Expression of Odontogenic Ameloblast-Associated (ODAM) in Dental and Other Epithelial Neoplasms

Daniel P Kestler, James S Foster, Sallie D Macy, Charles L Murphy, Deborah T Weiss, and Alan Solomon

Human Immunology and Cancer Program, Department of Medicine, University of Tennessee Graduate School of Medicine, Knoxville, Tennessee, United States of America

We previously have communicated our discovery that the amyloid associated with calcifying epithelial odontogenic tumors is composed of N-terminal fragments of the structurally novel odontogenic ameloblast-associated protein designated ODAM. Sub- sequently, it was shown by other investigators that ODAM is expressed in rodent enamel organ and is likely involved in dental de- velopment. We now report that this molecule also is found in certain human tissues, principally the salivary gland and trachea, as evidenced by RNA array analysis and immunohistochemistry-utilizing antibodies prepared against synthetic ODAM-related peptides and recombinant protein. Notably, these reagents immunostained normal and malignant ameloblasts and other types of human neoplastic cells, including those of gastric, lung, and breast origin where the presence in the latter was confirmed by in situ hybridization using -specific molecular probes. Moreover, significant titers of anti-ODAM IgG antibodies were detected in the sera of patients with these malignancies. Our studies have provided the first evidence in humans for the cellular expression of ODAM in normal and diseased states. Based on our findings, we posit that ODAM is a developmental antigen that has an es- sential role in tooth maturation and in the pathogenesis of certain odontogenic and other epithelial neoplasms; further, we sug- gest that ODAM may serve as a novel prognostic biomarker, as well as a potential diagnostic and therapeutic target for patients with breast and other epithelial forms of cancer. Online address: http://www.molmed.org doi: 10.2119/2008-00010.Kestler

INTRODUCTION designated APin) in odontogenesis, the composed of N-terminal fragments of a Odontogenic ameloblast-associated results of DNA microarray analyses 153-residue hypothetical protein speci- protein (ODAM) is encoded by a gene have shown that ODAM expression is fied by the FLJ20513 gene (a short form originally termed EO-009 (1) that con- up-regulated in human cervical (5) and of ODAM cDNA cloned from the Kato III sists of ten coding exons (Figure 1) lo- gastric cancer (6). human signet-ring gastric carcinoma cell cated within an ~800 kbp region of Although ODAM-related gene tran- line [9,10]), where the last six of ten pro- 4q13 containing the secre- scripts have been detected in a variety of tein-encoding exons of ODAM are lo- tory calcium-binding phosphoprotein mammalian tissues, including those of cated. Subsequently, in studies of amy- (SCPP) cluster that specifies elements human, chimpanzee, mouse, rat, and ca- loid from four other CEOT cases, we involved in bone and tooth develop- nine origin (7), our report that the amy- identified varying amounts of a second ment, as well as mineralization (2). loid associated with calcifying epithelial ODAM-related protein with residues Studies of rodent tissue have revealed odontogenic tumors (CEOT) is formed originating from the fourth exon (11). that ODAM is highly expressed by ma- from an ODAM molecule provided the This discovery provided conclusive evi- ture ameloblasts (3) and is present in first example of this protein’s expression dence for the transcription of a longer the enamel organ and junctional ep- (8). Through chemical analyses of amy- ODAM product that was predicted to ithelial cells (4). In addition to the po- loid fibrils isolated from three specimens, consist of 279 amino acids, 126 of which tential role of this protein (formerly we found that these components were are products of the first four coding exons (1,4). To gain further insight into the poten- tial role of ODAM in tissue development Address correspondence and reprint requests to Alan Solomon, University of Tennessee and carcinogenesis, we have generated Graduate School of Medicine, 1924 Alcoa Highway, Knoxville TN 37920. Phone: 865-305- anti-ODAM specific polyclonal and 9167; Fax: 865-305-6865; E-mail: [email protected]. monoclonal antibodies, using as im- Submitted January 23, 2008; Accepted for publication March 17, 2008; Epub (www. munogens synthetic peptides and re- molmed.org) ahead of print April 11, 2008. combinant protein. We now report that

318 | KESTLER ET AL. | MOL MED 14(5-6)318-326, MAY-JUNE 2008 RESEARCH ARTICLE

(5′-ATGTCTGCCAGCAATAGCAAT) and exon 10 antisense (5′TGGTTCCC TTAGGCTGTCAGT) primers which yielded a product encoding amino acid residues 25–279. To obtain by PCR a cDNA specifying the shorter (i.e., 153- residue) FLJ20513 product, exons 5 sense (5′ATGCCCTATGTATTCTCC) and 10 antisense primers were utilized. Aldolase-B sense and antisense primers began, respectively, at the start (5′-ATGCC CTACCAATATCCAGCACT) and termi- nation (5′-TTAATAGGCGTGGTTAGA GACG) of the coding sequence. The re- actions were run on an MJ Research model PTC-200 (Bio-RAD, Richmond, CA, USA) PCR apparatus for up to 40 cycles of amplification, each consisting Figure 1. The deduced amino acid sequence encoded by the human ODAM gene. The of 1 min at 94, 62, and 72° C, followed signal peptide region is underlined. The amino acids are numbered as given in Reference by a single 15-min incubation cycle at 1 and the ten coding exons specifying the secreted form of the ODAM are shown above. 72° C prior to agarose gel analysis. For expression of recombinant protein generated from the ODAM PCR products, these reagents recognized ODAM mole- Cells and Tissues the constructs included forward primers cules, not only in ameloblasts, but also The human signet-ring gastric carci- encoding the first methionine residue in certain normal and neoplastic human noma Kato III cell line was obtained from specified by the second and fifth coding epithelial tissues—a finding confirmed the American Type Culture Collection exons (5′-ATGTCTGCCAGCAATAGCAAT at the molecular level through RNA (ATCC, Rockville, MD, USA). Cells were and 5′-ATGCCCTATGT ATTCTCC, respec- array and in situ hybridization analyses. grown in RPMI supplemented with tively) and an exon 10 reverse primer Our studies have provided definite evi- L-glutamine, penicillin/streptomycin, and (5′-TGGTTCCCTTAGGCTGTCAGT) dence that ODAM is expressed under 10% FBS at 37° C in a humidified incuba- containing the last seven ODAM physiologic and pathologic conditions tor with a 95% air and 5% CO2 atmos- residues. For optimal prokaryotic protein and suggest that when up-regulated, phere at densities of 0.1-1 × 106 cells/mL. production, detection, and purification this protein may serve clinically as a Human normal and malignant tissue purposes, the constructs also included a novel cancer biomarker and provide a arrays (breast, stomach, and lung) were ribosomal binding site, a C-terminal therapeutic target for patients with cer- purchased from Zymed–Invitrogen (San FLAG peptide, and a termination codon. tain epithelial malignancies. Francisco, CA, USA) and a multi-tissue ODAM cDNA was prepared from sausage array from BioGenex (San PCR-generated fragments rendered MATERIALS AND METHODS Ramon, CA, USA). Mouse ten-day-old blunt using the Novagen (Madison, WI, fixed, embedded odontogenic tissue was USA) Perfectly Blunt Cloning Kit end Patient Specimens kindly provided by J Timothy Wright conversion reagents and were ligated to Serum samples were obtained from (University of North Carolina School of blunt end plasmid vectors with T4 DNA healthy adults, as well as patients with Dental Medicine, Chapel Hill, NC, USA). ligase and then cloned into E. coli (plas- breast, lung, or gastric cancer, and kept mid vectors pSTBlue-1 [Novagen] and frozen at –20° C prior to analysis. A max- RNA Isolation and RT-PCR pSmart [Lucigen, Middleton, WI, USA]). illary hybrid tumor consisting of CEOT RNA was extracted from Kato III cells The recombinant products were de- and an ameloblastoma was furnished by with guanidine isothiocyanate and tected by direct PCR screening or South- Philip Seim (12) and a supernummary cDNAs prepared by a two-step RT-PCR ern analysis of colony lifts using ODAM- tooth follicle by John Hudson. The study procedure using Superscript II reverse specific cDNA probes (13) and their was conducted in accordance with a pro- transcriptase (Invitrogen, Carlsbad, CA, nucleotide sequences confirmed by auto- tocol approved by the University of Ten- USA), Taq polymerase (Eppendorf, mated dideoxy sequencing at the Uni- nessee Graduate School of Medicine’s In- Westbury, NY, USA) and, for ODAM versity of Tennessee’s Molecular Biology stitutional Review Board. synthesis, both coding exon 2 sense Core Facility.

