Dated Phylogeny and Biogeography of the Eurasian Allium Section Rhizirideum (Amaryllidaceae)

Plant Syst Evol DOI 10.1007/s00606-016-1333-3

ORIGINAL ARTICLE

Dated phylogeny and biogeography of the Eurasian Allium section Rhizirideum (Amaryllidaceae)

1 2 2 Tatiana A. Sinitsyna • Tobias Herden • Nikolai Friesen

Received: 25 February 2016 / Accepted: 4 July 2016 Ó Springer-Verlag Wien 2016

Abstract Allium section Rhizirideum constitutes a group Introduction of approximately 24 species, distributed mostly in steppe areas of the Eurasian temperate zone. Its phylogenetic The testing of the congruence of species phylogenies and relationships are therefore relevant for understanding of the landscape evolution has been greatly enhanced by molec- evolutionary and biogeographical patterns of the Eurasian ular markers. During the last two decades, such phylo- steppes. Based upon DNA sequences from two plastid geographic studies analysed species histories for many regions (trnQ-rps16 and trnL-rpl32) and the internal tran- parts of the world and have helped us to understand veg- scribed spacer region of nuclear ribosomal DNA, the etation dynamics under changing climate conditions (see, phylogenetic relationships in Allium section Rhizirideum for example, Taberlet et al. 1998; Avise 2000; Hewitt are investigated by using maximum parsimony and Baye- 2001; Stehlick et al. 2002; Schmitt 2007;Nu¨rk et al. 2015). sian inference. Dated phylogenies revealed (1) that diver- Phylogeographic analyses of Eurasian steppe plants are sification started in the upper Pliocene and further largely missing. Some recent studies on Brassicaceae speciation events occurred during the Pleistocene and (2) a (Franzke et al. 2004; Hurka et al. 2012; Friesen et al. 2015), clear division of the section Rhizirideum into an ‘‘Asiatic’’ Allium taxa (Seregin et al. 2015; Herden et al. 2016), and ‘‘European’’ geographical group. Nomenclature, dis- however, highlight the importance of those studies for tribution maps and identification key for all species are understanding species history in the light of climate– provided. Origin and diversification within this section thus landscape dynamics. reflect the development and history of the modern Eurasian Allium L. is one of the largest genera of monocots. steppe. Currently, the number of species within the genus is estimated at 920 (Seregin et al. 2015). In this paper, we present Keywords Allium Á Dated phylogeny Á ITS Á Polyploidy Á a revision of the section Rhizirideum G.Don ex Rhizirideum Á Taxonomy Á trnL-rpl32 Á trnQ-rps16 W.D.J.Koch as described by Friesen et al. (2006). The phylogeny of the genus based on ITS sequences is resolved on subgeneric and sectional levels (Friesen et al. 2006;Li et al. 2010), but only little is known about taxonomic and Handling editor: Livia Wanntorp. genetic diversity within the established sections. According to a recent phylogeny and classification of the whole genus Electronic supplementary material The online version of this article (doi:10.1007/s00606-016-1333-3) contains supplementary Allium, section Rhizirideum is a strong monophyletic unit material, which is available to authorized users. (Friesen et al. 2006; Li et al. 2010) consisting of a group of 24 very closely related species. This monophyletic section & Nikolai Friesen is part of the third of three evolutionary lines of Allium [email protected] (Fritsch 2001; Fritsch and Friesen 2002; Friesen et al. 1 Altai State University, Lenina Pr. 61, Barnaul, Russia 656049 2006; Li et al. 2010). The phylogeny of the section is 2 Botanical Garden of the Osnabrueck University, Albrechtstr. complicated because of morphological diversity and 29, 49076 Osnabruëck, Germany hybridisation involving polyploidy (Friesen 1988, 1992; 123 T. A. Sinitsyna et al.

Kamelin 2004). Allium section Rhizirideum is the typical (trnQ-rps16 and rpl32-trnL spacers), performed phyloge- section of subgenus Rhizirideum (G.Don ex W.D.J.Koch) netic analyses, and estimated divergence times by a Wendelbo and characterised by having bulbs enclosed in Bayesian approach. For the first time, we also compiled membranous tunics and attached to horizontal rhizomes, a distribution maps of all Allium species of the section leaf shape ranging from hemicylindrical to plain, and a Rhizirideum. flower colour from white to purple. Section Rhizirideum includes 24 species (Table 1) and is widely distributed from Europe to East Asia. There is a distinct narrowing of Materials and methods the distribution area east of the Ural Mountains approximately along 708 eastern longitude. Most species of section Plant material Rhizirideum are distributed in temperate Asia (Allium austrosibiricum N.Friesen, A. azutavicum Kotukhov, A. Eighty-nine accessions of 19 different taxa of the section burjaticum N. Friesen, A. chiwui Wang & Tang, A. minus were included in the analysis (Table 1). Herbarium mate- (S.O.Yu, S.Lee & W.Lee) H.J.Choi & B.U.Oh, A. nutans rial from several herbaria (OSBU, WIR, MW, LE, ALTB, L., A. prostratum Trev., A. pseudosenescens H.J.Choi & NS, NSK, GAT) and living plants from the Botanical B.U.Oh, A. rubens Schrad. ex Willd., A. senescens L. Garden of Osnabrueck University were used. Voucher including A. senescens subsp. glaucum (Regel) Dostal, A. information and EMBL/GenBank accession numbers are spirale Willd., A. spurium G.Don, A. stellerianum Willd., listed in Table 1. From two species of section Rhizirideum A. taishanense J.M.Xu, A. tuvinicum (N.Friesen) N.Friesen, (Allium taishanense and A. chiwui), we have seen the A. tytthocephalum Schult. & Schult.f., and probably A. herbarium material (PE) but could not get proper material brevidentatum F.Z.Li). Four species (A. denudatum F.De- for sequencing. For Allium brevidentatum, we could not laroche, A. czelghauricum Bordz., A. incensiodorum Radic find any herbarium material or illustration. A. lusitanicum Lam. and A. pseudoalbidum N.Friesen & O¨ zhatay) occur in Europe (including Caucasus), but only Geographical distribution two species are common in Europe and reach Western Siberia (later denominated as European species: A. angu- We compiled distribution maps from the literature and losum L., A. flavescens Besser (Barkalov 1987; Friesen online databases (references are given in Online Resource 1987, 1988, 1995; Friesen and Hermann 1998; Xu and 2) and from herbarium surveys, including our own field Kamelin 2000; Choi and Oh 2010; Li et al. 2010; Choi collections. Published data were critically evaluated by 2015; Koldaeva 2015). The centre of species diversity is reference to herbarium material deposited in: ALTB; B; G; situated in the mountain steppes of South Siberia and GAT; HAL; FR; JE; K; LE; M; MNA; MW; NS; NSK; Mongolia (distribution maps Fig. 1a–d). OSBU; P; PE; SVER; TK; UBA; UBU; and WIR. The species of the section Rhizirideum share a basic chromosome number of x = 8, and the karyotypes are Molecular methods mostly similar. Four ploidy levels were found: di-, tetra-, penta- and hexaploids (Bolkhovskikh et al. 1969; DNA was isolated with the NucleoSpin Plant kit (Macherey– IPCN = Goldblatt and Johnson 1979–2016; Krogulevich Nagel, Dueren, Germany) according to the instructions of the and Rostovtseva 1984; Friesen 1988; Agapova et al. 1990). manufacturer (www.macherey-nagel.com). Isolated DNAs There are many publications concerning chromosome were used directly in PCR amplifications. numbers in each Allium species from section Rhizirideum For the most samples, the nrDNA ITS regions (ITS 1, (see Online Resource 1 for published counts and refer- 5.8S nrDNA subunit, ITS 2) were amplified using the ences). Our own counts are presented in Table 1. primers ITS A and ITS B. When amplification of the Additionally, the nomenclature is confusing, which may complete ITS region was not possible, we used a primer be explained by similar morphology of some species and combination of ITS A and ITS C and ITS D with 26R the disappearance of many morphological characters in the (Blattner 1999). In some cases, we applied a 5.8S primer voucher specimens in herbaria. specific for section Rhizirideum newly designed by us The aim of our work is to explore phylogenetic rela- (Rhiz ITS 5.8r—50 TAGAATGACGCAAGGCATGA 30 tionships as well as evolutionary and phylogeographic and Rhiz 5.8F Primer—50 CATCGAGTCTTTGAATGC events among Rhizirideum species. This problem can only AAGT 30). be appropriately addressed by reconstructing phylogenetic Amplifications were carried out in 30 lL reaction mix, relationships within Rhizirideum, covering most of the which included 1 unit Taq DNA polymerase, 3 lL109 species of the section. We sequenced the nuclear ribosomal reaction buffer (Boehringer, Mannheim, Germany), DNA ITS region and two noncoding chloroplast DNA parts 0.8 mM of each dNTPs, 0.4 lM of each primer and 5 ng of 123 hlgn n igorpyof biogeography and Phylogeny Table 1 Allium specimens used in the study Accession Taxon 2n Origin Voucher trnL-rpl32 trnQ-rps16 ITS

Rz65 A. angulosum 16 N KAZAKHSTAN: vill. Kievskoe GAT 2778 – – AJ250287 Rz1 A. angulosum 16 LITHUANIA BOGOS 07-26-0074-20 – – AM949598 Rz2 A. angulosum 16 LITHUANIA BOGOS 07-26-0072-20 HE603136 HE601771 LN867001 Rz14 A. angulosum 16 POLAND: Grodek [BG Lublin] BOGOS 05-18-0002-50 LN867020 LN867046 AM949629 Am184 A. angulosum 16 RUSSIA: Altai, Barnaul BOGOS 09-41-0002-20 LN867021 LN867047 LN867002 * A. angulosum Ricroch A. et al. GAT 0534 – – AY427532 Rz109 A. anisopodium 16 MONGOLIA: Aimak Chentij, Zargalant-Chan GAT 2349 HE603142 HE601765 AJ411847 Allium Rz6 A. austrosibiricum 16 RUSSIA: Tuva, Chadan BOGOS 06-31-0098-20 LN867022 LN867048 AM949599 Rz7 A. austrosibiricum 16 RUSSIA: Tuva, Chorumnug-Oi River, Chondergej pass BOGOS 06-31-0094-20 – – AM949613 sect.

