The Condensing Activities of the Mycobacterium Tuberculosis Type II

The Condensing Activities of the Mycobacterium tuberculosis Type II Fatty Acid Synthase Are Differentially Regulated by Phosphorylation Virginie Molle, Alistair Brown, Gurdyal Besra, Alain Cozzone, Laurent Kremer

To cite this version:

Virginie Molle, Alistair Brown, Gurdyal Besra, Alain Cozzone, Laurent Kremer. The Condensing Activities of the Mycobacterium tuberculosis Type II Fatty Acid Synthase Are Differentially Regu- lated by Phosphorylation. Journal of Biological Chemistry, American Society for Biochemistry and Molecular Biology, 2006, 281 (40), pp.30094-30103. 10.1074/jbc.M601691200. hal-02282907

HAL Id: hal-02282907 https://hal.archives-ouvertes.fr/hal-02282907 Submitted on 27 May 2021

HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés.

Distributed under a Creative Commons Attribution| 4.0 International License THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 40, pp. 30094–30103, October 6, 2006 © 2006 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

The Condensing Activities of the Mycobacterium tuberculosis Type II Fatty Acid Synthase Are Differentially Regulated by Phosphorylation* Received for publication, February 22, 2006, and in revised form, July 5, 2006 Published, JBC Papers in Press, July 27, 2006, DOI 10.1074/jbc.M601691200 Virginie Molle‡, Alistair K. Brown§, Gurdyal S. Besra§1, Alain J. Cozzone‡, and Laurent Kremer¶2 From the ‡Institut de Biologie et Chimie des Prote´ines (IBCP UMR 5086), CNRS, Universite´Lyon1, IFR128 BioSciences, Lyon-Gerland, 7 Passage du Vercors, 69367 Lyon Cedex 07, France, the §School of Biosciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, United Kingdom, and the ¶Laboratoire de Dynamique Mole´culaire des Interactions Membranaires, CNRS UMR 5539, Universite´de Montpellier II, case 107, Place Euge`ne Bataillon, 34095 Montpellier Cedex 05, France

Phosphorylation of proteins by Ser/Thr protein kinases terial waxy coat: they represent key virulence factors required (STPKs) has recently become of major physiological importance for intracellular survival (3, 4) and contribute to the physiopa- because of its possible involvement in virulence of bacterial thology of tuberculosis. They consist of very long chains of ␣ ␤ pathogens. Although Mycobacterium tuberculosis has eleven -branched -hydroxy fatty acids (C60-C90), whose biosynthe- STPKs, the nature and function of the substrates of these sis is controlled by two elongation systems, the eukaryotic-type enzymes remain largely unknown. In this work, we have identi- fatty acid synthase (FAS-I)3 and the prokaryotic-like FAS-II (5, fied for the first time STPK substrates in M. tuberculosis form- 6). FAS-I consists of a single multifunctional polypeptide, cata- ing part of the type II fatty acid synthase (FAS-II) system lyzing de novo synthesis of medium length acyl-CoA chains involved in mycolic acid biosynthesis: the malonyl-CoA::AcpM (C16-C26), whereas FAS-II comprises several distinct enzymes. transacylase mtFabD, and the ␤-ketoacyl AcpM synthases KasA It catalyzes similar types of reactions to FAS-I, but functions on and KasB. All three enzymes were phosphorylated in vitro by acyl carrier protein (AcpM)-bound chains and is incapable of de different kinases, suggesting a complex network of interactions novo synthesis. The initial substrates of FAS-II are ␤-ketoacyl- between STPKs and these substrates. In addition, both KasA AcpM resulting from the condensation by mtFabH of the acyl- and KasB were efficiently phosphorylated in M. bovis BCG CoA products of FAS-I with malonyl-AcpM (7, 8). Following each at different sites and could be dephosphorylated by the reduction by MabA, elimination of water by a yet unidentified M. tuberculosis Ser/Thr phosphatase PstP. Enzymatic studies dehydratase, and reduction by the enoyl-AcpM reductase revealed that, whereas phosphorylation decreases the activity InhA, the ␤-ketoacyl-AcpM synthases KasA and KasB catalyze of KasA in the elongation process of long chain fatty acids further condensations with malonyl-AcpM in the FAS-II cycle synthesis, this modification enhances that of KasB. Such a (9, 10). Although changes in the mycolic acid profile seem to be differential effect of phosphorylation may represent an regulated by various environmental stimuli, such as those unusual mechanism of FAS-II system regulation, allowing encountered within the infected macrophage, very little is pathogenic mycobacteria to produce full-length mycolates, known at a molecular basis about how pathogenic mycobacte- which are required for adaptation and intracellular survival ria modulate mycolate composition in response to these in macrophages. changes. Whether regulation of FAS-II enzymes occurs at the transcriptional and/or the translational level is not known. Elu- cidation of mechanisms modulating mycolic acid biosynthesis Mycobacterium tuberculosis has a unique cell wall structure would shed some light on the capacity of M. tuberculosis to that accounts for the ability of the bacterium to grow in several adapt and survive within the infected host. contrasting environments and which is responsible for its low Reversible protein phosphorylation is a key mechanism by membrane permeability, contributing to its resistance to com- which environmental signals are transmitted to cause mon chemotherapeutic agents (1). The cell wall has been impli- changes in protein expression or activity in both eukaryotes cated as a direct modulator of interactions between mycobac- and prokaryotes. Genes encoding functional serine/threo- teria and the environment (2). This envelope, characterized by nine protein kinases (STPKs) are ubiquitous in prokaryotic its high lipid content, comprises an inner membrane barrier genomes, but little is known regarding their physiological composed of mycolic acids anchored to arabinogalactan, linked substrates and their participation in bacterial signal trans- to peptidoglycan. Mycolic acids are a hallmark of the mycobac- duction pathways (11). Understanding prokaryotic kinase biology has been seriously hampered by the failure to iden- * The costs of publication of this article were defrayed in part by the payment tify relevant kinase substrates. Signaling through Ser/Thr of page charges. This article must therefore be hereby marked “advertise- ment” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 A Lister-Jenner Research Fellow supported by a grant from the Medical 3 The abbreviations used are: FAS-I, eukaryotic-type fatty acid synthase; Research Council (MRC). AcpM, mycobacterial acyl carrier protein; FAS-II, prokaryotic type II fatty 2 Supported by a grant from the CNRS (ATIP Microbiologie Fondamentale). To acid synthase; FHA, forkhead-associated domain; STPK, Ser/Thr protein whom correspondence should be addressed. Tel.: 33-4-67-14-33-81; Fax: kinase; NTA, nitrilotriacetic acid; PVDF, polyvinylidene difluoride; IPTG, 33-4-67-14-42-86; E-mail: [email protected]. isopropyl-1-thio-␤-D-galactopyranoside; GST, glutathione S-transferase.

