Expression of Odontogenic Ameloblast-Associated Protein (ODAM) in Dental and Other Epithelial Neoplasms

Expression of Odontogenic Ameloblast-Associated Protein (ODAM) in Dental and Other Epithelial Neoplasms Daniel P Kestler, James S Foster, Sallie D Macy, Charles L Murphy, Deborah T Weiss, and Alan Solomon Human Immunology and Cancer Program, Department of Medicine, University of Tennessee Graduate School of Medicine, Knoxville, Tennessee, United States of America We previously have communicated our discovery that the amyloid associated with calcifying epithelial odontogenic tumors is composed of N-terminal fragments of the structurally novel odontogenic ameloblast-associated protein designated ODAM. Sub- sequently, it was shown by other investigators that ODAM is expressed in rodent enamel organ and is likely involved in dental development. We now report that this molecule also is found in certain human tissues, principally the salivary gland and trachea, as evidenced by RNA array analysis and immunohistochemistry-utilizing antibodies prepared against synthetic ODAM-related peptides and recombinant protein. Notably, these reagents immunostained normal and malignant ameloblasts and other types of human neoplastic cells, including those of gastric, lung, and breast origin where the presence in the latter was confirmed by in situ hybridization using gene-specific molecular probes. Moreover, significant titers of anti-ODAM IgG antibodies were detected in the sera of patients with these malignancies. Our studies have provided the first evidence in humans for the cellular expression of ODAM in normal and diseased states. Based on our findings, we posit that ODAM is a developmental antigen that has an es- sential role in tooth maturation and in the pathogenesis of certain odontogenic and other epithelial neoplasms; further, we suggest that ODAM may serve as a novel prognostic biomarker, as well as a potential diagnostic and therapeutic target for patients with breast and other epithelial forms of cancer. Online address: http://www.molmed.org doi: 10.2119/2008-00010.Kestler INTRODUCTION designated APin) in odontogenesis, the composed of N-terminal fragments of a Odontogenic ameloblast-associated results of DNA microarray analyses 153-residue hypothetical protein speci- protein (ODAM) is encoded by a gene have shown that ODAM expression is fied by the FLJ20513 gene (a short form originally termed EO-009 (1) that con- up-regulated in human cervical (5) and of ODAM cDNA cloned from the Kato III sists of ten coding exons (Figure 1) lo- gastric cancer (6). human signet-ring gastric carcinoma cell cated within an ~800 kbp region of Although ODAM-related gene tran- line [9,10]), where the last six of ten pro- chromosome 4q13 containing the secre- scripts have been detected in a variety of tein-encoding exons of ODAM are lo- tory calcium-binding phosphoprotein mammalian tissues, including those of cated. Subsequently, in studies of amy- (SCPP) cluster that specifies elements human, chimpanzee, mouse, rat, and ca- loid from four other CEOT cases, we involved in bone and tooth develop- nine origin (7), our report that the amy- identified varying amounts of a second ment, as well as mineralization (2). loid associated with calcifying epithelial ODAM-related protein with residues Studies of rodent tissue have revealed odontogenic tumors (CEOT) is formed originating from the fourth exon (11). that ODAM is highly expressed by ma- from an ODAM molecule provided the This discovery provided conclusive evi- ture ameloblasts (3) and is present in first example of this protein’s expression dence for the transcription of a longer the enamel organ and junctional ep- (8). Through chemical analyses of amy- ODAM product that was predicted to ithelial cells (4). In addition to the po- loid fibrils isolated from three specimens, consist of 279 amino acids, 126 of which tential role of this protein (formerly we found that these components were are products of the first four coding exons (1,4). To gain further insight into the potential role of ODAM in tissue development Address correspondence and reprint requests to Alan Solomon, University of Tennessee and carcinogenesis, we have generated Graduate School of Medicine, 1924 Alcoa Highway, Knoxville TN 37920. Phone: 865-305- anti-ODAM specific polyclonal and 9167; Fax: 865-305-6865; E-mail: [email protected]. monoclonal antibodies, using as im- Submitted January 23, 2008; Accepted for publication March 17, 2008; Epub (www. munogens synthetic peptides and re- molmed.org) ahead of print April 11, 2008. combinant protein. We now report that 318 | KESTLER ET AL. | MOL MED 14(5-6)318-326, MAY-JUNE 2008 RESEARCH ARTICLE (5′-ATGTCTGCCAGCAATAGCAAT) and exon 10 antisense (5′TGGTTCCC TTAGGCTGTCAGT) primers which yielded a product encoding amino acid residues 25–279. To obtain by PCR a cDNA specifying the shorter (i.e., 153- residue) FLJ20513 product, exons 5 sense (5′ATGCCCTATGTATTCTCC) and 10 antisense primers were utilized. Aldolase-B sense and antisense primers began, respectively, at the start (5′-ATGCC CTACCAATATCCAGCACT) and termination (5′-TTAATAGGCGTGGTTAGA GACG) of the coding sequence. The re- actions were run on an MJ Research model PTC-200 (Bio-RAD, Richmond, CA, USA) PCR apparatus for up to 40 cycles of amplification, each consisting Figure 1. The deduced amino acid sequence encoded by the human ODAM gene. The of 1 min at 94, 62, and 72° C, followed signal peptide region is underlined. The amino acids are numbered as given in Reference by a single 15-min incubation cycle at 1 and the ten coding exons specifying the secreted form of the ODAM are shown above. 