Rz8 A. austrosibiricum 16 RUSSIA: Tuva, Sagly River, West Tannu-Ola BOGOS 06-31-0113-20 LN867023 LN867049 AM949630 Rhizirideum Rz39 A. austrosibiricum 16 RUSSIA: Tuva, Mogen-Buren River OSBU 17890 HE603130 HE601778 AM949624 Rz58 A. austrosibiricum 16 RUSSIA: Tuva, Ersin, Sayan range GAT 2747 – – AJ411832 Rz85 A. austrosibiricum 16 RUSSIA: Altai, Talduair range, Sailjugem BOGOS 06-31-0118-20 – – AM949639 Rz66 A. austrosibiricum 16 RUSSIA: Tuva, Chadan BOGOS 06-31-0097-20 AM949612 Am658 A. austrosibiricum 16 RUSSIA: Tuva, Cham-Dyt River OSBU 21917 LN867024 LN867050 LN867003 Am659 A. austrosibiricum 16 RUSSIA: Altai, Chulyshman River OSBU 23769 LN867025 LN867051 LN867004 Am660 A. austrosibiricum 16 RUSSIA: Altai, Katun OSBU 21690 LN867026 LN867052 LN867005 Rz15 A. azutavicum – E KAZAKHSTAN: S Altai, Azutau range OSBU 23352 HE603121 HE601775 AM949600 Rz16 A. burjaticum 32 RUSSIA: Tuva, v. Balgazyn ALTB HE603131 HE601768 AM949601 Rz17 A. burjaticum 32 MONGOLIA: Central Mongolian Altai, Cerch-ul, NE Delun GAT 1688 LN867027 LN867053 AM949602 Rz61 A. denudatum 16 GEORGIA: Caucasus range, Chevsuretia, Mutso GAT 1977 – – AJ411892 Rz56 A. denudatum 16 NE TURKEY [USA: Pepperell, M. McDonough] GAT 3470 – – AJ411954 Am675 A. denudatum 16 RUSSIA: North Caucasus BOGOS 07-40-0003-20 LN867028 LN867054 LN867006 Rz44 A. denudatum 16 SERBIA, Deliblatska Pescara [AUSTRIA: BG Graz] GAT 3765 HE603138 HE601770 AJ411841 Rz3 A. flavescens 16 N KAZAKHSTAN: vill.Kievskoe BOGOS 01-17-0199-10 – – AJ411842 Rz19 A. flavescens 16 RUSSIA: Voronezhskaja obl., Divnogorje, v.Seljavna WIR HE603137 HE601769 AM949603 Am663 A. flavescens 16 RUSSIA: Rostov-on-Don BOGOS 08-28-0003-50 LN867029 LN867055 LN867007 Rz5 A. incensiodorum 16 CROATIA: BG Graz BOGOS 00-36-0010-80 HE603141 HE601773 AJ411866 Rz57 A. lusitanicum 32 GERMANY: Harz, Benzingerode GAT 2927 – – AJ411831 Rz37 A. lusitanicum 32 ROMANIA: Muntele, Parau GAT 3877 HE603139 HE601772 AM949606 Rz38 A. lusitanicum 32 FRANCE: Alpes, Villard de Lane OSBU 21079 HE603140 HE601774 AM949607 Am666 A. lusitanicum 32 SWITZERLAND, Lac de Neuchatel OSBU 22168 LN867030 LN867056 LN867008 Am678 A. lusitanicum 32 AUSTRIA BOGOS 05-30-0005-20 LN867031 LN867057 LN867009 123 * A. lusitanicum Dubouzet J.G., Shinoda K. – – – AF037623 * A. lusitanicum Ricroch A. et al. GAT 0363 – – AY427541 * A. lusitanicum Ricroch A. et al. HRIGRU 8027 – – AY427551 123 Table 1 continued Accession Taxon 2n Origin Voucher trnL-rpl32 trnQ-rps16 ITS

Rz26 A. minus S KOREA: Prov.Injegun, Wolhaksanri [Kyangpok University Garden] GAT HE603133 HE601786 AM949621 * A. minus Gangwon, Korea KH 080063 – – GQ412218 Rz54 A. nutans 32 RUSSIA: Novosibirsk GAT 3184 – – AM949608 Rz9 A. nutans 32 RUSSIA: Altai Republic, left bank of Katun River, Oroktoj River BOGOS 06-31-0123-20 HE603125 HE601766 AM949631 Am664 A. nutans RUSSIA: Krasnoyarsk Krai OSBU 22091 LN867032 LN867058 LN867010 Am665 A. nutans 32 RUSSIA: Altai, Ust-Koksa OSBU 18725 LN867033 LN867059 LN867011 Rz11 A. nutans 32 RUSSIA: Altaiskij kraj BOGOS 07-26-0023-20 – – AM949627 Rz20 A. prostratum 16 MONGOLIA: Tumencogt mountain, Aimak Suchbaatar GAT 2357 HE603134 HE601782 LN867013 Rz21 A. cf. prostratum RUSSIA: Jakutia, Lena River basin, Buotam River, region « Diring-Jur’akh » WIR – – AM949604 Rz22 A. cf. prostratum 16 RUSSIA: Jakutia, Amga River, vill.Onees GAT 3075 HE603129 HE601783 AM949605 Am655 A. cf. prostratum RUSSIA: Jakutia, Lena River, vill.Bestjach WIR 620111 LN867034 LN867060 LN867012 Rz75 A. prostratum 16 MONGOLIA: Arhangai Tsenher, South Tanir River OSBU 21102 LN867035 LN867061 AM949634 Am677 A. prostratum 16 MONGOLIA: Hentey, OSBU 20424 LN867036 LN867062 LN867014 Rz83 A. prostratum 16 MONGOLIA: Gobi-Altai, National Park « Gurwan Sayhany Nuruu» OSBU 11888 – – AM949638 * A. pseudosenescens 32 Heilongjiang,, China KH 080199 – – GQ412222 Rz41 A. rubens 16 RUSSIA: Altai, conﬂuence of rivers Chuja-Katun OSBU13447 HE603135 HE601776 AM949614 Rz42 A. rubens 16 RUSSIA: Tuva, Mogen-Buren River OSBU18130 LN867037 LN867063 AM949615 Rz60 A. rubens 16 RUSSIA: Altai mountains, Sailugem GAT 3401 – – AJ411891 Rz62 A. rubens KAZAKHSTAN: Temirtau GAT 1609 – – AJ411904 Rz68 A. rubens 16 RUSSIA: Altai mountains, Sailugem range, mountain Chernaja OSBU 13247 LN867038 LN867064 AM949616 Rz69 A. rubens 16 RUSSIA: Altai Republic, Altai mountains, Belyi Bom BOGOS 02-36-0039-10 AM949617 Rz70 A. rubens 16 RUSSIA: Altai Republic, Bugusun BOGOS 06-31-0117-20 – – AM949618 Rz71 A. rubens 16 RUSSIA: Altai Republic, Taldinsky pass BOGOS 06-31-0121-20 – – AM949619 Rz24 A. senescens 48 RUSSIA: Buryatia, Lake Gusinoe GAT 2750 HE603123 HE601781 AJ411834 subsp. senescens Rz25 A. senescens RUSSIA: Amur area, Mukhinka WIR HE603122 HE601784 AM949620 subsp. senescens Rz51 A. senescens 48 RUSSIA: Buryatia, vill.Udunga NS – – AM949625 subsp. senescens. Am661 A. senescens 48 MONGOLIA: Hentey Mnt. OSBU 20336 LN867039 LN867065 LN867015 subsp. senescens al. et Sinitsyna A. T. * A. senescens Ricroch A. et al. HRIGRU 1256 – – AY427548 * A. senescens H.J.Choi et al. CBU 010009 – – GQ412236 * A. senescens H.J.Choi KH 070001 – – GQ412235 Rz45 A. senescens 32 RUSSIA: Tuva, Ersin, Samagaltai LE HE603124 HE601777 AM949636 subsp.glaucum hlgn n igorpyof biogeography and Phylogeny Table 1 continued Accession Taxon 2n Origin Voucher trnL-rpl32 trnQ-rps16 ITS

Rz4 A. spirale 32 N KOREA: Prov. S-Hwanghe [BG Wonsan] GAT 1968 LN867040 LN867066 AJ411833 Rz10 A. spirale 16 RUSSIA: Primorye Territory, vill.Glazkovka [BG-Institute] BOGOS 02-29-0053-10 – – AM949626 Rz12 A. spirale 16 RUSSIA: Primorye Territory, vill.Mramorny [BG-Institute] BOGOS 04-33-0056-10 HE603126 HE601767 AM949628 * A. spirale CHINA: Jilin CBU 23-060902-007 – – GQ412237 * A. spirale H.J.Choi, J.W.Han KH 070012 – – GQ412238 * A. spirale Ricroch A. et al. CGN 15758 – – AY427549 Rz27 A. spurium SOUTH KOREA: Prov. Zhekhe, Sun Jaun LE – – AM949622 Allium Rz28 A. spurium 32 RUSSIA: Chita area, Tungiro-Olekminskij region ALTB HE603127 HE601785 AM949623 Rz77 A. spurium 32 RUSSIA: Chita area, Tungiro-Olekminskij region, Tungir River ALTB – – AM949635 sect.

