TP53 Target Genes from Chea NR3C1 Target Genes From
Total Page：16
File Type：pdf, Size：1020Kb
Load more
Recommended publications
-
Connexin 40.1 (GJD4) (NM 153368) Human Tagged ORF Clone Lentiviral Particle – RC222438L3V | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC222438L3V Connexin 40.1 (GJD4) (NM_153368) Human Tagged ORF Clone Lentiviral Particle Product data: Product Type: Lentiviral Particles Product Name: Connexin 40.1 (GJD4) (NM_153368) Human Tagged ORF Clone Lentiviral Particle Symbol: GJD4 Synonyms: CX40.1 Vector: pLenti-C-Myc-DDK-P2A-Puro (PS100092) ACCN: NM_153368 ORF Size: 1110 bp ORF Nucleotide The ORF insert of this clone is exactly the same as(RC222438). Sequence: OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_153368.1 RefSeq Size: 1580 bp RefSeq ORF: 1113 bp Locus ID: 219770 UniProt ID: Q96KN9 Protein Families: Transmembrane MW: 40 kDa Gene Summary: Connexins, such as GJD4, are involved in the formation of gap junctions, intercellular conduits that directly connect the cytoplasms of contacting cells. Each gap junction channel is formed by docking of 2 hemichannels, each of which contains 6 connexin subunits (Sohl et al., 2003 [PubMed 12881038]).[supplied by OMIM, Mar 2008] This product is to be used for laboratory only. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Podocyte Specific Knockdown of Klf15 in Podocin-Cre Klf15flox/Flox Mice Was Confirmed
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1: Podocyte specific knockdown of Klf15 in Podocin-Cre Klf15flox/flox mice was confirmed. (A) Primary glomerular epithelial cells (PGECs) were isolated from 12-week old Podocin-Cre Klf15flox/flox and Podocin-Cre Klf15+/+ mice and cultured at 37°C for 1 week. Real-time PCR was performed for Nephrin, Podocin, Synaptopodin, and Wt1 mRNA expression (n=6, ***p<0.001, Mann-Whitney test). (B) Real- time PCR was performed for Klf15 mRNA expression (n=6, *p<0.05, Mann-Whitney test). (C) Protein was also extracted and western blot analysis for Klf15 was performed. The representative blot of three independent experiments is shown in the top panel. The bottom panel shows the quantification of Klf15 by densitometry (n=3, *p<0.05, Mann-Whitney test). (D) Immunofluorescence staining for Klf15 and Wt1 was performed in 12-week old Podocin-Cre Klf15flox/flox and Podocin-Cre Klf15+/+ mice. Representative images from four mice in each group are shown in the left panel (X 20). Arrows show colocalization of Klf15 and Wt1. Arrowheads show a lack of colocalization. Asterisk demonstrates nonspecific Wt1 staining. “R” represents autofluorescence from RBCs. In the right panel, a total of 30 glomeruli were selected in each mouse and quantification of Klf15 staining in the podocytes was determined by the ratio of Klf15+ and Wt1+ cells to Wt1+ cells (n=6 mice, **p<0.01, unpaired t test). Supplementary Figure 2: LPS treated Podocin-Cre Klf15flox/flox mice exhibit a lack of recovery in proteinaceous casts and tubular dilatation after DEX administration. -
Table 2. Significant
Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S. -
Seq2pathway Vignette
seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway. -
Supplementary Online Material Promoter-Anchored Chromatin
Supplementary Online Material Promoter-anchored chromatin interactions predicted from genetic analysis of epigenomic data Wu et al. Contents Figure S1 to S8 Supplementary Note 1-2 References Figure S1 Schematic overview of this study. a b mean=3.7 mean=79 Kb median=2 median=23 Kb Count Count 0 1000 3000 5000 0 5000 10000 15000 0 5 10 15 20 25 >30 0 500 1000 1500 2000 No. interacting pairs Distance between interacting DNAm (Kb) Figure S2 Summary of the predicted PAIs. Panel a): distribution of the number of PIDSs (promoter interacting DNAm sites) for each bait probe (located in the promoter of a gene). Panel b): distribution of physical distances between pairwise interacting DNAm sites of the significant PAIs. Figure S3 Overlap of the predicted PAIs with TADs annotated from the Rao et al. 1 Hi-C data. Panel a): a heatmap of the predicted PAIs (red asterisks) and chromatin interactions with correlation score > 0.4 (blue dots) identified by Hi-C in a 1.38 Mb region on chromosome 6. Only 41.5% of the predicted PAIs in this region showed overlap with the TADs. This region harbours the RPS6KA2 locus as shown in Fig. 5. Panel b): a heatmap of the predicted PAIs (red asterisks) and chromatin interactions with correlation score > 0.4 (blue dots) identified by Hi-C in a 0.81 Mb region on chromosome 12. The predicted PAIs were highly consistent with the chromatin interactions identified by Hi-C. This region harbours the ABCB9 locus as shown in Fig. S4. The heatmap is asymmetric for the PAIs with the x- and y-axes representing the physical positions of “outcome” and “exposure” probes respectively. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
ABCG1 (ABC8), the Human Homolog of the Drosophila White Gene, Is a Regulator of Macrophage Cholesterol and Phospholipid Transport
ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport Jochen Klucken*, Christa Bu¨ chler*, Evelyn Orso´ *, Wolfgang E. Kaminski*, Mustafa Porsch-Ozcu¨ ¨ ru¨ mez*, Gerhard Liebisch*, Michael Kapinsky*, Wendy Diederich*, Wolfgang Drobnik*, Michael Dean†, Rando Allikmets‡, and Gerd Schmitz*§ *Institute for Clinical Chemistry and Laboratory Medicine, University of Regensburg, 93042 Regensburg, Germany; †National Cancer Institute, Laboratory of Genomic Diversity, Frederick, MD 21702-1201; and ‡Departments of Ophthalmology and Pathology, Columbia University, Eye Research Addition, New York, NY 10032 Edited by Jan L. Breslow, The Rockefeller University, New York, NY, and approved November 3, 1999 (received for review June 14, 1999) Excessive uptake of atherogenic lipoproteins such as modified low- lesterol transport. Although several effector molecules have been density lipoprotein complexes by vascular macrophages leads to proposed to participate in macrophage cholesterol efflux (6, 9), foam cell formation, a critical step in atherogenesis. Cholesterol efflux including endogenous apolipoprotein E (10) and the cholesteryl mediated by high-density lipoproteins (HDL) constitutes a protective ester transfer protein (11), the detailed molecular mechanisms mechanism against macrophage lipid overloading. The molecular underlying cholesterol export in these cells have not yet been mechanisms underlying this reverse cholesterol transport process are characterized. currently not fully understood. To identify effector proteins that are Recently, mutations of the ATP-binding cassette (ABC) trans- involved in macrophage lipid uptake and release, we searched for porter ABCA1 gene have been causatively linked to familial HDL genes that are regulated during lipid influx and efflux in human deficiency and Tangier disease (12–14). -
Cellular and Molecular Signatures in the Disease Tissue of Early
Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of -
Synthetic Lethal Screen Demonstrates That a JAK2 Inhibitor Suppresses a BCL6 Dependent IL10RA/JAK2/STAT3 Pathway in High Grade B-Cell Lymphoma
BCL6 suppresses an IL10RA/JAK2/STAT3 pathway Synthetic lethal screen demonstrates that a JAK2 inhibitor suppresses a BCL6 dependent IL10RA/JAK2/STAT3 pathway in high grade B-cell lymphoma. Daniel Beck1,6, Jenny Zobel3,6, Ruth Barber1,2,6, Sian Evans1, Larissa Lezina1, Rebecca L. Allchin1, Matthew Blades4, Richard Elliott5, Christopher J. Lord5, Alan Ashworth5, Andrew C.G. Porter3, Simon D. Wagner1 1Department of Cancer Studies, Ernest and Helen Scott Haematology Research Institute and, 2 Leicester Diagnostic and Drug Development (LD3) Centre, University of Leicester, Lancaster Road, Leicester LE1 7HB, UK, 3Department of Haematology, Imperial College London, Hammersmith Campus, Du Cane Road, London W12 0NN, UK. 4Bioinformatics and Biostatistics Analysis Support Hub (B/BASH), University of Leicester, Lancaster Road, Leicester LE1 9HN and 5The Breakthrough Breast Cancer Research Centre, The Institute of Cancer Research, 237 Fulham Road, London, SW3 6JB, UK. 6The first three authors contributed equally to this work Running title: BCL6 suppresses an IL10RA/JAK2/STAT3 pathway. To whom correspondence should be addressed: Simon D. Wagner, Department of Cancer Studies, Room 104, Hodgkin Building, University of Leicester, Lancaster Road, Leicester LE1 7HB, UK. Tel: 0441162525584, Fax: 0441162525616, Email: [email protected] Keywords: cancer therapy, Janus kinase (JAK), lymphocyte, lymphoma, transcription factor, B-cell lymphoma 6 (BCL-6), synthetic lethal screen. ABSTRACT which shows higher levels of IL10RA, JAK2 and We demonstrate the usefulness of synthetic lethal STAT3 but lower levels of BCL6 than GC- screening of a conditionally BCL6 deficient DLBCL and might be usefully combined with Burkitt lymphoma cell line, DG75-AB7, with a novel approaches such as inhibition of IL10RA. -
AP-4 Mediates Export of ATG9A from the Trans-Golgi Network to Promote
AP-4 mediates export of ATG9A from the trans-Golgi PNAS PLUS network to promote autophagosome formation Rafael Matteraa,1, Sang Yoon Parka,1, Raffaella De Pacea, Carlos M. Guardiaa, and Juan S. Bonifacinoa,2 aCell Biology and Neurobiology Branch, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892 Edited by Pietro De Camilli, Howard Hughes Medical Institute and Yale University, New Haven, CT, and approved November 6, 2017 (received for review October 2, 2017) AP-4 is a member of the heterotetrameric adaptor protein (AP) mediated by a noncanonical YRYRF sequence in the receptor- complex family involved in protein sorting in the endomembrane associated, transmembrane AMPA receptor regulatory proteins system of eukaryotic cells. Interest in AP-4 has recently risen with (TARPs) (17). Finally, in the δ2 glutamate receptor protein, the discovery that mutations in any of its four subunits cause a binding to μ4 depends on several phenylalanine residues in a form of hereditary spastic paraplegia (HSP) with intellectual noncanonical context (18). disability. The critical sorting events mediated by AP-4 and the Interest in AP-4 has recently risen because of the discovery of pathogenesis of AP-4 deficiency, however, remain poorly under- mutations in genes encoding each of the subunits of AP-4 in stood. Here we report the identification of ATG9A, the only a subset of autosomal recessive hereditary spastic paraplegias multispanning membrane component of the core autophagy ma- (HSPs), namely, SPG47 (AP4B1/β4), SPG50 (AP4M1/μ4), SPG51 chinery, as a specific AP-4 cargo. AP-4 promotes signal-mediated (AP4E1/e), and SPG52 (AP4S1/σ4) (19–21). -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase