US 20130205441A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0205441 A1 Lira et al. (43) Pub. Date: Aug. 8, 2013

(54) CHLOROPLAST TRANSIT PEPTIDE Publication Classification (71) Applicant: Dow Agrosciences LLC, Indianapolis, (51) Int. Cl. IN (US) C07K I4/45 (2006.01) (52) U.S. Cl. (72) Inventors: Justin M. Lira, Zionsville, IN (US); CPC ...... C07K 14/415 (2013.01) Robert M. Cicchillo, Zionsville, IN USPC ...... 800/278; 536/23.6:530/324; 435/189: (US); Carla N. Yerkes, Crawfordsville, 435/227; 435/232; 435/193; 435/320.1; IN (US); Andrew E. Robinson, 435/419: 800/298; 800/306; 800/314: 800/307; Brownsburg, IN (US) 800/317: 800/305; 800/309: 800/317.1: 800/317.2: 800/313; 800/312:800/322; 800/317.3; 800/317.4: 800/308; 800/320.1; (73) Assignee: DOWAGROSCIENCES LLC, 800/320.2: 800/320:800/320.3: 435/468; Indianapolis, IN (US) 435/418; 800/300; 800/301; 800/302 (57) ABSTRACT (21) Appl. No.: 13/757.456 This disclosure concerns compositions and methods for tar geting peptides, polypeptides, and proteins to plastids of plas tid-containing cells. In some embodiments, the disclosure (22) Filed: Feb. 1, 2013 concerns chloroplast transit peptides that may direct a polypeptide to a plastid, and nucleic acid molecules encoding O O the same. In some embodiments, the disclosure concerns Related U.S. Application Data methods for producing a transgenic plant material (e.g., a (60) Provisional application No. 61/593,555, filed on Feb. transgenic plant) comprising a chloroplast transit peptide, as 1, 2012, provisional application No. 61/625.222, filed well as plant materials produced by Such methods, and plant on Apr. 17, 2012. commodity products produced therefrom. Patent Application Publication Aug. 8, 2013 Sheet 1 of 4 US 2013/0205441 A1

Patent Application Publication Aug. 8, 2013 Sheet 2 of 4 US 2013/0205441 A1

FG, 2

SEOI DNO: 1. ). Salina GPDH SECDNC); 2 D. Salina. EPSPS D. salira GPDH (EU 6.24 4 O 6) D. Salina. EPSPS (AMBM 68 632)

FG, 3.

SEQCO: A C. r SEQ NC 5 O. C, reinhardtii E. Salina EPS

FIG. 4 ZmPer53' UTR TraP14 v2 GFP ... / TraP14 v2. ( . . . attl2

Zinn Ubi intron pDAB109902 6083 bp

ZUbi? promoter pUC origin Patent Application Publication Aug. 8, 2013 Sheet 3 of 4 US 2013/0205441 A1

F.G. 5

F.G. 6 Overdrive T-DNA Border B SpnR Atubio promoter v2 Atubi? 0 promoter intron v. 1 TraP14 v2

DAB107532 DG-32 W 3 trfA p 11456bp AtuORF233' UTR v 1

oriT CSWMV Promoter V 2

T-DNA Border A . . . . .1 . N DSM2 W2 T-DNA Border A, AtuORF1 3' UTR v 6 T-DNA Border A Patent Application Publication Aug. 8, 2013 Sheet 4 of 4 US 2013/0205441 A1

F.G. 7

Overdrive T-DNA Border B SpnR - Atubit 0 promoter v2 Attu bit 0 promoter intron v. 1 TraP24 v2

DGT-33 v3 trfA pDAB107534 11444bp AtuORF233' UTR v

oriT 8. CsVMV Promoter v2

... | y DSN2 V2 T-DNA Border A / \ AtuORF13' UTR v6 TDNA Border A TDNA Border A US 2013/0205441 A1 Aug. 8, 2013

CHLOROPLAST TRANSIT PEPTIDE instance, triazine-derived herbicides inhibit photosynthesis by displacing a plastoquinone molecule from its binding site CROSS-REFERENCE TO RELATED in the 32 kD polypeptide of the photosystem II. This 32 kD APPLICATIONS polypeptide is encoded in the chloroplast genome and Syn 0001. This application claims the benefit of U.S. Provi thesized by the organelle machinery. Mutant plants have been sional Patent Application Ser. No. 61/593,555 filed Feb. 1, obtained which are resistant to triazine herbicides. These 2012, and also to U.S. Provisional Patent Application Ser. No. plants contain a mutant 32 kD polypeptide from which the 61/625.222, filed Apr. 17, 2012, the disclosure of each of plastoquinone can no longer be displaced by triazine herbi which is hereby incorporated herein in its entirety by this cides. Sulfonylureas inhibit acetolactate synthase in the chlo reference. roplast. Acetolactate synthase is involved in isoleucine and valine synthesis. Glyphosate inhibits the function of 5-enol STATEMENT ACCORDING TO 37 C.F.R. pyruvyl-3-phosphoshikimate synthase (EPSPS), which is an S1.821(c) or (e) SEQUENCE LISTING enzyme involved in the synthesis of aromatic amino acids. All SUBMITTED AS ASCII TEXT FILE these enzymes are encoded by the nuclear genome, but they are translocated into the chloroplast where the actual amino 0002 Pursuant to 37 C.F.R. S1.821(c) or (e), a file con acid synthesis takes place. taining an ASCII text version of the Sequence Listing has 0007 Most chloroplast proteins are encoded in the been Submitted concomitant with this application, the con nucleus of the plant cell, synthesized as larger precursor pro tents of which are hereby incorporated by reference. teins in the cytosol, and post-translationally imported into the chloroplast. Import across the outer and inner envelope mem FIELD OF THE DISCLOSURE branes into the stroma is the major means for entry of proteins 0003. This disclosure relates to compositions and methods destined for the stroma, the thylakoid membrane, and the for genetically encoding and expressing polypeptides that are thylakoid lumen. Localization of imported precursor proteins targeted to chloroplasts of higher plants. In certain embodi to the thylakoid membrane and thylakoid lumen is accom ments, the disclosure relates to amino acid sequences that plished by four distinct mechanisms, including two that are target polypeptides to chloroplasts, and/or nucleic acid mol homologous to bacterial protein transport systems. Thus, ecules encoding the same. In certain embodiments, the dis mechanisms for protein localization in the chloroplast are in closure relates to chimeric polypeptides comprising an amino part derived from the prokaryotic endosymbiont. Cline and acid sequence that control the transit of the chimeric polypep Henry (1996), Annu. Rev. Cell. Dev. Biol. 12:1-26. tides to chloroplasts, and/or nucleic acid molecules encoding 0008 Precursor proteins destined for chloroplastic the same. expression contain N-terminal extensions known as chloro plast transit peptides (CTPs). The transit peptide is instru BACKGROUND mental for specific recognition of the chloroplast Surface and 0004 Plant cells contain distinct subcellular organelles, in mediating the post-translational translocation of pre-pro referred to generally as “plastids.' that are delimited by char teins across the chloroplastic envelope and thence to the Vari acteristic membrane systems and perform specialized func ous Sub-compartments within the chloroplast (e.g., stroma, tions within the cell. Particular plastids are responsible for thylakoid, and thylakoid membrane). These N-terminal tran photosynthesis, as well as the synthesis and storage of certain sit peptide sequences contain all the information necessary chemical compounds. All plastids are derived from proplas for the import of the chloroplast protein into plastids; the tids that are present in the meristematic regions of the plant. transit peptide sequences are necessary and Sufficient for Proplastids may develop into, for example: chloroplasts, etio plastid import. plasts, chromoplasts, gerontoplasts, leucoplasts, amylo 0009 Plant genes reported to have naturally-encoded tran plasts, elaioplasts, and proteinoplasts. Plastids existina semi sit peptide sequences at their N-terminus include the chloro autonomous fashion within the cell, containing their own plast small subunit of ribulose-1,5-bisphosphate caroxylase genetic system and protein synthesis machinery, but relying (RuBisCo) (de Castro Silva-Filho et al. (1996), Plant Mol. upon a close cooperation with the nucleo-cytoplasmic system Biol. 30:769-80; Schnell et al. (1991), J. Biol. Chem. 266: in their development and biosynthetic activities. 3335-42); EPSPS (see, e.g., Archer et al. (1990), J. Bioenerg. 0005. In photosynthetic leaf cells of higher plants the most and Biomemb. 22:789-810 and U.S. Pat. Nos. 6,867,293, conspicuous plastids are the chloroplasts. The most essential 7,045,684, and Re. 36,449); tryptophan synthase (Zhao et al. function of chloroplasts is the performance of the light-driven (1995), J. Biol. Chem. 270:6081-7); plastocyanin (Lawrence reactions of photosynthesis. But, chloroplasts also carry out et al. (1997), J. Biol. Chem. 272:20357-63); chorismate syn many other biosynthetic processes of importance to the plant thase (Schmidt et al. (1993), J. Biol. Chem. 268:27447-57): cell. For example, all of the cell's fatty acids are made by the light harvesting chlorophyll afb binding protein (LHBP) enzymes located in the chloroplast Stroma, using the ATP, (Lamppa et al. (1988), J. Biol. Chem. 263:14996-14999); and NAOPH, and carbohydrates readily available there. More chloroplast protein of Arabidopsis thaliana (Lee et al. (2008), over, the reducing power of light-activated electrons drives Plant Cell 20:1603-22). United States Patent Publication No. the reduction of nitrite (NO) to ammonia (NH) in the US 2010/007 1090 provides certain chloroplast targeting pep chloroplast; this ammonia provides the plant with nitrogen tides from Chlamydomonas sp. required for the synthesis of amino acids and nucleotides. 0010. However, the structural requirements for the infor 0006. The chloroplast also takes part in processes of par mation encoded by chloroplast targeting peptides remains ticular importance in the agrochemical industry. For example, elusive, due to their high level of sequence diversity and lack it is known that many herbicides act by blocking functions of common or consensus sequence motifs, though it is pos which are performed within the chloroplast. Recent studies sible that there are distinct subgroups of chloroplast targeting have identified the specific target of several herbicides. For peptides with independent structural motifs. Lee et al. (2008), US 2013/0205441 A1 Aug. 8, 2013

Supra. Further, not all of these sequences have been useful in chloroplast transit peptide operably linked to a nucleotide the heterologous expression of chloroplast-targeted proteins sequence of interest. In some embodiments, a plant, plant in higher plants. tissue, or plant cell may have Such a nucleic acid molecule stably integrated in its genome. In some embodiments, a BRIEF SUMMARY OF THE DISCLOSURE plant, plant tissue, or plants cell may transiently express Such 0011. Described herein are compositions and methods for a nucleic acid molecule. chloroplast targeting of polypeptides in a plant. In some 00.15 Methods are also described for expressing a nucle embodiments, compositions comprise a nucleic acid mol otide sequence in a plant or plant cell in chloroplasts of the ecule comprising at least one nucleotide sequence encoding a plant or plant cells. In some embodiments, a nucleic acid chloroplast transit peptide (e.g., a TraP14 or TraP24 peptide) molecule comprising at least one nucleotide sequence encod operably linked to a nucleotide sequence of interest. In par ing a TraP14 and TraP24 chloroplast transit peptide operably ticular embodiments. Such nucleic acid molecules may be linked to a nucleotide sequence of interest may be used to useful for expression and targeting of a polypeptide encoded transform a plant cell, so that a precursor fusion polypeptide by the nucleotide sequence of interest in a monocot or dicot comprising the TraP14 and TraP24 chloroplast transit peptide plant. Further described are vectors comprising a nucleic acid fused to an expression product of the nucleotide sequence of molecule comprising at least one nucleotide sequence encod interest is produced in the cytoplasm of the plant cell, and the ing a TraP14 and TraP24 chloroplast transit peptide operably fusion polypeptide is then transported in vivo into a chloro linked to a nucleotide sequence of interest. plast of the plant cell. 0012. In some embodiments, a nucleotide sequence 0016 Further described are methods for the production of encoding a TraP14 and TraP24 chloroplast transit peptide a transgenic plant comprising a nucleic acid molecule com may be a prokaryotic nucleotide sequence (for example, a prising at least one nucleotide sequence encoding a TraP14 sequence isolated from a Cyanobacterium or Agrobacte and TraP24 chloroplast transit peptide operably linked to a rium), or a functional variant thereof. In some embodiments, nucleotide sequence of interest. Also described are plant a nucleotide sequence encoding a TraP14 and TraP24 chlo products (e.g., seeds) produced from Such transgenic plants. roplast transit peptide may be a nucleotide sequence isolated from a lower photosynthetic eukaryote (for example, a 0017. The foregoing and other features will become more sequence isolated from a Chlorophyte. Such as Chlamydomo apparent from the following detailed description of several nas and Dunaliella), or a functional variant thereof. In spe embodiments, which proceeds with reference to the accom cific embodiments, a nucleotide sequence encoding a TraP14 panying figures. and TraP24 chloroplast transit peptide may be a nucleotide sequence isolated from Dunaliella Salina or Chlamydomonas BRIEF DESCRIPTION OF THE FIGURES reinhardtii. In further embodiments, a nucleotide sequence encoding a TraP14 and TraP24 chloroplast transit peptide 0018 FIG. 1 includes a cartoon depiction of an mRNA may be a chimeric nucleotide sequence comprising a partial molecule comprising a TraP14 or TraP24 peptide-encoding prokaryotic TraP14 and TraP24 chloroplast transit peptide nucleotide sequence operably linked to a nucleotide sequence nucleotide sequence, or a functional variant thereof. In still of interest. In some embodiments, an mRNA molecule such further embodiments, a nucleotide sequence encoding a as the one shown may be transcribed from a DNA molecule TraP14 and TraP24 chloroplast transit peptide may be a chi comprising an open reading frame comprising the TraP14 or meric nucleotide sequence comprising more than one eukary TraP24 peptide-encoding sequence operably linked to the otic chloroplast transit peptide nucleotide sequences, such as nucleotide sequence of interest. The nucleotide sequence of more than one (e.g., two) chloroplast transit peptide nucle interest may be in Some embodiments a sequence encoding a otide sequences from different plant species, or functional peptide of interest, for example and without limitation, a variants thereof. In still further embodiments, a nucleotide marker gene product or peptide to be targeted to a plastid. sequence encoding a TraP14 and TraP24 chloroplast transit 0019 FIG. 2 illustrates an alignment of the predicted chlo peptide may be a synthetic nucleotide sequence, which may roplast transit peptides for the Glycerol-3-Phosphate Dehy be designed at least in part by reference to a prokaryotic drogenase (GPDH) protein (SEQID NO: 1) and 3-enolpyru TraP14 and TraP24 chloroplast transit peptide nucleotide vylshikimate-5-phosphate synthetase (EPSPS) protein (SEQ Sequence. ID NO:2) from Dunaliella salina. The asterisk indicates 0013. In some embodiments, compositions comprise a where the sequences were spit and recombined to form nucleic acid molecule comprising at least one means for TraP14 (SEQID NO:3). targeting a polypeptide to a chloroplast operably linked to a nucleotide sequence of interest. In particular embodiments, 0020 FIG.3 illustrates an alignment of the predicted chlo Such nucleic acid molecules may be useful for expression and roplast transit peptides for the EPSPS protein from Chlamy targeting of a polypeptide encoded by the nucleotide domonas reinhardtii (SEQIDNO:4) and EPSPS protein from sequence of interest in a monocot or dicot plant. Further Dunaliella salina (SEQ ID NO:5). The asterisk indicates described are vectors comprising a nucleic acid molecule where the sequences were spit and recombined to form comprising at least one means for targeting a polypeptide to a TraP24 (SEQID NO:6). chloroplast operably linked to a nucleotide sequence of inter (0021 FIG. 4 illustrates the plasmid map of pDAB109902. est. A means for targeting a polypeptide to a chloroplast is a 0022 FIG. 5 illustrates a microscopy image of the TraP14 TraP14 and TraP24 nucleotide sequence and functional GFP transformed into maize protoplasts showing the trans equivalents thereof. location into the chloroplasts of the maize protoplast. 0014. Also described herein are plants, plant tissues, and plant cells comprising a nucleic acid molecule comprising at (0023 FIG. 6 illustrates the plasmid map of pDAB 107532. least one nucleotide sequence encoding a TraP14 and TraP24 (0024 FIG. 7 illustrates the plasmid map of pDAB 107534. US 2013/0205441 A1 Aug. 8, 2013