Rz79 A. spurium RUSSIA: Zabajkalje, Onona River basin, Bukukun River, vill.Bukukunskij LE – – AM949637 Rhizirideum Am656 A. spurium 32 MONGOLIA: Hentey, river Uldsa-Gol OSBU 20426 LN867041 LN867067 LN867016 Am657 A. spurium 32 E MONGOLIA: Dornod Aimag OSBU 20563 LN867042 LN867068 LN867017 * A. spurium H.J.Choi, J.W.Han KH 070033 – – *GQ412242 Rz29 A. stellerianum RUSSIA: Krasnojarskij kraj, Sharypovskij r-on, lake Alabuga LE – – – Rz33 A. stellerianum 32 RUSSIA: Mukhor, Lake Baikal BOGOS 01-17-0200-10 HE603128 HE601780 AJ411963 Am667 A. stellerianum 32 RUSSIA: Khakasia, Bograd OSBU 22056 LN867043 LN867069 LN867018 Rz59 A. tuvinicum 16 RUSSIA: Tuva, Ersin, Sayan range GAT 2744 – – AJ411853 Rz87 A. tuvinicum 16 RUSSIA: Tuva, Mogen-Buren River BOGOS 06-31-0070-20 LN867044 LN867070 AM949609 Rz47 A. tuvinicum 16 RUSSIA: Tuva, Chadan BOGOS 06-31-0100-20 HE603132 HE601779 AM949611 Rz67 A. tuvinicum 16 RUSSIA: Tuva, West Tannu-Ola Mts, Sagly River BOGOS 06-31-0112-20 – – AM949610 Rz35 A. tytthocephalum RUSSIA: Tuva, Tsagan-Shibetu Mts, Barlyk River basin ALTB – – AM949633 Rz82 A. tytthocephalum 32 MONGOLIA: Middle Gobi-Altai OSBU 11921 LN867045 LN867071 AM949632 The origin of specimen (country, location and botanical garden in square brackets) is represented. Asterisks represent accessions taken from Genbank 123 T. A. Sinitsyna et al. total DNA, in a PTC-100 Peltier Thermal Cycler using the different ITS types in the same nucleus. To analyse the program ITS-2: 95 °C for 2 min. [95 °C for 20 s., 55 °C inﬂuence of polyploid taxa on our phylogenetic recon- for 30 s., 70 °C for 3 min.]930,70°C for 7 min., 4.0 °C struction, we excluded all polyploid species from the until the end of the process. analysis. Primers for the chloroplast regions trnQ-5-rps16 and Incongruence between the ITS and the combined plastid trnL-rpl32 were described in Shaw et al. (2007), and the data sets and putative hybridisation was analysed using a trnL-intron and trnL-trnF spacer were ampliﬁed using phylogenetic network approach implemented in the soft- primers Tab c, Tab d, Tab e, Tab f (Taberlet et al. 1991). ware DENDROSCOPE 3.2.1 (Huson and Scornavacca PCR was carried out in a PTC-100 Peltier Thermal Cycler 2010, 2012). For that, we built a reduced Bayesian ITS (Biozyme Diagnostics) using the program TRN: [94 °C for consensus tree, which contained the same taxon set as the

1 min., 50 °C for 30 s., 72 °C for 1 min.]930,72°C for combined cpDNA tree. 4 min., 4 °C until the end of the process. The PCR products were purified with the NucleoSpinÒ Extract II kit Estimations of divergence times (Macherey–Nagel, Dueren, Germany) according to the instruction of the manufacturer (www.macherey-nagel. We used BEAST 1.8 to estimate the divergence time of the com). Products of the cycle sequencing reactions were run genera Rhizirideum (Drummond and Rambaut 2007). The on an ABI 377XL automated sequencer or PCR products BEAUti 1.8 interface was used to create the input files for were sent to SeqLab (Go¨ttingen, Germany; www.seqlab. BEAST, and the XML files were adjusted manually if de) for sequencing. necessary. For the estimation, a reduced subset of 14 taxa was Phylogenetic analysis selected (Rz 75 Allium prostratum,Rz26A. minus,Rz22 A. cf prostratum,Rz6A. austrosibiricum,RZ5A. Forward and reverse sequences from every individual incensiodorum,Rz14A. angulosum,Rz56A. denudatum, were manually edited in CHROMAS Lite 2.1 (Techne- Rz 19 A. flavescens,Rz17A. burjaticum,Rz59A. tuvi- sylum Pty Ltd) and combined in single consensus nicum,Am15A. azutavicum,Rz70A. rubens,Rz10A. sequences. The sequences of all samples were aligned spirale, 2349 A. anisopodium). The reduced consensus tree with CLUSTAL X (Jeanmogin et al. 1998), and the of the ITS data obtained with MrBayes 3.2.1 (Ronquist and alignment subsequently corrected manually in MEGA 6 Huelsenbeck 2003) was used as starting tree and inserted (Tamura et al. 2011). manually in the XML files in Newick format. Allium ani- A heuristic search with the tree bisection reconnection sopodium L. [sect. Tenuissima (Tzag.) Hanelt] was used as (TBR) algorithm was conducted for the ITS and combined an out-group according to Friesen et al. (2006). We used chloroplast (rpl32-trnL and rps16) sequences in the evolutionary model HKY ? I selected by Akaike PAUP 9 4.0b10 (Swofford 2002). Bootstrap support (BS) information criterion (AIC) performed by Modeltest 3.7 (Felsenstein 1985) was estimated with 1000 bootstrap (Posada and Crandall 1998) and the uncorrelated lognor- replicates, each with 100 random addition sequence sear- mal relaxed clock. The Yule process was chosen as spe- ches. We evaluated sequence evolution models by the ciation process. Akaike information criterion (AIC) with the aid of Branch length was calibrated using a mean published Modeltest 3.7 (Posada and Crandall 1998) what resulted in ITS substitution rate for herbaceous annual/perennial the HKY ? I model of sequence evolution. Bayesian angiosperms of 4.13 9 10-9 substitutions per site per phylogenetic analyses were performed with MrBayes year (sub/site/yr) (Kay et al. 2006). We set the ucld.mean 3.1.23 (Ronquist and Huelsenbeck 2003). Two independent to a normal distribution, with a mean of 4.13 9 10-9 and runs of two times four chains each, 10 million generations, a standard deviation (SD) of 1.0 9 10-10. Huang et al. sampling trees every 100 generations were performed. (2012) state a lower mean rate of 2.5 9 10-9 sub/site/yr 25 % of the initial trees were discarded as burn-in. The (1.56–3.44 9 10-9 sub/site/yr). Therefore, we also cal- convergence of the MrBayes analyses was checked with culated a tree with an ucld.mean of 2.5 9 10-9 with a SD Tracer 1.5. The remaining 250,000 trees were combined of 6.0 9 10-10. Other parameters were set default. into a single data set, and a phylogenetic tree and posterior Additional runs with empty alignments were carried out probabilities (pp) for clades were calculated in MrBayes to ensure that the priors alone were not determining the 3.1.23. results. Finally, three BEAST runs were performed for Eight analysed species (47 %) were polyploids every substitution rate setting with a MCMC chain length (2n = 32, 40, 48, see Table 1). In the worst case in terms of 108 generations and a sample frequency of every 100 of phylogenetic analysis, these might be allopolyploids generations. The ESS was [200 with a 25 % burn-in for resulting from hybridisation events, thus combining all parameters as confirmed by analysing the output file 123 Phylogeny and biogeography of Allium sect. Rhizirideum

Fig. 1 Distribution maps of Allium species: (a) Allium angulosum, A. senescens subsp. senescens, A. senescens subsp. glaucum;(c) A. brevidentatum, A. denudatum, A. stellerianum, A. spurium, A. spirale; rubens, A. tuvinicum, A. burjaticum, A. azutavicum; and (d) A. (b) A. prostratum, A. lusitanicum, A. ﬂavescens, A. nutans, A. tytthocephalum, A. austrosibiricum, A. pseudoalbidum, A. taisha- incensiodorum, A. czelghauricum, A. chiwui, A. jakuticum, A. nense, A. pseudosenescens, A. minus

with Tracer 1.5. The tree output ﬁles from the runs were credibility tree type was chosen, the mean node height combined with LogCombiner 1.8 and summarised with option was selected, and the posterior probability was set the program TreeAnnotator 1.8. The burn-in was set to to 0.5. The tree was visualised using FigTree 1.4 with 25 % with the aid of Tracer. The maximum clade mean and 95 % HPDs of age estimates.