72° C prior to agarose gel analysis. For expression of recombinant protein generated from the ODAM PCR products, these reagents recognized ODAM mole- Cells and Tissues the constructs included forward primers cules, not only in ameloblasts, but also The human signet-ring gastric carci- encoding the first methionine residue in certain normal and neoplastic human noma Kato III cell line was obtained from specified by the second and fifth coding epithelial tissues—a finding confirmed the American Type Culture Collection exons (5′-ATGTCTGCCAGCAATAGCAAT at the molecular level through RNA (ATCC, Rockville, MD, USA). Cells were and 5′-ATGCCCTATGT ATTCTCC, respec- array and in situ hybridization analyses. grown in RPMI supplemented with tively) and an exon 10 reverse primer Our studies have provided definite evi- L-glutamine, penicillin/streptomycin, and (5′-TGGTTCCCTTAGGCTGTCAGT) dence that ODAM is expressed under 10% FBS at 37° C in a humidified incuba- containing the last seven ODAM physiologic and pathologic conditions tor with a 95% air and 5% CO2 atmos- residues. For optimal prokaryotic protein and suggest that when up-regulated, phere at densities of 0.1-1 × 106 cells/mL. production, detection, and purification this protein may serve clinically as a Human normal and malignant tissue purposes, the constructs also included a novel cancer biomarker and provide a arrays (breast, stomach, and lung) were ribosomal binding site, a C-terminal therapeutic target for patients with cer- purchased from Zymed–Invitrogen (San FLAG peptide, and a termination codon. tain epithelial malignancies. Francisco, CA, USA) and a multi-tissue ODAM cDNA was prepared from sausage array from BioGenex (San PCR-generated fragments rendered MATERIALS AND METHODS Ramon, CA, USA). Mouse ten-day-old blunt using the Novagen (Madison, WI, fixed, embedded odontogenic tissue was USA) Perfectly Blunt Cloning Kit end Patient Specimens kindly provided by J Timothy Wright conversion reagents and were ligated to Serum samples were obtained from (University of North Carolina School of blunt end plasmid vectors with T4 DNA healthy adults, as well as patients with Dental Medicine, Chapel Hill, NC, USA). ligase and then cloned into E. coli (plas- breast, lung, or gastric cancer, and kept mid vectors pSTBlue-1 [Novagen] and frozen at –20° C prior to analysis. A max- RNA Isolation and RT-PCR pSmart [Lucigen, Middleton, WI, USA]). illary hybrid tumor consisting of CEOT RNA was extracted from Kato III cells The recombinant products were de- and an ameloblastoma was furnished by with guanidine isothiocyanate and tected by direct PCR screening or South- Philip Seim (12) and a supernummary cDNAs prepared by a two-step RT-PCR ern analysis of colony lifts using ODAM- tooth follicle by John Hudson. The study procedure using Superscript II reverse specific cDNA probes (13) and their was conducted in accordance with a pro- transcriptase (Invitrogen, Carlsbad, CA, nucleotide sequences confirmed by auto- tocol approved by the University of Ten- USA), Taq polymerase (Eppendorf, mated dideoxy sequencing at the Uni- nessee Graduate School of Medicine’s In- Westbury, NY, USA) and, for ODAM versity of Tennessee’s Molecular Biology stitutional Review Board. synthesis, both coding exon 2 sense Core Facility. MOL MED 14(5-6)318-326, MAY-JUNE 2008 | KESTLER ET AL. | 319 ODAM PROTEIN EXPRESSION Coupled transcription–translation re- oligonucleotide distinct from that derived in the Glyca pH 4.0 antigen–retrieval so- actions were run in 20-µLvolumes in the from coding exon 5 (5′-CATGTAAACTG- lution (BioGenex, San Ramon, CA, USA), presence of purified rODAM plasmid GATAGTATTGAAACATCTGT) were used heated in a microwave oven, and then constructs (25 µg/mL) and 35S-Trans in competition experiments to ensure hy- immunostained using the ImmPRESS Label (3000 Ci/mMole-Cys/Met, MBP, bridization specificity. The biotinylated polymerized reporter enzyme-linked Irvine, CA, USA) using a T7 RNA poly- ODAM probe reacted in the presence of a system (Vector Laboratories, Burlingame, merase reticulocyte lysate coupled tran- 100× molar excess of either the matched CA, USA) (15). scription-translation system (Promega, unbiotinylated or the non-related ODAM Madison, WI, USA). Aliquots (1 µL) of antisense oligonucleotide. After hybridiza- Protein Analyses the 35S-labeled products were used in tion, the slides were rinsed with 2× SSC SDS/PAGE was performed under re- immunoprecipitation assays and the re- containing 0.1% pyrophosphate (SSCPP) ducing conditions in 10% tris-glycine sultant precipitates analyzed by SDS/ and then incubated at 42° C for 30 min gels (Invitrogen, Carlsbad, CA, USA).

Load more