MOL MED 14(5-6)318-326, MAY-JUNE 2008 | KESTLER ET AL. | 319 ODAM PROTEIN EXPRESSION

Coupled transcription–translation re- oligonucleotide distinct from that derived in the Glyca pH 4.0 antigen–retrieval so- actions were run in 20-µLvolumes in the from coding exon 5 (5′-CATGTAAACTG- lution (BioGenex, San Ramon, CA, USA), presence of purified rODAM plasmid GATAGTATTGAAACATCTGT) were used heated in a microwave oven, and then constructs (25 µg/mL) and 35S-Trans in competition experiments to ensure hy- immunostained using the ImmPRESS Label (3000 Ci/mMole-Cys/Met, MBP, bridization specificity. The biotinylated polymerized reporter enzyme-linked Irvine, CA, USA) using a T7 RNA poly- ODAM probe reacted in the presence of a system (Vector Laboratories, Burlingame, merase reticulocyte lysate coupled tran- 100× molar excess of either the matched CA, USA) (15). scription-translation system (Promega, unbiotinylated or the non-related ODAM Madison, WI, USA). Aliquots (1 µL) of antisense oligonucleotide. After hybridiza- Protein Analyses the 35S-labeled products were used in tion, the slides were rinsed with 2× SSC SDS/PAGE was performed under re- immunoprecipitation assays and the re- containing 0.1% pyrophosphate (SSCPP) ducing conditions in 10% tris-glycine sultant precipitates analyzed by SDS/ and then incubated at 42° C for 30 min gels (Invitrogen, Carlsbad, CA, USA). PAGE fluorography, as detailed else- with 125 µLof supplemented hybridiza- Mass spectrometric studies were done as where (14). The rODAM constructs in tion mix containing no probe. After two described (8) using an ion-spray PE-Sciex BL21 (DE3) E. coli were induced in LB successive washes at 42° C for 10 min with type 150 EX instrument. Mass data were broth with 0.1 M isopropylthioguanine 2× SSCPP and then 0.2× SSCPP, the sec- analyzed with Bio Multiview software (IPTG) at 37° C for 3 h with shaking and tions were exposed to HRP–labeled anti- provided by the manufacturer (Applied protein expression documented by West- biotin IgG (Dako, Carpenteria, CA, USA) Biosystems, Foster City, CA, USA). ern blotting. Recombinant molecules and developed for color signal using tyra- were isolated and purified from lysates mide amplification (15). Serologic Assays of IPTG-induced rODAM cultures using The human #7775-1 MTE array (Clon- The immunoassay for measurement of a FLAG-affinity column (Sigma-Aldrich, tech, Palo Alto, CA, USA) containing serum anti-ODAM antibodies involved St. Louis, MO, USA) and size-exclusion RNA from 76 different tissues and cells coating wells in a standard 96-well mi- chromatography. was hybridized, as previously reported crotiter ELISA plate with 100 µLof the (16), using a 32P-labeled ODAM cDNA full-length rODAM (5 µg/mL in PBS). In situ RNA Hybridization and Multiple probe (13). The wells were washed, blocked with Tissue Expression (MTE) Array Analysis BSA, filled with 100 µLof patients’ serum Deparaffinized tumor sections, where Antibodies and Immunoassays diluted 1:50 in PBS/Tween/BSA for 2 h the presence of cellular RNA was docu- Anti-ODAM mAbs were generated by at room temperature, and then washed mented by pyronin Y staining, were first immunizing mice with a synthetic with PBS/Tween. Next, biotinylated goat heated at 90° C for 20 min in 0.5× SSC HPLC-purified peptide encompassing 45 anti-human IgG (in ELISA diluent) was (Standard Saline Citrate–0.3M magnesium amino acids encoded by ODAM exon 4 added to each well and, after 1 h and a chloride, 30 mM sodium citrate, pH 7) and (Keck Biotechnology Resource Labora- wash, the wells were filled with HRP- then pre-hybridized at 42° C for 2 h in a tory, Yale University, New Hampshire, labeled streptavidin. Following a 1 h in- humidified chamber with 125 µLof com- CT, USA), as well as with the shorter cubation and a final wash, the ABTS/ plete hybridization mix (Fisher Scientific, rODAM molecule (residues 127–279). A H2O2 substrate (KPL, Gaithersburg, MD, Norcross, GA, USA) containing 5× SCC, polyclonal antiserum made to a 12-mer USA) was added and the color measured 0.5% SDS, 50% formamide, and 10% dex- synthetic peptide (residues 67–78) was by absorbance photometry 30 min later tran sulfate supplemented with 250 µg/ raised in rabbits (Syn-Pep Corp, Dublin, in an ELISA plate reader at 405 nm using mL yeast tRNA (Ambion, Austin, TX, CA, USA); the anti Gli-1 antibody was a Wallac 1420 Multilabel Counter (Perkin USA), 100 µg/mL sonicated, denatured her- obtained from Santa Cruz Biotech (Santa Elmer, Shelton, CT, USA). Sera were ring sperm DNA (Promega, Madison, WI, Cruz, CA, USA). Immunoprecipitates of tested in duplicate and population statis- USA), 0.05% Na-pyrophosphate, and 0.2 35S-labeled cell lysates and Western blot- tics analyzed for significance using µM of a random 15-mer deoxy-oligomer. ting were analyzed, respectively, by fluo- Graph Pad Prism 4 software. Next, a 5′–biotinylated antisense rography and horseradish peroxidase ODAM–specific oligonucleotide probe in (HRP)-based chemiluminesence, as de- RESULTS hybridization buffer (final concentration, scribed previously (14,17). 0.2 µM) was added, and the incubation For immunohistochemical analyses, Molecular Evidence for ODAM continued overnight at 42°C. Biotinylated 4-µm-thick formalin-fixed paraffin- Expression and unlabeled 30-mer antisense oligonu- embedded tissue sections were mounted We had shown previously (8) that the cleotide probes from coding exon 2 (5′-CA- on poly-L-lysine-coated slides, dried cDNA generated by PCR from a CEOT GAGAAAGGTGGAATCCATGAATT overnight at room temperature, and de- specimen was identical in nucleotide AAGTG) and a 31-mer antisense paraffinized. Sections were first immersed sequence to the coding region of the

320 | KESTLER ET AL. | MOL MED 14(5-6)318-326, MAY-JUNE 2008 RESEARCH ARTICLE

FLJ20513 gene cloned from the human Kato III signet-ring gastric carcinoma cell line (and other sources) that specified a 153-residue protein (9,10). To determine if these cells also expressed a longer ODAM transcript (4), we used a primer specific for the upstream coding exon 2 and found, by RT-PCR, cDNA specifying a 256-residue molecule that included an additional 103 amino acids located N- terminal to the FLJ20513 form and en- compassing positions 24 to 126 (Figure 2).