123 T. A. Sinitsyna et al.

Fig. 1 continued

Results ITS alignment consists of 645 characters (bp): 533 characters are constant, 95 characters are variable but not parsimony Nuclear DNA sequence data: ITS informative, and 17 characters are parsimony informative (Online Resource 3). The length of the 36 shortest trees is 118 The aligned ITS data matrix consisted of 645 characters steps; consistency index (CI) = 0.9831; and retention index across 93 accessions including the outgroup species A. ani- (RI) = 0.9908 (Fig. 2a). sopodium (Table 1). The length of ITS fragments of the The phylogenetic tree of Rhizirideum species based on ITS section’s species is in general 643 base pairs (bp) with ITS sequences shows two distinct groups of species termed as 1 = 238 bp (except for A. burjaticum, A. tuvinicum where ‘‘Asiatic’’ and ‘‘European’’ (Fig. 2a). The ‘‘Asiatic’’ group ITS 1 = 239 bp), 5,8S = 164 bp, and ITS 2 = 241 bp. The (pp 0.95 pp, BS = 68 %) combines species only from Asia;

123 Phylogeny and biogeography of Allium sect. Rhizirideum

Rz41 Rz54 nutans rubens Rz9 nutans Rz82 0.86 1.00 Rz11 nutans tytthocephalum Rz27 89 nutans/spurium Rz68 rubens 62 a Am665 nutans b Am664 nutans Rz42 rubens Am660 austrosibiricum Rz85 0.89 austrosibiricum Rz33 stellerianum Rz8 austrosibiricum 69 Rz66 austrosibiricum Am667 stellerianum Am658 austrosibiricum Rz58 austrosibiricum Rz87 tuvinicum Rz39 ITS austrosibiricum 0.98 CP Rz6 austrosibiricum Rz47 tuvinicum Am659 austrosibiricum Am660 70 Rz7 austrosibiricum austrosibiricum 0.88 Am655 cf prostratum Am659 Rz22 cf prostratum austrosibiricum 67 Rz21 cf prostratum Am658 austrosibiricum 0.95 Rz20 prostratum Rz75 prostratum Rz39 austrosibiricum 59 Am677 prostratum Rz51 0.94 senescens Rz8 austrosibiricum Am667 stellerianum 69 Rz24 senescens Rz6 austrosibiricum Rz33 stellerianum 0.99 Rz29 stellerianum Rz20 prostratum Rz77 spurium Temperate 0.82 78 Rz656 spurium Am677 prostratum AY427548 senescens 55 0.88 Rz83 Rz75 prostratum Asia prostratum 58 Rz26 minus Am661 senescens Rz26 minus GQ412218 minus Rz25 senescens Rz22 cf prostratum Rz16 burjaticum Am655 cf Rz28 spurium prostratum GQ412222 pseudosenescens Rz17 burjaticum Rz657 spurium GQ412235 senescens Rz16 burjaticum Rz12 spirale Rz10 spirale Rz15 azutavicum 0.92 Rz79 spurium 0.98 0.95 GQ412242 spurium Rz45 senescens glaucum 78 64 AY427549 spirale 1.00 68 Rz4 0.97 spirale Am665 nutans GQ412237 spirale 98 -- GQ412236 senescens Am664 nutans GQ412238 spirale 0.88 R45 senescens glaucum Rz9 nutans 68 Rz69 rubens Rz70 rubens Rz24 senescens Rz71 rubens 1.00 Rz62 rubens Am661 senescens 90 Rz60 rubens Section Rz41 rubens Rz25 senescens Rz42 Section Rhizirideum rubens Rz4 Rz68 rubens spirale Rhizirideum Rz67 tuvinicum Rz12 spirale 0.97 Rz47 tuvinicum Rz87 tuvinicum Am657 spurium 1.00 1.00 72 Rz59 tuvinicum Rz17 Am656 1.00 100 81 burjaticum spurium Rz 15 azutavicum 100 Rz82 tytthocephalum Rz28 spurium Rz35 tytthocephalum AY427541 lusitanicum Am675 denudatum Rz5 incensiodorum Rz37 lusitanicum Rz44 denudatum Am678 lusitanicum Am184 angulosum Am663 flavescens Am666 lusitanicum 0.98 Rz57 lusitanicum Europe, North Rz19 flavescens Rz65 67 angulosum Rz2 Rz14 angulosum Kazakhstan angulosum Rz2 angulosum Am184 0.84 AY427532 angulosum angulosum Rz56 denudatum and West Siberia 68 Rz61 Rz14 angulosum denudatum 1.00 AF037623 lusitanicum Rz5 Rz1 angulosum incensiodorum 78 Rz3 flavescens Rz37 lusitanicum Am675 denudatum Rz44 denudatum Am678 lusitanicum Rz19 flavescens Am663 flavescens Am666 lusitanicum Rz38 lusitanicum AY427551 lusitanicum Rz38 lusitanicum 2349 anisopodium 0.1 0.1

123 T. A. Sinitsyna et al. b Fig. 2 Bayesian consensus trees of section Rhizirideum species: the ‘‘European’’ clade A. angulosum, A. denudatum and A. a based on ITS sequences, and b based on combined plastid DNA flavescens form also a subclade with good support. In the sequences. Bayesian posterior probabilities (pp) above branches, bootstrap support (BS, maximum parsimony) over 50 % below ‘‘Asiatic’’ clade, the phylogenetic analysis revealed a basal branches. Out-group is Allium anisopodium from section Tenuissima. polytomy of several well-defined species end clades, but these For origin of accessions, see Table 1 species end clades were not identical to the end clades in the ITS tree (Fig. 2a). Incongruence between the ITS and the combined the second group (pp 0.84, BS = 68 %) is mixed and plastid data sets and putative hybridisation was analysed using a includes representatives from Europe (A. lusitanicum, A. in- phylogenetic network approach implemented in the software censiodorum, A. denudatum) and those distributed also in DENDROSCOPE 3.2.1 (see Online Resource 6). West Siberia (A. angulosum, A. flavescens). The ‘‘Asiatic’’ group revealed a basal polytomy of several well-defined Divergence time estimates species clusters: A. rubens (pp 1.0, BS = 90 %), A. tuvinicum (pp 1.00, BS = 72 %) together with sister species A. azu- Divergence time estimates within the species of the section tavicum (pp 1.0, BS = 81 %) and one group with several Rhizirideum are shown in Fig. 4. Estimated mean ages and unresolved species (A. minus, A. spurium, A. burjaticum, A. 95 % HPDs are presented in the Online Resource 7. The split senescens, A. stellerianum and A. pseudosenescens)along between ‘‘Asian’’ and ‘‘European’’ groups was estimated at with the good supported monophyletic group of A. nutans (pp ca. 3.97 Ma (95 % HPD: 1.13–6.91 Ma), which concurs with 1.0, BS = 89 %) and its sister species A. austrosibiricum (pp Pliocene age. Within the Asian group, the oldest split is 0.89, BS = 69 %). A. prostratum is divided into two geo- between A. austrosibiricum, A. prostratum and A. minus on graphically defined clades: Yakutian accessions indicated as one side and A. spirale, A. rubens, A. tuvinicum and A. azu- cf. prostratum (pp 0.88; BS = 67 %) and Mongolian–Bury- tavicum on the other side (ca. 2.88 Ma, late Pliocene). The atian accessions (pp 0.95; BS = 59 %). Species of the second oldest split-off (ca. 2.27 Ma) in ‘‘Asiatic’’ group is ‘‘European’’ clade were unresolved. between A. rubens with A. spirale and A. azutavicum, A. The alignment of ITS sequences of diploid species tuvinicum and A. burjaticum. Some branching, as, for (2n = 16) and A. anisopodium also consists of 645 characters instance, within Yakutian A. cf. prostratum and A. prostratum (nucleotides): 536 of them are constant, 95 variable characters from Mongolia together with A. minus and A. austrosibir- are not parsimony informative, and 14 characters are parsi- icum, is 1.44 Myr (95 % HPD: 0.18–3.33 Ma) old (Pleis- mony informative (Online Resource 4). The length of the five tocene). Further branching within the ‘‘European’’ clade is of most parsimonious trees is 115 steps (Fig. 3). In comparison rather young age 1.13 Ma (95 % HPD: 0.04–2.95 Ma) with the complete ITS tree, the node support and the sequence (Pleistocene) between the A. incensiodorum—A. angulosum information are slightly better (CI = 0.9339; RI = 0.9835). branch and the A. denudatum–A. flavescens branch. However, the topology differs only within the terminal clades (i.e. within species) and not among the major groups. Discussion Chloroplast DNA sequence data The major groups within section Rhizirideum revealed by We first sequenced the trnL-intron and trnL-trnF spacer the molecular phylogenies (Figs. 3, 4) are supported also from several species of section Rhizirideum (Sinitsyna and by morphology and biogeography. Below, we will discuss Friesen 2008). Sequences of all sequenced species were these clades in more detail. identical (see GenBank accession numbers for trnL-trnF ‘‘Asiatic’’ group: This group of species is consistently spacers: AM949681–AM949696; for trnL-intron found in all our analyses. Some species (A. nutans, A. AM949640–AM949676); therefore, we did not use these austrosibiricum, A. prostratum, A. rubens, A. spirale, A. sequences in the phylogenetic analysis. Aligned trnQ- tuvinicum, A. tytthocephalum) form subclades with good rps16 and trnL-rpl32 spacer data matrices consisted of statistical support (Fig. 2a, b). All diploid species from the 1748 characters across 48 accessions including the out- ‘‘Asiatic’’ group form separate terminal clades with good group species A. anisopodium (Online Resource 5). Of statistical support (Fig. 3) and mostly have isolated distri- these, 1701 characters were constant; 34 variable charac- bution areas in South Siberia in contrast to the polyploid ters were parsimony uninformative and 14 were potentially species, which show a much wider distribution (Friesen parsimony informative. The six most parsimonious trees et al. 1993). This might indirectly confirm the hypothesis of had a length of 54 steps (CI = 0.9259, RI = 0.9762). the hybrid origin of many polyploid species after the Ice Phylogenetic analyses of chloroplast sequences revealed a Age, when the isolated diploid species could meet and better resolved tree than the ITS analyses (Fig. 2b), again with enable the emergence of hybrids (Favarger 1961, 1984; the ‘‘Asiatic’’ and ‘‘European’’ clades as sister groups. Inside Ehrendorfer 1980; Taberlet et al. 1998; Parisod et al. 2010). 123 Phylogeny and biogeography of Allium sect. Rhizirideum

