Dated Phylogeny and Biogeography of the Eurasian Allium Section Rhizirideum (Amaryllidaceae)
Total Page：16
File Type：pdf, Size：1020Kb
Plant Syst Evol DOI 10.1007/s00606-016-1333-3 ORIGINAL ARTICLE Dated phylogeny and biogeography of the Eurasian Allium section Rhizirideum (Amaryllidaceae) 1 2 2 Tatiana A. Sinitsyna • Tobias Herden • Nikolai Friesen Received: 25 February 2016 / Accepted: 4 July 2016 Ó Springer-Verlag Wien 2016 Abstract Allium section Rhizirideum constitutes a group Introduction of approximately 24 species, distributed mostly in steppe areas of the Eurasian temperate zone. Its phylogenetic The testing of the congruence of species phylogenies and relationships are therefore relevant for understanding of the landscape evolution has been greatly enhanced by molec- evolutionary and biogeographical patterns of the Eurasian ular markers. During the last two decades, such phylo- steppes. Based upon DNA sequences from two plastid geographic studies analysed species histories for many regions (trnQ-rps16 and trnL-rpl32) and the internal tran- parts of the world and have helped us to understand veg- scribed spacer region of nuclear ribosomal DNA, the etation dynamics under changing climate conditions (see, phylogenetic relationships in Allium section Rhizirideum for example, Taberlet et al. 1998; Avise 2000; Hewitt are investigated by using maximum parsimony and Baye- 2001; Stehlick et al. 2002; Schmitt 2007;Nu¨rk et al. 2015). sian inference. Dated phylogenies revealed (1) that diver- Phylogeographic analyses of Eurasian steppe plants are sification started in the upper Pliocene and further largely missing. Some recent studies on Brassicaceae speciation events occurred during the Pleistocene and (2) a (Franzke et al. 2004; Hurka et al. 2012; Friesen et al. 2015), clear division of the section Rhizirideum into an ‘‘Asiatic’’ Allium taxa (Seregin et al. 2015; Herden et al. 2016), and ‘‘European’’ geographical group. Nomenclature, dis- however, highlight the importance of those studies for tribution maps and identification key for all species are understanding species history in the light of climate– provided. Origin and diversification within this section thus landscape dynamics. reflect the development and history of the modern Eurasian Allium L. is one of the largest genera of monocots. steppe. Currently, the number of species within the genus is esti- mated at 920 (Seregin et al. 2015). In this paper, we present Keywords Allium Á Dated phylogeny Á ITS Á Polyploidy Á a revision of the section Rhizirideum G.Don ex Rhizirideum Á Taxonomy Á trnL-rpl32 Á trnQ-rps16 W.D.J.Koch as described by Friesen et al. (2006). The phylogeny of the genus based on ITS sequences is resolved on subgeneric and sectional levels (Friesen et al. 2006;Li et al. 2010), but only little is known about taxonomic and Handling editor: Livia Wanntorp. genetic diversity within the established sections. According to a recent phylogeny and classification of the whole genus Electronic supplementary material The online version of this article (doi:10.1007/s00606-016-1333-3) contains supplementary Allium, section Rhizirideum is a strong monophyletic unit material, which is available to authorized users. (Friesen et al. 2006; Li et al. 2010) consisting of a group of 24 very closely related species. This monophyletic section & Nikolai Friesen is part of the third of three evolutionary lines of Allium [email protected] (Fritsch 2001; Fritsch and Friesen 2002; Friesen et al. 1 Altai State University, Lenina Pr. 61, Barnaul, Russia 656049 2006; Li et al. 2010). The phylogeny of the section is 2 Botanical Garden of the Osnabrueck University, Albrechtstr. complicated because of morphological diversity and 29, 49076 Osnabru¨eck, Germany hybridisation involving polyploidy (Friesen 1988, 1992; 123 T. A. Sinitsyna et al. Kamelin 2004). Allium section Rhizirideum is the typical (trnQ-rps16 and rpl32-trnL spacers), performed phyloge- section of subgenus Rhizirideum (G.Don ex W.D.J.Koch) netic analyses, and estimated divergence times by a Wendelbo and characterised by having bulbs enclosed in Bayesian approach. For the first time, we also compiled membranous tunics and attached to horizontal rhizomes, a distribution maps of all Allium species of the section leaf shape ranging from hemicylindrical to plain, and a Rhizirideum. flower colour from white to purple. Section Rhizirideum includes 24 species (Table 1) and is widely distributed from Europe to East Asia. There is a distinct narrowing of Materials and methods the distribution area east of the Ural Mountains approxi- mately along 708 eastern longitude. Most species of section Plant material Rhizirideum are distributed in temperate Asia (Allium austrosibiricum N.Friesen, A. azutavicum Kotukhov, A. Eighty-nine accessions of 19 different taxa of the section burjaticum N. Friesen, A. chiwui Wang & Tang, A. minus were included in the analysis (Table 1). Herbarium mate- (S.O.Yu, S.Lee & W.Lee) H.J.Choi & B.U.Oh, A. nutans rial from several herbaria (OSBU, WIR, MW, LE, ALTB, L., A. prostratum Trev., A. pseudosenescens H.J.Choi & NS, NSK, GAT) and living