Synthesis of rODAM-Related Polypeptides Figure 2. Analyses of ODAM RT-PCR prod- To provide the requisite material for ucts derived from the Kato III human gas- immunochemical studies, recombinant tric carcinoma cell line. Lanes 1 and 3 products that represented the coding se- contained cDNAs for exons 5-10 and 2- quences of either the Kato III-derived 10, respectively, and lanes 2 and 4, full- FLJ20513 or exons 2–10 of full-length length aldolase cDNA as an RNA tem- ODAM were synthesized. Analysis of the plate control. two 35S-labeled in vitro translated prod- ucts by SDS/PAGE (Figure 3A) indicated immunized with a 12-mer peptide Mrs of ~21,000 and ~38,000, respectively. (residues 67 to 78). In addition, two IgG These masses were higher that those pre- mAbs were generated: one, designated dicted from their primary structure (i.e., 5A-1, resulted from immunizing mice with 18,424 and 29,298) and may have resulted a peptide encompassing residues 52 to 90 from protein misfolding (or other factors) in coding exon 4, and the other, 8B-4, was that impeded gel migration. Nonetheless, produced against the 153-amino acid mass spectrometric analyses revealed Mrs FLJ20513 form of rODAM. As illustrated in consistent with the expected values and, Figure 3C, mAb 8B-4 immune-precipitated in the case of the long ODAM product, it both exons 2–10 and 5–10 rODAM runoff was comparable to that reported for the translation products. As expected, the 5A-1 Figure 3. In vitro and in vivo expression of rat homolog (4). mAb did not react with the shorter rODAM rODAM. Immunodetection of ODAM poly- Immunoprecipitation and Western molecule corresponding to FLJ20513. To lo- peptides. (A) Fluorographs of 35S-labeled blot studies indicated that the products calize the region of ODAM recognized by translation-runoff products from exons 5-10 contained the C-terminal FLAG epitope mAb 8B-4, we tested by Western blotting (lanes 1 and 2) and exons 2-10 (lanes 3 (Figure 3B). Shorter, immunoreactive pro- the reactivity of this reagent with proteolyti- and 4) plasmid templates encoding FLAG- teins corresponding in size to that en- cally-derived rODAM fragments. These in- tagged ODAM , incubated with a coded by exons 5-10 were consistently cluded molecules spanning residues murine anti-FLAG IgG mAb (lanes 1 and 3) or, as a control, an irrelevant murine IgG observed in both in vivo and in vitro prod- 178–279, 217–279, and 223–279. This anti- mAb (lanes 2 and 4). (B) Western blots of ucts obtained from the larger rODAM body reacted only with the 178–279 compo- exons 5-10 (lane 1) and exons 2-10 (lane 2) construct (these components presumably nent, indicating that the epitope was located forms of rODAM expressed in E. coli and represent partial degradation products, as between ODAM residues 178 and 216 (data probed with the anti-FLAG antibody. noted by other investigators [4], and/or not shown). (C) Fluorographs of 35S-labeled exons 2-10 secondary initiation sites). and 5-10 rODAM translation runoff-prod- ODAM Expression by Normal and ucts (lanes 1 and 4, respectively) immuno- Generation of Anti-ODAM Antibodies Malignant Dental Tissue precipitated with mAbs 5A-1 (lanes 2 and As part of an effort to develop antibod- The monoclonal anti-ODAM anti- 5) and 8B-4 (lanes 3 and 6). ies that would recognize ODAM–related body 5A-1 immunostained CEOT and molecules, synthetic peptides and protein ameloblastoma cells, as well as dental ten-day-old mouse teeth (Figure 4). Similar were used as immunogens. A polyclonal epithelial cells present in unerupted results were obtained with the polyclonal antiserum was obtained from a rabbit human tooth follicles and ameloblasts in anti-ODAM antiserum (not illustrated).

MOL MED 14(5-6)318-326, MAY-JUNE 2008 | KESTLER ET AL. | 321 ODAM PROTEIN EXPRESSION

Figure 4. Immunohistochemical detection of ODAM molecules in malignant and normal dental tissue. Photomicrographs of a human CEOT/ameloblastoma and an extracted supernummary tooth, as well as a developing tooth from a ten-day-old mouse. The upper pan- els depict sections stained with hematoxylin-eosin (H&E); the middle and lower were immunostained (immunoperoxidase reaction) with anti-ODAM mAb 5A-1 or normal mouse serum (NMS), respectively, as primary reagents (TC, calcified epithelial tumor cells; CM, calcified material containing amyloid; AM, ameloblasts; CT, connective tissue; DE, dental epithelium; OD, odontoblasts; EN, enamel). Original magnifications; CEOT, Ameloblastoma, Human tooth follicle, ×200; Murine 10d tooth, ×400.