30094 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281•NUMBER 40•OCTOBER 6, 2006 This is an Open Access article under the CC BY license. Phosphorylation of M. tuberculosis Condensing Enzymes

TABLE 1 Primers used in this study Kinase Primera 5؅ to 3؅ sequenceb,c Primers pair PknA-(1–338) 132 (ϩ) TATGGATCCATGAGCCCCCGAGTTGGCGTGACGC 132/184 184 (Ϫ) TATAAGCTTCAACGCTGACCGGACGAAAACGTGCG PknB-(1–331) 133 (ϩ) TATGGATCCATGACCACCCCTTCCCACCTGTCCG 133/86 86 (Ϫ) TATAAGCTTCAACGGCCCACCGAACCGATGCTGCG PknD-(1–378) 206 (ϩ) TATGGATCCGTGAGCGATGCCGTTCCGCAG 206/207 207 (Ϫ) TATAAGCTTTTACCGTTTGTTGCCGGCCGGCGG PknE-(1–337) 220 (ϩ) TATGGATCCATGGATGGCACCGCGGAATCG 220/222 222 (Ϫ) TATAAGCTTTTACCAGGGCTGGCGGGCTGA PknF-(1–300) 212 (ϩ) TATGGATCCATGCCGCTCGCGGAAGGTTCGACGTTCGCCGGC 212/141 TTCACCATCGTCCGGCAGTTGGGGTCC 141 (Ϫ) TATAAGCTTTTACGGTTGCGACACCCGCGT PknG-(1–360) 200 (ϩ) TATGGATCCATGGCCAAAGCGTCAGAGACC PCR1 ϭ 200/201 201 (Ϫ) GTAGCCGACCGGGTCCCCGTGCCT PCR2 ϭ PCR1/273 273 (Ϫ) TATAAGCTTTTACAGCACCGGGTCGTCTTC PknH-(1–399) 187 (ϩ) TATGGATCCATGAGCGACGCACAGGAC 187/88 88 (Ϫ) TATAAGCTTGAGTTGGTTTTGCGCGGGGTCTG PknI-(1–351) 198 (ϩ) TATGGATCCATGGCGTTGGCCAGCGGCGTG PCR1 ϭ 198/199 199 (Ϫ) GGCCAACAGAATCCGTTGGTC PCR2 ϭ PCR1/211 211 (Ϫ) TATAAGCTTTTAGCGTGGCCGGCGCCTGGTGGG PknJ-(1–340) 208 (ϩ) GCGATGGCCAAGGACCCCATGCGT PCR1 ϭ 209/210 210 (Ϫ) TATAAGCTTTTAGTAGCGGCGCGGTCGTCTCGG PCR2 ϭ PCR1/209 209 (ϩ) TATGGATCCGTGGCCCACGAGTTGAGT PknK-(1–300) 274 (ϩ) TATGGATCCATGACCGACGTTGATCCGCAC 274/275 275 (Ϫ) TATAAGCTTTTAGACGGGCAGGGGCATCTCGTC PknL-(1–369) 196 (ϩ) TATGGATCCGTGGTCGAAGCTGGCACG 196/197 197 (Ϫ) TATAAGCTTTTATCGACGGGCGTGCTGTCG a Forward and reverse primers are represented by plus (ϩ) or minus (Ϫ), respectively. b Restriction sites are italicized. c The bases mutated from those present in the wild type are underlined. phosphorylation has emerged as a critical regulatory mech- EXPERIMENTAL PROCEDURES anism in various bacteria, including pathogenic mycobacte- Bacterial Strains and Growth Conditions—Strains used for ria. The genome of M. tuberculosis contains eleven coding cloning and expression of recombinant proteins were Esche- regions with significant similarity to eukaryotic STPKs (11, richia coli DH5␣ (Clontech Laboratories), E. coli TOP-10 12). Nine of these gene products are predicted to be mem- (Invitrogen), E. coli BL21(DE3)pLysS (Novagen) and E. coli brane proteins, presenting a sensor domain to the extracel- strain C41(DE3) (29). All strains were grown and maintained in lular face and a kinase catalytic domain to the cytoplasm LB medium at 37 °C. When required, media were supple- (11). All mycobacterial Ser/Thr kinases described to date mented with 100 ␮g/ml ampicillin, and/or 50 ␮g/ml chloram- display autophosphorylation activity, and several exogenous phenicol, and/or kanamycin 25 ␮g/ml. M. bovis BCG strain substrates have been reported to be phosphorylated by these Pasteur 1173P2 was grown on Middlebrokk 7H10 agar plates enzymes (13–21). Our understanding of STPKs/substrate supplemented with OADC enrichment (Difco) or in Sauton interactions in mycobacteria remains limited, because only a medium. few endogenous substrates have been reported, most of them Cloning, Expression, and Purification of the Eleven Recombi- being recognized by virtue of being encoded by genes close to nant GST-tagged STPKs of M. tuberculosis—PCR fragments their cognate STPK genes (22–26). encoding the intracellular region corresponding to the kinase A recent proteomic study with Corynebacterium glutami- core and the juxtamembrane linker of PknA (residues 1–338), cum revealed that the vast majority of the phosphorylated pro- PknB (residues 1–331), PknD (residues 1–378), PknE (residues teins are metabolic enzymes rather than regulatory proteins, 1–337), PknF (1–300), PknG (residues 1–360), PknH (residues suggesting that protein phosphorylation plays a much broader 1–399), PknI (residues 1–351), PknJ (residues 1–340), PknK function in the physiology of the bacteria than was previously (residues 1–300), and PknL (residues 1–369) were amplified by expected (27). This observation, along with several pieces of using M. tuberculosis H37Rv genomic DNA as template. Site- data brought us to suspect that activity of the tightly intercon- directed mutagenesis based on PCR amplification was carried nected FAS-II components (28) might depend on post-transla- out for the cloning of PknG, PknI, and PknJ. This strategy, as tional modifications, such as phosphorylation. Therefore, as a already described by Molle et al. (22), consisted of creating sub- first step toward the identification of regulatory mechanisms stitutions in the BamHI restriction site naturally present in governing mycolic acid biosynthesis, we investigated whether those genes to create a mismatch in the specific restriction metabolic FAS-II components from M. tuberculosis may repre- sequence without changing the coding sequence. Therefore, sent substrates of STPKs. In this study, we show for the first PknG, PknI, and PknJ could be digested and cloned as BamHI/ time that several FAS-II components, including KasA and HindIII DNA fragments. DNA fragments corresponding to the KasB, are phosphorylated in vitro and in vivo by STPKs and 11 intracellular regions of the different kinases were amplified provide evidence that phosphorylation differentially affects with their specific primers (Table 1), digested by BamHI and their condensing activity. HindIII, and ligated into vector pGEX(M).

OCTOBER 6, 2006•VOLUME 281•NUMBER 40 JOURNAL OF BIOLOGICAL CHEMISTRY 30095 Phosphorylation of M. tuberculosis Condensing Enzymes

Recombinant strains harboring the kinase-expressing con- core, was amplified by using M. tuberculosis genomic DNA as a structs were used to inoculate 100 ml of LB medium supple- template. The 894-bp pstP gene fragment with appropriate sites mented with ampicillin and were incubated at 37 °C with shak- at both ends was synthesized by PCR amplification with the Ј ing until A600 reached 0.5. IPTG was then added at a final following primers: 5 -TAT GGA TCC GTG GCG CGC GTG concentration of 1 mM, and growth was continued for an addi- ACC CTG GTC-3Ј; and 5Ј-TAT AAG CTT TCA GCC CGA tional3hat37°C,with shaking. Purification of the GST-tagged CCA CCG TGG CCG ACT-3Ј. This DNA fragment was recombinant proteins was performed with glutathione-Sepha- digested with BamHI and HindIII, and ligated into vector rose 4B matrix (Amersham Biosciences), as already described pETAmp, digested with the same enzymes, to yield pETAmp- (22). pstP-(1–298). E. coli BL21(DE3)pLysS cells were transformed