plants from the Botanical B.U.Oh, A. rubens Schrad. ex Willd., A. senescens L. Garden of Osnabrueck University were used. Voucher including A. senescens subsp. glaucum (Regel) Dostal, A. information and EMBL/GenBank accession numbers are spirale Willd., A. spurium G.Don, A. stellerianum Willd., listed in Table 1. From two species of section Rhizirideum A. taishanense J.M.Xu, A. tuvinicum (N.Friesen) N.Friesen, (Allium taishanense and A. chiwui), we have seen the A. tytthocephalum Schult. & Schult.f., and probably A. herbarium material (PE) but could not get proper material brevidentatum F.Z.Li). Four species (A. denudatum F.De- for sequencing. For Allium brevidentatum, we could not laroche, A. czelghauricum Bordz., A. incensiodorum Radic find any herbarium material or illustration. A. lusitanicum Lam. and A. pseudoalbidum N.Friesen & O¨ zhatay) occur in Europe (including Caucasus), but only Geographical distribution two species are common in Europe and reach Western Siberia (later denominated as European species: A. angu- We compiled distribution maps from the literature and losum L., A. flavescens Besser (Barkalov 1987; Friesen online databases (references are given in Online Resource 1987, 1988, 1995; Friesen and Hermann 1998; Xu and 2) and from herbarium surveys, including our own field Kamelin 2000; Choi and Oh 2010; Li et al. 2010; Choi collections. Published data were critically evaluated by 2015; Koldaeva 2015). The centre of species diversity is reference to herbarium material deposited in: ALTB; B; G; situated in the mountain steppes of South Siberia and GAT; HAL; FR; JE; K; LE; M; MNA; MW; NS; NSK; Mongolia (distribution maps Fig. 1a–d). OSBU; P; PE; SVER; TK; UBA; UBU; and WIR. The species of the section Rhizirideum share a basic chromosome number of x = 8, and the karyotypes are Molecular methods mostly similar. Four ploidy levels were found: di-, tetra-, penta- and hexaploids (Bolkhovskikh et al. 1969; DNA was isolated with the NucleoSpin Plant kit (Macherey– IPCN = Goldblatt and Johnson 1979–2016; Krogulevich Nagel, Dueren, Germany) according to the instructions of the and Rostovtseva 1984; Friesen 1988; Agapova et al. 1990). manufacturer (www.macherey-nagel.com). Isolated DNAs There are many publications concerning chromosome were used directly in PCR amplifications. numbers in each Allium species from section Rhizirideum For the most samples, the nrDNA ITS regions (ITS 1, (see Online Resource 1 for published counts and refer- 5.8S nrDNA subunit, ITS 2) were amplified using the ences). Our own counts are presented in Table 1. primers ITS A and ITS B. When amplification of the Additionally, the nomenclature is confusing, which may complete ITS region was not possible, we used a primer be explained by similar morphology of some species and combination of ITS A and ITS C and ITS D with 26R the disappearance of many morphological characters in the (Blattner 1999). In some cases, we applied a 5.8S primer voucher specimens in herbaria. specific for section Rhizirideum newly designed by us The aim of our work is to explore phylogenetic rela- (Rhiz ITS 5.8r—50 TAGAATGACGCAAGGCATGA 30 tionships as well as evolutionary and phylogeographic and Rhiz 5.8F Primer—50 CATCGAGTCTTTGAATGC events among Rhizirideum species. This problem can only AAGT 30). be appropriately addressed by reconstructing phylogenetic Amplifications were carried out in 30 lL reaction mix, relationships within Rhizirideum, covering most of the which included 1 unit Taq DNA polymerase, 3 lL109 species of the section. We sequenced the nuclear ribosomal reaction buffer (Boehringer, Mannheim, Germany), DNA ITS region and two noncoding chloroplast DNA parts 0.8 mM of each dNTPs, 0.4 lM of each primer and 5 ng of 123 Phylogeny and biogeography of Table 1 Allium specimens used in the study Accession Taxon 2n Origin Voucher trnL-rpl32 trnQ-rps16 ITS Rz65 A. angulosum 16 N KAZAKHSTAN: vill. Kievskoe GAT 2778 – – AJ250287 Rz1 A. angulosum 16 LITHUANIA BOGOS 07-26-0074-20 – – AM949598 Rz2 A. angulosum 16 LITHUANIA BOGOS 07-26-0072-20 HE603136 HE601771 LN867001 Rz14 A. angulosum 16 POLAND: Grodek [BG Lublin] BOGOS 05-18-0002-50 LN867020 LN867046 AM949629 Am184 A. angulosum 16 RUSSIA: Altai, Barnaul BOGOS 09-41-0002-20 LN867021 LN867047 LN867002 * A. angulosum Ricroch A. et al. GAT 0534 – – AY427532 Rz109 A. anisopodium 16 MONGOLIA: Aimak Chentij, Zargalant-Chan GAT 2349 HE603142 HE601765 AJ411847 Allium Rz6 A. austrosibiricum 16 RUSSIA: Tuva, Chadan BOGOS 06-31-0098-20 LN867022 LN867048 AM949599 Rz7 A. austrosibiricum 16 RUSSIA: Tuva, Chorumnug-Oi River, Chondergej pass BOGOS 06-31-0094-20 – – AM949613 sect. Rz8 A. austrosibiricum 16 RUSSIA: Tuva, Sagly River, West Tannu-Ola BOGOS 06-31-0113-20 LN867023 LN867049 AM949630 Rhizirideum Rz39 A. austrosibiricum 16 RUSSIA: Tuva, Mogen-Buren River OSBU 17890 HE603130 HE601778 AM949624 Rz58 A. austrosibiricum 16 RUSSIA: Tuva, Ersin, Sayan range GAT 2747 – – AJ411832 Rz85 A. austrosibiricum 16 RUSSIA: Altai, Talduair range, Sailjugem BOGOS 06-31-0118-20 – – AM949639 Rz66 A. austrosibiricum 16 RUSSIA: Tuva, Chadan BOGOS 06-31-0097-20 AM949612 Am658 A.