Am660 austrosibiricum Rz85 austrosibiricum Rz8 austrosibiricum Rz66 austrosibiricum 0.89 Am658 austrosibiricum - Rz58 austrosibiricum Rz39 austrosibiricum Rz6 austrosibiricum Am659 austrosibiricum Rz7 austrosibiricum Am655 cf prostratum 0.98 0.97 Rz22 cf prostratum 80 70 Rz21 cf prostratum Rz20 prostratum 0.91 Rz75 prostratum 61 Am677 prostratum Rz83 prostratum Rz26 minus GQ412218 minus Rz69 rubens Rz70 rubens Rz71 rubens Temperate Asia 1.00 Rz62 rubens 0.91 91 Rz60 rubens 89 Rz41 rubens Rz42 rubens Rz68 rubens GQ412238 spirale Rz12 spirale 0.98 Rz10 spirale 80 Rz4 spirale AY427549 spirale GQ412237 spirale Rz59 tuvinicum 1.00 Rz47 tuvinicum 100 0.97 Rz87 tuvinicum 70 Rz67 tuvinicum Rz15 azutavicum Am663 flavescens Rz5 incensiodorum Am184 angulosum Rz65 angulosum Rz14 angulosum Rz2 angulosum AY427532 angulosum 0.83 Rz56 Europe, North Kazakhstan 68 denudatum Rz61 denudatum and West Siberia Rz1 angulosum Rz3 flavescens Am675 denudatum Rz44 denudatum Am705 denudatum Rz19 flavescens 2349 anisopodium 0.1

Fig. 3 ITS Bayesian consensus trees based on diploid species only of below branches. Outgroup is Allium anisopodium from section section Rhizirideum. Bayesian posterior probabilities (pp) above Tenuissima. For origin of accessions see Table 1 branches, bootstrap support (BS, maximum parsimony) over 50 %

123 T. A. Sinitsyna et al.

Fig. 4 Divergence time Rz17 burjaticum estimates within species of the 0.3 N13 section Rhizirideum based on ITS sequences of 14 diploid 1.02 N12 Rz59 taxa. The maximum clade tuvinicum credibility tree from the divergence times estimated with BEAST. Mean divergence time Am15 2.27 azutavicum estimates are shown at the N10 nodes. Node labels are represented in front of each Rz70 rubens node. The 95 % highest 1.56 posterior density (HPD) N11 estimates for each node are represented by bars (exact Rz10 spirale values see Online Resource 7). 2.88 Geological epochs according to N6 international commission on Rz6 austrosibiricum stratigraphy (ICS) 0.56 N9

0.91 Rz26 minus N8

1.44 N7 Rz75 prostratum

3.97 N5

Rz22 cf. prostratum

Rz5 incensiodorum 0.33 N3

7.15 N1 Rz14 angulosum 1.13 N2

Rz56 denudatum 0.32 N4

Rz19 flavescens

2349 anisopodium Miocene Pliocene Pleistocene 12.5 10.0 7.5 5.0 2.5 0

Due to their reticulate structure, hybrid taxa cannot be characters. But the lack of herbarium material and moni- placed correctly in a dichotomous tree and might even toring in nature did not allow determining the taxonomical disturb parts in the phylogenetic tree adjacent to the hybrid rank of these plants at that time (Friesen 1987). In our if mosaic sequences occur (Friesen et al. 2006). In the tree present analysis, three samples of A. prostratum from with all studied taxa, some terminal clades in the ‘‘Asiatic’’ Yakutia (Rz 21, Rz 22 and Am655), marked as A. cf. group are mixed (Fig. 3): One sample of A. spurium (Rz prostratum, build one clade and reliably differ from sam- 27) appears in the A. nutans clade, as well as A. burjaticum ples from Mongolia (pp 0.94, BS = 68 %). These plants (Rz 17) which appears in the A. tuvinicum clade. Probably, differ from the typical Mongolian plants (Vvedensky 1935; this may be caused by polyploidy (2n = 32) and hybrid Friesen 1988) morphologically and will be described below origin of A. nutans and A. burjaticum. as a new species. According to our own earlier observations, A. prostra- On both trees (ITS and plastid), A. senescens subsp. tum plants from the Lena–Kolyma region of Yakutia differ glaucum is placed in some distance to A. senescens subsp. from typical A. prostratum plants by some morphological senescens. On the ITS tree (Fig. 3a), A. senescens subsp.

123 Phylogeny and biogeography of Allium sect. Rhizirideum glaucum is the sister taxa to the A. spirale clade, and on the species appeared: A. lusitanicum in Europe, A. nutans, A. cpDNA tree (Fig. 3b) A. senescens subsp. glaucum toge- senescens, A. stellerianum, A. burjaticum and A. spurium in ther with A. azutavicum builds a relatively well-supported Asia. Separation of the species into the ‘‘European’’ and the clade (pp 0.92; BS = 78 %) and compose an unresolved ‘‘Asiatic’’ groups, approximately along 70° eastern longi- clade with A. nutans and A. senescens subsp. senescens. tude to the east of the Ural Mountains (Figs. 1a, b, 2a, b), Morphological characters of tetraploid A. senescens subsp. corresponds with genetic subdivisions found within other glaucum are closer to diploid A. austrosibiricum than to species of the Eurasian steppe belt (Franzke et al. 2004; tetraploid/hexaploid A. senescens subsp. senescens.This Friesen et al. 2015; Seregin et al. 2015). finding supports similar results of a population analysis (Cheremushkina 2004). Allium minus from Korea and A. azutavicum from south- Nomenclatural conspectus east Kazakhstan need to be studied further because of the poor material hitherto available to us. Sect. Rhizirideum G.Don ex W.D.J.Koch, Syn. Fl. Germ. ‘‘European’’ group: In both (plastid and ITS) trees, the Helv.: 714. 1837. European species formed a separate clade. In the tree Type: Allium senescens L. based on the chloroplast markers, three closely related species (A. angulosum, A. denudatum and A. flavescens) A. angulosum L., Sp. Pl. 1: 300. 1753.—A. danubiale form a subclade with good support. The diploid A. Spreng., Fl. Hal. Mant.: 38. 1807.—A. acutangulum incensiodorum, a local endemic from Croatia, has iden- Schrad., Sem. Hort. Goett. 1808.—A. andersonii G.Don, tical DNA (ITS and plastid) fragments as the European Mem. Wern. Soc. 6: 59. 1827.—A. laxum G.Don, Mem. tetraploid A. lusitanicum. Pastor (1982) reported also a Wern. Soc. 6: 63. 1827. diploid A. lusitanicum from Spain (Pyrenees), but we A. austrosibiricum N.Friesen, Fl. Sibir. (Arac.-Orchi- could not investigate diploid accessions from the Pyre- dac.): 66. 1987.—A. senescens var. serotinum Regel, Trudy nees. It is striking that the diploid A. lusitanicum and A. Imp. S.-Peterburgsk. Bot. Sada 3, 2: 139. 1875.—A. incensiodorum occur in the Mediterranean only in the senescens var. montanum Krylov, Fl. Zap. Sib. 3: 618. proposed glacial refugias (Hermy et al. 1999; Bardy et al. 1929. 2010; Delplancke et al. 2013), which could mean that A. azutavicum Kotukhov, Turczaninowia 6, 1: 6(-7). tetraploid A. lusitanicum has arisen only after the last Ice 2003. Age cycle. European A. lusitanicum is clearly distin- A. brevidentatum F.Z.Li, Bull. Bot. Res. Harbin and guished from A. senescens growing in Siberia as already (1):170. 1986. earlier reported (Friesen and Hermann 1998). It is placed We have not seen any illustration and herbarium mate- in the ‘‘European’’ group of species in our trees (Figs. 3, rial of A. brevidentatum. In the very short description, a 4). The ca. 4 Myr old split between European and Asian rhizome is not mentioned and other characters ‘‘tunic clades supports our point of view that A. lusitanicum is an brown, pale brown inside, usually irregularly splitting at independent species and cannot be included as a sub- apex. ….Perianth pale yellowish green’’ (Xu and Kamelin species of the Siberian species A. senescens (for example 2000), give us strong doubts for affiliation of A. brevi- Kirschner et al. 2007). dentatum to section Rhizirideum. The subdivision of the ‘‘European’’ group in the clades A. burjaticum N.Friesen, Fl. Sibir. (Arac.-Orchidac.): of species with pink flowers (A. angulosum and A. incen- 68. 1987.—A. prostratum subsp. burjaticum (N.Friesen) siodorum) on one side and yellow-whitish flowers (A. fla- Sancz in Gen. Allium: Taxon. Prob. Genet. Res. (Proc. vescens and A. denudatum) on the other, and with the split Internat. Symp. Gatersleben, 1991) 294. 1992, nom. illeg. dated 1.13 Ma (Fig. 5), correlates with different ecological A. chiwui F.T.Wang and Tang, Bull. Fan Mem. Inst. and expansion characters of both groups: A. denudatum and Biol. Bot. 7: 294. 1937. A. flavescens are xerophytic steppe plants, A. angulosum A. czelghauricum Bordz., Trudy Bot. Sada Imp. Yur’- grows in wet floodplain meadows, and A. lusitanicum/ evsk. Univ. 13: 18. 1912. A.incensiodorum grow in mountain rock corridors and dry A. denudatum F.Delaroche, Liliac. [Redoute´] 6: t. 357. grasslands up to 2200 m above the sea level. As a species 1812.—A. albidum M.Bieb., Fl. Taur.-Caucas. 3: 260. clearly belonging to the European clade, Allium angulosum 1819.—A. angulosum var. caucasicum Regel, Trudy Imp. is the only known Allium species which is probably spread S.-Peterburgsk. Bot. Sada 3, 2: 145. 1875.—A. albidum far eastward to the Yenisei after the last Ice Age period. subsp. caucasicum (Regel) Stearn, Ann. Mus. Goulandris We hypothesise that climate changes during the Pleis- 4: 126. 1978. tocene led to interspecific hybridisation and polyploidisa- A. flavescens Besser, Enum. Pl. [Besser]: 56. 1822.—A. tion in the section Rhizirideum. As a result, many polyploid angulosum var. flavescens Regel, Trudy Imp. S.- 123 T. A. Sinitsyna et al.