Construction and Purification of His6-tagged mtFabD, KasA, with pETAmp-pstP-(1–298) and the recombinant E. coli strain KasB, Holo-AcpM, and OmpATb—Plasmids designed to was used to inoculate 100 ml of LB medium supplemented with express mtFabD and KasA (pET28a-mtFabD and pET28a- ampicillin and chloramphenicol, and was incubated at 37 °C kasA) were described earlier (10, 30). The kasB gene (Rv2246) with shaking until A600 reached 0.5. IPTG was then added at a was amplified by PCR using M. tuberculosis H37Rv genomic final concentration of 1 mM, and growth was continued for an DNA as a template and the following primers: kasB-up 5Ј-GGG additional 3-h period at 37 °C, with shaking. Recombinant His- TAC CAC CAC TTG CGG GGG CGA GT-3Ј and kasB-lo tagged PstP-(1–298) protein was purified on Ni-NTA beads 5Ј-GGG GGC CAA GCT TGT CAT CGC AGG TCT-3Ј. This (Qiagen) as described previously (23). 1361-bp DNA fragment was directly ligated into the pET28a Two-dimensional Gel Electrophoresis—To detect the differ- (Novagen), which had been cut with NdeI and filled-in with ent phosphorylated isoforms of proteins that were phosphoryl- the Klenow enzyme, thus giving rise to pET28a-kasB. E. coli ated in vitro,5␮g of KasA, KasB, or mtFabD (purified from C41(DE3) cells transformed with pET28a-kasB were used to E. coli and phosphorylated in the presence of [␥-33P]ATP and inoculate 100 ml of Terrific Broth medium supplemented PknA) were electrophoresed on immobilized 7-cm pH 5–8 gra- with 25 ␮g/ml kanamycin. Cultures were incubated at 37 °C dient strips on a Protean IEF Cell (Bio-Rad) in the first dimen- with shaking until A600 reached 1. IPTG was then added at a sion and on a 10% SDS-PAGE in the second dimension. The final concentration of 1 mM, and growth was continued over- Coomassie Blue-stained gels were dried onto filter paper night at 16 °C with shaking. Purification of recombinant (Whatman), and radioactivity was revealed by autoradiogra- mtFabD, KasA, KasB was performed as described earlier phy. For in vivo detection, wild-type M. bovis BCG was grown (30). Expression and purification of holo-AcpM and to early stationary phase. Cells were harvested, washed twice OmpATb was done as reported previously (30, 31). with 20 mM Tris-HCl, pH 7.5, and resuspended in lysis buffer Analysis of the Phosphoamino Acid Content of Proteins— (20 mM Tris-HCl pH 7.5, 10% glycerol, antiprotease mixture, Phosphoamino acid analysis of the labeled protein reaction Roche Applied Science), followed by sonication. The lysate was products of the in vitro protein kinase reactions were per- cleared by centrifugation at 14,000 rpm for 30 min at 4 °C. formed as previously described (32). Approximately 150 ␮g of total soluble proteins were loaded Overexpression and Purification of the M. tuberculosis KasA onto a 7-cm immobiline strip (Bio-Rad, pH 3–6) and electro- and KasB Proteins in M. bovis BCG—Standard PCR strategies phoresed in a Protean IEF Cell in the first dimension and on a were used to amplify the M. tuberculosis H37Rv kasA or kasB 10% SDS-PAGE in the second dimension. genes, using the following primers: pVV16-kasA-up 5Ј-TGA Immunoblotting—Two-dimensional gels of M. bovis BCG GTC AGC CTT CCA CCG CTA-3Ј and pVV16-kasA-lo total soluble proteins were blotted on PVDF membrane, and 5Ј-TTT AAG CTT GTA ACG CCC GAA GGC AAG CG-3Ј probed with a rat anti-KasA antibody raised against the M. tu- (containing a HindIII site underlined), pVV16-kasB-up berculosis KasA protein, which also strongly cross-reacts with 5Ј-TGG GGG TCC CCC CGC TTG CGG-3Ј and pVV16- KasB (1:1000 dilution) (35). Horseradish peroxidase-conju- kasB-lo 5Ј-TTT AAG CTT GTA CCG TCC GAA GGC GAT gated anti-rat serum was used as a secondary antibody (1:5000 TGC-3Ј (containing a HindIII site underlined). The PCR prod- dilution), and detection was carried out using the Western ucts were cut with HindIII, enabling direct cloning into the Lightening Reagent (PerkinElmer Life Sciences) according to pVV16 expression vector cut with MscI/HindIII (33). This plas- the manufacturer’s instructions. For immunoblotting of puri- mid is a derivative of pMV261 (34), containing both a kanamy- fied KasA and KasB proteins from E. coli or M. bovis BCG cin and a hygromycin resistance cassette, harboring the hsp60 resolved on 1D PAGE, 2 ␮g were loaded on a 10% polyacrylam- promoter as well as a His tag for expression of C-terminal His- ide gel, electrophoresed, blotted on PVDF, and detected using tagged fusion proteins. The resulting expression vectors, either polyclonal rabbit anti-phosphothreonine or polyclonal named pVV16-kasA and pVV16-kasB, were used to transform rabbit anti-phosphoserine (Invitrogen Immunodetection) anti- M. bovis BCG. Transformants were selected on Middlebrook bodies used at 1:200 dilution. Horseradish peroxidase-conju- 7H10 supplemented with OADC enrichment and 25 ␮g/ml gated anti-rabbit serum was used as a secondary antibody kanamycin and grown in Sauton containing kanamycin. Purifi- (1:5000 dilution), and detection was carried out using the cation of soluble KasA-(His)6 and KasB-(His)6 was performed Western Lightening Reagent according to the manufacturer’s on Ni-NTA agarose beads as described previously (23). instructions. Cloning, Overexpression, and Purification of PstP—The PCR KasA and KasB Activity Assay—KasA and KasB enzymatic fragment encoding the cytoplasmic region of the PstP phospha- activities were assayed as described (10). Briefly, Holo-AcpM tase (residues 1–298), containing the phosphatase catalytic (40 ␮M) was incubated at 37 °C for 30 min with 1 mM ␤-mer-

30096 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281•NUMBER 40•OCTOBER 6, 2006 Phosphorylation of M. tuberculosis Condensing Enzymes

captoethanol in 100 mM potassium phosphate buffer, pH 7.0 to a total volume of 25 ␮l. Kinetic analysis used varied concentrations of [2-14C]malonyl-CoA (specific activity 1.92 Gbq/mmol; Amersham Biosciences) (0–40 ␮M). mtFabD (40 ng) was pre- heated to 37 °C, added to the reaction mixture and held at 37 °C for 30 min to allow mtFabD-catalyzed transacylation of holo- AcpM (30) using [2-14C]malonyl-CoA to reach equilibrium. ␮ C16-AcpM (0–35 M) (30) was added to obtain a final volume of 49 ␮l. Unphosphorylated/phosphorylated KasA (0.6 ␮g) or unphosphorylated/phosphorylated KasB (0.8 ␮g) were added to the reaction mixture to a final volume of 50 ␮l. The reaction was held at 37 °C for 40 min, after which it was quenched by