SEQUENCE LISTING rium. Confocal microscopy and Western blot analysis con firmed that TraP14 successfully targeted GFP to maize 0025. The nucleic acid sequences listed in the accompa chloroplasts. nying sequence listing are shown using standard letter abbre 0038. In a further exemplary embodiment, nucleic acid viations for nucleotide bases, as defined in 37 C.F.R.S 1.822. sequences, each encoding a synthetic TraP peptide of the Only one strand of each nucleic acid sequence is shown, but invention, were synthesized independently and operably the complementary Strand is understood to be included by any linked to a nucleic acid sequence encoding an agronomically reference to the displayed Strand. In the accompanying important gene sequence. The TraP sequences were fused to sequence listing: herbicide tolerant traits (e.g. dgt-32 and dgt-33) to produce 0026 SEQID NO:1 shows the amino acid sequence of a synthetic nucleic acid molecules, each encoding a chimeric GPDH peptide from Dunaliella salina. TraP14:DGT-32 or TraP24:DGT-33 fusion polypeptide. Such 0027 SEQID NO:2 shows the amino acid sequence of a nucleic acid molecules, each encoding a chimeric TraP14: EPSPS peptide from Dunaliella salina. DGT-32 or TraP24:DGT-33 polypeptide, were each intro 0028 SEQID NO:3 shows the amino acid sequence of a duced into a binary vector, such that each TraP14:dgt-32 or chimeric TraP14 fusion protein. TraP24:dgt-33-encoding nucleic acid sequence was operably 0029 SEQID NO:4 shows the amino acid sequence of a linked to a promoter and other gene regulatory elements. The EPSPS peptide from Chlamydomonas reinhardtii. binary containing the TraP14:dgt-32 or TraP24:dgt-33-en 0030 SEQID NO:5 shows the amino acid sequence of a coding nucleic acid sequence was used to transform Varopis EPSPS peptide from Dunaliella salina. plant species. The transgenic plants were assayed for herbi 0031 SEQID NO:6 shows the amino acid sequence of a cide tolerance as a result of the expression and translocation chimeric TraP24 fusion protein. of the DGT-32 or DGT-33 enzymes to the chloroplast. 0032 SEQID NO:7 shows a nucleotide sequence encod 0039. In view of the aforementioned detailed working ing a TraP14 peptide labeled as TraP14v2. examples, TraP14 and TraP24 sequences of the invention may 0033 SEQ ID NO:8 shows a nucleotide sequence of a be used to direct any polypeptide to a plastid in abroad range TraP24 peptide labeled as TraP24 v2. of plant species. For example, by methods made available to those of skill in the art by the present disclosure, a chimeric DETAILED DESCRIPTION polypeptide comprising a TraP14 and TraP24 peptide sequence fused to the N-terminus of any second peptide sequence may be introduced into a host cell for plastid tar I. Overview of Several Embodiments geting of the second peptide sequence. Thus, in particular 0034. A chloroplast transit peptide (CTP) (or plastid tran embodiments, a TraP14 and TraP24 peptide may provide sit peptide) functions co-translationally or post-translation increased efficiency of import and processing of a peptide for ally to direct a polypeptide comprising the CTP to a plastid, which plastid expression is desired. for example, a chloroplast. In some embodiments of the invention, either endogenous chloroplast proteins or heter II. Abbreviations ologous proteins may be directed to a chloroplast by expres 0040 CTP chloroplast transit peptide sion of such a protein as a larger precursor polypeptide com 0041. EPSPS 3-enolpyruvylshikimate-5-phosphate prising a CTP. synthetase 0035. In an exemplary embodiment, a nucleic acid sequence encoding a CTP was isolated from an EPSPS gene (0.042 YFP yellow fluorescent protein sequence obtained from Dunaliella salina (NCBI Database 0043. T, tumor-inducing (plasmids derived from A. Accession No. AMBM68632), a GPDH gene sequence tumefaciens) obtained from Dunaliella salina (NCBI Database Accession 0044 T-DNA transfer DNA No. EU624406), and an EPSPS gene sequence obtained from Chlamydomonas reinhardtii (NCBI Accession No.: III. Terms XP 001702942). The CTP was identified and isolated from 0045. In order to facilitate review of the various embodi the full length protein by analyzing the gene sequence with ments of the disclosure, the following explanations of specific the ChloroP prediction server. Emanuelsson et al. (1999), terms are provided: Protein Science 8:978-84 (available at cbs.dtu.dk/services/ 0046 Chloroplast transit peptide: As used herein, the term ChloroP). The predicted protein product of the isolated CTP “chloroplast transit peptide' (CTP) (or “plastid transit pep encoding sequences were used to produce the chimeric CTP tide') may refer to an amino acid sequence that, when present encoding nucleic acid sequences of the Subject disclosure, at the N-terminus of a polypeptide, directs the import of the TraP14 and TraP24. polypeptide into a plastid of a plant cell, e.g., a chloroplast. A 0036. In a further exemplary embodiment, a TraP14 pep CTP is generally necessary and sufficient to direct the import tide was synthesized independently and fused to a yellow of a protein into a plastid (e.g., a primary, secondary, or fluorescent protein (GFP) to produce a chimeric TraP14-GFP tertiary plastid, Such as a chloroplast) of a host cell. A putative polypeptide. A nucleic acid molecule encoding the chimeric chloroplast transit peptide may be identified by one of several TraP14-GFP polypeptide was introduced into a binary vector, available algorithms (e.g., PSORT, and ChloroP (available at such that the TraP14-GFP-encoding nucleic acid sequence www.cbs.dtu.dk/services/ChloroP)). ChloroP may provide was operably linked to an AtlJbi 10 promoter. particularly good prediction of chloroplast transit peptides. 0037. In yet a further exemplary embodiment, a binary Emanuelsson et al. (1999), Protein Science 8:978-84. How vector comprising a TraP14-GFP-encoding nucleic acid ever, prediction of functional chloroplast transit peptides is sequence operably linked to an AtlJbi 10 promoter was tran not achieved at 100% efficiency by any existing algorithm. siently transformed into maize (Zea mays) via Agrobacte Therefore, it is important to verify that an identified putative US 2013/0205441 A1 Aug. 8, 2013

chloroplast transit peptide does indeed function as intended tide that is not normally expressed in cells of the same type in, e.g., an in vitro, or in vivo methodology. from non-genetically engineered plants of the same species 0047 Chloroplast transit peptides may be located at the (e.g., a polypeptide that is expressed in different cells of the N-terminus of a polypeptide that is imported into a plastid. same organism or cells of a different organism). The transit peptide may facilitate co- or post-translational 0053 Isolated: As used herein, the term “isolated refers transport of a polypeptide comprising the CTP into the plas to molecule (e.g., nucleic acid molecules and polypeptides) tid. Chloroplast transit peptides typically comprise between that are substantially separated or purified away from other about 40 and about 100 amino acids, and such CTPs have molecules of the same type (e.g., other nucleic acid molecules been observed to contain certain common characteristics, for and other polypeptides) with which the molecule is normally example, CTPs contain very few, if any, negatively charged associated in the cell of the organism in which the molecule amino acids (such as aspartic acid, glutamic acid, aspar naturally occurs. For example, an isolated nucleic acid mol agines, or glutamine); the N-terminal regions of CTPS lack ecule may be substantially separated or purified away from charged amino acids, glycine, and proline; the central region chromosomal DNA or extrachromosomal DNA in the cell of of a CTP also is likely to contain a very high proportion of the organism in which the nucleic acid molecule naturally basic or hydroxylated amino acids (such as serine and threo occurs. Thus, the term includes recombinant nucleic acid nine); and the C-terminal region of a CTP is likely to be rich molecules and polypeptides that are biochemically purified in arginine, and have the ability to comprise an amphipathic Such that other nucleic acid molecules, polypeptides, and beta-sheet structure. Plastid proteases may cleave the CTP cellular components are removed. The term also includes from the remainder of a polypeptide comprising the CTP after recombinant nucleic acid molecules, chemically-synthesized importation of the polypeptide into the plastid. nucleic acid molecules, and recombinantly produced 0.048 Contact: As used herein, the term “contact with or polypeptides. “uptake by a cell, tissue, or organism (e.g., a plant cell; plant tissue; and plant), with regard to a nucleic acid molecule, 0054 The term “substantially purified, as used herein, includes internalization of the nucleic acid molecule into the refers to a molecule that is separated from other molecules organism, for example and without limitation: contacting the normally associated with it in its native state. A substantially organism with a composition comprising the nucleic acid purified molecule may be the predominant species present in molecule; and soaking of organisms with a solution compris a composition. A substantially purified molecule may be, for ing the nucleic acid molecule. example, at least 60% free, at least 75% free, or at least 90% 0049 Endogenous: As used herein, the term "endog free from other molecules besides a solvent present in a enous” refers to Substances (e.g., nucleic acid molecules and natural mixture. The term “substantially purified' does not polypeptides) that originate from within a particular organ refer to molecules present in their native state. ism, tissue, or cell. For example, an "endogenous' polypep 0055 Nucleic acid molecule: As used herein, the term tide expressed in a plant cell may refer to a polypeptide that is “nucleic acid molecule' refers to a polymeric form of nucle normally expressed in cells of the same type from non-ge otides, which may include both sense and anti-sense Strands netically engineered plants of the same species. of RNA, cDNA, genomic DNA, and synthetic forms and 0050 Expression: As used herein, “expression of a cod mixed polymers of the above. A nucleotide may refer to a ing sequence (for example, a gene or a transgene) refers to the ribonucleotide, deoxyribonucleotide, or a modified form of process by which the coded information of a nucleic acid either type of nucleotide. A “nucleic acid molecule' as used transcriptional unit (including, e.g., genomic DNA or cDNA) herein is synonymous with “nucleic acid' and “polynucle is converted into an operational, non-operational, or struc otide. A nucleic acid molecule is usually at least 10 bases in tural part of a cell, often including the synthesis of a protein. length, unless otherwise specified. The term includes single Gene expression can be influenced by external signals; for and double-stranded forms of DNA. Nucleic acid molecules example, exposure of a cell, tissue, or organism to an agent include dimeric (so-called in tandem) forms, and the tran that increases or decreases gene expression. Expression of a Scription products of nucleic acid molecules. A nucleic acid gene can also be regulated anywhere in the pathway from molecule can include either or both naturally occurring and DNA to RNA to protein. Regulation of gene expression modified nucleotides linked together by naturally occurring occurs, for example, through controls acting on transcription, and/or non-naturally occurring nucleotide linkages. translation, RNA transport and processing, degradation of 0056. Nucleic acid molecules may be modified chemically intermediary molecules such as mRNA, or through activa or biochemically, or may contain non-natural or derivatized tion, inactivation, compartmentalization, or degradation of nucleotide bases, as will be readily appreciated by those of specific protein molecules after they have been made, or by skill in the art. Such modifications include, for example, combinations thereof. Gene expression can be measured at labels, methylation, substitution of one or more of the natu the RNA level or the protein level by any method known in the rally occurring nucleotides with an analog, internucleotide art, including, without limitation, Northern blot, RT-PCR, modifications (e.g., uncharged linkages: for example, methyl Western blot, or in vitro, in situ, or in vivo protein activity phosphonates, phosphotriesters, phosphoramidates, carbam assay(s). ates, etc.: charged linkages: for example, phosphorothioates, 0051 Genetic material: As used herein, the term “genetic phosphorodithioates, etc.; pendent moieties: for example, material includes all genes, and nucleic acid molecules, such peptides; intercalators: for example, acridine, psoralen, etc.; as DNA and RNA. chelators; alkylators; and modified linkages: for example, 0052 Heterologous: As used herein, the term "heterolo alpha anomeric nucleic acids, etc.). The term “nucleic acid gous' refers to Substances (e.g., nucleic acid molecules and molecule' also includes any topological conformation, polypeptides) that do not originate from within a particular including single-stranded, double-stranded, partially organism, tissue, or cell. For example, a "heterologous' duplexed, triplexed, hairpinned, circular, and padlocked con polypeptide expressed in a plant cell may refer to a polypep formations. US 2013/0205441 A1 Aug. 8, 2013