ODAM Expression by Non-Dental and/or cytoplasm with mAb 8B-4 in 46 Serologic Evidence for ODAM Normal and Malignant Tissue and 48 of the 60 breast and gastric sam- Expression Hybridization of a 70-member human ples, respectively, and in three of six lung To document the presence of ODAM tissue array, using as a probe 32P-labeled specimens contained in a multi-specific molecules in human serum, we utilized a cDNA that encodes the FLJ20513 form of array (examples are illustrated in Figure solid-phase capture ELISA in which wells ODAM, revealed a strong signal with tra- 5C). This reactivity was confined princi- were coated with anti-ODAM mAbs 5A-1 cheal and salivary gland-derived RNA, pally to adenocarcinomas and could be and polyclonal anti-ODAM that were ca- but only a weak reaction with stomach inhibited by the presence of the immuno- pable of detecting this protein in amounts and fetal lung (Figure 5A). ODAM ex- gen. Comparable results were obtained as low as 200 pg. Under the conditions of pression in the two major sites also was using mAb 5A-1, albeit with varying de- the assay, ODAM was not found in analy- evidenced by the demonstration that the grees of intensity, as well as with 8B-4 ses of 24 specimens from normal individ- epithelial cells were immunostained by and the anti-Gli-1 antibody (Figure 6). uals and 48 with epithelial forms of can- mAb 8B-4 (Figure 5B), as well as mAb The presence of ODAM within neoplastic cer. In contrast, antibodies to ODAM were 5A-1 and the polyclonal anti-ODAM anti- breast cells also was shown by in situ present in patients’ sera, as evidenced by serum (not illustrated). Immunohisto- hybridization using a biotin-labeled ELISA using for capture the exons 2–10 chemical analyses of 35 other normal tis- oligonucleotide probe specific for exons rODAM product as the solid phase anti- sues revealed comparable staining of the 2–10-encoded ODAM proteins. This reac- gen. Immunoassay of archival specimens bronchus and, to a lesser extent, ovary, tivity could be diminished by competi- from 72 females with breast cancer re- bladder, ureter, endometrium, and skin. tion with the corresponding unlabeled vealed that 25 (35%) had anti-ODAM IgG Given our detection of ODAM in the specific ODAM oligonucleotide, but not antibodies in titers > 2 standard devia- human gastric carcinoma Kato III cell with a non-corresponding ODAM anti- tions above the mean values of 45 of 48 line, we also analyzed human tumor tis- sense oligonucleotide. In contrast, the normal women (Figure 8A). The differ- sue-specific arrays and found moderate probe did not appear to hybridize with ence between the diseased and healthy to intense immunostaining of the nucleus normal breast tissue (Figure 7). groups was statistically significant, as

322 | KESTLER ET AL. | MOL MED 14(5-6)318-326, MAY-JUNE 2008 RESEARCH ARTICLE

determined by both standard and asym- metric t-test analyses (P < 0.001). The presence of anti-ODAM autoantibodies in patient sera also was demonstrated when these molecules immune-precipitated rODAM (Figure 8B). Similarly, analyses of sera from 63 individuals with lung and seven with gastric cancer revealed that ~30% had anti-ODAM IgG antibody reac- tivity against rODAM > 2 standard devia- tion above the mean values of 27 normal subjects (data not shown).

DISCUSSION The fact that the ODAM gene is located in the SCPP cluster on chromosome 4q13 implies that this element also is involved in tooth formation. Indeed ODAM-related transcripts, highly homologous to the human counterpart, have been identified in mouse and rat enamel organs (1,2,4). Our immunohistochemical studies with mAb 5A-1 have demonstrated the pres- ence of ODAM within ameloblasts in ten- day-old murine teeth, unerupted human tooth follicles (a precursor to dental tu- mors, for example, CEOT) (18), and ameloblastomas. These findings indicate that this molecule has an essential role in normal and tumor-related odontogenesis. Notably, the follicular dendritic cell secre- tory protein gene, FDC-SP, located adja- cent to ODAM, also has been found to be functional in late dental development within the periodontal ligament (19). Sig- naling pathways operative in odontogen- esis include Shh, BMP, FGF, and Wnt that have been shown to be active in dental enamel knot signaling centers present within developing teeth and also in odontogenic tumors (20,21). Similarly, these pathways are considered to be es- sential in embryogenesis and organogen- esis. Recently, it has been revealed by in situ hybridization (3) and immunohisto- Figure 5. Detection of ODAM in normal and malignant tissues. (A) 70-member RNA-con- chemistry (4) that ODAM is strongly ex- taining human tissue microarray (16) hybridized with a 32P-labeled ODAM cDNA probe. pressed in maturation-stage rat incisor Wells e-9, h-7, b-5, and g-11 contained tracheal, salivary gland, stomach, and fetal lung ameloblasts and in the junctional epithe- RNA, respectively. (B) Immunostained tissue sections of normal human trachea and sali- vary gland and (C) human breast, lung, and gastric adenocarcinomas exposed to mAb lium attached to the enamel of erupted 8B-4 as the primary reagent (immunoperoxidase reaction) (CE, columnar epithelium; M, molars, as well as in the late stage of mucosa; SC, sereous cells; MC, mucosal cells; IT, intraductal tumor cells; CT, connective ameloblast-lineage cell cultures (3,4). tissue; ATC, adenocarcinoma tumor cells; GC, gastric carcinoma cells). Original magnifi- Additional products encoded by cations, ×200. within the 4q13 SCPP cluster and