adding 2 ml of a NaBH4 reducing solution (5 mg/ml NaBH4 in 0.1 M K2HPO4, 0.4 M KCl and 30% (v/v) tetrahydrofuran) followed by incubation at 37 °C for 1 h. The completely reduced product was extracted twice with 2 ml of water-saturated toluene. The combined organic phases from both extractions were FIGURE 1. A, in vitro phosphorylation of KasA, KasB, mtFabD, AcpM, and pooled and washed with 2 ml of toluene-saturated water. The OmpATb by STPKs. The 11 recombinant STPKs (PknA to PknJ) encoded by the organic layer was removed and dried under a stream of nitrogen M. tuberculosis genome were expressed and purified as GST fusions in E. coli 14 and incubated with the purified His-tagged mycobacterial FAS-II enzymes in 33 in a scintillation vial. The C18-1,3-diol product was then the presence of [␥- P]ATP. The quantity between the 11 STPKs is varying quantified by liquid scintillation counting using 10 ml of from 0.6 to 4.2 ␮g to obtain for each specific kinase their optimal autophosphorylation activity. Samples were separated by SDS-PAGE and visualized by EcoScintA. autoradiography. Upper panel, KasA; second panel, KasB; third panel, mtFabD; fourth panel, AcpM; and lower panel, OmpATb. The right lane in each panel RESULTS AND DISCUSSION corresponds to the Coomassie Blue-stained gel showing purity and migration of each substrate. The asterisks represent the autophosphorylated kinases. B, STPK-mediated Phosphorylation of Mycobacterial FAS-II kinetic phosphorylation of the PknA-phosphorylated KasA, KasB, and mtFabD Enzymes—The main locus of the mycobacterial FAS-II system substrates. A kinetic analysis (0–30 min) was performed with [␥-33P]ATP. Pro- is an operon comprising five genes, all transcribed in the same teins were analyzed by SDS-PAGE, and radioactive bands were revealed by autoradiography. Upper panel, KasA; middle panel, KasB; lower panel, mtFabD. orientation (6, 36). The third and fourth ORFs, kasA and kasB, encode the ␤-ketoacyl-ACP synthases that elongate the growing meromycolate precursor, whereas the first gene, mtfabD, KasB was similar to that of KasA, with PknA being the most encodes the malonyl-CoA:AcpM transacylase that provides active kinase. It is, therefore, very likely that different kinases, them with the malonyl-AcpM substrate, the carbon donor such as PknA, recognize KasA and KasB equally well, and sug- during the elongation steps (6, 10, 30). AcpM, the mycobac- gest that they present the same phosphorylation profile. terial acyl carrier protein, is encoded by a gene located between We next examined whether mtFabD may be phosphorylated mtfabD and kasA (10). A systematic approach was used to in vitro, an enzyme that has previously been shown to be phos- investigate whether the eleven STPKs of M. tuberculosis (PknA phorylated in M. bovis BCG (37). The autoradiograph clearly to PknL) phosphorylate these FAS-II components. All eleven shows [33P]mtFabD in the presence of the different STPKs (Fig. STPKs were expressed as GST fusions and purified from E. coli. 1A, third panel). More surprising was the finding that the phos- The various FAS-II components investigated were expressed as phorylation profile was comparable to those obtained for KasA His tag fusions and purified from E. coli. Interestingly, when and KasB. Altogether, these results suggest that the three STPKs were incubated in the presence of KasA and [␥-33P]ATP FAS-II components can be phosphorylated by a specific set of (specific activity 3000 Ci/mmol; Amersham Biosciences), phos- M. tuberculosis kinases, and are preferred substrates for PknA phorylation of KasA was observed, although at different levels in vitro, suggesting that PknA (and presumably the other with regard to the kinase. Fig. 1A shows that PknA was the most STPKs) could phosphorylate all three enzymes using a similar efficient kinase to phosphorylate KasA, while PknB, E, F, and H mechanism. were also found to efficiently phosphorylate KasA. However, Removal of the N-terminal His tag of KasA, KasB, or mtFabD PknK and PknL, which display strong autophosphorylation by cleavage with thrombin did not alter the phosphorylation activity in vitro, did not phosphorylate KasA. PknG, PknI, and profile of the “mature” proteins, thus indicating that phospho- PknJ did not phosphorylate KasA but this might have been rylation did not occur on the additional His tag residues (data caused by their very low in vitro autokinase activity. To our not shown). knowledge, this is the first demonstration of phosphorylation of AcpM is a crucial FAS-II component that carries on the a FAS-II condensing enzyme. This unexpected result prompted growing fatty acyl chain during the elongation step. We there- us to explore whether KasB, which closely resembles KasA (67% fore investigated whether holo-AcpM may also be phosphoryl- identity) and is encoded by the adjacent gene, may also be a ated. Fig. 1A (fourth panel) shows that all STPKs failed to phos- substrate of M. tuberculosis STPKs. As shown in Fig. 1A (second phorylate AcpM. We next addressed the question whether panel), KasB was also phosphorylated in vitro, as evidenced by OmpATb, the major porin found in the cell wall of M. tubercu- the incorporation of radiolabeled phosphate from [␥-33P]ATP. losis (31, 38) and which is not related to FAS-II, could be a In addition, the STPK-mediated phosphorylation profile of substrate of the kinases. Our results indicate that none of the