Peterburgsk. Bot. Sada 3: 145. 1875.—A. ammophilum Chuchur-Muran. Steppe meadow. 1987. S. N. Bakhareva, Heuff., Flora 28: 241. 1845.—A. albidum subsp. albidum O. G. Dolinskaya s.n.’’ (WIR No. 52102!). ‘‘YaSSR, Stearn, Ann. Mus. Goulandris 4: 126. 1978.—A. flavescens Ordzhonikidze district, Lena river right side, 20 km up subsp. ammophilum (Heuff.) Soo´, Feddes Repert. 85, 7–8: the river from Buotama river mouth, south slope of knoll 435. 1974. in region ‘Diring-Yur’akh’ (height from river bed is A. incensiodorum Radic, Acta Biokovica 5: 29, 36. 105 m). Steppe meadow. 1987. S. N. Bakhareva, O. 1989.—A. polycormium Lovric´, Abstact. VII Optima G. Dolinskaya s.n.’’ (WIR No. 52103!). ‘‘YaASSR, meeting, Borovec, Bulgaria: 123. 1993. nom. invalid. Yakutsk district, near the city Yakutsk. Steppe meadow. Allium jakuticum Sinitsyna and N. Friesen, sp. nov.— 1987. S. N. Bakhareva, O. G. Dolinskaya s.n.’’ (WIR No. TYPE: Yakutia, Amginskiy district, Amga River, 30 km 52104!). ‘‘YaSSR, Ordzhonikidzevskiy district, Lena river up the river from vil. Oneyes, herb meadow on the terrace right side, 36 km downstream from the mouth of river above the flood plain. 30.07.1990. Friesen N. s.n. (holotype Sinyaya. Steppe meadow. 1987. S. N. Bakhareva, O. designated here: OSBU No. 19619!; isotypes designated G. Dolinskaya s.n.’’ (WIR No. 52105!). ‘‘YaASSR, here—ALTB!, NSK!). Yakutskiy district, near the city Yakutsk. Steppe meadow. 1987. Coll. S. N. Bakhareva, O. G. Dolinskaya s.n.’’ Etymology The species name refers to the distribution in (WIR No. 44760!). ‘‘Yakutskiy district, middle part of Yakutia. Lena river stream near vill. Zhataya, Best’akh island. Description Perennial herbs. Rhizomes horizontal, Herb–grass meadow of steppe type. 02.08.1959. G. Beli- 15–25 mm long with purple roots. Bulbs 1–6 clustered, mov-V. Ivanov s.n.’’ (WIR No. 52170!). ‘‘Yakutia cylindrical–conical, without bulblets, 10–15 mm in diam., (Sakha), Churapcha district, vill. Ozhelun. Solonetz with slightly violet membranous, smooth inner tunics and habitat near the road, part of steppe meadow. 18.08.1978. brown outer ones. Scape 19–27 cm high, 1–2 mm wide, Ivanov I. A. s.n.’’ (WIR No. 55549!). glabrous, slightly ribbed, slightly flattened below the A. lusitanicum Lam., Encycl. [J. Lamarck and al.] 1, 1: inflorescence. Leaves 4–10, plane, linear, valleculate at the 70. 1783.—A. montanum auct., non Schrank: F.W.Schmidt, bottom, 9–25 cm long, 1–2 mm wide. Umbel subglobose, Fl. Boem. 4: 28. 1794.—A. fallax Schult. and Schult.f., dense, not drooping, 15–30 mm high, 20–30 mm wide, Syst. Veg., ed. 15 bis [Roemer and Schultes] 7, 2: 1072. without bulblets. Pedicels equal in length, violet, without 1830. nom. illeg.—A. montanum subsp. lusitanicum (Lam.) bracts at the base, 7–10 mm long. Flowers yellowish-pink, Nyman, Consp. Fl. Eur.: 739. 1882.—A. senescens subsp. inner tepals ovate, obtuse, longer than outer ones, more or montanum (Pohl) Holub, Folia Geobot. Phytotax. 5: 341. less crenate, 6–7 mm long, 3–4 mm wide, pink, turn yel- 1970.—A. senescens subsp. lusitanicum (Lam.) Dosta´l, low in dry condition, outer tepals boat-shaped, round-el- Folia Mus. Rerum Nat. Bohemiae Occid., Bot. 21: 15. liptical, almost ovoid, 5–6 mm long, 2.5–3 mm wide, with 1984. visible purple vein. Stamens longer than tepals, entire, from A. minus (S.O.Yu, S.Lee and W.Lee) H.J.Choi and the oblong base subulate. Style exserted. Anthers B.U.Oh, Brittonia 62, 3: 200.—A. senescens var. minus 1–1.2 mm long, yellow, yellow-brown. Ovary yellow- S.O.Yu, S.Lee and W.Lee, J. Korean Pl. Taxon. 11, 1–2: brown. Seeds black, corrugated, 3 mm long. 32. 1981 (as ‘‘var. minor’’). Diagnosis It differs from the closely related species A. A. nutans L., Sp. Pl. 1: 299. 1753. prostratum by larger size, yellowish-pink flowers, ovate, A. prostratum Trev., Ind. Sem. Vratisl. 1821.—A. stel- obtuse, pink inner tepals, turned yellow in dry condition, lerianum var. prostratum (Trev.) Regel, Trudy Imp. S.- outer tepals with visible purple vein and stamens subulate Peterburgsk. Bot. Sada 3, 2: 150. 1875.—A. satoanum from the oblong base. Kitag., Bot. Mag. (Tokyo) 48: 92. 1934. A. pseudoalbidum N.Friesen and O¨ zhatay, Feddes Phenology Anthesis in July to begin of August. Repert. 109, 1–2: 25. 1998.—A. albidum subsp. cauca- Habitats Steppe and herb meadows, only on south sides sicum auct. of rivers Lena and Amga. A. pseudosenescens H.J.Choi and B.U.Oh, Brittonia 62, 3: 200 (2–5; figs. 1–2). 2010. Distribution area Yakutia (East Siberia). A. rubens Schrad. ex Willd., Enum. Pl. [Willdenow] 1: Additional specimens examined ‘‘Yakutia, Amga district, 360. 1809.—A. bisulcum F.Delaroche, Liliac. [Redoute´]5: Amga River, in 20 km downstream from the vil. Lyagus t. 286. 1810. (Tegulta-Terde), steppe slope at the foot of a rock. A. senescens L., Sp. Pl. 1: 299. 1753. 28.07.1990. Friesen N. s.n.’’ (OSBU No. 19620!). subsp. senescens—A. senescens var. typicum Regel, ‘‘YaASSR, Yakuts district, 7 km West Yakutsk city, Mt. Trudy Imp. S.-Peterburgsk. Bot. Sada, 3, 2: 138. 1875.—A.

123 Phylogeny and biogeography of Allium sect. Rhizirideum senescens f. albiﬂorum Q.S.Sun, Bull. Bot. Res., Harbin 15, A. stellerianum Willd., Sp. Pl., ed. 4 [Willdenow] 2, 1: 3: 332. 1995. 82. 1799.—A. senescens var. ﬂavescens Regel, Trudy Imp. subsp. glaucum (Regel) Dosta´l, Folia Mus. Rerum Nat. S.-Peterburgsk. Bot. Sada 3, 2: 140. 1875. Bohemiae Occid., Bot. 21: 16. 1984.—A. glaucum Schrad. A. taishanense J.M.Xu, Fl. Reipubl. Popularis Sin. 14: ex Poir., Encycl. [J. Lamarck and al.] Suppl. 1: 265. 1810. 285. 1980. nom.inval.—A. senescens subsp. glaucum (Schrader) A. tuvinicum (N.Friesen) N.Friesen, Fl. Sibir. (Arac.- N.Friesen, Fl. Sibir. (Arac.-Orchidac.): 73. 1987. nom. Orchidac.): 75. 1987.—A. stellerianum subsp. tuvinicum inval.—A. senescens var. glaucum Regel, Trudy Imp. S.- N.Friesen, Novosti Sist. Vyssh. Rast. 22: 75. 1985. Peterburgsk. Bot. Sada 3, 2: 139. 1875. A. tytthocephalum Schult. & Schult.f., Syst. Veg., ed. Note: Nomenclatory history of A. senescens is very 15 bis [Roemer and Schultes] 7, 2: 1133. 1830.—A. confusing and complicated. We are preparing a separate senescens var. brevipedicellatum Regel, Trudy Imp. S.- taxonomic review of this group. Peterburgsk. Bot. Sada 3, 2: 140. 1875. A. spirale Willd., Enum. Pl. Suppl. [Willdenow]: 17. A. tytthocephalum Schult. & Schult.f., in Roemer et 1814. Schultes, Syst. Veg. 7, 2: 1133. 1830.—A. senescens var. A. spurium G.Don, Mem. Wern. Soc. 6: 59. 1827.—A. brevipedicellatum Regel, Trudy Imp. S.-Peterburgsk. Bot. dauricum N.Friesen, Fl. Sibir. (Arac.-Orchidac.): 68. 1987. Sada 3(2): 140. 1875.