MOL MED 14(5-6)318-326, MAY-JUNE 2008 | KESTLER ET AL. | 323 ODAM PROTEIN EXPRESSION

(AK009298) (28) was found to have a dif- ferent coding sequence at the end of the 5′ region, thus supporting the presence of alternative splicing or, possibly, a 5′ un- translated region (UTR). Seemingly, this short ODAM protein would be deficient in a secretory signal sequence and presum- ably would remain within the cell where it could have a more restrictive or differing functional role from that of the larger ODAM product. Notably, the gene encod- ing ODAM has been predicted to evolve from those specifying enamelin and other evolutionarily-derived dental components, for example, amelogenin and amelotin, where alternative splicing occurs (29–31); this phenomenon has been documented in over 60% of human and mouse genes (32). Our studies have confirmed the pres- ence of ODAM in gastric cancer where we demonstrated immunohistochemi- cally that anti-ODAM mAb 8B-4 im- munostained, with varying degrees of intensity, all but 14 specimens in a 60- member human gastric tumor array. Through serial analyses of gene expres- sion and quantitative RT–PCR of four primary human stomach cancers, it was found that ODAM was one of nine genes over-expressed, as compared with non- Figure 6. Co-localization of ODAM and Gli-1 in human epithelial malignancies. Sections of breast, lung, and gastric cancer immunostained (immunoperoxidase reaction) with anti- gastric tissues, and posited that these ele- ODAM mAb 8B-4 and anti-Gli antibody as primary reagents (CT, connective tissue; IT, infil- ments could serve as possible tumor trating tumor cells; LC, lung carcinoma cells; GC, gastric carcinoma cells; GL, gastric markers (33). Our detection of ODAM in gland). Original magnifications, ×200. other epithelial malignancies, for exam- ple, breast, lung, and gastric cancers, also implicated in dental development in- human trachea and salivary gland. Other suggests that this protein is up-regulated clude amelogenin, amelotin, and investigators have found this entity in in these cancers. Interestingly, the FDC-SP ameloblastin (22,23). Many of these mol- the lacrimal gland (25) and breast ducts gene, adjacent to ODAM in the SCPP ecules, like ODAM, contain few or no (26). Further, homologous ODAM cluster, is expressed in late dental devel- cysteines and are characterized by a rela- cDNAs have been detected in fetal heart opment, as well as in neoplasms of the tively large number of disorder-promot- and lung, as well as in colon tissue (27). breast; further, it has been included as a ing amino acids, such as proline and glu- Historically, the first documented evi- gene signature screening component in- tamine (which, in the case of ODAM, dence of ODAM expression resulted as dicative of breast cancer invasiveness comprise 33 and 40 of the 264 residues of part of the Japanese NEDO human ge- (19,34,35). In the case of colon cancer, this the mature protein, respectively) that can nome sequencing project where FLJ20513 neoplasm results from a progressive se- impart multi-functional properties to cDNA encoding the 153-residue ODAM ries of steps whereby epithelial dysplasia such molecules (24) and may account for component was synthesized using mRNA evolves into a flat adenoma, carcinoma in the presence of ODAM transcripts in from the Kato III human signet ring gas- situ, and finally, adenocarcinoma. Of note odontogenic and non-odontogenic mam- tric carcinoma cell line (9). This transcript is that ODAM expression is increased malian tissues. As for the latter, ODAM (AK000520.1) encompassed coding exons ~6-fold in the earlier stage of disease, i.e., mRNA has been seen in rodent salivary 5–10 of the long form of ODAM, but did flat adenoma, as compared with the nor- and nasal glands (4) and, as we have not contain a 5′-non-coding sequence (9). mal mucosa (36). Notably, epidermal shown, it (and protein) is present in However, a murine ODAM cDNA growth factors such as ampiregulin,

324 | KESTLER ET AL. | MOL MED 14(5-6)318-326, MAY-JUNE 2008 RESEARCH ARTICLE

epigen, and epiregulin, which are found in a variety of human cancers, including those of breast and gastrointestinal ori- gin, map to the identical chromosomal band (4q13.3) and are present in a cis- oriented cluster on the same DNA strand as ODAM and FDC-SP (37). ODAM may have a functional role in the pathogenesis of epithelial malig- nances, given that this molecule has been shown to interact with parvalbumin (an EF-hand calcium-binding protein) and ad- ditionally, modulates the expression of at least one metalloproteinase (MMP-20), molecules implicated in aggressive and metastatic cancer (38,39). Further, we posit that the ODAM gene is up-regulated Figure 7. In situ competition analyses of ODAM transcript expression in neoplastic human by the Shh pathway which is involved in breast tissue. Formalin–fixed deparaffinized sections of an (A) intraductal adenocarci- carcinogenesis, as evidenced by the con- noma or (B) normal breast tissue hybridized with a biotinylated antisense specific oligonu- comitant expression of the zinc finger cleotide probe for ODAM in the presence of 100× excess of either the non-specific (Panel 1) transcription factor Gli-1 (an Shh pathway or specific (Panel 2) unlabeled ODAM oligonucleotides. The sections in Panel 3 were member) in CEOT and other odontogenic stained with pyronin Y (CT, connective tissue; IT, intraductal tumor cells; ID, interlobular neoplasms (7,40), as well as gastric (41), duct). Original magnifications, ×200. breast (42,43), and lung cancers (44). The discovery that ODAM, in addition to its role in the development of teeth and other body tissues, may be implicated in neo- plastic transformation has potential diag- nostic and therapeutic relevance. Autoantibodies frequently are found in the sera of patients with malignances and the titers of these components have been correlated to survival and other clinico- pathological parameters (45–47). Notably, the reactivity of these molecules may be directed against cancer-associated pro- teins (for example, Her-2, Nectin-4, Muc-1) that have been implicated in ei- ther tumor growth or invasiveness (48,49). In this regard, our detection of serum anti-ODAM IgG antibodies in patients with breast, lung, and gastric cancer im- plies that they represent an immune re- sponse that may have functional import. Further, the presence and titer of anti- ODAM antibodies could serve as a Figure 8. Detection of serum anti-ODAM IgG autoantibodies. (A) Serum samples from 72 unique prognostic biomarker for patients patients with breast cancer (BrCa) and 48 healthy females were tested for antibody re- with epithelial forms of cancer. activity to rODAM by ELISA. The mean O.D.s for the patient and control groups, 0.662 and 0.459, differed significantly (P < 0.001). The cutoff value for positives (dotted line equals O.D. 0.750) was derived from the mean of the healthy subjects plus two standard devia- ACKNOWLEDGMENTS tions. (B) Radiolabeled rODAM was subjected to immunoprecipitation with anti-ODAM We thank P Seim for furnishing the mAb 8B-4, as well as with normal human sera (NHS) and sera from three of the above pa- CEOT/ameloblastoma specimen, J T tients with the highest anti-ODAM antibody reactivities. Wright for the mouse dental tissue,