OCTOBER 6, 2006•VOLUME 281•NUMBER 40 JOURNAL OF BIOLOGICAL CHEMISTRY 30097 Phosphorylation of M. tuberculosis Condensing Enzymes kinases were able to phosphorylate OmpATb in vitro (Fig. 1A, fifth panel). Together, these results indicate that the kinases exhibit substrate specificity, although they present overlapping activities with regard to KasA, KasB, or mtFabD. The results of kinetic analyses of PknA on the three FAS-II substrates, KasA, KasB, and mtFabD is summarized in Fig. 1B. In all three cases, the phosphorylation activity reached a maxi- mum after 20 min. The “overlapping” substrate specificity of different kinases is consistent with previous studies showing that PknB, PknD, PknE, and PknF can all phosphorylate the FHA-containing protein GarA to some extent (24), as well as the FHA-containing proteins Rv0020c and Rv1747 (39). Most studies have reported interactions between FHA-containing proteins and STPKs belonging to either the same or different operons. This work shows that the same kinases can also phosphorylate substrates that lack the FHA domain. Thus, in addition to FHA-containing proteins, FHA-independent mechanisms involve direct binding to STPKs, emphasizing the complexity of STPKs signaling in M. tuberculosis. Another finding arising from these experiments is that KasA, KasB, and mtFabD can interact with multiple STPKs, suggesting that these enzymes may be regulated by multiple signals. However, it remains to be established whether this STPK cross-talk occurs in vivo, which would argue for a very complex signaling mechanism. PknA Phosphorylates All Three FAS-II Enzymes on Multiple Threonine Residues—First, to investigate which amino acid res- FIGURE 2. Phosphoamino acid content of the PknA-phosphorylated FAS-II substrates. KasA, KasB, and mtFabD were phosphorylated in vitro in idues were phosphorylated by PknA, we analyzed the phos- presence of GST-PknA and [␥-33P]ATP, analyzed by SDS-PAGE, electroblotted phoamino acid content of phosphorylated KasA, KasB, and onto an Immobilon PVDF membrane, excised, and hydrolyzed in acid. The mtFabD. The different proteins (1 ␮g) were labeled with phosphoamino acids thus liberated were separated by electrophoresis in the 33 first dimension and ascending chromatography in the second dimension. [␥- P]ATP in vitro, separated by SDS-PAGE, excised, and sub- After migration, radioactive molecules were detected by autoradiography. jected to acid hydrolysis as described in Molle et al. (22). Fig. 2 Authentic phosphoserine (P-Ser), phosphothreonine (P-Thr), and phosphoty- rosine (P-Tyr) were run in parallel as internal standard controls, and visualized shows that all three substrates are preferentially phosphoryla- by ninhydrin staining. Upper panel, KasA; middle panel, KasB; lower panel, ted at threonine residues with minor amounts of phospho- mtFabD. serine being detected. We have recently shown that PknH-mediated phosphoryla- in vivo, we have adopted a proteomic approach. Total soluble tion of EmbR in vitro leads to five phosphorylation states in M. bovis BCG proteins were resolved on a two-dimensional gel, EmbR (40), whereas PknB phosphorylated GarA at a single which were subsequently transferred to a membrane and phosphate acceptor residue (24). Therefore, to determine the in probed with rat anti-KasA antibodies, which also cross-reacts vitro phosphorylation profile of all three FAS-II enzymes, we with KasB. Western blot analysis shows the presence of 3 or 4 performed two-dimensional gel electrophoresis. First, follow- isoforms of KasA and KasB, presumably corresponding to var- ing in vitro phosphorylation by PknA, gel analysis indicated up ious phosphorylation states (Fig. 4). These results clearly dem- to three phosphorylation states in KasA (Fig. 3A). The conclu- onstrate that both KasA and KasB are very efficiently phospho- sion that the different phosphorylation states of KasA corre- rylated in vivo and that it is more significant in vivo than in vitro spond to mono-, di-, or tri-phosphorylated forms of the protein (following treatment with purified STPKs added individually, relies on the fact that each spot on the two-dimensional gel is Fig. 3). The basis for the difference in the phosphorylation pro- equidistant to the next one and can only correspond to a post- files observed in vitro and in vivo is presently unknown but translational modification such as phosphorylation. In fact, suggests that the intracellular environment plays a key role in each phosphate group changes the charge of the protein and the phosphorylation efficiency of KasA and KasB. Some myco- makes it to migrate toward the acidic end of the two-dimen- bacterial factors, which are absent from in vitro assays, may be sional strip (41). Spot intensities from autoradiographs indi- required for better presentation of the substrate to the STPK(s). cated a dominant phosphorylated state (labeled 1), accounting Alternatively, some STPKs may act first in order to mono- for 88% of the total integrated spot intensity, with states 2 and 3 phosphorylate the substrate, thus allowing other kinases to accounting for 10 and 2% each. Similarly, three phosphoryla- phosphorylate the enzymes in a sequential manner. More- tion sites were observed following PknA-mediated phosphoryl- over, this approach constitutes a powerful tool to look for ation of KasB (Fig. 3B) and mtFabD (Fig. 3C). phosphorylation of any mycobacterial protein. In addition, it In Vivo Phosphorylation of KasA and KasB in M. bovis BCG— may be useful to analyze how growth conditions can affect To investigate whether KasA and KasB phosphorylation occurs the phosphorylation profile. More importantly, these results

30098 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281•NUMBER 40•OCTOBER 6, 2006 Phosphorylation of M. tuberculosis Condensing Enzymes

Overproduction and Purification of KasA and KasB Phospho- rylated in Vivo in M. bovis BCG—To overproduce and purify in vivo phosphorylated KasA, a His tag was attached at the C ter- minus of the KasA polypeptide and the recombinant protein was expressed in M. bovis BCG. Cultures of M. bovis BCG/ pVV16-kasA were collected, lysed, and fractionated to separate the soluble cytosolic compartment from the cell envelope. Sol- uble KasA was then purified to homogeneity by affinity chromatography on Ni-containing beads under native conditions (Fig. 5D, left panel). We reasoned that analysis of this purified KasA sample by two-dimensional gel electrophoresis would allow us to determine whether phosphorylation of KasA takes place in mycobacteria, and whether it corresponds to a consti- tutive or growth phase-dependent phenomenon. Samples were collected at various time points during M. bovis BCG growth, corresponding to early-log, mid-log, late-log, or early stationary phases and KasA was purified at each time point and subjected to two-dimensional gel electrophoresis. Three spots, the first one presumably corresponding to the unphosphorylated form of KasA followed in the acidic direction by mono- and di-phosphorylated KasA, were clearly observed (Fig. 5A), demonstrat- ing that KasA is phosphorylated in vivo. Here, the vast majority of KasA was phosphorylated at either one or two sites (mono- phosphorylation being the more prominent spot), and only a small proportion of KasA remained unphosphorylated. This contrasts with our in vitro analyses in which the majority of KasA remained unphosphorylated (Fig. 3A). Furthermore, the phosphorylation state of KasA remained constant, regardless of the growth phase. However, it is noteworthy that the phosphorylation profile was slightly different during stationary phase FIGURE 3. Two-dimensional gel electrophoresis profiles of in vitro PknA-phosphorylated FAS-II substrates. Two-dimensional gel electro- (Fig. 5A), where the mono-phosphorylated species was less pro- phoresis of KasA (A), KasB (B), or mtFabD (C) following in vitro phosphoryl- nounced than in actively replicating mycobacteria and charac- ation by PknA in the presence of [␥-33P]ATP. Proteins were either stained with Coomassie Blue (upper panels) or visualized by autoradiography terized by the appearance of another spot, corresponding to the (lower panels). The arrowheads represent the different protein isoforms: tri-phosphorylated form of KasA. This contrasts with recent np, unphosphorylated; 1, mono-phosphorylated; 2, di-phosphorylated; 3, findings using an anti-phosphothreonine antibody suggest- tri-phosphorylated. ing that mtFabD phosphorylation can only be detected in growing M. bovis BCG cultures (37). Like KasA, the vast majority of KasB was mono-phosphorylated (Fig. 5C)in M. bovis BCG. These results clearly confirm that both condensing enzymes are phosphorylated in mycobacteria to a significant level. To determine whether in vivo phosphorylation of KasA and KasB occurs on threonine and/or serine residues, Western blot analysis were performed using specific anti-phosphothreonine or anti-phosphoserine antibodies. It was found that KasA and FIGURE 4. In vivo phosphorylation of KasA and KasB in M. bovis BCG. Approximately 150 ␮g of total soluble protein from M. bovis BCG lysate were KasB purified from their respective M. bovis BCG strains were loaded on a 7-cm immobiline strip (pH 3–6) and electrophoresed in Protean only phosphorylated on threonine residues (Fig. 5E). This is IEF Cell for the first dimension and 10% SDS-PAGE as the second dimension. consistent with the results obtained by phosphoaminoacid Proteins were then transferred to a PVDF membrane and probed with rat antibodies raised against the M. tuberculosis KasA protein, which also strongly analysis when the proteins were phosphorylated in vitro using cross-reacts with KasB. Following incubation with horseradish peroxidase- PknA (Fig. 2). It clearly establishes that both condensing conjugated anti-rat serum as secondary antibody, detection was carried out using the Western Lightening Reagent. Represented is a selected portion of enzymes are highly phosphorylated in vivo on threonines. In the membrane that strongly reacted with the antibodies and consisting of contrast, neither the anti-phosphothreonine nor the anti-phos- KasA (43.3 kDa, pHi 4.9) and KasB (46.4 kDa, pHi 5.2). The arrowheads represent phoserine antibodies did react with recombinant KasA or KasB the different phosphorylated isoforms of KasA and KasB proteins. proteins purified from E. coli thus confirming that the phospho- suggest that M. bovis BCG represents an attractive source of rylation of the condensing enzymes is a specific phenomenon phosphorylated material to exploit for further studies aimed of M. bovis BCG (Fig. 5E). to analyze the effect of phosphorylation on the activity of the M. tuberculosis Phosphatase PstP Dephosphorylates KasA— condensing enzymes. M. tuberculosis has only one gene (pstP) encoding a transmem-