0057. As used herein with respect to DNA, the term "cod “Blast 2 sequences' function of the BLASTTM (Blastn) pro ing sequence.” “structural nucleotide sequence.” or 'struc gram may be employed using the default BLOSUM62 matrix tural nucleic acid molecule' refers to a nucleotide sequence set to default parameters. Nucleic acid sequences with even that is ultimately translated into a polypeptide, via transcrip greater similarity to the reference sequences will show tion and mRNA, when placed under the control of appropriate increasing percentage identity when assessed by this method. regulatory sequences. With respect to RNA, the term “coding 0063 Specifically hybridizable/Specifically complemen sequence” refers to a nucleotide sequence that is translated tary: As used herein, the terms “Specifically hybridizable' into a peptide, polypeptide, or protein. The boundaries of a and 'specifically complementary are terms that indicate a coding sequence are determined by a translation start codon Sufficient degree of complementarity Such that stable and at the 5'-terminus and a translation stop codon at the 3'-ter specific binding occurs between the nucleic acid molecule minus. Coding sequences include, but are not limited to: and a target nucleic acid molecule. Hybridization between genomic DNA, cDNA; ESTs; and recombinant nucleotide two nucleic acid molecules involves the formation of an anti Sequences. parallel alignment between the nucleic acid sequences of the 0.058. In some embodiments, the invention includes nucle two nucleic acid molecules. The two molecules are then able otide sequences that may be isolated, purified, or partially to form hydrogen bonds with corresponding bases on the purified, for example, using separation methods such as, e.g., opposite strand to form a duplex molecule that, if it is suffi ion-exchange chromatography; by exclusion based on ciently stable, is detectable using methods well known in the molecular size or by affinity; by fractionation techniques art. A nucleic acid molecule need not be 100% complemen based on solubility in different solvents; or methods of tary to its target sequence to be specifically hybridizable. genetic engineering Such as amplification, cloning, and Sub However, the amount of sequence complementarity that must cloning. exist for hybridization to be specific is a function of the 0059 Sequence identity: The term “sequence identity” or hybridization conditions used. “identity, as used herein in the context of two nucleic acid or 0064) Hybridization conditions resulting in particular polypeptide sequences, may refer to the residues in the two degrees of stringency will vary depending upon the nature of sequences that are the same when aligned for maximum cor the hybridization method of choice and the composition and respondence over a specified comparison window. length of the hybridizing nucleic acid sequences. Generally, 0060. As used herein, the term “percentage of sequence the temperature of hybridization and the ionic strength (espe identity” may refer to the value determined by comparing two cially the Na" and/or Mg" concentration) of the hybridiza optimally aligned sequences (e.g., nucleic acid sequences, tion buffer will determine the stringency of hybridization, and amino acid sequences) over a comparison window, though wash times also influence Stringency. Calculations wherein the portion of the sequence in the comparison win regarding hybridization conditions required for attaining par dow may comprise additions or deletions (i.e., gaps) as com ticular degrees of stringency are known to those of ordinary pared to the reference sequence (which does not comprise skill in the art, and are discussed, for example, in Sambrooket additions or deletions) for optimal alignment of the two al. (ed.) Molecular Cloning: A Laboratory Manual, 2" ed., sequences. The percentage is calculated by determining the vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring number of positions at which the identical nucleotide or Harbor, N.Y., 1989, chapters 9 and 11; and Hames and Hig amino acid residue occurs in both sequences to yield the gins (eds.) Nucleic Acid Hybridization, IRL Press, Oxford, number of matched positions, dividing the number of 1985. Further detailed instruction and guidance with regard to matched positions by the total number of positions in the the hybridization of nucleic acids may be found, for example, comparison window, and multiplying the result by 100 to in Tijssen, “Overview of principles of hybridization and the yield the percentage of sequence identity. strategy of nucleic acid probe assays in Laboratory Tech 0061 Methods for aligning sequences for comparison are niques in Biochemistry and Molecular Biology—Hybridiza well-known in the art. Various programs and alignment algo tion with Nucleic Acid Probes, Part I, Chapter 2, Elsevier, rithms are described in, for example: Smith and Waterman N.Y., 1993; and Ausubel et al., Eds., Current Protocols in (1981), Adv. Appl. Math. 2:482; Needleman and Wunsch Molecular Biology, Chapter 2, Greene Publishing and Wiley (1970), J. Mol. Biol. 48:443; Pearson and Lipman (1988), Interscience, NY, 1995. Proc. Natl. Acad. Sci. U.S.A. 85:2444; Higgins and Sharp 0065. As used herein, “stringent conditions' encompass (1988), Gene 73:237-44; Higgins and Sharp (1989), CABIOS conditions under which hybridization will only occur if there 5:151-3: Corpet et al. (1988), Nucleic Acids Res. 16:10881 is less than 20% mismatch between the hybridization mol 90; Huang et al. (1992), Comp. Appl. Biosci. 8:155-65; Pear ecule and a homologous sequence within the target nucleic son et al. (1994), Methods Mol. Biol. 24:307-31; Tatiana et al. acid molecule. “Stringent conditions” include further particu (1999), FEMS Microbiol. Lett. 174:247-50. A detailed con lar levels of stringency. Thus, as used herein, "moderate strin sideration of sequence alignment methods and homology gency' conditions are those under which molecules with calculations can be found in, e.g., Altschul et al. (1990), J. more than 20% sequence mismatch will not hybridize; con Mol. Biol. 215:403-10. ditions of “high Stringency are those under which sequences 0062. The National Center for Biotechnology Information with more than 10% mismatch will not hybridize; and con (NCBI) Basic Local Alignment Search Tool (BLASTTM: ditions of “very high stringency” are those under which Altschul et al. (1990)) is available from several sources, sequences with more than 5% mismatch will not hybridize. including the National Center for Biotechnology Information (Bethesda, Md.), and on the internet, for use in connection 0066. The following are representative, non-limiting with several sequence analysis programs. A description of hybridization conditions. how to determine sequence identity using this program is 0067. High Stringency condition (detects sequences available on the internet under the “help' section for that share at least 90% sequence identity): Hybridization BLASTTM. For comparisons of nucleic acid sequences, the in 5xSSC buffer at 65° C. for 16 hours; wash twice in US 2013/0205441 A1 Aug. 8, 2013

2xSSC buffer at room temperature for 15 minutes each; are well-known and commonly used by those of skill in the and wash twice in 0.5xSSC buffer at 65° C. for 20 art. See, e.g., Myers and Miller (1988), Computer Applica minutes each. tions in BioSciences 4:11-7. 0068 Moderate Stringency condition (detects 0074 Thus, embodiments of the invention include func sequences that share at least 80% sequence identity): tional variants of exemplary plastid transit peptideamino acid Hybridization in 5x-6xSSC buffer at 65-70° C. for sequences, and nucleic acid sequences encoding the same. A 16-20 hours; wash twice in 2XSSC buffer at room tem functional variant of an exemplary transit peptide sequence perature for 5-20 minutes each; and wash twice in may be, for example, a fragment of an exemplary transit 1XSSC buffer at 55-70° C. for 30 minutes each. peptide amino acid sequence (such as an N-terminal or C-ter minal fragment), or a modified sequence of a full-length 0069. Non-stringent control condition (sequences that exemplary transit peptide amino acid sequence or fragment of share at least 50% sequence identity will hybridize): an exemplary transit peptide amino acid sequence. An exem Hybridization in 6xSSC buffer at room temperature to plary transit peptide amino acid sequence may be modified in 55° C. for 16-20 hours; wash at least twice in 2x-3XSSC Some embodiments be introducing one or more conservative buffer at room temperature to 55° C. for 20-30 minutes amino acid Substitutions. A "conservative' amino acid Sub each. stitution is one in which the amino acid residue is replaced by 0070. As used herein, the term “substantially homolo an amino acid residue having a similar functional side chain, gous' or 'substantial homology, with regard to a contiguous similar size, and/or similar hydrophobicity. Families of nucleic acid sequence, refers to contiguous nucleotide amino acids that may be used to replace anotheramino acid of sequences that hybridize under Stringent conditions to the the same family in order to introduce a conservative Substi reference nucleic acid sequence. For example, nucleic acid tution are known in the art. For example, these amino acid sequences that are substantially homologous to a reference families include: Basic amino acids (e.g., lysine, arginine, nucleic acid sequence of SEQID NO:3 and SEQID NO:6 are and histidine); acidic amino acids (e.g., aspartic acid and those nucleic acid sequences that hybridize under stringent glutamic acid); uncharged (at physiological pH) polar amino conditions (e.g., the Moderate Stringency conditions set acids (e.g., glycine, asparagines, glutamine, serine, threonine, forth, supra) to the reference nucleic acid sequence of SEQID tyrosine, and cytosine); non-polar amino acids (e.g., alanine, NO:3 and SEQ ID NO:6. Substantially homologous Valine, leucine, isoleucine, proline, phenylalanine, methion sequences may have at least 80% sequence identity. For ine, and tryptophan); beta-branched amino acids (e.g., threo example, Substantially homologous sequences may have nine, valine, and isoleucine); and aromatic amino acids (e.g., from about 80% to 100% sequence identity, such as about tyrosine, phenylalanine, tryptophan, and histidine). See, e.g., 81%; about 82%; about 83%; about 84%; about 85%; about Sambrooketal. (Eds.), supra; and Innis et al., PCR Protocols: 86%; about 87%; about 88%; about 89%; about 90%; about A Guide to Methods and Applications, 1990, Academic Press, 91%; about 92%; about 93%; about 94% about 95%; about NY, USA. 96%; about 97%; about 98%; about 98.5%; about 99%; about 0075 Operably linked: A first nucleotide sequence is 99.5%; and about 100%. The property of substantial homol “operably linked with a second nucleotide sequence when ogy is closely related to specific hybridization. For example, the first nucleotide sequence is in a functional relationship a nucleic acid molecule is specifically hybridizable when with the second nucleotide sequence. For instance, a pro there is a sufficient degree of complementarity to avoid non moter is operably linked to a coding sequence if the promoter specific binding of the nucleic acid to non-target sequences affects the transcription or expression of the coding sequence. under conditions where specific binding is desired, for When recombinantly produced, operably linked nucleotide example, under Stringent hybridization conditions. sequences are generally contiguous and, where necessary to 0071. As used herein, the term “ortholog” refers to a gene join two protein-coding regions, in the same reading frame. in two or more species that has evolved from a common However, nucleotide sequences need not be contiguous to be ancestral nucleotide sequence, and may retain the same func operably linked. tion in the two or more species. (0076. The term, “operably linked,” when used in reference to a regulatory sequence and a coding sequence, means that 0072. As used herein, two nucleic acid sequence mol the regulatory sequence affects the expression of the linked ecules are said to exhibit “complete complementarity' when coding sequence. "Regulatory sequences, or “control ele every nucleotide of a sequence read in the 5' to 3’ direction is ments.” refer to nucleotide sequences that influence the tim complementary to every nucleotide of the other sequence ing and level/amount of transcription, RNA processing or when read in the 3' to 5' direction. A nucleotide sequence that stability, or translation of the associated coding sequence. is complementary to a reference nucleotide sequence will Regulatory sequences may include promoters; translation exhibit a sequence identical to the reverse complement leader sequences; introns; enhancers; stem-loop structures; sequence of the reference nucleotide sequence. These terms repressor binding sequences; termination sequences; poly and descriptions are well defined in the art and are easily adenylation recognition sequences; etc. Particular regulatory understood by those of ordinary skill in the art. sequences may be located upstream and/or downstream of a 0073. When determining the percentage of sequence iden coding sequence operably linked thereto. Also, particular tity between amino acid sequences, it is well-known by those regulatory sequences operably linked to a coding sequence of skill in the art that the identity of the amino acid in a given may be located on the associated complementary strand of a position provided by an alignment may differ without affect double-stranded nucleic acid molecule. ing desired properties of the polypeptides comprising the (0077. Promoter: As used herein, the term “promoter” aligned sequences. In these instances, the percent sequence refers to a region of DNA that may be upstream from the start identity may be adjusted to account for similarity between of transcription, and that may be involved in recognition and conservatively Substituted amino acids. These adjustments binding of RNA polymerase and other proteins to initiate US 2013/0205441 A1 Aug. 8, 2013