MOL MED 14(5-6)318-326, MAY-JUNE 2008 | KESTLER ET AL. | 325 ODAM PROTEIN EXPRESSION

JHudson for the supernummary tooth Cdk inhibitors and Cdc25A independent of cy- 32. Noh SJ, Lee K, Paik H, Hur CG. (2006) TISA: follicle, Elliot K. Swab for technical assis- clin D1-Cdk4 function. Mol. Cell Biol. 21:794–810. tissue-specific alternative splicing in human and 15. Solomon A et al. (2006) Amyloid contained in the tance, and Keira Clark for manuscript mouse genes. DNA Res. 13:229–43. knee joint meniscus is formed from apolipopro- 33. Aung PP et al. (2006) Systematic search for gastric preparation. This work was supported, tein A-I. Arthritis Rheum. 54:3545–50. cancer-specific genes based on SAGE data: mela- in part, by USPHS Research Grant CA- 16. Tchaikovskaya T et al. (2005) Glutathione S- noma inhibitory activity and matrix metallopro- 10056 from the National Cancer Institute transferase hGSTM3 and ageing-associated neu- teinase-10 are novel prognostic factors in patients rodegeneration: relationship to Alzheimer’s dis- and the University of Tennessee Medical with gastric cancer. Oncogene. 25:2546–57. ease. Mech. Ageing Dev. 126:309–15. 34. Zucchi I et al. (2004) Gene expression profiles of ep- Center’s Physician’s Medical and Educa- 17. Gengozian N, Foster JS, Kestler DP. (2005) Char- ithelial cells microscopically isolated from a breast- tion Research Foundation. acterization of a monoclonal antibody identify- invasive ductal carcinoma and a nodal metastasis. ing a CD45RA antigen on feline leukocytes. Vet. Proc. Natl. Acad. Sci. U.S.A. 101:18147–52. Immunol. Immunopathol. 108:253–64. 35. Liu R et al. (2007)The prognostic role of a gene REFERENCES 18. Philipsen HP, Reichart PA. (2000) Calcifying ep- signature from tumorigenic breast-cancer cells. 1. Moffatt P, Smith CE, Sooknanan R, St-Arnaud R, ithelial odontogenic tumor: biological profile N. Engl. J. Med. 356:217–26. Nanci A. (2006) Identification of secreted and based on 181 cases from the literature. Oral 36. Kita H et al. (2006) Differential gene expression membrane proteins in the rat incisor enamel Oncol. 36:17–26. between flat adenoma and normal mucosa in the organ using a signal-trap screening approach. 19. Nakamura S et al. (2005) Identification of genes pref- colon in a microarray analysis. J. Gastroenterol. Eur. J. Oral Sci. 114 (Suppl 1):139–46. erentially expressed in periodontal ligament: specific 41:1053–63. 2. Kawasaki K, Weiss KM. (2003) Mineralized tissue expression of a novel secreted protein, FDC-SP. 37. http:www.ncbi.nlm.nih.gov/mapview/maps. and vertebrate evolution: the secretory calcium- Biochem. Biophys. Res. Commun. 338:1197–203. binding phosphoprotein gene cluster. Proc. Natl. 20. Matalova E, Antonarakis GS, Sharpe PT, Tucker Gene Mapviewer: ODAM http://www. Acad. Sci. U.S.A. 100:4060–5. AS. (2005) Cell lineage of primary and secondary ncbi.nlm.nih.gov/ Updated April 4, 2008. 3. Park JC, et al. (2007) The amyloid protein APin is enamel knots. Dev. Dyn. 233:754–9. 38. Cross SS, Hamdy FC, Deloulme JC, Rehman I. highly expressed during enamel mineralization 21. Jernvall J, Thesleff I. (2000) Reiterative signaling (2005) Expression of S100 proteins in normal and maturation in rat incisors. Eur. J. Oral Sci. and patterning during mammalian tooth mor- human tissues and common cancers using tissue 115:153–60. phogenesis. Mech. Dev. 92:19–29. microarrays: S100A6, S100A8, S100A9, and 4. Moffatt, P. Smith, CE, St-Arnaud R, Nanci A. 22. Kawasaki K, Weiss KM. (2006) Evolutionary S100A11 are all overexpressed in common can- (2008) Characterization of APin, a secreted pro- genetics of vertebrate tissue mineralization: the cers. Histopathology. 46:256–69. tein highly expressed in tooth-associated epithe- origin and evolution of the secretory calcium- 39. Deryugina EI, Quigley JP. (2006) Matrix metallo- lia. J. Cell Biochem. 103:941–60. binding phosphoprotein family. J. Exp. Zoolog. B. proteinases and tumor metastasis. Cancer Metas- 5. Rosty C, et al. (2005) Clinical and biological char- Mol. Dev. Evol. 306:295–316. tasis Rev. 25:9–34. acteristics of cervical neoplasias with FGFR3 mu- 23. Iwasaki K et al. (2005) Amelotin-a Novel Secreted, 40. Zhang L et al. (2006) Epithelial expression of tation. Mol. Cancer. 4:15. Ameloblast-specific protein. J. Dent. Res. 84:1127–32. SHH signaling pathway in odontogenic tumors. 