERG Panels • The bar is very high across all nine panels • Track record led - CV must demonstrate a substantial impact of your research (e.g. high impact journals, record of ground breaking research, clear upward trajectory etc) To paraphrase Walport ‘to support scientists with the best track records, obviously appropriate to the stage in their career’ • Notable esteem factors (but note ‘several FRSs were not shortlisted’) • Your novelty of your research vision is CRUCIAL. Don’t just carry on doing more of the same • The Trust is not averse to risk (but what about ERG panel members?) • Success rate for short-listing for interview is ~15-25% at Senior Investigator level (3-5 proposals shortlisted from each ERG) • Fewer New Investigator than Senior Investigator applications – an opportunity? • There are fewer applications overall for the second round, but ‘the bar will not be lowered’ The Challenge UoB has roughly 45 existing
    [Show full text]
  • The Molecular Bases of / T Cell–Mediated
    Article The molecular bases of / T cell–mediated antigen recognition Daniel G. Pellicci,1,2* Adam P. Uldrich,1,2* Jérôme Le Nours,3,4 Fiona Ross,1,2 Eric Chabrol,3 Sidonia B.G. Eckle,1 Renate de Boer,5 Ricky T. Lim,1 Kirsty McPherson,1 Gurdyal Besra,6 Amy R. Howell,7 Lorenzo Moretta,8 James McCluskey,1 Mirjam H.M. Heemskerk,5 Stephanie Gras,3,4 Jamie Rossjohn,3,4,9** and Dale I. Godfrey1,2** 1Department of Microbiology and Immunology, Peter Doherty Institute for Infection and Immunity and 2Australian Research Council Centre of Excellence in Advanced Molecular Imaging, University of Melbourne, Parkville, Victoria 3010, Australia 3Department of Biochemistry and Molecular Biology, School of Biomedical Sciences and 4Australian Research Council Centre of Excellence in Advanced Molecular Imaging, Monash University, Clayton, Victoria 3800, Australia 5Department of Hematology, Leiden University Medical Center, 2300 RC Leiden, Netherlands 6School of Biosciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, England, UK 7Department of Chemistry, University of Connecticut, Storrs, CT 06269 8Istituto Giannina Gaslini, 16147 Genova, Italy 9Institute of Infection and Immunity, School of Medicine, Cardiff University, Heath Park, Cardiff CF14 4XN, Wales, UK and T cells are disparate T cell lineages that can respond to distinct antigens (Ags) via the use of the and T cell Ag receptors (TCRs), respectively. Here we characterize a population of human T cells, which we term / T cells, expressing TCRs comprised of a TCR- variable gene (V1) fused to joining and constant domains, paired with an array of TCR- chains. We demonstrate that these cells, which represent 50% of all V1+ human T cells, can recognize peptide- and lipid-based Ags presented by human leukocyte antigen (HLA) and CD1d, respectively.
    [Show full text]
  • 1A.Jan2011-1
    “...scholarships for researchand education...” Newsletter January 2011 Arctic climate change 1750 to 1850 Changing Of whales Planetary codes and men atmospheres No malice…. and Ancient numeracy According to recent findings, one adult in five in England today is the consequences innumerate (“Wecan’t allow people to say ‘I’m no good at maths’”, Arough but possible division of research styles is Guardian 27/4/2010). The figure is particularly stunning when compared to adult illiteracy rates, which are closer to 1%. As the that between the impact-driven and the opportunity- article remarks, for aperson to admit to illiteracy carries social driven. In the first, we tackle recognised objectives stigma, whereas many people will not have aproblem in proclaiming such as the elimination of aparticular disease or the that they cannot count, do not have ahead for figures –that they are establishment of areliable renewable energy source; ‘no good at maths’. Numeracy and literacy,both parts of basic the target is known, it is widely recognised and education, are notably asymmetrical in terms of prestige, and of the progress towards it can be sensibly measured. In the status attached to possessing, or not possessing, them. second, we assess the existing knowledge base and How did things get to be like this? Why is there such agap between we explore the avenues available for its extension; perceptions of numeracy and of literacy –when was it decided that the target is new understanding, it is frequently an being apoet is more glamorous than being an actuary? Ipropose to individual’s quest, and progress lies in the promise take these questions back to the ancient world, because, for all the for new and meaningful investigation that is revealed.