OCTOBER 6, 2006•VOLUME 281•NUMBER 40 JOURNAL OF BIOLOGICAL CHEMISTRY 30099 Phosphorylation of M. tuberculosis Condensing Enzymes

FIGURE 5. Analysis of the phosphorylation profile of KasA and KasB purified from recombinant M. bovis BCG strains. A, phosphorylation profile of KasA at various time points during growth of M. bovis BCG carrying the pVV16-kasA construct in Sauton medium with gentle shaking (70 rpm). Cells were lysed, and the soluble fraction was incubated with Ni-NTA agarose beads to purify the His-tagged KasA protein. KasA was purified at the times indicated (early-, mid-, late-log, and early stationary phase), subjected to two-dimensional gel electrophoresis and stained with Coomassie Blue. The arrowheads represent the different KasA isoforms: np, unphosphorylated; 1, mono-; 2, di-; 3, tri-phosphorylated. B, dephosphorylation assay with purified PstP-(1–298) using in vivo phosphorylated KasA as substrate. In vivo purified-KasA (3 ␮g) was incubated with His-tagged purified PstP-(1–298) (3 ␮g) in a reaction mixture containing 50 mM Tris-HCl buffer pH 7.5, 0.1 mM EDTA, 1 mM dithiothreitol, and 5 mM MnCl2 for1hat37°C.ThePstP-treated profile of KasA was obtained by two-dimensional gel electrophoresis. The arrowhead indicates the unique KasA isoform (unphosphorylated, np) observed following treatment with PstP. C, phosphorylation profile of KasB purified from M. bovis BCG carrying the pVV16-kasB harvested at mid-log phase. Analysis was performed as mentioned above. D, purity of the His-tagged KasA protein isolated from M. bovis BCG carrying the pVV16-kasA construct checked on a 12% SDS-PAGE (left panel) and purity of the cytoplasmic region of the PstP phosphatase (residues 1–298) comprising the phosphatase catalytic core isolated from E. coli BL21(DE3)pLysS cells carrying pETAmp-pstP- (1–298) (right panel). E, detection of phosphorylated amino acids in in vivo phosphorylated KasA and KasB. Recombinant KasA and KasB purified from either E. coli or from M. bovis BCG strains (2 ␮g) were analyzed on a 10% SDS-PAGE and detected by immunoblotting using antibodies against phosphoserine and phosphothreonine residues. brane Ser/Thr phosphatase (12, 18). PstP efficiently dephospho- basic pH and corresponding to an unphosphorylated state, sug- rylates a variety of phosphorylated proteins, including PknA gestingthatPstP-(1–298)dephosphorylatedmono-anddi-phos- and PknB (17, 18) as well as other M. tuberculosis STPK phorylated KasA (Fig. 5B). To our knowledge, this is the first domains (42). Dephosphorylation of STPKs simultaneously time that PstP has been shown to dephosphorylate a mycobac- abolishes binding sites for substrates containing FHA domains terial STPK-phosphorylated substrate, suggesting that PstP (22) and substantially reduces protein kinase activity (18). Here, exerts its phosphatase activity not only on kinases but also on we addressed the question whether PstP was active on in vivo- the kinase substrates. These results strongly suggest that phos- phosphorylated KasA, as might be expected if the phosphoryl- phorylation of KasA is reversible in vivo, where the phosphatase ation activity is regulated and dependent on a reversible phos- PstP may play a key regulatory role. phorylation mechanism. Therefore, the cytoplasmic region of Phosphorylation Differentially Modulates KasA and KasB PstP (residues 1–298), containing the phosphatase catalytic Condensing Activities—KasA and KasB have been previously core, was expressed as a His-tagged protein. The recombinant shown to be ␤-ketoacyl-AcpM synthases of the mycobacterial His-tagged PstP-(1–298) was produced as a soluble protein in FAS-II system (6, 10). FAS-II is responsible for the production E. coli, purified (Fig. 5D, right panel) and incubated with phos- of the long-chain fatty acid that is subsequently modified to phorylated KasA isolated from M. bovis BCG. Two-dimen- form the meromycolate chain of mycolic acids. To date, there is sional gel analysis revealed a single spot migrating toward the very little information as to whether mycolic acid biosynthesis

30100 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281•NUMBER 40•OCTOBER 6, 2006 Phosphorylation of M. tuberculosis Condensing Enzymes

FIGURE 6. Effect of KasA and KasB phosphorylation on condensation reaction kinetics. A, catalytic activities of KasA (A and B) and KasB (C and D) were determined as described under “Experimental Procedures,” by increasing C16-AcpM (A and C) and malonyl-AcpM (B and D) concentrations. Catalytic parameters were obtained on analysis of the data by Lineweaver-Burk plots (insets). Each graph compares the activities of unphosphorylated (F) versus phosphorylated proteins (E). Unphosphorylated KasA and KasB were purified from E. coli C41(DE3) carrying pET28a-kasA or pET28a-kasB, respectively, whereas phosphorylated KasA and KasB were purified from recombinant M. bovis BCG carrying pVV16-kasA or pVV16-kasB, respectively. Three independent protein preparations were assayed in duplicate with similar results.

can be regulated post-translationally. We therefore sought to by ϳ3–4-fold on phosphorylation, leading to a reduction in the investigate the regulatory implications of the phosphorylation rate of the condensation reaction. We also compared these of FAS-II condensing enzymes. Kinetic analysis was carried out parameters for unphosphorylated versus phosphorylated KasB to investigate the effect of phosphorylation on substrate affinity (Fig. 6, C and D). In contrast to KasA, we found that phospho- and turnover of KasA and KasB. The effect of phosphorylation rylation consistently increased the condensation activity of

on KasA activity was analyzed using the recombinant purified KasB. Although the apparent Km values for C16-AcpM protein from E. coli or from M. bovis BCG as sources of non- remained unchanged following phosphorylation (about 12 ␮M),

phosphorylated or phosphorylated KasA, respectively, and by the apparent Km of malonyl-AcpM was reduced by 3-fold to 10 ␮ varying both C16-AcpM and malonyl-AcpM substrate concen- M. These unexpected results demonstrate that phosphoryla- trations (Fig. 6, A and B). The apparent Km values for substrates tion affects KasA and KasB differently and suggests that they ␮ ␮ C16-AcpM and malonyl-AcpM were about 18 M and 12 M, might be phosphorylated at different sites, despite their strong respectively, and did not change on phosphorylation, indicating overall homology. Alternatively, structural variations around a that phosphorylation does not affect binding of these sub- conserved phosphorylation site might produce this differential

strates. However, the apparent Vmax was consistently reduced effect.