6. Aung PP, et al. (2006) Systematic search for gas- 24. Huq NL, Cross KJ, Ung M, Reynolds EC. (2005) A Oral Oncol. 42:398–408. tric cancer-specific genes based on SAGE data: review of protein structure and gene organisation 41. Ma X et al. (2005) Frequent activation of the melanoma inhibitory activity and matrix metallo- for proteins associated with mineralised tissue hedgehog pathway in advanced gastric adeno- proteinase-10 are novel prognostic factors in pa- and calcium phosphate stabilisation encoded on carcinomas. Carcinogenesis. 26:1698–705. tients with gastric cancer. Oncogene. 25:2546–57. human . Arch. Oral Biol. 50:599–609. 42. Mukherjee S et al. (2006) Hedgehog signaling and 7. www.ncbi.nlm.nih.gov/ HomoloGene: 49511 25. Ozyildirim AM, Wistow GJ, Gao J, Wang J, Dick- response to cyclopamine differ in epithelial and Gene conserved in Eutheria. http://www.ncbi. inson DP, Frierson HF Jr, Laurie GW. (2005) The stromal cells in benign breast and breast cancer. nlm.nih.gov/ Updated April 4, 2008. lacrimal gland transcriptome is an unusually rich Cancer Biol. Ther. 5:674–83. 8. Solomon A, Murphy CL, Weaver K, et al. (2003) source of rare and poorly characterized gene tran- 43. Hatsell S, Frost AR. (2007) Hedgehog signaling in Calcifying epithelial odontogenic (Pindborg) scripts. Invest. Ophthalmol. Vis. Sci. 46:1572–80. mammary gland development and breast cancer. tumor-associated amyloid consists of a novel 26. Rijnkels M, Elnitski L, Miller W, Rosen JM. (2003) J. Mammary Gland Biol. Neoplasia. 12:163–73. human protein. J. Lab. Clin. Med. 142:348–55. Multispecies comparative analysis of a mammalian- 44. Lemjabbar-Alaoui H et al. (2006) Wnt and hedge- 9. Sugano S, et al. 2000. Hypothetical protein specific genomic domain encoding secretory pro- hog are critical mediators of cigarette smoke- FLJ20513 (FLJ20513 mRNA), Accession teins. Genomics. 82:417–32. induced lung cancer. PLoS ONE. 1:e93. AK000520, www.ncbi.nlm.nih.gov/ Updated 27. www.ncbi.nlm.nih.gov/ UniGene: Hs. 143811 45. Soussi T. (2000) Antibodies in the sera of patients September 12, 2008. Homo sapiens ODAM expression profile. http:// with various types of cancer: a review. Cancer 10. Sekiguchi M, Sakakibara K, Fujii G. (1978) Estab- www.ncbi.nlm.nih.gov/ Updated February 11, Res. 60:1777–88. lishment of cultured cell lines derived from a 2008. 46. Fernandez MF. (2005) Autoantibodies in breast human gastric carcinoma. Jpn. J. Exp. Med. 48:61–8. 28. Adachi J et al. (2000) Direct submission, Accession 11. Murphy CL et al. (2008) Odontogenic ameloblast- AK009298, www.ncbi.nlm.nih,gov/ Updated cancer sera: candidate biomarkers and reporters associated protein nature of the amylid found in February 11, 2008. of tumorigenesis. Cancer Lett. 230:187–98. calcifying epithelial odontogenic tumors and 29. Sire JY, Davit-Bela T, Delgado S, Gu X. (2007) The 47. Toubi E, Shoenfeld Y. (2007) Protective autoim- unerupted tooth follicles. Amyloid 15:89-95. origin and evolution of enamel mineralization munity in cancer (review). Oncol. Rep. 17:245–51. 12. Seim P, Regezi JA, O’Ryan F. (2005) Hybrid genes. Cells Tissues Organs. 186:25–48. 48. Lacroix M. (2006) Significance, detection and ameloblastoma and calcifying epithelial odonto- 30. Ravindranath RM, Devarajan A, Uchida T. (2007) markers of disseminated breast cancer cells. En- genic tumor: case report. J. Oral Maxillofac. Surg. Spatiotemporal expression of ameloblastin iso- docr. Relat. Cancer. 13:1033–67. 63:852–5. forms during murine tooth development J. Biol. 49. Fabre-Lafay S, Monville F, Garrido-Urbani S. 13. Kestler DP, Hill M, Agarwal S, Hall RE. (2000) Chem. 282:36370–76. (2007) Nectin-4 is a new histological and serolog- Use of bidirectional blots in differential display 31. Moffatt P, Smith CE, St-Arnaud R, Simmons D, ical tumor associated marker for breast cancer. analysis. Anal. Biochem. 280:216–20. Wright JT, Nanci A. (2006) Cloning of rat BMC Cancer. 7:73. 14. Foster JS, Henley DC, Bukovsky A, Seth P, amelotin and localization of the protein to the Wimalasena J. (2001) Multifaceted regulation of basal lamina of maturation stage ameloblasts and cell cycle progression by estrogen: regulation of junctional epithelium. Biochem. J. 399:37–46.

326 | KESTLER ET AL. | MOL MED 14(5-6)318-326, MAY-JUNE 2008