transcription. A promoter may be operably linked to a coding which a nucleic acid molecule can be introduced into Such a sequence for expression in a cell, or a promoter may be cell. Examples include, but are not limited to: transfection operably linked to a nucleotide sequence encoding a signal with viral vectors; transformation with plasmid vectors; elec sequence which may be operably linked to a coding sequence troporation (Fromm et al. (1986), Nature 319:791-3); lipo for expression in a cell. A "plant promoter may be a promoter fection (Felgner et al. (1987), Proc. Natl. Acad. Sci. USA capable of initiating transcription in plant cells. Examples of 84:7413-7); microinjection (Mueller et al. (1978), Cell promoters under developmental control include promoters 15:579-85); Agrobacterium-mediated transfer (Fraley et al. that preferentially initiate transcription in certain tissues, (1983), Proc. Natl. Acad. Sci. USA 80:4803-7); direct DNA Such as leaves, roots, seeds, fibers, xylem vessels, tracheids, uptake; and microprojectile bombardment (Klein et al. or sclerenchyma. Such promoters are referred to as “tissue (1987), Nature 327:70). preferred.” Promoters which initiate transcription only in cer 0082 Transgene: An exogenous nucleic acid sequence. In tain tissues are referred to as “tissue-specific. A “cell type Some examples, a transgene may be a sequence that encodes specific' promoter primarily drives expression in certain cell a polypeptide comprising at least one TraP14 or TraP24 chlo types in one or more organs, for example, Vascular cells in roplast transit peptide. In particular examples, a transgene roots or leaves. An “inducible' promoter may be a promoter may encode a polypeptide comprising at least one TraP14 or which may be under environmental control. Examples of TraP24 chloroplast transit peptide and at least an additional environmental conditions that may initiate transcription by peptide sequence (e.g., a peptide sequence that confers her inducible promoters include anaerobic conditions and the bicide-resistance), for which plastid expression is desirable. presence of light. Tissue-specific, tissue-preferred, cell type In these and other examples, a transgene may contain regu specific, and inducible promoters constitute the class of “non latory sequences operably linked to a coding sequence of the constitutive' promoters. A “constitutive' promoter is a pro transgene (e.g., a promoter). For the purposes of this disclo moter which may be active under most environmental condi Sure, the term “transgenic.” when used to refer to an organism tions. (e.g., a plant), refers to an organism that comprises the exog 0078. Any inducible promoter can be used in some enous nucleic acid sequence. In some examples, the organism embodiments of the invention. See Ward et al. (1993), Plant comprising the exogenous nucleic acid sequence may be an Mol. Biol. 22:361-366. With an inducible promoter, the rate organism into which the nucleic acid sequence was intro of transcription increases in response to an inducing agent. duced via molecular transformation techniques. In other Exemplary inducible promoters include, but are not limited examples, the organism comprising the exogenous nucleic to: Promoters from the ACEI system that responds to copper; acid sequence may be an organism into which the nucleic acid In2 gene from maize that responds to benzenesulfonamide sequence was introduced by, for example, introgression or herbicide safeners; Tet repressor from Tn 10; and the induc cross-pollination in a plant. ible promoter from a steroid hormone gene, the transcrip I0083 Transport: As used herein, the terms “transport(s). tional activity of which may be induced by a glucocorticos “target(s), and “transfer(s)' refers to the property of certain teroid hormone (Schena et al. (1991), Proc. Natl. Acad. Sci. amino acid sequences of the invention that facilitates the USA 88:0421). movement of a polypeptide comprising the amino acid 0079 Exemplary constitutive promoters include, but are sequence from the nucleus of a host cell into a plastid of the not limited to: Promoters from plant viruses, such as the 35S host cell. In particular embodiments, such an amino acid promoter from CaMV; promoters from rice actingenes; ubiq sequence (i.e., a CTP) may be capable of transporting about uitin promoters; pEMU; MAS; maize H3 histone promoter; 100%, at least about 95%, at least about 90%, at least about and the ALS promoter, Xbal/NcoI fragment 5' to the Brassica 85%, at least about 80%, at least about 70%, at least about napus ALS3 structural gene (or a nucleotide sequence simi 60%, and/or at least about 50% of a polypeptide comprising larity to said Xbal/NcoI fragment) (International PCT Pub the amino acid sequence into plastids of a host cell. lication No. WO 96/30530). 0084 Vector: A nucleic acid molecule as introduced into a 0080 Additionally, any tissue-specific or tissue-preferred cell, for example, to produce a transformed cell. A vector may promoter may be utilized in some embodiments of the inven include nucleic acid sequences that permit it to replicate in the tion. Plants transformed with a nucleic acid molecule com host cell. Such as an origin of replication. Examples of vectors prising a coding sequence operably linked to a tissue-specific include, but are not limited to: a plasmid, cosmid; bacterioph promoter may produce the product of the coding sequence age; or virus that carries exogenous DNA into a cell. A vector exclusively, or preferentially, in a specific tissue. Exemplary may also include one or more genes, antisense molecules, tissue-specific or tissue-preferred promoters include, but are and/or selectable marker genes and other genetic elements not limited to: A root-preferred promoter, such as that from known in the art. A vector may transduce, transform, or infect the phaseolin gene; a leaf-specific and light-induced pro a cell, thereby causing the cell to express the nucleic acid moter Such as that from cab or rubisco; an anther-specific molecules and/or proteins encoded by the vector. A vector promoter Such as that from LAT52; a pollen-specific pro optionally includes materials to aid in achieving entry of the moter such as that from Zm13; and a microspore-preferred nucleic acid molecule into the cell (e.g., a liposome, protein promoter Such as that from apg. coating, etc.). 0081 Transformation: As used herein, the term “transfor I0085 Unless specifically indicated or implied, the terms mation' or “transduction” refers to the transfer of one or more “a,” “an and “the signify "at least one.” as used herein. nucleic acid molecule(s) into a cell. A cell is “transformed by I0086. Unless otherwise specifically explained, all techni a nucleic acid molecule transduced into the cell when the cal and Scientific terms used herein have the same meaning as nucleic acid molecule becomes stably replicated by the cell, commonly understood by those of ordinary skill in the art to either by incorporation of the nucleic acid molecule into the which this disclosure belongs. Definitions of common terms cellular genome, or by episomal replication. As used herein, in molecular biology can be found in, for example, Lewin B., the term “transformation' encompasses all techniques by Genes V, Oxford University Press, 1994 (ISBN 0-19-854287 US 2013/0205441 A1 Aug. 8, 2013

9); Kendrew et al. (eds.). The Encyclopedia of Molecular "codon optimization. Optimized coding sequences contain Biology, Blackwell Science Ltd., 1994 (ISBN 0-632-02182 ing codons preferred by a particular prokaryotic or eukaryotic 9); and Meyers R. A. (ed.), Molecular Biology and Biotech host may be prepared by, for example, to increase the rate of nology: A Comprehensive Desk Reference, VCH Publishers, translation or to produce recombinant RNA transcripts hav Inc., 1995 (ISBN 1-56081-569-8). All percentages are by ing desirable properties (e.g., a longer half-life, as compared weight and all solvent mixture proportions are by Volume with transcripts produced from a non-optimized sequence). unless otherwise noted. All temperatures are in degrees Cel 0090 Some embodiments include TraP14 functional vari S1S. ants. TraP14 functional variants include, for example and without limitation: homologs and orthologs of the TraP14 set IV. Nucleic Acid Molecules Comprising a TraP14 forth as SEQID NO:3: chloroplast transit peptides that com and TraP24-Encoding Sequence prise a contiguous amino acid sequence within SEQID NO:3: 0087. In some embodiments, this disclosure provides a truncated TraP14 peptides; longer chloroplast transit peptides nucleic acid molecule comprising at least one nucleotide that comprise a contiguous amino acid sequence within SEQ sequence encoding a TraP14 chloroplast transit peptide oper ID NO:3: chloroplast transit peptides comprising a contigu ably linked to a nucleotide sequence of interest. In other ous amino acid sequence within SEQID NO:3 that has one or embodiments, this disclosure provides a nucleic acid mol more conservative amino acid Substitutions; and chloroplast ecule comprising at least one nucleotide sequence encoding a transit peptides comprising a contiguous amino acid TraP24 chloroplast transit peptide operably linked to a nucle sequence within SEQ ID NO:3 that has one or more non otide sequence of interest. In particular embodiments, the conservative amino acid substitutions that are demonstrated nucleotide sequence of interest may be a nucleotide sequence to direct an operably linked peptide to a plastid in a plastid that encodes a polypeptide of interest. In particular embodi containing cell. ments, a single nucleic acid molecule is provided that encodes 0091. Some embodiments include TraP24 functional vari a polypeptide wherein a TraP14 peptide sequence is fused to ants. TraP24 functional variants include, for example and the N-terminus of a polypeptide of interest. In particular without limitation: homologs and orthologs of the TraP24 set embodiments, a single nucleic acid molecule is provided that forth as SEQID NO:6; chloroplast transit peptides that com encodes a polypeptide wherein a TraP24 peptide sequence is prise a contiguous amino acid sequence within SEQID NO:6; fused to the N-terminus of a polypeptide of interest. truncated TraP24 peptides; longer chloroplast transit peptides 0088. In nucleic acid molecules provided in some embodi that comprise a contiguous amino acid sequence within SEQ ments of the invention, the last codon of a nucleotide ID NO:6; chloroplast transit peptides comprising a contigu sequence encoding a TraP14 or TraP24 chloroplast transit ous amino acid sequence within SEQID NO:6 that has one or peptide and the first codon of a nucleotide sequence of interest more conservative amino acid Substitutions; and chloroplast may be separated by any number of nucleotide triplets, e.g., transit peptides comprising a contiguous amino acid without coding for an intron or a "STOP’. In some examples, sequence within SEQ ID NO:6 that has one or more non a sequence encoding the first amino acids of a mature protein conservative amino acid substitutions that are demonstrated normally associated with a transit peptide in a natural precur to direct an operably linked peptide to a plastid in a plastid Sor polypeptide may be present between the last codon of a containing cell. nucleotide sequence encoding a TraP14 or TraP24 chloro 0092. Some embodiments of the invention also include a plast transit peptide and the first codon of a nucleotide nucleic acid molecule comprising a nucleotide sequence sequence of interest. A sequence separating a nucleotide encoding a TraP14 or TraP24 peptide. Such nucleic acid sequence encoding a TraP14 or TraP24 chloroplast transit molecules may be useful, for example, in facilitating manipu peptide and the first codon of a nucleotide sequence of interest lation of the TraP14 and TraP24-encoding sequence in may, for example, consist of any sequence, such that the molecular biology techniques. For example, in some embodi amino acid sequence encoded is not likely to significantly ments, a TraP14 or TraP24-encoding sequence may be intro alter the translated of the chimeric polypeptide and its trans duced into a suitable vector for Sub-cloning of the sequence location to a plastid. In these and further embodiments, the into an expression vector, or a TraP14 or TraP24-encoding last codon of a nucleotide sequence encoding a TraP14 or sequence may be introduced into a nucleic acid molecule that TraP24 chloroplast transit peptide may be fused in phase facilitates the production of a further nucleic acid molecule register with the first codon of the nucleotide sequence of comprising the TraP14 or TraP24-encoding sequence oper interest directly contiguous thereto, or separated therefrom ably linked to a nucleotide sequence of interest. by no more than a short peptide sequence, Such as that 0093. In particular examples, a TraP14 peptide is less than encoded by a synthetic nucleotide linker (e.g., a nucleotide 79 amino acids in length. For example, a TraP14 peptide may linker that may have been used to achieve the fusion). be 78, 77, 76, 75, 74,73, 72, 71, 70, 69, or fewer amino acids 0089. In some embodiments, it may be desirable to modify in length. In certain examples, a TraP14 peptide comprises the the nucleotides of a nucleotide sequence of interest and/or a amino acid sequence set forth in SEQ ID NO:3, or a func TraP14 or TraP24-encoding sequence fused thereto in a tional variant thereof. Thus, a TraP14 peptide may comprise single coding sequence, for example, to enhance expression an amino acid sequence comprising SEQ ID NO:3, or a of the coding sequence in a particular host. The genetic code functional variant thereof, wherein the length of the TraP14 is redundant with 64 possible codons, but most organism peptide or functional variant thereof is less than 79 amino preferentially use a subset of these codons. The codons that acids in length. In certain examples, a TraP14 peptide or are utilized most often in a species are called optimal codons, functional variant thereof may comprise an amino acid and those not utilized very often are classified as rare or sequence that is, e.g., at least 80%, at least 85%, at least 90%, low-usage codons. Zhang et al. (1991), Gene 105:61-72. at least 92%, at least 94%, at least 95%, at least 96%, at least Codons may be substituted to reflect the preferred codon 97%, at least 98%, at least 99%, or 100% identical to SEQID usage of aparticular hostina process sometimes referred to as NO:3. US 2013/0205441 A1 Aug. 8, 2013