OCTOBER 6, 2006•VOLUME 281•NUMBER 40 JOURNAL OF BIOLOGICAL CHEMISTRY 30101 Phosphorylation of M. tuberculosis Condensing Enzymes

the fact that both enzymes share a similar phosphorylation profile in vivo, and are presumably phosphorylated at the same conserved threonine residues. This may represent an unusual mechanism of regulation where damping KasA may allow time to produce immature mycolates. Conversely, boosting KasB activity may ensure that mycobacteria produce only the full- length mycolates required for virulence and intracellular survival. Among the few substrates of M. tuberculosis STPKs identified so far mtFabD, KasA and KasB are the only ones to which a clear enzymatic function has been assigned. Our work suggests that phosphorylation of these enzymes plays a role in the control of the FAS-II pathway FIGURE 7. Model for the regulation of the meromycolic acid elongation by phosphorylation of the condensing enzymes. Changes in cell wall and mycolic acid composition to various environmental stimuli are and paves the way for studies dedi- central to M. tuberculosis adaptation during infection. Many of these stimuli are transduced within the bacteria cated to the regulation of mycolic by sensor STPKs on the mycobacterial membrane. When sensing external stimuli, STPKs are phosphorylated and transfer the signal to KasA and KasB by transphosphorylation. Our results suggest a differential regulation acid biosynthesis. The differential mechanism of KasA and KasB activities, each enzyme being part of a specialized elongation FAS-II system, expression of the mycobacterial E1-FAS-II comprising KasA, and E2-FAS-II possessing KasB. E1-FAS-II elongates the acyl-AcpM chains from FAS-I kinases in response to stress condi- to longer acyl chains, whereas E2-FAS-II terminates the elongation process by adding the last 2–4 carbon units at the proximal site. Production of full-length mycolates is critical for pathogenic mycobacteria to survive in tions may directly affect the phos- infected macrophages. We propose that, to ensure the biosynthesis of mature mycolates, mycobacteria dif- phorylation profile of these sub- ferentially regulate their E1-FAS-II and E2-FAS-II systems through STPK-dependent phosphorylation. strates, and as a consequence modulate mycolic acid biosynthesis in Based on in vitro assays and drug inhibition studies, it has order to promote adaptation to environmental changes. In an been proposed that KasA is involved in the initial elongation of elegant study, Veyron-Churlet et al. (28) have proposed an meromycolic acid precursors that are further extended by KasB attractive model based on the interaction between the various (6, 43). This hypothesis has recently been supported by in vivo FAS-II components, in which different specialized FAS-II com- studies in both kasA and kasB mutants. Null mutants of kasB, plexes are interconnected. In particular, this model predicts the but not kasA, could be generated in Mycobacterium smegmatis, occurrence of two FAS-II systems involved in the elongation suggesting that, unlike kasB, kasA is essential (44). It was also step: the “elongation-1 FAS-II” (E1-FAS-II) formed by a core found that conditional depletion of KasA in M. smegmatis leads and KasA, capable of elongating acyl-AcpM originating from to the loss of mycolic acid biosynthesis prior to cell lysis (44). A FAS-I (or an initiation-FAS-II complex); the longer chain of kasB mutant of Mycobacterium marinum showed an impaired acyl-AcpM products would then be channeled into the “elon- growth within infected macrophages, although KasB was not gation-2 FAS-II” (E2-FAS-II), comprising the core and KasB required for normal growth in broth medium, indicating a crit- that would complete meromycolate synthesis. Thus, our results ical role of KasB in intracellular survival (4). Moreover, the support a model in which STPK-dependent phosphorylation meromycolates were shortened by 2–4 carbon units in the kasB can induce either positive or negative signaling to the mutant and this defect was localized to the proximal portion of E1-FAS-II and E2-FAS-II complexes (Fig. 7). Further work is the meromycolate chain (4). Therefore, given the importance needed to understand how environmental changes, including for pathogenic mycobacteria to produce full-length mycolates those encountered within the infected macrophages, affect this for intracellular survival and virulence, one can postulate that regulation mechanism. Moreover, it was recently demon- KasA and KasB activities are being differentially regulated. strated that GroEL1 modulates mycolates synthesis during bio- Because kasA and kasB are adjacent genes and belong to the film formation and physically associates with KasA (45). A same operon, one would predict that differential regulation ⌬groEl1 mutant of M. smegmatis, that is defective in biofilm proceeds at a post-translational rather than a transcriptional formation also showed a marked reduction in KasA and KasB level. Our results suggest that phosphorylation is the post- levels. Therefore, whether GroEL1 interacts specifically with translational modification that reduces the activity of KasA and phosphorylated KasA or KasB rather than the non-phosphoryl- enhances that of KasB. The differential effect of phosphoryla- ated proteins deserves to be investigated. It may be reasonable tion of KasA and KasB, two highly similar enzymes sharing the to speculate that GroEL1 plays a regulatory role in phosphoryl- same enzymatic activity but with different substrates specifici- ation of these proteins by the kinases. Another perspective of ties, is rather unexpected. This is even more surprising given this work is the opening of a new field of investigation for future