    [Show full text]
  • Mrp1 Is Involved in Lipid Presentation and Inkt Cell Activation by Streptococcus Pneumoniae
    ARTICLE DOI: 10.1038/s41467-018-06646-8 OPEN Mrp1 is involved in lipid presentation and iNKT cell activation by Streptococcus pneumoniae Shilpi Chandra1, James Gray2, William B. Kiosses1, Archana Khurana1, Kaori Hitomi1, Catherine M. Crosby1, Ashu Chawla3, Zheng Fu 3, Meng Zhao1, Natacha Veerapen4, Stewart K. Richardson5, Steven A. Porcelli6, Gurdyal Besra 4, Amy R. Howell5, Sonia Sharma2,7, Bjoern Peters8,9 & Mitchell Kronenberg 1,10 Invariant natural killer T cells (iNKT cells) are activated by lipid antigens presented by CD1d, 1234567890():,; but the pathway leading to lipid antigen presentation remains incompletely characterized. Here we show a whole-genome siRNA screen to elucidate the CD1d presentation pathway. A majority of gene knockdowns that diminish antigen presentation reduced formation of glycolipid-CD1d complexes on the cell surface, including members of the HOPS and ESCRT complexes, genes affecting cytoskeletal rearrangement, and ABC family transporters. We validated the role in vivo for the multidrug resistance protein 1 (Mrp1) in CD1d antigen presentation. Mrp1 deficiency reduces surface clustering of CD1d, which decreased iNKT cell activation. Infected Mrp1 knockout mice show decreased iNKT cell responses to antigens from Streptococcus pneumoniae and were associated with increased mortality. Our results highlight the unique cellular events involved in lipid antigen presentation and show how modification of this pathway can lead to lethal infection. 1 Division of Developmental Immunology, La Jolla Institute for Allergy and Immunology, La Jolla, CA 92037, USA. 2 The Functional Genomics Center, La Jolla Institute for Allergy and Immunology, La Jolla, CA 92037, USA. 3 Bioinformatics Core, La Jolla Institute for Allergy and Immunology, La Jolla, CA 92037, USA.
    [Show full text]
  • Pnas11052ackreviewers 5098..5136
    Acknowledgment of Reviewers, 2013 The PNAS editors would like to thank all the individuals who dedicated their considerable time and expertise to the journal by serving as reviewers in 2013. Their generous contribution is deeply appreciated. A Harald Ade Takaaki Akaike Heather Allen Ariel Amir Scott Aaronson Karen Adelman Katerina Akassoglou Icarus Allen Ido Amit Stuart Aaronson Zach Adelman Arne Akbar John Allen Angelika Amon Adam Abate Pia Adelroth Erol Akcay Karen Allen Hubert Amrein Abul Abbas David Adelson Mark Akeson Lisa Allen Serge Amselem Tarek Abbas Alan Aderem Anna Akhmanova Nicola Allen Derk Amsen Jonathan Abbatt Neil Adger Shizuo Akira Paul Allen Esther Amstad Shahal Abbo Noam Adir Ramesh Akkina Philip Allen I. Jonathan Amster Patrick Abbot Jess Adkins Klaus Aktories Toby Allen Ronald Amundson Albert Abbott Elizabeth Adkins-Regan Muhammad Alam James Allison Katrin Amunts Geoff Abbott Roee Admon Eric Alani Mead Allison Myron Amusia Larry Abbott Walter Adriani Pietro Alano Isabel Allona Gynheung An Nicholas Abbott Ruedi Aebersold Cedric Alaux Robin Allshire Zhiqiang An Rasha Abdel Rahman Ueli Aebi Maher Alayyoubi Abigail Allwood Ranjit Anand Zalfa Abdel-Malek Martin Aeschlimann Richard Alba Julian Allwood Beau Ances Minori Abe Ruslan Afasizhev Salim Al-Babili Eric Alm David Andelman Kathryn Abel Markus Affolter Salvatore Albani Benjamin Alman John Anderies Asa Abeliovich Dritan Agalliu Silas Alben Steven Almo Gregor Anderluh John Aber David Agard Mark Alber Douglas Almond Bogi Andersen Geoff Abers Aneel Aggarwal Reka Albert Genevieve Almouzni George Andersen Rohan Abeyaratne Anurag Agrawal R. Craig Albertson Noga Alon Gregers Andersen Susan Abmayr Arun Agrawal Roy Alcalay Uri Alon Ken Andersen Ehab Abouheif Paul Agris Antonio Alcami Claudio Alonso Olaf Andersen Soman Abraham H.