0094 All of the nucleotide sequences that encode, for soil conditions, light levels, water levels, and chemical envi example, the TraP14 peptide of SEQID NO:3, or functional ronment), or a polypeptide that may be used as a marker to variants thereof comprising less than the entire sequence of identify a plant comprising a trait of interest (e.g., a selectable SEQID NO:3, will be immediately recognizable by those of marker gene product, a polypeptide involved in seed color, skill in the art. The degeneracy of the genetic code provides a etc.). finite number of coding sequences for a particular amino acid sequence. The selection of a particular sequence to encode a 0098. Non-limiting examples of polypeptides involved in TraP14 peptide is within the discretion of the practitioner. herbicide resistance that may be linked to a TraP14 or TraP24 Different coding sequences may be desirable in different peptide sequence in Some embodiments of the invention applications. For example, to increase expression of the include: acetolactase synthase (ALS), mutated ALS, and pre TraP14 peptide in a particular host, a coding sequence may be cursors of ALS (see, e.g., U.S. Pat. No. 5,013,659); EPSPS selected that reflects the codon usage bias of the host. By way (see, e.g., U.S. Pat. Nos. 4,971,908 and 6.225,114), such as a of example, a TraP14 peptide may be encoded by the nucle CP4 EPSPS or a class III EPSPS; enzymes that modify a otide sequence set forth as SEQID NO:7. physiological process that occurs in a plastid, including pho 0095. In particular examples, a TraP24 peptide is less than tosynthesis, and synthesis of fatty acids, amino acids, oils, 79 amino acids in length. For example, a TraP24 peptide may arotenoids, terpenoids, starch, etc. Other non-limiting be 78, 77, 76, 75, 74,73, 72, 71, 70, 69, or feweramino acids examples of polypeptides that may be linked to a TraP14 or in length. In certain examples, a TraP24 peptide comprises the TraP24 peptide in particular embodiments include: zeaxan amino acid sequence set forth in SEQ ID NO:6, or a func thin epoxidase, choline monooxygenase, ferrochelatase, tional variant thereof. Thus, a TraP24 peptide may comprise omega-3 fatty acid desaturase, glutamine synthetase, starch an amino acid sequence comprising SEQ ID NO:6, or a modifying enzymes, polypeptides involved in synthesis of functional variant thereof, wherein the length of the TraP24 essential amino acids, provitaminA, hormones, Bt toxin pro peptide or functional variant thereof is less than 79 amino teins, etc. Nucleotide sequences encoding the aforemen acids in length. In certain examples, a TraP24 peptide or tioned peptides are available in the art, and Such nucleotide functional variant thereof may comprise an amino acid sequences may be operably linked to a nucleotide sequence sequence that is, e.g., at least 80%, at least 85%, at least 90%, encoding a TraP14 or TraP24 peptide to be expressed into a at least 92%, at least 94%, at least 95%, at least 96%, at least polypeptide comprising the polypeptide of interest linked to 97%, at least 98%, at least 99%, or 100% identical to SEQID the TraP14 or TraP24 peptide. Furthermore, additional nucle NO:6. otide sequences encoding any of the aforementioned 0096 All of the nucleotide sequences that encode, for polypeptides may be identified by those of skill in the art (for example, the TraP24 peptide of SEQID NO:6, or functional example, by cloning of genes with high homology to other variants thereof comprising less than the entire sequence of genes encoding the particular polypeptide). Once such a SEQID NO:6, will be immediately recognizable by those of nucleotide sequence has been identified, it is a straightfor skill in the art. The degeneracy of the genetic code provides a ward process to design a nucleotide sequence comprising a finite number of coding sequences for a particular amino acid TraP14 or TraP24-encoding sequence operably linked to the sequence. The selection of a particular sequence to encode a identified nucleotide sequence, or a sequence encoding an TraP24 peptide is within the discretion of the practitioner. equivalent polypeptide. Different coding sequences may be desirable in different applications. For example, to increase expression of the V. Expression of Polypeptides Comprising a TraP14 TraP24 peptide in a particular host, a coding sequence may be and TraP24 Chloroplast Transit Peptide selected that reflects the codon usage bias of the host. By way of example, a TraP24 peptide may be encoded by the nucle 0099. In some embodiments, at least one nucleic acid mol otide sequence set forth as SEQID NO:8. ecule(s) comprising a nucleotide sequence encoding a 0097. Any polypeptide may be targeted to a plastid of a polypeptide comprising at least one TraP14 or TraP24 chlo plastid-containing cell by incorporation of a TraP14 or roplast transit peptide may be introduced into a cell, tissue, or TraP24 peptide sequence. For example, a polypeptide may be organism for expression of the polypeptide therein. In par linked to a TraP14 or TraP24 peptide sequence in some ticular embodiments, a nucleic acid molecule may comprise a embodiments, so as to direct the polypeptide to a plastid in a nucleotide sequence of interest operably linked to a nucle cell wherein the linked polypeptide-TraP14 or TraP24 mol otide sequence encoding a TraP14 or TraP24 chloroplast tran ecule is expressed. In particular embodiments, a polypeptide sit peptide. For example, a nucleic acid molecule may com targeted to a plastid by incorporation of a TraP14 or TraP24 prise a coding sequence encoding a polypeptide comprising sequence may be, for example, a polypeptide that is normally at least one TraP14 or TraP24 chloroplast transit peptide and expressed in a plastid of a cell wherein the polypeptide is at least an additional peptide sequence encoded by a nucle natively expressed. For example and without limitation, a otide sequence of interest. In some embodiments, a nucleic polypeptide targeted to a plastid by incorporation of a TraP14 acid molecule of the invention may be introduced into a or TraP24 sequence may be a polypeptide involved in herbi plastid-containing host cell, tissue, or organism (e.g., a plant cide resistance, virus resistance, bacterial pathogen resis cell, plant tissue, and plant). Such that a polypeptide may be tance, insect resistance, nematode resistance, or fungal resis expressed from the nucleic acid molecule in the plastid-con tance. See, e.g., U.S. Pat. Nos. 5,569,823: 5,304.730; 5,495, taining host cell, tissue, or organism, wherein the expressed 071; 6,329.504; and 6,337,431. A polypeptide targeted to a polypeptide comprises at least one TraP14 or TraP24 chloro plastid by incorporation of a TraP14 or TraP24 sequence may plast transit peptide and at least an additional peptide alternatively be, for example and without limitation, a sequence encoded by a nucleotide sequence of interest. In polypeptide involved in plant vigor or yield (including certain examples, the TraP14 or TraP24 chloroplast transit polypeptides involved in tolerance for extreme temperatures, peptide of Such an expressed polypeptide may facilitate tar US 2013/0205441 A1 Aug. 8, 2013

geting of a portion of the polypeptide comprising at least the ers); 5,322,938, 5,352,605, 5,359,142, and 5,530,196 (35S additional peptide sequence to a plastid of the host cell, tissue, promoter); 6,433,252 (maize L3 oleosin promoter); 6,429, or organism. 357 (rice actin 2 promoter, and rice actin 2 intron); 6.294.714 0100. In some embodiments, a nucleic acid molecule of (light-inducible promoters); 6,140,078 (salt-inducible pro the invention may be introduced into a plastid-containing cell moters); 6.252,138 (pathogen-inducible promoters); 6,175, by one of any of the methodologies known to those of skill in 060 (phosphorous deficiency-inducible promoters); 6.388, the art. In particular embodiments, a host cell, tissue, or 170 (bidirectional promoters); 6,635,806 (gamma-coixin organism may be contacted with a nucleic acid molecule of promoter); and U.S. patent application Ser. No. 09/757,089 the invention in order to introduce the nucleic acid molecule (maize chloroplast aldolase promoter). into the cell, tissue, or organism. In particular embodiments, 0104. Additional exemplary promoters include the nopa a cell may be transformed with a nucleic acid molecule of the line synthase (NOS) promoter (Ebert etal. (1987), Proc. Natl. invention Such that the nucleic acid molecule is introduced Acad. Sci. USA 84(16):5745-9); the octopine synthase (OCS) into the cell, and the nucleic acid molecule is stably integrated promoter (which is carried on tumor-inducing plasmids of into the genome of the cell. In some embodiments, a nucleic Agrobacterium tumefaciens); the caulimovirus promoters acid molecule comprising at least one nucleotide sequence such as the cauliflower mosaic virus (CaMV) 19S promoter encoding a TraP14 and TraP24 chloroplast transit peptide (Lawton et al. (1987), Plant Mol. Biol. 9:315-24); the CaMV operably linked to a nucleotide sequence of interest may be 35S promoter (Odell et al. (1985), Nature 313:810-2: the used for transformation of a cell, for example, a plastid figwort mosaic virus 35S-promoter (Walker et al. (1987), containing cell (e.g., a plant cell). In order to initiate or Proc. Natl. Acad. Sci. USA 84(19):6624-8); the sucrose syn enhance expression, a nucleic acid molecule may comprise thase promoter (Yang and Russell (1990), Proc. Natl. Acad. one or more regulatory sequences, which regulatory Sci. USA 87:4144-8); the R gene complex promoter (Chan sequences may be operably linked to the nucleotide sequence dler et al. (1989), Plant Cell 1:1175-83); the chlorophylla/b encoding a polypeptide comprising at least one TraP14 and binding protein gene promoter: CaMV35S (U.S. Pat. Nos. TraP24 chloroplast transit peptide. 5,322,938, 5,352,605, 5,359,142, and 5,530,196); FMV35S 0101. A nucleic acid molecule may, for example, be a (U.S. Pat. Nos. 6,051,753, and 5,378,619); a PC1SV pro vector system including, for example, a linear or a closed moter (U.S. Pat. No. 5,850,019); the SCP1 promoter (U.S. circular plasmid. In particular embodiments, the vector may Pat. No. 6,677.503); and AGRtu.nos promoters (GenBank be an expression vector. Nucleic acid sequences of the inven Accession No. V00087: Depicker et al. (1982), J. Mol. Appl. tion may, for example, be inserted into a vector, such that the Genet. 1:561-73; Bevan et al. (1983), Nature 304:184-7). nucleic acid sequence is operably linked to one or more 0105. In particular embodiments, nucleic acid molecules regulatory sequences. Many vectors are available for this of the invention may comprise a tissue-specific promoter. A purpose, and selection of the particular vector may depend, tissue-specific promoter is a nucleotide sequence that directs for example, on the size of the nucleic acid to be inserted into a higher level of transcription of an operably linked nucle the vector and the particular host cell to be transformed with otide sequence in the tissue for which the promoter is specific, the vector. A vector typically contains various components, relative to the other tissues of the organism. Examples of the identity of which depend on a function of the vector (e.g., tissue-specific promoters include, without limitation: tape amplification of DNA and expression of DNA), and the par tum-specific promoters; anther-specific promoters; pollen ticular host cell(s) with which the vector is compatible. specific promoters (see, e.g., U.S. Pat. No. 7,141,424, and 0102 Some embodiments may include a plant transfor International PCT Publication No. WO 99/042587); ovule mation vector that comprises a nucleotide sequence compris specific promoters; (see, e.g., U.S. Patent Application No. ing at least one of the above-described regulatory sequences 2001/047525Al); fruit-specific promoters (see, e.g., U.S. Pat. operatively linked to one or more nucleotide sequence(s) Nos. 4,943,674, and 5,753,475); and seed-specific promoters encoding a polypeptide comprising at least one TraP14 or (see, e.g., U.S. Pat. Nos. 5,420,034, and 5,608,152). In some TraP24 chloroplast transit peptide. The one or more nucle embodiments, a developmental stage-specific promoter (e.g., otide sequences may be expressed, under the control of the a promoteractive at a later stage in development) may be used regulatory sequence(s), in a plant cell, tissue, or organism to in a composition or method of the invention. produce a polypeptide comprising a TraP14 and TraP24 chlo 0106 Additional regulatory sequences that may in some roplast transit peptide that targets at least a portion of the embodiments be operably linked to a nucleic acid molecule polypeptide to a plastid of the plant cell, tissue, or organism. include 5' UTRs located between a promoter sequence and a 0103. In some embodiments, a regulatory sequence oper coding sequence that function as a translation leader ably linked to a nucleotide sequence encoding a polypeptide sequence. The translation leader sequence is present in the comprising at least one TraP14 and TraP24 chloroplast transit fully-processed mRNA, and it may affect processing of the peptide, may be a promoter sequence that functions in a host primary transcript, and/or RNA stability. Examples of trans cell, such as a bacterial cell wherein the nucleic acid molecule lation leader sequences include maize and petunia heat shock is to be amplified, or a plant cell wherein the nucleic acid protein leaders (U.S. Pat. No. 5,362,865), plant virus coat molecule is to be expressed. Promoters suitable for use in protein leaders, plant rubisco leaders, and others. See, e.g., nucleic acid molecules of the invention include those that are Turner and Foster (1995), Molecular Biotech. 3(3):225-36. inducible, viral, synthetic, or constitutive, all of which are Non-limiting examples of 5' UTRs are provided by: GmHsp well known in the art. Non-limiting examples of promoters (U.S. Pat. No. 5,659,122); PhDnaK (U.S. Pat. No. 5,362, that may be useful in embodiments of the invention are pro 865); AtAnt1; TEV (Carrington and Freed (1990), J. Virol. vided by: U.S. Pat. Nos. 6,437.217 (maize RS81 promoter): 64: 1590-7); and AGRtunos (GenBank Accession No. 5,641,876 (rice actin promoter); 6,426,446 (maize RS324 V00087; and Bevan et al. (1983), Nature 304:184-7). promoter); 6,429,362 (maize PR-1 promoter); 6.232.526 0107 Additional regulatory sequences that may in some (maize A3 promoter); 6,177,611 (constitutive maize promot embodiments be operably linked to a nucleic acid molecule US 2013/0205441 A1 Aug. 8, 2013

