Eye in a Disk: Eyeintegration Human Pan-Eye and Body 2 Transcriptome Database Version 1.0
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
University of California, San Diego
UNIVERSITY OF CALIFORNIA, SAN DIEGO The post-terminal differentiation fate of RNAs revealed by next-generation sequencing A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biomedical Sciences by Gloria Kuo Lefkowitz Committee in Charge: Professor Benjamin D. Yu, Chair Professor Richard Gallo Professor Bruce A. Hamilton Professor Miles F. Wilkinson Professor Eugene Yeo 2012 Copyright Gloria Kuo Lefkowitz, 2012 All rights reserved. The Dissertation of Gloria Kuo Lefkowitz is approved, and it is acceptable in quality and form for publication on microfilm and electronically: __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ Chair University of California, San Diego 2012 iii DEDICATION Ma and Ba, for your early indulgence and support. Matt and James, for choosing more practical callings. Roy, my love, for patiently sharing the ups and downs of this journey. iv EPIGRAPH It is foolish to tear one's hair in grief, as though sorrow would be made less by baldness. ~Cicero v TABLE OF CONTENTS Signature Page .............................................................................................................. iii Dedication .................................................................................................................... -
Ccdc80 and Ccdc80-L1: Identification and Functional Analysis of Two Novel Genes Involved in Zebrafish (Danio Rerio) Development
UNIVERSITÀ DEGLI STUDI DI MILANO SCUOLA DI DOTTORATO IN SCIENZE BIOLOGICHE E MOLECOLARI DIPARTIMENTO DI BIOLOGIA DOTTORATO DI RICERCA IN BIOLOGIA CELLULARE E MOLECOLARE XXIV CICLO ccdc80 and ccdc80-l1: Identification and Functional Analysis of Two Novel Genes Involved in Zebrafish (Danio rerio) Development settori scientifico/disciplinari: BIO/06; BIO/11 Tesi di dottorato di Chiara Brusegan R08215 TUTOR: prof. Franco Cotelli COORDINATORE DEL DOTTORATO: prof. Martino Bolognesi A.A. 2010/2011 Index Part I 1. Abstract 1 2. State of the art 2 2.1 Motility of the zebrafish embryo 2 2.2 Muscle formation 3 2.3 Neural differentiation 6 2.4 Identification of zebrafish ccdc80 genes 9 3. Aim of the project 13 4. Materials and Methods 14 4.1 Zebrafish lines and maintenance 14 4.2 Sequence analysis 14 4.3 RT-PCR 15 4.4 Synthesis of probes for whole mount in situ hybridization (WISH) 16 4.5 Whole-mount in situ hybridization 17 4.6 Immunohistochemistry 17 4.7 Histological sections 18 4.8 Injections 18 4.9 Cyclopamine treatment 19 4.10 Statistical analysis 19 5. Results 20 5.1 Identification of ccdc80 homologs in the genome of zebrafish 20 5.2.1 ccdc80 expression profiling 22 5.2.2 ccdc80-loss- and gain-of-function affects somitogenesis in vivo 23 5.2.3 ccdc80 is involved in somitogenesis, but not in the development of the notochord 25 5.2.4 ccdc80 is positively regulated by the Hedgehog pathway 26 5.3.1 ccdc80-l1 expression profiling 27 5.3.2 ccdc80-l1 knocked-down embryos displayed impaired motility 29 5.3.3 ccdc80-l1 loss of function does not affect somitogenesis nor muscle pioneers and adaxial cells formation 30 5.3.4 analysis of neurogenesis of primary motoneurons in ccdc80-l1 morphants 32 5.3.5 Also ccdc80-l1 expression is positively regulated by the Hedgehog pathway 35 5.4.1 ccdc80 expression is not regulated by ccdc80-l1, nor vice versa 37 6. -
A University of Sussex Phd Thesis Available Online Via
A University of Sussex PhD thesis Available online via Sussex Research Online: http://sro.sussex.ac.uk/ This thesis is protected by copyright which belongs to the author. This thesis cannot be reproduced or quoted extensively from without first obtaining permission in writing from the Author The content must not be changed in any way or sold commercially in any format or medium without the formal permission of the Author When referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given Please visit Sussex Research Online for more information and further details Exploring interactions between Epstein- Barr virus transcription factor Zta and The Human Genome By IJIEL BARAK NARANJO PEREZ FERNANDEZ A Thesis submitted for the degree of Doctor of Philosophy University Of Sussex School of Life Sciences September 2017 ii I hereby declare that this thesis has not been and will not be, submitted in whole or in part to another University for the award of any other degree. Signature:…………………………..…………………………..……………………… iii Acknowledgements I want to thank Professor Alison J Sinclair for her guidance, mentoring and above all continuous patience. During the time that I’ve been part of her lab I’ve appreciated her wisdom as an educator her foresight as a scientist and tremendous love as a parent. I wish that someday soon rather than later her teachings are reflected in my person and career; hopefully inspiring others like me. Thanks to Professor Michelle West for her help whenever needed or offered. Her sincere and honest feedback, something that I only learned to appreciate after my personal scientific insight was developed. -
Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Tepzz¥ 6Z54za T
(19) TZZ¥ ZZ_T (11) EP 3 260 540 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 27.12.2017 Bulletin 2017/52 C12N 15/113 (2010.01) A61K 9/127 (2006.01) A61K 31/713 (2006.01) C12Q 1/68 (2006.01) (21) Application number: 17000579.7 (22) Date of filing: 12.11.2011 (84) Designated Contracting States: • Sarma, Kavitha AL AT BE BG CH CY CZ DE DK EE ES FI FR GB Philadelphia, PA 19146 (US) GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO • Borowsky, Mark PL PT RO RS SE SI SK SM TR Needham, MA 02494 (US) • Ohsumi, Toshiro Kendrick (30) Priority: 12.11.2010 US 412862 P Cambridge, MA 02141 (US) 20.12.2010 US 201061425174 P 28.07.2011 US 201161512754 P (74) Representative: Clegg, Richard Ian et al Mewburn Ellis LLP (62) Document number(s) of the earlier application(s) in City Tower accordance with Art. 76 EPC: 40 Basinghall Street 11840099.3 / 2 638 163 London EC2V 5DE (GB) (71) Applicant: The General Hospital Corporation Remarks: Boston, MA 02114 (US) •Thecomplete document including Reference Tables and the Sequence Listing can be downloaded from (72) Inventors: the EPO website • Lee, Jeannie T •This application was filed on 05-04-2017 as a Boston, MA 02114 (US) divisional application to the application mentioned • Zhao, Jing under INID code 62. San Diego, CA 92122 (US) •Claims filed after the date of receipt of the divisional application (Rule 68(4) EPC). (54) POLYCOMB-ASSOCIATED NON-CODING RNAS (57) This invention relates to long non-coding RNAs (IncRNAs), libraries of those ncRNAs that bind chromatin modifiers, such as Polycomb Repressive Complex 2, inhibitory nucleic acids and methods and compositions for targeting IncRNAs. -
A Single-Cell Transcriptomic Landscape of Primate Arterial Aging
ARTICLE https://doi.org/10.1038/s41467-020-15997-0 OPEN A single-cell transcriptomic landscape of primate arterial aging Weiqi Zhang 1,2,3,4,5,13, Shu Zhang6,7,13, Pengze Yan3,8,13, Jie Ren7,9,13, Moshi Song3,5,8, Jingyi Li2,3,8, Jinghui Lei4, Huize Pan2,3, Si Wang3,5,8, Xibo Ma3,10, Shuai Ma2,3,8, Hongyu Li2,3, Fei Sun2,3, Haifeng Wan3,5,11, ✉ ✉ ✉ Wei Li 3,5,11, Piu Chan4, Qi Zhou3,5,11, Guang-Hui Liu 2,3,4,5,8 , Fuchou Tang 6,7,9,12 & Jing Qu 3,5,11 Our understanding of how aging affects the cellular and molecular components of the vas- 1234567890():,; culature and contributes to cardiovascular diseases is still limited. Here we report a single-cell transcriptomic survey of aortas and coronary arteries in young and old cynomolgus monkeys. Our data define the molecular signatures of specialized arteries and identify eight markers discriminating aortic and coronary vasculatures. Gene network analyses characterize tran- scriptional landmarks that regulate vascular senility and position FOXO3A, a longevity- associated transcription factor, as a master regulator gene that is downregulated in six subtypes of monkey vascular cells during aging. Targeted inactivation of FOXO3A in human vascular endothelial cells recapitulates the major phenotypic defects observed in aged monkey arteries, verifying FOXO3A loss as a key driver for arterial endothelial aging. Our study provides a critical resource for understanding the principles underlying primate arterial aging and contributes important clues to future treatment of age-associated vascular disorders. 1 CAS Key Laboratory of Genomic and Precision Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101, China. -
Supplementary Table 1: Adhesion Genes Data Set
Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like, -
Learning from Cadherin Structures and Sequences: Affinity Determinants and Protein Architecture
Learning from cadherin structures and sequences: affinity determinants and protein architecture Klára Fels ıvályi Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Klara Felsovalyi All rights reserved ABSTRACT Learning from cadherin structures and sequences: affinity determinants and protein architecture Klara Felsovalyi Cadherins are a family of cell-surface proteins mediating adhesion that are important in development and maintenance of tissues. The family is defined by the repeating cadherin domain (EC) in their extracellular region, but they are diverse in terms of protein size, architecture and cellular function. The best-understood subfamily is the type I classical cadherins, which are found in vertebrates and have five EC domains. Among the five different type I classical cadherins, the binding interactions are highly specific in their homo- and heterophilic binding affinities, though their sequences are very similar. As previously