    [Show full text]
  • Monoclonal Invariant
    Monoclonal Invariant NKT (iNKT) Cell Mice Reveal a Role for Both Tissue of Origin and the TCR in Development of iNKT Functional Subsets This information is current as of October 29, 2020. Eleanor Clancy-Thompson, Gui Zhen Chen, Paul M. Tyler, Mariah M. Servos, Marta Barisa, Patrick J. Brennan, Hidde L. Ploegh and Stephanie K. Dougan J Immunol 2017; 199:159-171; Prepublished online 2 June 2017; Downloaded from doi: 10.4049/jimmunol.1700214 http://www.jimmunol.org/content/199/1/159 Supplementary http://www.jimmunol.org/content/suppl/2017/05/31/jimmunol.170021 http://www.jimmunol.org/ Material 4.DCSupplemental References This article cites 58 articles, 28 of which you can access for free at: http://www.jimmunol.org/content/199/1/159.full#ref-list-1 Why The JI? Submit online. by guest on October 29, 2020 • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2017 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Monoclonal Invariant NKT (iNKT) Cell Mice Reveal a Role for Both Tissue of Origin and the TCR in Development of iNKT Functional Subsets Eleanor Clancy-Thompson,* Gui Zhen Chen,* Paul M.
    [Show full text]
  • Discovery and Characterization of an Anti-Inflammatory Lipid Derived from Mycobacterium Vaccae
    Discovery and characterization of an anti-inflammatory lipid derived from Mycobacterium vaccae By David G. Smith B.S., The Ohio State University, 2010 A thesis submitted to the Faculty of the Graduate School of the University of Colorado in partial fulfillment of the requirement for the degree of Doctor of Philosophy Department of Chemistry and Biochemistry 2017 i This thesis entitled: Discovery and characterization of an anti-inflammatory lipid derived from Mycobacterium vaccae written by David G. Smith has been approved by the Department of Chemistry and Biochemistry ________________________________________________ Christopher A. Lowry, PhD ________________________________________________ Dylan J. Taatjes, PhD Date______________________ The final copy of this thesis has been examined by the signatories, and we find that both the content and the form meet acceptable presentation standards of scholarly work in the above-mentioned discipline. ii Smith, Gregory David (PhD, Chemistry and Biochemistry) Discovery and characterization of an anti-inflammatory lipid derived from Mycobacterium vaccae Thesis directed by Christopher A. Lowry, PhD. In modern urban environments there is an increased prevalence of allergies, asthma, inflammatory bowel diseases (IBD), and anxiety disorders. The underlying cause for these disorders, as postulated by the Hygiene Hypothesis, is chronic inflammation, and the imbalance in the immune system is caused by a lack of interaction with microbes that have been removed from the urban space and lifestyle. One such microbe is the environmental saprophyte, Mycobacterium vaccae. In animal models, immunization with M. vaccae protects against the development of these prevalent inflammatory disorders. This immunoregulatory effect has been shown to occur due to the expansion of regulatory T cells, but it is still unclear how M.
    [Show full text]
  • Endogenously Bound Ligands Crystal Structure of Bovine Cd1b3 With
    Crystal Structure of Bovine CD1b3 with Endogenously Bound Ligands Enrico Girardi, Jing Wang, Thien-Thi Mac, Cees Versluis, Veemal Bhowruth, Gurdyal Besra, Albert J.R. Heck, Ildiko This information is current as Van Rhijn and Dirk M. Zajonc of October 1, 2021. J Immunol published online 2 June 2010 http://www.jimmunol.org/content/early/2010/06/02/jimmun ol.1000042 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2010/06/02/jimmunol.100004 Material 2.DC1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on October 1, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published June 2, 2010, doi:10.4049/jimmunol.1000042 The Journal of Immunology Crystal Structure of Bovine CD1b3 with Endogenously Bound Ligands Enrico Girardi,* Jing Wang,* Thien-Thi Mac,* Cees Versluis,†,‡ Veemal Bhowruth,x Gurdyal Besra,x Albert J.R. Heck,†,‡ Ildiko Van Rhijn,{,‖ and Dirk M. Zajonc* The CD1 family of Ag-presenting molecules is able to display lipids to T cells by binding them within a hydrophobic groove con- nected to the protein surface.