Identification key for all species of the section Rhizirideum 1a Flowers white to yellow 2 1b Flowers pale pink to purple 8 2a Leaves plane, linear, smooth or grooved, to 5 mm wide 3 2b Leaves semi-cylindrical or filiform, grooved, to 3 mm wide 5 3a Leaves grooved, to 5 mm wide, flowers white, sometimes turn light pink A. denudatum. 3b Leaves linear, 2–5 mm wide 4 4a Flowers pale yellowish green. Filaments equal, inner ones 1-toothed on each side A. brevidentatum 4b Flowers white to yellow. Inner filaments triangular A. chiwui 5a Flowers white, often with pink vein, not redden in dry condition, leaves filiform A. pseudoalbidum 5b Flowers yellow 6 6a Pedicels 2–3(4) times longer than flowers A. flavescens 6b Pedicels 1.5–2 times longer than flowers or equal to it 7 7a Pedicels 1.5 times longer than flowers. Tepals yellow, without visible vein, 5–6 mm long. Umbel subglobose, loose A. stellerianum 7b Pedicels shorter or equal to flowers. Tepals 3–4 mm long, yellow with barely visible vein, sometimes turn pink. A. tuvinicum Umbel subglobose, dense, almost capitate 8a Leaves narrowly linear, plane, 2–15 mm wide 9 8b Leaves grooved, semi-cylindrical or filiform, to 2 mm wide 23 9a Stamens slightly shorter or of tepal length 10 9b Stamens exserted 11 10a Inner tepals lanceolatewith cuspidate apex, edges of apex wrapped inside A. angulosum 10b Inner tepals elliptical, obtuse, longer than outer ones, 3.5–4.7 mm long, 1–1.8 mm wide, outer tepals ovate-oblong, A. minus obtuse at apex, 3.4–4.1 mm long, 0.8–1.2 mm wide, pale pink 11a Inner stamens with two (sometimes one) basal teeth A. nutans 11b Inner stamens entire at the base 12 12a Inner stamens entire, subulate, not wider than external. Pedicels shorter or as long as the flowers. Umbel capitate. A. tytthocephalum 12b Inner stamens in 1.5–2 times wider than external. Pedicels longer than flowers. Umbel not capitate 13 13a Scape with 2 winges, often equal to scape in wide. Stamens subulate from deltoid base. Tepals pinkish-purple, widely A. spirale ovate, with barely visible thin vein 13b Scape two-edged, ribbed, often with narrow wings. Stamens subulate from wide or oblong base. Tepals pink or 14 pinkish-violet from elliptical to widely ovate or obovate 14a Bulbs 1–2, ovate-conical or ovate-cylindrical, not clustered 15 14b Bulbs more than 2, narrow-conical or conical-cylindrical, clustered 18

123 T. A. Sinitsyna et al.

15a Leaves widely linear to 15 mm wide, rhizome to 1 cm wide. Scape often with 2 narrow wings. Umbel 16 subglobose or globose, dense 15b Leaves to 4 mm wide, rhizome to 4 mm wide. Scape thin, terete, ribbed. Umbel often subglobose, loose 20 16a Leaves 7–10 mm wide, one-keeled beneath, scabrous-dentate along keel and edges. Ovary with deep A. taishanense nectariferous pores covered by hood-like projections at base 16b Leaves not keeled, linear, ovary without deep nectariferous pores 17 17a Leaves plane, 5–10(12) mm wide. Scape terete, flattened at upper part A. senescens subsp. senescens 17b Leaves ascending, some tortuous, plane, 5–15 mm wide. Scape hemicylindrical to rhomboid in cross section A. pseudosenescens 18a Leaves 6–8, no longer than half of the scape length. Pedicels obliquely upward directed, 2–4 times longer than A. spurium flowers. Tepals triangular-ovate 18b Leaves longer than half of the scape length. Pedicels equal, 1.5–2 times longer than flowers. Tepals ovate or 19 widely obovate 19a Leaves 5–6, plane, linear, without keel, 2–5 mm wide. Pedicels glabrate. Tepals ovate A. lusitanicum 19b Leaves 7–14, slightly ribbed, slightly pubescent, linear, sometimes slightly keeled beneath, 2–2.5(3) mm wide. A. incensiodorum Pedicels ribbed and scabrid with papillae of very different size, not bracteolate. Inner tepals widely obovate, larger than lanceolate outer ones 20a Bulbs conical. Bulb tunics membranous, violet, more or less entire. Scape cylindrical, with 2 visible ribs on A. burjaticum opposite sides. Leaves 2–3 mm wide, almost equal to scape length 20b Bulbs conical-cylindrical. Tunics membranous, whitish-grey, colorless or rarely pale pink. Scape cylindrical, 21 sometimes with hardly visible ribs. Leaves to 6 mm wide, equal or some longer than half of the scape length 21a Several bulbs, small, bent, form a sward. Leaves 2–3 mm wide, not wider than scapePedicels 1.5–2 times longer A. austrosibiricum than flowers 21b Bulbs to 4. Leaves 2–5(6) mm wide, some wider than scape, longer than half of the scape length. Pedicels more 22 than 2 times longer than flowers 22a Bulb 1, rarely 2. Leaves 2–4 mm wide, obtuse, finely scabrous on edges. Umbel subglobose, loose. Pedicels pale A. azutavicum violet, 2–3 times longer than flowers. Outer tepals widely elliptical, pink, 5–6 mm long, with well visible vein, inner tepals somewhat longer than external ones, white. Inner stamens strongly widened to base, sometimes with a small tooth on one or both sides 22b Bulbs 2–4, elongate. Leaves 3–5(6) mm wide, glaucous (glaucous-green), scabrous. Umbel almost globose, .A. senescens subsp. dense. Pedicels 3–4 times longer than flowers, green Tepals widely ovate, pink, 6–7 mm long, stamens without glaucum teeth 23a Bulb tunics not violet. Leaves 2 mm wide, narrowly linear, canaliculate, almost reaching the umbel. Tepals A. czelghauricum oblong, obtuse, pink or pinkish-lilac. Stamens linear-subulate, shorter than tepals 23b Inner bulb tunics violet 24 24a Umbel almost globose, loose, close-clustered. Pedicels 2–4 times longer than flowers. Tepals lanceolate- A. rubens elliptical, acute with barely visible vein, violet. Style not exserted 24b Umbel subglobose or almost globose, dense. Pedicels 1.5–2 times longer than flowers. Tepals pink. Style 25 exserted 25a Umbel almost globose, dense. Inner tepals ovate, apex rounded, pink, 3–5 mm long A. prostratum 25b Umbel subglobose, dense. Inner tepals ovate, obtuse, longer than outer ones, more or less crenate, 6–7 mm long, A. jakuticum pink, turn yellow in dry condition, outer tepals boat-shaped, with visible purple vein

Acknowledgments Curators and managers of the visited herbaria are biogeography of the eurasian section rhizirideum G.Don ex W.D.J.Koch greatly acknowledged for help and providing leaf material. We thank (Allium L., Amaryllidaceae)’’ (PLSY-D-16-00066) complies with all Herbert Hurka and Reinhard Fritsch for helpful comments on the the requirements of ‘‘the ethical responsibilities of the authors’’ part in manuscript and Lucille Schmieding for correcting the English. We the ‘‘instruction for authors’’ guideline (Cope guidlines). want to give special thanks to the reviewers, for their valuable comments and suggestions on this manuscript. For financial support, we are grateful to DAAD for a Grant (PKZ A/07/90071) to the first author as well as to DFG for supporting the collecting of Allium Information on Electronic Supplementary Material specimen in Siberia and Mongolia for N. Friesen and to RSF (Russian Science Foundation, Project 14-14-00472) for T. Sinitsyna. Online resource 1. Sources of geographical information. Online resource 2. Chromosome numbers of Allium sect. Rhiziri- Compliance with ethical standards deum species and sources of information. Online resource 3. ITS Alignment of all accessions of section We confirm that this work is original and has not been published else- Rhizirideum. where nor is it currently under consideration for publication elsewhere. Online resource 4. ITS Alignment with only diploid species of We the authors declare that the manuscript ‘‘Dater phylogeny and section Rhizirideum.