also include 3' non-translated sequences, 3' transcription ter dopaquinone which in turn condenses to melanin (Katz et al. mination regions, or poly-adenylation regions. These are (1983), J. Gen. Microbiol. 129:2703-14); and an O-galactosi genetic elements located downstream of a nucleotide dase. sequence, and include polynucleotides that provide polyade 0110 Suitable methods for transformation of host cells nylation signal, and/or other regulatory signals capable of include any method by which DNA can be introduced into a affecting transcription or mRNA processing. The polyadeny cell, for example and without limitation: by transformation of lation signal functions in plants to cause the addition of poly protoplasts (see, e.g., U.S. Pat. No. 5,508,184); by desicca adenylate nucleotides to the 3' end of the mRNA precursor. tion/inhibition-mediated DNA uptake (see, e.g., Potrykus et The polyadenylation sequence can be derived from a variety al. (1985), Mol. Gen. Genet. 199:183-8); by electroporation of plant genes, or from T-DNA genes. A non-limiting (see, e.g., U.S. Pat. No. 5,384.253); by agitation with silicon example of a 3' transcription termination region is the nopa carbide fibers (see, e.g., U.S. Pat. Nos. 5,302,523 and 5,464, line synthase 3' region (nos 3'; Fraley et al. (1983), Proc. Natl. 765); by Agrobacterium-mediated transformation (see, e.g., Acad. Sci. USA 80:4803-7). An example of the use of different U.S. Pat. Nos. 5,563,055, 5,591,616, 5,693,512, 5,824,877, 3' nontranslated regions is provided in Ingelbrecht et al., 5,981,840, and 6,384.301); and by acceleration of DNA (1989), Plant Cell 1:671-80. Non-limiting examples of poly coated particles (see, e.g., U.S. Pat. Nos. 5,015,580, 5,550, adenylation signals include one from a Pisum sativum RbcS2 318, 5.538,880, 6,160,208, 6,399,861, and 6,403,865); etc. gene (Ps. RbcS2-E9; Coruzzi et al. (1984), EMBO.J. 3:1671 Through the application oftechniques such as these, the cells 9) and AGRtu.nos (GenBank Accession No. E01312). of virtually any species may be stably transformed. In some 0108. A recombinant nucleic acid molecule or vector of embodiments, transforming DNA is integrated into the the present invention may comprise a selectable marker that genome of the host cell. In the case of multicellular species, confers a selectable phenotype on a transformed cell. Such as transgenic cells may be regenerated into a transgenic organ a plant cell. Selectable markers may also be used to select for ism. Any of these techniques may be used to produce a trans plants or plant cells that comprise recombinant nucleic acid genic plant, for example, comprising one or nucleic acid molecule of the invention. The marker may encode biocide sequences of the invention in the genome of the transgenic resistance, antibiotic resistance (e.g., kanamycin, Geneticin plant. (G418), bleomycin, hygromycin, etc.), or herbicide resis 0111. The most widely utilized method for introducing an tance (e.g., glyphosate, etc.). Examples of selectable markers expression vector into plants is based on the natural transfor include, but are not limited to: a neogene which codes for mation system of Agrobacterium. A. tumefaciens and A. kanamycin resistance and can be selected for using kanamy rhizogenes are plant pathogenic soil bacteria which geneti cin, G418, etc.; a bar gene which codes for bialaphos resis cally transform plant cells. The Ti and Ri plasmids of A. tance; a mutant EPSP synthase gene which encodes glypho tumefaciens and A. rhizogenes, respectively, carry genes sate resistance; a nitrilase gene which confers resistance to responsible for genetic transformation of the plant. The Ti bromoxynil; a mutant acetolactate synthase gene (ALS) (tumor-inducing)-plasmids contain a large segment, known which confers imidazolinone or Sulfonylurea resistance; and as T-DNA, which is transferred to transformed plants. a methotrexate resistant DHFR gene. Multiple selectable Another segment of the Tiplasmid, the Vir region, is respon markers are available that confer resistance to ampicillin, sible for T-DNA transfer. The T-DNA region is bordered by bleomycin, chloramphenicol, gentamycin, hygromycin, terminal repeats. In some modified binary vectors, the tumor kanamycin, lincomycin, methotrexate, phosphinothricin, inducing genes have been deleted, and the functions of the vir puromycin, spectinomycin, rifampicin, Streptomycin and tet region are utilized to transfer foreign DNA bordered by the racycline, and the like. Examples of Such selectable markers T-DNA border sequences. The T-region may also contain, for are illustrated in, e.g., U.S. Pat. Nos. 5,550,318; 5.633,435: example, a selectable marker for efficient recovery of trans 5,780,708 and 6,118,047. genic plants and cells, and a multiple cloning site for inserting 0109. A recombinant nucleic acid molecule or vector of sequences for transfer such as a TraP14 and TraP24-encoding the present invention may also or alternatively include a nucleic acid. screenable marker. Screenable markers may be used to moni 0112 Thus, in some embodiments, a plant transformation tor expression. Exemplary Screenable markers include a vector is derived from a Ti plasmid of A. tumefaciens (see, B-glucuronidase or uidA gene (GUS) which encodes an e.g., U.S. Pat. Nos. 4,536,475, 4,693,977, 4,886,937, and enzyme for which various chromogenic Substrates are known 5,501,967; and European Patent EP 0122791) or a Ri plas (Jefferson et al. (1987), Plant Mol. Biol. Rep. 5:387-405); an mid of A. rhizogenes. Additional plant transformation vectors R-locus gene, which encodes a product that regulates the include, for example and without limitation, those described production of anthocyanin pigments (red color) in plant tis by Herrera-Estrella et al. (1983), Nature 303:209-13: Bevan sues (Dellaporta etal. (1988) “Molecular cloning of the maize et al. (1983), Nature 304:184-7; Klee et al. (1985), Bio/Tech R-njallele by transposon tagging with Ac.” In 18' Stadler mol. 3:637-42; and in European Patent EP 0120516, and Genetics Symposium, P. Gustafson and R. Appels, eds. (New those derived from any of the foregoing. Other bacteria such York: Plenum), pp. 263-82); a B-lactamase gene (Sutcliffe et as Sinorhizobium, Rhizobium, and Mesorhizobium that inter al. (1978), Proc. Natl. Acad. Sci. USA 75:3737-41); a gene act with plants naturally can be modified to mediate gene which encodes an enzyme for which various chromogenic transfer to a number of diverse plants. These plant-associated Substrates are known (e.g., PADAC, a chromogenic cepha symbiotic bacteria can be made competent for gene transfer losporin); a luciferase gene (Ow et al. (1986), Science 234: by acquisition of both a disarmed Tiplasmid and a Suitable 856-9); a XylE gene that encodes a catechol dioxygenase that binary vector. can convert chromogenic catechols (Zukowski et al. (1983), 0113. After providing exogenous DNA to recipient cells, Gene 46(2-3):247-55); an amylase gene (Ikatu et al. (1990), transformed cells are generally identified for further culturing Bio/Technol. 8:241-2); a tyrosinase gene which encodes an and plant regeneration. In order to improve the ability to enzyme capable of oxidizing tyrosine to DOPA and identify transformed cells, one may desire to employ a select US 2013/0205441 A1 Aug. 8, 2013

able or screenable marker gene, as previously set forth, with 0118. In particular embodiments, copies of at least one the vector used to generate the transformant. In the case where polypeptide comprising at least one TraP14 and TraP24 chlo a selectable marker is used, transformed cells are identified roplast transit peptide are produced in a plastid-containing within the potentially transformed cell population by expos cell, into which has been introduced at least one nucleic acid ing the cells to a selective agent or agents. In the case where molecule(s) comprising a nucleotide sequence encoding the a screenable marker is used, cells may be screened for the at least one polypeptide comprising at least one TraP14 and desired marker gene trait. TraP24 chloroplast transit peptide. Each polypeptide com 0114 Cells that survive the exposure to the selective prising at least one TraP14 and TraP24 chloroplast transit agent, or cells that have been scored positive in a screening peptide may be expressed from multiple nucleic acid assay, may be cultured in media that Supports regeneration of sequences introduced in different transformation events, or plants. In some embodiments, any Suitable plant tissue cul from a single nucleic acid sequence introduced in a single ture media (e.g., MS and N6 media) may be modified by transformation event. In some embodiments, a plurality of including further Substances, such as growth regulators. Tis Such polypeptides is expressed under the control of a single Sue may be maintained on a basic media with growth regula promoter. In other embodiments, a plurality of such polypep tors until Sufficient tissue is available to begin plant regenera tides is expressed under the control of multiple promoters. tion efforts, or following repeated rounds of manual selection, Single polypeptides may be expressed that comprise multiple until the morphology of the tissue is Suitable for regeneration peptide sequences, each of which peptide sequences is to be (e.g., at least 2 weeks), then transferred to media conducive to targeted to a plastid. shoot formation. Cultures are transferred periodically until 0119. In addition to direct transformation of a plant with a sufficient shoot formation has occurred. Once shoots are recombinant nucleic acid molecule, transgenic plants can be formed, they are transferred to media conducive to root for prepared by crossing a first plant having at least one trans mation. Once Sufficient roots are formed, plants can be trans genic event with a second plant lacking such an event. For ferred to soil for further growth and maturity. example, a recombinant nucleic acid molecule comprising a 0115 To confirm the presence of a nucleic acid molecule nucleotide sequence encoding a polypeptide comprising at of interest (for example, a nucleotide sequence encoding a least one TraP14 and TraP24 chloroplast transit peptide may polypeptide comprising at least one TraP14 or TraP24 chlo be introduced into a first plant line that is amenable to trans roplast transit peptide) in a regenerating plant, a variety of formation, to produce a transgenic plant, which transgenic assays may be performed. Such assays include, for example: plant may be crossed with a second plant line to introgress the molecular biological assays, such as Southern and Northern nucleotide sequence that encodes the polypeptide into the blotting, PCR, and nucleic acid sequencing, biochemical second plant line. assays, such as detecting the presence of a protein product, e.g., by immunological means (ELISA and/or Western blots) VI. Plant Materials Comprising a TraP14 and TraP24 or by enzymatic function; plant part assays, Such as leaf or Chloroplast Transit Peptide-Directed Polypeptide root assays; and analysis of the phenotype of the whole regen I0120 In some embodiments, a plant is provided, wherein erated plant. the plant comprises a plant cell comprising a nucleotide 0116 Integration events may be analyzed, for example, by sequence encoding a polypeptide comprising at least one PCR amplification using, e.g., oligonucleotide primers spe TraP14 and TraP24 chloroplast transit peptide. In particular cific for a nucleotide sequence of interest. PCR genotyping is embodiments, such a plant may be produced by transforma understood to include, but not be limited to, polymerase tion of a plant tissue or plant cell, and regeneration of a whole chain reaction (PCR) amplification of genomic DNA derived plant. In further embodiments, such a plant may be obtained from isolated host plant tissue predicted to contain a nucleic from a commercial source, or through introgression of a acid molecule of interest integrated into the genome, fol nucleic acid comprising a nucleotide sequence encoding a lowed by Standard cloning and sequence analysis of PCR polypeptide comprising at least one TraP14 and TraP24 chlo amplification products. Methods of PCR genotyping have roplast transit peptide into a germplasm. Plant materials com been well described (see, e.g., Rios, G. et al. (2002), Plant J. prising a plant cell comprising a nucleotide sequence encod 32:243-53) and may be applied to genomic DNA derived ing a polypeptide comprising at least one TraP14 and TraP24 from any plant species (e.g., Z. mays or G. max) or tissue type, chloroplast transit peptide are also provided. Such a plant including cell cultures. material may be obtained from a plant comprising the plant 0117. A transgenic plant formed using Agrobacterium cell. In further embodiments, the plant material is a plant cell dependent transformation methods typically contains a single that is incapable of regeneration to produce a plant. recombinant DNA sequence inserted into one chromosome. 0121 A transgenic plant or plant material comprising a The single recombinant DNA sequence is referred to as a nucleotide sequence encoding a polypeptide comprising at “transgenic event' or “integration event. Such transgenic least one TraP14 and TraP24 chloroplast transit peptide may plants are heterozygous for the inserted DNA sequence. In in some embodiments exhibit one or more of the following Some embodiments, a transgenic plant homozygous with characteristics: expression of the polypeptide in a cell of the respect to a transgene may be obtained by sexually mating plant; expression of a portion of the polypeptide in a plastid of (selfing) an independent segregant transgenic plant that con a cell of the plant; import of the polypeptide from the cytosol tains a single exogenous gene sequence to itself, for example, of a cell of the plant into a plastid of the cell; plastid-specific an Fo plant, to produce F seed. One fourth of the F seed expression of the polypeptide in a cell of the plant; and/or produced will be homozygous with respect to the transgene. localization of the polypeptide in a cell of the plant. Such a Germinating F seed results in plants that can be tested for plant may additionally have one or more desirable traits other heterozygosity, typically using a SNP assay or a thermal than expression of the encoded polypeptide. Such traits may amplification assay that allows for the distinction between include, for example: resistance to insects, other pests, and heterozygotes and homozygotes (i.e., a Zygosity assay). disease-causing agents; tolerances to herbicides; enhanced US 2013/0205441 A1 Aug. 8, 2013