    [Show full text]
  • Identification and Validation of Mode of Action of Chalcones for Their Anti-Mycobacterial Activity
    Identification and validation of mode of action of chalcones for their anti-mycobacterial activity Bhavani Anagani School of Life and Medical Sciences University of Hertfordshire, College Lane, Hatfield, UK. AL10 9AB 1 “The world is headed for a post-antibiotic era, in which common infections and minor injuries which have been treatable for decades can once again kill.” (WHO, 2015) 2 Tuberculosis • Top infectious killer disease – 1.6 Million people • Mycobacterium tuberculosis • Rifampicin, Isoniazid, Ethambutol, and Pyrazinamide • Multi drug treatment – 6 Months Rod shaped Mycobacterium tuberculosis 3 RR-TB; MDR-TB; XDR-TB; TDR-TB --- Treatment limited • New drugs • New classes • New targets • Understanding the resistance 4 Existing Antibiotics Streptomycin - Streptomyces griseus Rifampicin - Amycolatopsis rifamycinia 5 Chalcones Galenia africana Helichrysum melanacme Dalbergia odorifera 6 Synthesis of chalcones Scheme 1: Synthesis of chalcones 7 Physical data for the chalcones (1a-1o) Table1: In vitro preliminary screening data of Chalcones Substituents MIC (µg/ml) Compound M.wt Clogp m.smegmati J-774 (IC50) SI=IC50/MIC R R R m.bovis 1 2 3 s 1a H H H 270.33 3.35 50 6 50 8.4 1b H Br H 349.22 4.18 - - 25 - 1c Br H H 349.22 4.18 100 25 25 1 1d H H Br 349.22 4.18 200 12 25 2.08 1e H Cl H 304.77 3.91 - - 12 - 1f Cl H H 304.77 3.91 100 12 12 1 1g H H Cl 304.77 3.91 - 200 12 0.06 1h H H F 288.32 3.51 200 25 100 4 1i H H OCH3 300.35 3.23 200 50 100 2 1j H H CH3 284.35 3.84 100 25 25 1 1k H H C6 H5 346.43 5.03 200 100 25 0.25 1l H NO2 H 315.32 3.48 - 100 25 0.25 1m CH3 H H 284.35 3.84 200 50 25 0.5 1n H H NO2 315.32 3.48 - 200 50 0.25 1o Cl H Cl 339.21 4.47 - 200 6 0.03 8 MIC Determination against Mycobacteria • Colorimetric broth micro-dilution method according to CLSI guidelines • M.
    [Show full text]
  • N-Methylation of a Bactericidal Compound As a Resistance Mechanism in Mycobacterium Tuberculosis
    N-methylation of a bactericidal compound as a PNAS PLUS resistance mechanism in Mycobacterium tuberculosis Thulasi Warriera, Kanishk Kapilashramib, Argyrides Argyrouc, Thomas R. Ioergerd, David Littlea, Kenan C. Murphye, Madhumitha Nandakumara, Suna Parka, Ben Golda, Jianjie Mia, Tuo Zhanga, Eugenia Meilerf, Mike Reesc, Selin Somersan-Karakayag, Esther Porras-De Franciscof, Maria Martinez-Hoyosf, Kristin Burns-Huanga, Julia Robertsa, Yan Linga, Kyu Y. Rheea,g, Alfonso Mendoza-Losanaf, Minkui Luob,h, and Carl F. Nathana,1 aDepartment of Microbiology and Immunology, Weill Cornell Medicine, New York, NY 10021; bChemical Biology Program, Memorial Sloan Kettering Cancer Center, New York, NY 10065; cPlatform Technology and Science, GlaxoSmithKline, Stevenage SG1 2NY, United Kingdom; dDepartment of Computer Science and Engineering, Texas A&M University, College Station, TX 77843-3474; eDepartment of Microbiology and Physiological Systems, University of Massachusetts Medical School, Worcester, MA 01655; fDiseases of the Developing World, GlaxoSmithKline (GSK), 28760 Madrid, Spain; gDepartment of Medicine, Weill Cornell Medicine, New York, NY 10021; and hDepartment of Pharmacology, Weill Cornell Medicine, New York, NY 10021 Contributed by Carl F. Nathan, June 8, 2016 (sent for review April 26, 2016; reviewed by Thomas Dick, Babak Javid, and Richard E. Lee) The rising incidence of antimicrobial resistance (AMR) makes it im- accumulation of spontaneous mutations allows selection for drug perative to understand the underlying mechanisms. Mycobacterium resistance. Clinically, resistance to most frontline TB drugs is caused tuberculosis (Mtb) is the single leading cause of death from a bacterial by mutations in the activation pathways of prodrugs (e.g., katG pathogen and estimated to be the leading cause of death from AMR.
    [Show full text]