123 Phylogeny and biogeography of Allium sect. Rhizirideum

Online resource 5. Plastid Alignment. held at Gatersleben. Institut fu¨r Pflanzengenetik und Kul- Online resource 6. Hybridogenic Network, based on ITS and plastid turpflanzenforschung, Gatersleben, pp 55–66 trees. Friesen N (1995) The genus Allium L. in the flora of Mongolia. Online resource 7. Estimated mean ages. Feddes Repert 106:59–81 Friesen N, Hermann N (1998) Taxonomy, chorology and evolution of Allium lusitanicum: the European ‘‘A. senescens’’. Linzer Biol Beitr 30:815–830 References Friesen N, Bolognini G, Nimis PL (1993) Quantitative phytogeog- raphy of the genus Allium in Siberia and Mongolia. Nordic J Bot Agapova ND, Arkharova KB, Vakhtina LI, Zemskova EA, Tarvis LV 5:295–307 (1990) Numeri chromosomatum magnoliophytorum florae Friesen N, Fritsch RM, Blattner FR (2006) Phylogeny and intra- URSS: Aceraceae—Menyanthaceae. Nauka, Sectio Leninopoli- generic classification of Allium L. (Alliaceae) based on nuclear tana, St Petersburg ribosomal DNA ITS. Aliso 22:372–395 Avise JC (2000) Phylogeography: the history and formation of Friesen N, German DA, Hurka H, Herden T, Oyuntsetseg B, Neuffer species. Harvard University Press, Cambridge B (2015) Dated phylogenies and historical biogeography of Bardy KE, Albach DC, Schneeweiss GM, Fischer MA, Scho¨nswetter Dontostemon and Clausia (Brassicaceae) mirror the palaegeo- P (2010) Disentangling phylogeography, polyploid evolution and graphical history of the Eurasian steppe. J Biogeogr. doi:10. taxonomy of a woodland herb (Veronica chamaedrys group, 1111/jbi.12658 Plantaginaceae s.l.) in southeastern Europe. Molec Phylogen Fritsch RM (2001) Taxonomy of the genus Allium: contributions from Evol 57:771–786 IPK Gatersleben. Herbertia 56:19–50 Barkalov VY (1987) Sem. 143. Lukovye – Alliaceae J. Agardh. In: Fritsch RM, Friesen N (2002) Evolution, domestication, and taxon- Charkevicz SS (ed) Plantae vasculares Orientis Extremi Sovi- omy. In: Rabinovich HD, Currah L (eds) Allium crop science: etici, Tomus 2. Nauka, Leningrad, pp 376–393 recent advances. CABI Publishing, Wallingford, pp 5–30 Blattner FR (1999) Direct amplification of the entire ITS region from Herden T, Hanelt P, Friesen N (2016) Phylogeny of Allium L. poorly preserved plant material using recombinant PCR. subgenus Anguinum (G. Don. ex W. D. J. Koch) N. Friesen Biotechniques 27:1180–1186 (Amaryllidaceae). Molec Phylogen Evol 95:79–93 Bolkhovskikh ZV, Grif VG, Zakhar’eva OI, Matveyeva TS (1969) Hermy M, Honnay O, Firbank L, Grasof-Bokdam C, Lawesson JE Khromosomnye chisla tsvetkovych rastenii. Nauka, Leningrad (1999) An ecological comparison between ancient and other Cheremushkina VA (2004) Biologiia lukov Evrazii, Novosibirsk forest plant species of Europe, and the implications for forest Choi HJ (2015) Portrayal of Allium spurium G. Don (Amaryllidaceae) conservation. Biol Conservation 91:9–22 from the border area of China and North Korea: a putative Hewitt GM (2001) Speciation, hybrid zones and phylogeography: or unrecorded species in the Korean Peninsula. Botanica. Pacifica seeing genes in space and time. Molec Ecol 10(3):537–549 4:1–3. doi:10.17581/bp.2015.04202 Huang C-C, Hung K-H, Wang W-K, Ho C-W, Huang C-L, Hsu T-W, Choi HJ, Oh BU (2010) A new species and a new combination of Osada N et al (2012) Evolutionary rates of commonly used Allium sect. Rhizirideum (Alliaceae) from northeastern China nuclear and organelle markers of Arabidopsis relatives (Brassi- and Korea. Brittonia 62:199–205 caceae). Gene 499:194–201 Delplancke M, Alvarez N, Benoit L, Espindola A, Joly HI, Hurka H, Friesen N, German DA, Franzke A, Neuffer B (2012) Neuenschwander S, Arrigo N (2013) Evolutionary history of ‘Missing link’ species Capsella orientalis and Capsella thracica almond tree domestication in the Mediterranean basin. Molec elucidate evolution of model plant genus Capsella (Brassi- Ecol 22:1092–1104 caceae). Molec Ecol 21:1223–1238 Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary Huson DH, Scornavacca C (2010) A survey of combinatorial methods analysis by sampling trees. BMC Evol Biol 7:214 for phylogenetic networks. Genome Biol Evol 3:23–35. doi:10. Ehrendorfer F (1980) Chapter 3 polyploidy and distribution. In: Lewis 1093/gbe/evq077 WH (ed) Polyploidy, biological relevance. Plenum Press, New Huson DH, Scornavacca C (2012) Dendroscope 3: an interactive tool York, pp 45–60 for rooted phylogenetic trees and networks. Syst Biol Favarger C (1961) Sur l’emploides nombres de chromosomes en 61:1061–1067. doi:10.1093/sysbio/sys062 geógraphie botanique historique. Ber Geobot Inst ETH Stiftung IPCN (1979–2016) Index to plant chromosome numbers. Goldblatt Ru¨bel 32:119–146 P, Johnson DE (eds) Missouri Botanical Garden, St. Louis. Favarger C (1984) Cytogeography and biosystematics. In: Grant WF http://mobot.mobot.org/W3T/Search/ipcn.html. Accessed 15 Jan (ed) Plant biosystematics. Academic Press, Vancouver, 2016 pp 453–476 Jeanmogin F, Thompson JD, Gouy M, Higgins DG, Gibson TJ (1998) Felsenstein J (1985) Confidence limits on phylogenies: an approach Multiple sequence alignment with Clustal X. Trends Biochem using the bootstrap. Evolution 39:783–791 Sci 23:403–405 Franzke A, Hurka H, Janssen D, Neuffer B, Friesen N, Markov M Kamelin RV (2004) Lektsii po sistematike rastenii. Glavy teoretich- (2004) Molecular signals for late Tertiary/Early Quarternary eskoi sistematiki rastenii, Izdatel’stvo ‘‘AzBuka’’, Barnaul range splits of an Eurasian steppe plant: Clausia aprica Kay K, Whittall J, Hodges S (2006) A survey of nuclear ribosomal (Brassicaceae). Molec Ecol 13:2789–2795 internal transcribed spacer substitution rates across angiosperms: Friesen N (1987) Rod Allium L. In: Malyshev LI, Peshkova GA (eds) an approximate molecular clock with life history effects. BMC Flora Sibiri. Araceae-Orchidaceae, Novosibirsk, pp 55–96 Evol Biol 6:36 Friesen N (1988) Lukovye Sibiri: sistematika, kariologiia, khorolo- Kirschner J, Kirschnerova L, Ste˘pańek J (2007) Generally accepted giia. Nauka-Sibirskoe otd, Novosibirsk plant names based on material from the Czech Republic and Friesen N (1992) Systematics of the Siberian polyploid complex in published in 1753–1820. Preslia 79:323–365 subgenus Rhizirideum (Allium). In: Hanelt P, Hammer K, Koldaeva MN (2015) On the infraspecific diversity of Allium spirale Knupffer H (eds) The genus Allium: taxonomic problems and Willd. ex Schlecht. (Alliaceae) in the Russian Far East. genetic resources, proceedings of an international symposium Turczaninowia 18:5–10

123 T. A. Sinitsyna et al.

Krogulevich RE, Rostovtseva TS (1984) Khromosomnye chisla regions for phylogenetic studies in angiosperms: the tortoise tsvetkovykh rastenii Sibiri i Dal’nego Vostoka. Nauka, Sibirskoe and the hare III. Amer J Bot 94:275–288 Otdelenie, Novosibirsk Sinitsyna TA, Friesen N (2008) Phylogeny of the Allium L. section Li QQ, Zhou DZ, He XH, Xu Y, Zhang YC, Wei XQ (2010) Rhizirideum G. Don ex W. D. J. Koch based on molecular- Phylogeny and biogeography of Allium (Amaryllidaceae: genetic data: In: Proceedings of 7th international scientific- Allieae) based on nuclear ribosomal internal transcribed spacer practical conference on problems of botany of South Siberia and and chloroplast rps16 sequences, focusing on the inclusion of Mongolia. (Barnaul, 21–24 Oktober 2008): 323–326 species endemic to China. Ann Bot (Oxford) 106:709–733 Stehlik I, Blattner FR, Holderegger R, Bachmann K (2002) Nunatak Nu¨rk NM, Uribe-Convers S, Gehrke B, Tank DC, Blattner FR (2015) survival of the high Alpine plant Eritrichium nanum (L.) Gaudin Oligocene niche shift, Miocene diversification: cold tolerance in the central Alps during the ice ages. Molec Ecol and accelerated speciation rates in the St. John’s Worts 11:2027–2036 (Hypericum, Hypericaceae). BMC Evol Biol 15:80. doi:10. Swofford DL (2002) PAUP*: phylogenetic analysis using parsimony 1186/s12862-015-0359-4 (* and other methods), vers. 4.0. Sinauer Associates, Inc., Parisod C, Holderegger R, Brochmann C (2010) Evolutionary Sunderland consequences of autopolyploidy. New Phytol 186:5–17 Taberlet P, Gielly L, Pautou G, Bouvet J (1991) Universal primers for Pastor J (1982) Karyology of Allium species from the Iberian amplification of three non-coding regions of chloroplast DNA. Pl Peninsula. Phyton (Horn) 22:171–200 Molec Biol 17:1105–1109 Posada D, Crandall KA (1998) Modeltest: testing the model of DNA Taberlet P, Fumagalli L, Wust-Saucy A-G, Cosson J-F (1998) substitution. Bioinformatics 14:817–818 Comparative phylogeography and postglacial colonization routes Ronquist R, Huelsenbeck JP (2003) MrBayes 3: Bayesian phyloge- in Europe. Molec Ecol 7:453–464 netic inference under mixed models. Bioinformatics Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S 19:1572–1574 (2011) MEGA5: molecular evolutionary genetics analysis using Schmitt T (2007) Molecular biogeography of Europe: pleistocene maximum likelihood, evolutionary distance, and maximum cycles and postglacial trends. Front Zool 4:11 parsimony methods. Molec Biol Evol 28(10):2731–2739. Seregin AP, Anac´kov G, Friesen N (2015) Molecular and morpho- doi:10.1093/molbev/msr121 logical revision of the Allium saxatile group (Amaryllidaceae): Vvedensky AI (1935) Rod 267. Luk: Allium L. In: Komarov VL (ed) geographical isolation as the driving force of underestimated Flora URSS IV, Izdatel’stvo AN SSSR, Leningrad, pp 112–280 speciation. Bot J Linn Soc 178:67–101. doi:10.1111/boj.12269 Xu JM, Kamelin RV (2000) Allium L. In: Wu ZY, Raven PH (eds) Shaw J, Lickey EB, Schilling EE, Small RL (2007) Comparison of Flora of China. Science Press and Missouri Botanical Garden whole chloroplast genome sequence to choose noncoding Press, Beijing and St. Louis

123