stability, yield, or shelf-life; environmental tolerances; phar a fluorescent molecule. Expression of the gene product as part maceutical production; industrial product production; and of a polypeptide also comprising a TraP14 or TraP24 peptide nutritional enhancements. may provide a system to evaluate the plastid-localizing capa 0122. A transgenic plant according to the invention may bilities of a particular TraP14 and TraP24 peptide sequence. be any plant capable of being transformed with a nucleic acid In some embodiments, expression of a marker gene product molecule of the invention. Accordingly, the plant may be a as part of a TraP14 and TraP24-containing polypeptide is dicot or monocot. Non-limiting examples of dicotyledonous utilized to target expression of the marker gene product to a plants usable in the present methods include Arabidopsis, plastid of a cell wherein the polypeptide is expressed. In alfalfa, beans, broccoli, cabbage, carrot, cauliflower, celery, certain embodiments, such a marker gene product is localized Chinese cabbage, cotton, cucumber, eggplant, lettuce, melon, in plastid(s) of the host cell. For example, the marker gene pea, pepper, peanut, potato, pumpkin, radish, rapeseed, spin product may be expressed at higher levels in the plastid(s) ach, soybean, Squash, Sugarbeet, Sunflower, tobacco, tomato, than in the cytosol or other organelles of the host cell; the and watermelon. Non-limiting examples of monocotyledon marker gene product may be expressed at much higher levels ous plants usable in the present methods include corn, Bras in the plastid(s); the marker gene product may be expressed Sica, onion, rice, Sorghum, wheat, rye, millet, Sugarcane, oat, essentially only in the plastid(s); or the marker gene product triticale, Switchgrass, and turfgrass. Transgenic plants may be expressed entirely in the plastid(s). Such that expres according to the invention may be used or cultivated in any sion in the cytosol or non-plastid organelles cannot be a. detected. 0123. Some embodiments also provide commodity prod ucts containing one or more nucleotide sequences encoding a 0.126 In some embodiments, a polypeptide comprising a polypeptide comprising at least one TraP14 or TraP24 chlo functional TraP14 and TraP24 variant peptide linked to a roplast transit peptide, for example, a commodity product marker gene product is used to evaluate the characteristics of produced from a recombinant plant or seed containing one or the functional TraP14 or TraP24 variant peptide. For more of Such nucleotide sequences. Commodity products example, the sequence of a TraP14 or TraP24 peptide may be containing one or more nucleotide sequences encoding a varied, e.g., by introducing at least one conservative mutation polypeptide comprising at least one TraP14 or TraP24 chlo (s) into the TraP14 and TraP24 peptide, and the resulting roplast transit peptide include, for example and without limi TraP14 and TraP24 variant peptide may be linked to a marker tation: food products, meals, oils, or crushed or whole grains gene product. After expression in a Suitable host cell (for or seeds of a plant comprising one or more nucleotide example, a cell wherein one or more regulatory elements in sequences encoding a polypeptide comprising at least one the expression construct are operable), expression of the TraP14 or TraP24 chloroplast transit peptide. The detection of marker gene product may be determined. By comparing the one or more nucleotide sequences encoding a polypeptide sub-cellular localization of the marker gene product between comprising at least one TraP14 or TraP24 chloroplast transit the reference TraP peptide-marker construct and the variant peptide in one or more commodity or commodity products is TraP peptide-marker construct, it may be determined whether de facto evidence that the commodity or commodity product the variant TraP14 and TraP24 peptide provides, for example, was at least in part produced from a plant comprising one or greater plastid localization, Substantially identical plastid more nucleotide sequences encoding a polypeptide compris localization, or lesser plastid localization. By identifying ing at least one TraP14 or TraP24 chloroplast transit peptide. TraP14 or TraP24 variants that provide greater plastic local In particular embodiments, a commodity product of the ization, the mutations in such TraP14 or TraP24 variants may invention comprise a detectable amount of a nucleic acid be incorporated into further TraP14 and TraP24 variants. sequence encoding a polypeptide comprising at least one Performing multiple rounds of this evaluation process, and TraP14 or TraP24 chloroplast transit peptide. In some Subsequently incorporating identified favorable mutations in embodiments. Such commodity products may be produced, a TraP14 and TraP24 sequence, may yield an iterative process for example, by obtaining transgenic plants and preparing for optimization of a TraP14 and TraP24 sequence. Such food or feed from them. optimized TraP14 and TraP24 peptide sequences, and nucle 0124. In some embodiments, a transgenic plant or seed otide sequences encoding the same, are considered part of the comprising a transgene comprising a nucleotide sequence present invention, whether or not such optimized TraP14 and encoding a polypeptide comprising at least one TraP14 or TraP24 peptide sequences may be further optimized by addi TraP24 chloroplast transit peptide also may comprise at least tional mutation. one other transgenic event in its genome, including without I0127. All references, including publications, patents, and limitation: a transgenic event from which is transcribed an patent applications, cited herein are hereby incorporated by iRNA molecule; a gene encoding an insecticidal protein (e.g., reference to the extent they are not inconsistent with the an Bacillus thuringiensis insecticidal protein); an herbicide explicit details of this disclosure, and are so incorporated to tolerance gene (e.g., a gene providing tolerance to glypho the same extent as if each reference were individually and sate); and a gene contributing to a desirable phenotype in the specifically indicated to be incorporated by reference and transgenic plant (e.g., increased yield, altered fatty acid were set forth in its entirety herein. The references discussed metabolism, or restoration of cytoplasmic male sterility). herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be VII. TraP14 and TraP24-Mediated Localization of construed as an admission that the inventors are not entitled to Gene Products to Plastids antedate such disclosure by virtue of prior invention. 0.125. Some embodiments of the present invention provide I0128. The following Examples are provided to illustrate a method for expression and/or localization of a gene product certain particular features and/or aspects. These Examples to a plastid (e.g., a chloroplast). In particular embodiments, should not be construed to limit the disclosure to the particu the gene product may be a marker gene product, for example, lar features or aspects described. US 2013/0205441 A1 Aug. 8, 2013 14