30102 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281•NUMBER 40•OCTOBER 6, 2006 Phosphorylation of M. tuberculosis Condensing Enzymes drug development against tuberculosis by interfering with 19. Koul, A., Choidas, A., Tyagi, A. K., Drlica, K., Singh, Y., and Ullrich, A. these regulatory processes, such as by selective inhibition of (2001) Microbiology 147, 2307–2314 FAS phosphorylation. This notion is supported by the fact that 20. Young, T. A., Delagoutte, B., Endrizzi, J. A., Falick, A. M., and Alber, T. (2003) Nat. Struct. Biol. 10, 168–174 specific inhibitors of protein kinases have been successfully 21. Gopalaswamy, R., Narayanan, P. R., and Narayanan, S. (2004) Protein developed for therapeutic usage against a variety of diseases Expr. Purif. 36, 82–89 (46), and a specific inhibitor of PknG was capable to inhibit 22. Molle, V., Kremer, L., Girard-Blanc, C., Besra, G. S., Cozzone, A. J., and growth of M. tuberculosis inside macrophages (47). This work Prost, J. F. (2003) Biochemistry 42, 15300–15309 provides a new framework for future investigation of FAS-II 23. Molle, V., Soulat, D., Jault, J. M., Grangeasse, C., Cozzone, A. J., and Prost, regulation, not only in mycobacteria but also in apicomplexan J. F. (2004) FEMS Microbiol Lett. 234, 215–223 parasites and in plants, which also possess a FAS-II system. 24. Villarino, A., Duran, R., Wehenkel, A., Fernandez, P., England, P., Brodin, P., Cole, S. T., Zimny-Arndt, U., Jungblut, P. R., Cervenansky, C., and Alzari, P. M. (2005) J. Mol. Biol. 350, 953–963 Acknowledgments—We thank Dr. V. D. Vissa (Colorado State Uni- 25. Kang, C. M., Abbott, D. W., Park, S. T., Dascher, C. C., Cantley, L. C., and versity) for the kind gift of the pVV16 cloning vector, Dr. L. G. Dover Husson, R. N. (2005) Genes Dev. 19, 1692–1704 (University of Birmingham), Prof. M. J. Buttner (John Innes Centre), 26. Dasgupta, A., Datta, P., Kundu, M., and Basu, J. (2006) Microbiology 152, and Sir D. A. Hopwood (John Innes Centre) for their comments on the 493–504 manuscript. 27. Bendt, A. K., Burkovski, A., Schaffer, S., Bott, M., Farwick, M., and Hermann, T. (2003) Proteomics 3, 1637–1646 28. Veyron-Churlet, R., Guerrini, O., Mourey, L., Daffe, M., and Zerbib, D. REFERENCES (2004) Mol. Microbiol. 54, 1161–1172 1. Brennan, P. J., and Nikaido, H. (1995) Annu. Rev. Biochem. 64, 29–63 29. Miroux, B., and Walker, J. E. (1996) J. Mol. Biol. 260, 289–298 2. Daffe, M., and Draper, P. (1998) Adv. Microb. Physiol. 39, 131–203 30. Kremer, L., Nampoothiri, K. M., Lesjean, S., Dover, L. G., Graham, S., 3. Dubnau, E., Chan, J., Raynaud, C., Mohan, V. P., Laneelle, M. A., Yu, K., Betts, J., Brennan, P. J., Minnikin, D. E., Locht, C., and Besra, G. S. (2001) Quemard, A., Smith, I., and Daffe, M. (2000) Mol. Microbiol. 36, 630–637 J. Biol. Chem. 276, 27967–27974 4. Gao, L. Y., Laval, F., Lawson, E. H., Groger, R. K., Woodruff, A., Morisaki, 31. Molle, V., Saint, N., Campagna, S., Kremer, L., Lea, E., Draper, P., and J. H., Cox, J. S., Daffe, M., and Brown, E. J. (2003) Mol. Microbiol. 49, Molle, G. (2006) Mol. Microbiol. 61, 826–837 1547–1563 32. Grangeasse, C., Doublet, P., Vaganay, E., Vincent, C., Deleage, G., Duclos, 5. Takayama, K., Wang, C., and Besra, G. S. (2005) Clin. Microbiol Rev. 18, B., and Cozzone, A. J. (1997) Gene (Amst.) 204, 259–265 81–101 33. Jackson, M., Crick, D. C., and Brennan, P. J. (2000) J. Biol. Chem. 275, 6. Kremer, L., Baulard, A. R., and Besra, G. S. (2000) in Molecular Genetics of 30092–30099 Mycobacteria (Hatfull, G. F., a. W. R. J., Jr., ed) pp. 173–190, ASM Press, 34. Stover, C. K., de la Cruz, V. F., Fuerst, T. R., Burlein, J. E., Benson, L. A., Washington, D. C. Bennett, L. T., Bansal, G. P., Young, J. F., Lee, M. H., Hatfull, G. F., Snapper, 7. Choi, K. H., Kremer, L., Besra, G. S., and Rock, C. O. (2000) J. Biol. Chem. S. B., Barletta, R. G., Jacobs, W. R., Jr., and Bloom, B. R. (1991) Nature 351, 275, 28201–28207 456–460 8. Brown, A. K., Sridharan, S., Kremer, L., Lindenberg, S., Dover, L. G., Sac- 35. Kremer, L., Guerardel, Y., Gurcha, S. S., Locht, C., and Besra, G. S. (2002) chettini, J. C., and Besra, G. S. (2005) J. Biol. Chem. 280, 32539–32547 Microbiology 148, 3145–3154 9. Schaeffer, M. L., Agnihotri, G., Volker, C., Kallender, H., Brennan, P. J., and 36. Mdluli, K., Slayden, R. A., Zhu, Y., Ramaswamy, S., Pan, X., Mead, D., Lonsdale, J. T. (2001) J. Biol. Chem. 276, 47029–47037 Crane, D. D., Musser, J. M., and Barry, C. E., 3rd. (1998) Science 280, 10. Kremer, L., Dover, L. G., Carrere, S., Nampoothiri, K. M., Lesjean, S., 1607–1610 Brown, A. K., Brennan, P. J., Minnikin, D. E., Locht, C., and Besra, G. S. 37. Sinha, I., Boon, C., and Dick, T. (2003) FEMS Microbiol. Lett. 227, (2002) Biochem. J. 364, 423–430 141–147 11. Av-Gay, Y., and Everett, M. (2000) Trends Microbiol 8, 238–244 38. Senaratne, R. H., Mobasheri, H., Papavinasasundaram, K. G., Jenner, P., 12. Cole, S. T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D., Lea, E. J., and Draper, P. (1998) J. Bacteriol. 180, 3541–3547 Gordon, S. V., Eiglmeier, K., Gas, S., Barry, C. E., 3rd, Tekaia, F., Badcock, 39. Grundner, C., Gay, L. M., and Alber, T. (2005) Protein Sci. 14, 1918–1921 K., Basham, D., Brown, D., Chillingworth, T., Connor, R., Davies, R., Dev- 40. Alderwick, L. J., Molle, V., Kremer, L., Cozzone, A. J., Dafforn, T. R., Besra, lin, K., Feltwell, T., Gentles, S., Hamlin, N., Holroyd, S., Hornsby, T., Jagels, Proc. Natl. Acad. Sci. U. S. A. 103, K., Krogh, A., McLean, J., Moule, S., Murphy, L., Oliver, K., Osborne, J., G. S., and Futterer, K. (2006) 2558–2563 Quail, M. A., Rajandream, M. A., Rogers, J., Rutter, S., Seeger, K., Skelton, 41. Grangeasse, C., Obadia, B., Mijakovic, I., Deutscher, J., Cozzone, A. J., and J., Squares, R., Squares, S., Sulston, J. E., Taylor, K., Whitehead, S., and Doublet, P. (2003) J. Biol. Chem. 278, 39323–39329 Barrell, B. G. (1998) Nature 393, 537–544 42. Duran, R., Villarino, A., Bellinzoni, M., Wehenkel, A., Fernandez, P., Boi- 13. Peirs, P., De Wit, L., Braibant, M., Huygen, K., and Content, J. (1997) Eur. tel, B., Cole, S. T., Alzari, P. M., and Cervenansky, C. (2005) Biochem. J. Biochem. 244, 604–612 Biophys. Res. Commun. 333, 858–867 14. Av-Gay, Y., Jamil, S., and Drews, S. J. (1999) Infect. Immun. 67, 5676–5682 43. Slayden, R. A., and Barry, C. E., 3rd. (2002) Tuberculosis (Edinb.) 82, 15. Molle, V., Girard-Blanc, C., Kremer, L., Doublet, P., Cozzone, A. J., and 149–160 Prost, J. F. (2003) Biochem. Biophys. Res. Commun. 308, 820–825 44. Bhatt, A., Kremer, L., Dai, A. Z., Sacchettini, J. C., and Jacobs, W. R., Jr. 16. Chaba, R., Raje, M., and Chakraborti, P. K. (2002) Eur. J. Biochem. 269, (2005) J. Bacteriol. 187, 7596–7606 1078–1085 45. Ojha, A., Anand, M., Bhatt, A., Kremer, L., Jacobs, W. R., Jr., and Hatfull, 17. Chopra, P., Singh, B., Singh, R., Vohra, R., Koul, A., Meena, L. S., Koduri, G. F. (2005) Cell 123, 861–873 H., Ghildiyal, M., Deol, P., Das, T. K., Tyagi, A. K., and Singh, Y. (2003) 46. Shawver, L. K., Slamon, D., and Ullrich, A. (2002) Cancer Cell 1, 117–123 Biochem. Biophys. Res. Commun. 311, 112–120 47. Walburger, A., Koul, A., Ferrari, G., Nguyen, L., Prescianotto-Baschong, 18. Boitel, B., Ortiz-Lombardia, M., Duran, R., Pompeo, F., Cole, S. T., Cerve- C., Huygen, K., Klebl, B., Thompson, C., Bacher, G., and Pieters, J. (2004) nansky, C., and Alzari, P. M. (2003) Mol. Microbiol 49, 1493–1508 Science 304, 1800–1804

OCTOBER 6, 2006•VOLUME 281•NUMBER 40 JOURNAL OF BIOLOGICAL CHEMISTRY 30103