shown, E- and N-cadherins, two prototypic members of the subfamily, differ in their homophilic K D by about an order of magnitude, while their heterophilic affinity is intermediate. To examine the source of the binding affinity differences among type I cadherins, we used crystal structures, analytical ultracentrifugation (AUC), surface plasmon resonance (SPR), and electron paramagnetic resonance (EPR) studies. Phylogenetic analysis and binding affinity behavior show that the type I cadherins can be further divided into two subgroups, with E- and N-cadherin representing each. In addition to the affinity differences in their wild-type binding through the strand-swapped interface, a second interface also shows an affinity difference between E- and N-cadherin. -
Chromatin Accessibility Changes at Intergenic Regions Associated with Ovarian Cancer Drug Resistance
Gallon et al. Clin Epigenet (2021) 13:122 https://doi.org/10.1186/s13148-021-01105-6 RESEARCH Open Access Chromatin accessibility changes at intergenic regions are associated with ovarian cancer drug resistance John Gallon1†, Erick Loomis1†, Edward Curry1, Nicholas Martin2, Leigh Brody3, Ian Garner1, Robert Brown1,4* and James M. Flanagan1* Abstract Background: Resistance to DNA damaging chemotherapies leads to cancer treatment failure and poor patient prog- nosis. We investigated how genomic distribution of accessible chromatin sites is altered during acquisition of cisplatin resistance using matched ovarian cell lines from high grade serous ovarian cancer (HGSOC) patients before and after becoming clinically resistant to platinum-based chemotherapy. Results: Resistant lines show altered chromatin accessibility at intergenic regions, but less so at gene promoters. Clusters of cis-regulatory elements at these intergenic regions show chromatin changes that are associated with altered expression of linked genes, with enrichment for genes involved in the Fanconi anemia/BRCA DNA damage response pathway. Further, genome-wide distribution of platinum adducts associates with the chromatin changes observed and distinguish sensitive from resistant lines. In the resistant line, we observe fewer adducts around gene promoters and more adducts at intergenic regions. Conclusions: Chromatin changes at intergenic regulators of gene expression are associated with in vivo derived drug resistance and Pt-adduct distribution in patient-derived HGSOC drug resistance models. Keywords: Cancer, Chemotherapy, Drug resistance, Epigenomics, Ovarian Background chemotherapy, they will eventually relapse with disease Platinum-based chemotherapeutics, such as cisplatin and that fails to respond to treatment leading to poor survival carboplatin, are clinically important frst line therapies [3, 4]. -
Comprehensive Genome Methylation Analysis in Bladder Cancer: Identification and Validation of Novel Methylated Genes and Application of These As Urinary Tumor Markers
Published OnlineFirst July 25, 2011; DOI: 10.1158/1078-0432.CCR-10-2659 Clinical Cancer Human Cancer Biology Research Comprehensive Genome Methylation Analysis in Bladder Cancer: Identification and Validation of Novel Methylated Genes and Application of These as Urinary Tumor Markers Thomas Reinert1, Charlotte Modin1, Francisco M. Castano1, Philippe Lamy1, Tomasz K. Wojdacz4, Lise Lotte Hansen4, Carsten Wiuf3, Michael Borre2, Lars Dyrskjøt1, and Torben F. Ørntoft1 Abstract Purpose: Epigenetic alterations are common and can now be addressed in a parallel fashion. We investigated the methylation in bladder cancer with respect to location in genome, consistency, variation in metachronous tumors, impact on transcripts, chromosomal location, and usefulness as urinary markers. Experimental Design: A microarray assay was utilized to analyze methylation in 56 samples. Inde- pendent validation was conducted in 63 samples by a PCR-based method and bisulfite sequencing. The methylation levels in 174 urine specimens were quantified. Transcript levels were analyzed using expression microarrays and pathways were analyzed using dedicated software. Results: Global methylation patterns were established within and outside CpG islands. We validated methylation of the eight tumor markers genes ZNF154 (P < 0.0001), HOXA9 (P < 0.0001), POU4F2 (P < 0.0001), EOMES (P ¼ 0.0005), ACOT11 (P ¼ 0.0001), PCDHGA12 (P ¼ 0.0001), CA3 (P ¼ 0.0002), and PTGDR (P ¼ 0.0110), the candidate marker of disease progression TBX4 (P < 0.04), and other genes with stage-specific methylation. The methylation of metachronous tumors was stable and targeted to certain pathways. The correlation to expression was not stringent. Chromosome 21 showed most differential methylation (P < 0.0001) and specifically hypomethylation of keratins, which together with keratin-like proteins were epigenetically regulated. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line