EXAMPLES half of the chloroplast transit peptide sequence from the first organism/enzyme with the second half of the chloroplast Example 1 transit peptide sequence from the second organism/enzyme in an approximate ratio of 1:1. Exemplary sequences of the Design and Production of Chimeric Chloroplast newly designed chimeric chloroplast transit peptides are Transit Peptide (TraP) Sequences TraP14 (SEQ ID NO:3) and TraP24 (SEQ ID NO:6). The 0129. Plastids are cytoplasmic organelles found in higher TraP14 (SEQ ID NO:3) chimeric chloroplast transit peptide plant species and are present in all plant tissues. Choloro sequence comprises an N-terminus which is derived from the plasts are a specific type of plastid found in green photosyn Glycerol-3-Phosphate Dehydrogenase (GPDH) protein of thetic tissues which are responsible for essential physiologi Dunaliella Salina, and the C-terminus of the chloroplast tran cal functions. For example, one Such primary physiological sit peptide is derived from the EPSPS protein of Dunaliella function is the synthesis of aromatic amino acids required by salina. The TraP24 (SEQ ID NO:6) chloroplast transit pep the plant. Nuclear encoded enzymes are required in this bio tide sequence comprises an N-terminus which is derived from synthetic pathway and are transported from the cytoplasm to the EPSPS protein of Chlamydomonas reinhardtii, and the the interior of the chloroplast. These nuclear encoded C-terminus of the chloroplast transit peptide is derived from enzymes usually possess an N-terminal transit peptide that the EPSPS protein of Dunaliella salina. The chimeric chlo interacts with the chloroplast membrane to facilitate transport roplast transit peptides were tested via multiple assays which of the peptide to the stroma of the chloroplast. Bruce B. included a transient in planta expression system and trans (2000) Chloroplast transit peptides: structure, function, and genically as a stable transformation event comprising a gene evolution. Trends Cell Bio. 10:440-447. Upon import, stro expression element fused to an agronomic important trans mal peptidases cleave the transit peptide, leaving the mature gene Sequence. functional protein imported within the chloroplast. Richter S, Example 2 Lamppa GK. (1999) Stromal processing peptidase binds tran sit peptides and initiates their ATP-dependent turnover in chloroplasts. Journ. Cell Bio. 147:33-43. The chloroplast Transient in Planta Testing of Chimeric Chloroplast transit peptides are variable sequences which are highly Transit Peptide (TraP) Sequences divergent in length, composition and organization. Bruce B. Maize Protoplast Transient Assay: (2000) Chloroplast transit peptides: structure, function, and evolution. Trends Cell Bio. 10:440-447. The sequence simi I0131 The Trap14v2 chimeric chloroplast transit peptide larities of chloroplast transit peptides diverge significantly sequence (SEQID NO:8) were cloned upstream of the green amongst homologous proteins from different plant species. fluorescent protein gene and incorporated into construct The amount of divergence between chloroplast transit pep pDAB109902 (FIG. 4) for testing via the maize protoplast tides is unexpected given that the homologous proteins transient in planta assay. The resulting constructs contained a obtained from different plant species typically share rela single plant transcription unit (PTU). The first PTU was com tively high levels of sequence similarity when comparing the prised of the Zea mays Ubiquitin 1 promoter (ZmUbi1 pro processed mature functional protein. moter: Christensen, A., Sharrock R., and Quail P., (1992) 0130 Novel chimeric chloroplast transit peptide Maize polyubiquitingenes: structure, thermal perturbation of sequences were designed, produced and tested in planta. The expression and transcript splicing, and promoteractivity fol novel chimeric chloroplast transit peptides were shown to lowing transfer to protoplasts by electroporation, Plant possess efficacious translocation and processing properties Molecular Biology, 18:675-689), TraP-green fluorescent pro for the import of agronomic important proteins within the tein fusion gene (TraP14-GFP; U.S. Pat. No. 7,678,893), and chloroplast. Initially, native 5-enolpyruvylshikimate-3-phos Zea mays Peroxidase 5 3' untranslated region (ZmPer5 phate synthase (EPSPS) protein sequences from different 3'UTR: U.S. Pat. No. 6,384.207). The constructs were con plant species were analyzed via the ChloroPTM computer firmed via restriction enzyme digestion and sequencing. program to identify putative chloroplast transit peptide I0132) Seed of Zea mays var. B104 were surface sterilized sequences (Emanuelsson O, Nielsen H. von Heijne G. (1999) by shaking vigorously in 50% Clorox (3% sodium hypochlo ChloroP, a neural network-based method for predicting chlo rite), containing 2-3 drops of Tween 20, for about 20 minutes. roplast transit peptides and their cleavage sites, Protein Sci The seeds were rinsed thoroughly with sterile distilled water. ence 8: 978-984), available at http://www.cbs.dtu.dk/ser The sterile seed were plated onto /2 MS medium in vices/ChloroP/. After the native chloroplast transit peptides Phytatrays or similar type boxes, and allowed to grow in the were identified, a first chloroplast transit peptide sequence dark (28°C.) for 12 to 20 days. A maize protoplast transient was aligned with a second chloroplast transit peptide assay was used to obtain and transfect maize protoplasts from sequences from a second organism. FIG. 2 illustrates the leaves of B104-maize. This maize protoplast assay is a modi alignment of the putative chloroplast transit peptide fication of the system described by Yoo, S.-D., Cho, Y.-H... and sequences from the EPSPS (NCBI Accession No.: Sheen, J., (2007), Arabidopsis Mesophyll Protoplasts: A Ver AMBM68632) and Glycerol-3-Phosphate Dehydrogenase sitile Cell System for Transient Gene Expression Analysis, (NCBI Accession No.: EU624406) proteins obtained from Nature Protocols, 2:1565-1572. The solutions were prepared the microorganism, Dunaliella salina. FIG. 3 illustrates the as described by Yoo et. al., (2007), with the exception that the alignment of the putative EPSPS chloroplast transit peptide mannitol concentration used for the following experiments sequences from Dunaliella salina (NCBI Accession No.: was change to 0.6 M. AMBM68632.1) and Chlamydomonas reinhardtii (NCBI (0.133 Transfection of 100 to 500 ul of protoplasts (1-5x Accession No.: XP 001702942). Utilizing the chloroplast 10) was completed by adding the protoplasts to a 2 ml transit peptide sequence alignment, novel chimeric chloro microfuge tube containing about 40 ug of plasmid DNA plast transit peptides were designed by combining the first (pDAB106597), at room temperature. The volume of DNA US 2013/0205441 A1 Aug. 8, 2013 was preferably kept to about 10% of the protoplast volume. viously characterized in regard to glyphosate tolerance or The protoplasts and DNA were occasionally mixed during a 5 PEP substrate affinity. Furthermore, these EPSP synthase minute incubation period. An equal volume of PEG solution enzymes represent a new class of EPSP synthase enzymes was slowly added to the protoplasts and DNA, 2 drops at a and do not contain any sequence motifs that have been used to time with mixing in-between the addition of the drops of PEG characterize previously described Class I (plant derived solution. The tubes were allowed to incubate for about 10 sequences further described in U.S. Pat. No. RE39247), II minutes with occasional gentle mixing. Next, 1 ml of W5+ (bacterially derived sequences further described in U.S. Pat. solution was added and mixed by inverting the tube several No. RE39247), and III (bacterially derived sequences further times. The tube(s) were centrifuged for 5 minutes at 75xg at described in International Patent Application WO 2006/ a temperature of 4°C. Finally, the supernatant was removed 110586) EPSP synthase enzymes. and the pellet was resuspended in 1 ml of WI solution and the 0.139. The novel DGT-14, DGT-28, DGT-31, DGT-32, and protoplasts were placed into a small Petri plate (35x10 mm) DGT-33 enzymes were characterized for glyphosate toler or into 6-well multiwell plates and incubated overnight in the ance and PEP substrate affinity by comparison to Class I dark at room temperature. Fluorescence of GFP was viewed EPSP synthase enzymes. The following Class I enzymes: by microscopy after 12 hours of incubation. The microscopy DGT-1 from Glycine max, DGT-3 from Brassica napus conditions previously described were used for the imaging. (GENBANK ACC NO: P17688), and DGT-7 from Triticum 0134. The microscopy imaging results indicated that the aestivum (GENBANK ACC NO: EU977181) were for com GFP fluorescent protein comprising a TraP14 chimeric chlo parison. The Class I EPSP synthase enzymes and mutant roplast transit peptide accumulated within the chloroplasts variants thereof were synthesized and evaluated. A mutation located in the cytoplasm of the tobacco cells (FIG. 5). These introduced into the plant EPSP synthase enzymes consisted microscopy imaging results suggest that the translocation of of the Glycine to Alanine mutation made within the EPSP the GFP protein into the chloroplast was a result of the TraP14 synthase enzyme at a similar location as that of the G96A chimeric chloroplast transit peptide. mutation from the E. coli version of the enzyme. In addition, Threonine to Isoleucine and Proline to Serine mutations were Example 3 introduced within these Class I EPSP synthase enzymes at analogous positions as that of amino acid 97 (T to I) and Chimeric Chloroplast Transit Peptide (TraP) amino acid 101 (P to S) in the EPSP synthase of E. coli as Sequences for Expression of Agronomically described in Funke et al., (2009). Important Transgenes in Arabidopsis 0135 A single amino acid mutation (G96A) in the DGT-28, DGT-31, DGT-32, and DGT-33: Escherichia coli 5-enolpyruvylshikimate 3-phosphate syn 0140 Transgenic Arabidopsis plants containing the thase enzyme (EPSP synthase) can resultinglyphosate insen TraP14 fused to dgt-32 and TraP24 fused to dgt-33 transgenes sitivity (Padgette et al., (1991); Eschenburg et al., (2002); were produced as described in U.S. patent Filing Ser. No. Priestman et al., (2005); Haghani et al., (2008)). While this 11/975,658. The transgenic plants were sprayed with differ mutation confers tolerance to glyphosate, it is also known to ing rates of glyphosate. A distribution of varying concentra adversely affect binding of EPSP synthase with its natural tions of glyphosate rates, including elevated rates, were substrate, phosphoenolpyruvate (PEP). The resulting change applied in this study to determine the relative levels of resis in Substrate binding efficiency can render a mutated enzyme tance (105, 420, 1,680 or 3.360 gae/ha). The typical 1.x field unsuitable for providing in planta tolerance to glyphosate. usage rate of glyphosate is 1,120 gae/ha. The TArabidopsis 0136. The NCBIGenbank database was screened in silico plants that were used in this study were variable in copy for EPSP synthase protein and polynucleotide sequences that number for the TraP14:dgt-32 and TraP24:dgt-33 transgenes. naturally contain an alanine at an analogous position within The low copy T. Arabidopsis plants were identified using the EPSP synthase enzyme as that of the G96A mutation molecular confirmation assays, and self-pollinated and used which was introduced into the E. coli version of the enzyme to produce T plants. Table 1 shows the comparison of (Padgette et al., (1991); Eschenburg et al., (2002); Priestman TraP14:dgt-32, and TraP24:dgt-33 Arabidopsis plants drawn et al., (2005); Haghani et al., (2008)). to a glyphosate herbicide resistance gene, dgt-1, and wildtype 0.137. One enzyme that was identified to contain a natural controls. Table 2 shows the comparison of the novel bacterial alanine at this position was DGT-28 (GENBANKACC NO: EPSP synthase enzymes to the Class I EPSP synthase ZP 06917240.1) from Streptomyces sviceus ATCC29083. enzymes and the controls at aglyphosate rate of 1,680 gae/ha. Further in silico data mining revealed three other unique The events contain3 dgt-32 linked with TraP14 v2 (SEQ ID Streptomyces enzymes with greater homology to DGT-28; NO:7) which is contained in construct pI)AB107532 (FIG. 6) DGT-31 (GENBANK ACC NO: YP 004922608.1): DGT and dgt-33 linked with TraP24 v2 (SEQ ID NO:8) which is 32 (GENBANK ACC NO: ZP 04696613); and DGT-33 contained in construct pl)AB107534 (FIG. 7). Data from the (GENBANK ACC NO: NC 010572). Each of these glyphosate selection of T plants demonstrated that when enzymes contains a natural alanine at an analogous position dgt-32 and dgt-33 were linked with the TraP14 and TraP24 within the EPSP synthase enzyme as that of the G96A muta chloroplast transit peptides, robust tolerance to high levels of tion that was introduced into the E. coli version of the glyphosate was provided. Comparatively, the non-trans enzyme. FIG. 1. formed (or wild-type) controls did not provide tolerance to 0138 Because EPSP synthase proteins from different the treatment of high concentrations of glyphosate when organisms are of different lengths, the numbering of the muta treated with similar rates of glyphosate. tion for the E. coli version of the EPSP synthase enzyme does 0.141. The Arabidopsis T transformants were first not necessarily correspond with the numbering of the muta selected from the background of untransformed seed using a tion for the EPSP synthase enzymes from the other organ glufosinate selection scheme. Three flats or 30,000 seed were isms. These identified EPSP synthase enzymes were not pre analyzed for each T construct. The T plants selected above US 2013/0205441 A1 Aug. 8, 2013 16 were molecularly characterized and the high copy number plants expressed the transgene was not completed. It is likely plants were Subsequently transplanted to individual pots and that the presence of high copy numbers of the transgene sprayed with various rates of commercial glyphosate as pre within the TArabidopsis plants resulted in transgene silenc viously described. The response of these plants is presented in ing or other epigenetic effects which resulted in sensitivity to terms of% visual injury 2 weeks after treatment (WAT). Data glyphosate, despite the presence of the dgt-32 and dgt-33 are presented in a table which shows individual plants exhib transgene. iting little or no injury (<20%), moderate injury (20–40%), or 0.143 An overall population injury average by rate is pre severe injury (>40%). An arithmetic mean and standard sented in Table 2 for rates of glyphosate at 1,680 gae?ha to deviation is presented for each construct used for Arabidopsis demonstrate the significant difference between the plants transformation. The range in individual response is also indi transformed withdgt-3, dgt-7, dgt-32. dgt-33 versus the dgt-1 cated in the last column for each rate and transformation. and wildtype controls. The tolerance provided by the novel Wildtype, non-transformed Arabidopsis (c.V. Columbia) bacterial EPSP synthases varied depending upon the specific served as a glyphosate sensitive control. enzyme. TraP14:DGT-32 and TraP24:DGT-33 unexpectedly 0142. The level of plant response varied. This variance can provided significant tolerance to glyphosate. The digt genes be attributed to the fact each plant represents an independent imparted herbicide resistance to individual T Arabidopsis transformation event and thus the copy number of the gene of plants as a result of the fusion of the digt gene with the interest varies from plant to plant. It was noted that some chloroplast transit peptide. As such, the use of the chloroplast plants which contained the transgene were not tolerant to transit peptide fused to the dgt-32 and dgt-33 genes provided glyphosate; a thorough analysis to determine whether these protection to glyphosate as reported in the tables below. TABLE 1.

dgt-32, and digit-33 transformed TArabidopsis response to a range of glyphosate rates applied postemergence, compared to a dgt-1 (T,) homozygous resistant population, and a non-transformed control. Visual % injury 14 days after application.

% Injury % Injury

Averages <20% 20-40% >40% Ave Stol dev Range (%)

DAB107532: TraP14 v2 - dgt-32 w3

Ogae?ha glyphosate 4 O O O.O O.O O 105 gae?ha glyphosate 4 O O O.O O.O O 420 gae?ha glyphosate 2 O 2 3O.O 29.4 O-60 1680 gae?ha glyphosate 3 O 1 17.5 21.8 5-50 3360 gae?ha glyphosate O 3 1 3S.O 3O.O 20-80 pDAB107534: TraP24 v2 -- dgt-33 w3

Ogae?ha glyphosate 4 O O O.O O.O O 105 gae?ha glyphosate 2 2 O 21.3 14.9 5-40 420 gae?ha glyphosate 1 1 2 46.3 30.9 5-70 1680 gae?ha glyphosate 1 O 3 62.S. 38.8 S-90 3360 gae?ha glyphosate 1 O 3 62.O 36.O 8-8O pDAB4104: dgt-1 (transformed control)

Ogae?ha glyphosate 4 O O O.O O.O O 105 gae?ha glyphosate O 2 3 42.5 15.O 20-50 420 gae?ha glyphosate O 1 2 38.8 11.1 25-50 1680 gae?ha glyphosate O O 4 79.O. 19.4 SO-90 3360 gae?ha glyphosate O O 4 SO.O O.O 50 WT (non-transformed control)

Ogae?ha glyphosate 4 O O O.O O.O O 105 gae?ha glyphosate O O 4 85.0 O.O 85 420 gae?ha glyphosate O O 4 1OO.O O.O 100 1680 gae?ha glyphosate O O 4 1OO.O O.O 100 3360 gae?ha glyphosate O O 4 1OO.O O.O 100 US 2013/0205441 A1 Aug. 8, 2013 17

TABLE 2 dgt-32, dgt-33, dgt-3, and dgt-7 transformed TArabidopsis response to glyphosate applied postemergence at 1,680 gae?ha, compared to a dgt-1 (T) homozygous resistant population, and a non-transformed control. Visual % injury 14 days after application. %. Iniury %. Iniury Std Range <20%. 20-40% -40% Awe dev (%) Bacterial plDAB107532 TraP14 v2 - dgt- 3 O 1 17.5 21.8 S-SO Enzymes 32 v3 pDAB107534 TraP24 v2 -- dgt- 1 O 3 62.5 38.8 S-90 33 w8 Class I pDAB102715 dgt-3 v2 4 O 3 42 48 O-1OO Enzymes p)AB102716 dgt-3 v3 2 O 1 14 23 O-40 pDAB102717 digit-3 v4 3 2 1 28 35 10-100 pDAB102785 dgt-7 v4 O 1 1 45 21 30-60 pDAB4104 dgt-1 O O 4 8O.O O.O 8O (transformed control) WT (non- O O 4 1OOO O.O 100 transformed control)

0144. The newly-designed, dicotyledonous plant opti fragment of dgt-28, up to and including a unique AccI restric mized dgt-28 v5 polynucleotide sequence is listed in SEQID tion endonuclease recognition site. NO:9. The newly-designed, monocotyledonous plant opti 0149 Binary plasmids which contained the various TraP mized dgt-28 v6 polynucleotide sequence is listed in SEQID and dgt-28 expression cassettes were driven by the Arabidop NO:10; this sequence was slightly modified by including an sis thaliana Ubiquitin 10 promoter (Atl Jbi10 V2: Callis, et al., alanine at the second amino acid position to introduce a (1990).J. Biol. Chem., 265: 12486-12493) and flanked by the restriction enzyme site. The resulting DNA sequences have a Agrobacterium tumefaciens open reading frame twenty-three higher degree of codon diversity, a desirable base composi 3' untranslated region (AtuORF23 3' UTR v1; U.S. Pat. No. tion, contains strategically placed restriction enzyme recog 5,428,147). nition sites, and lacks sequences that might interfere with 0150. The assembled TraP and dgt-28 expression cassettes transcription of the gene, or translation of the product mRNA. were engineered using GATEWAYR Technology (Invitro 0145 Synthesis of DNA fragments comprising SEQ ID gen, Carlsbad, Calif.) and transformed into plants via Agro NO:9 and SEQID NO:10 containing additional sequences, bacterium-mediated plant transformation. Restriction endo Such as 6-frame stops (stop codons located in all six reading nucleases were obtained from New England BioLabs (NEB; frames that are added to the 3' end of the coding sequence), Ipswich, Mass.) and T4 DNA Ligase (Invitrogen) was used and a 5' restriction site for cloning were performed by com for DNA ligation. Gateway reactions were performed using mercial suppliers (DNA2.0, Menlo Park, Calif.). The syn GATEWAYR LR CLONASER enzyme mix (Invitrogen) for thetic nucleic acid molecule was then cloned into expression assembling one entry vector into a single destination vector vectors and transformed into plants or bacteria as described in which contained the selectable marker cassette Cassaya Vein the Examples below. Mosaic Virus promoter (CsVMV V2; Verdaguer et al., (1996) Plant Mol. Biol., 31: 1129-1139) DSM-2 (U.S. Pat. App. 0146 Similar codon optimization strategies were used to No. 2007/086813)-Agrobacterium tumefaciens open reading design dgt-1, dgt-3 v2 (G173A), dgt-3 v3 (G173A, P178S), frame one 3' untranslated region (AtuORF1 3' UTR v6: dgt-3 v4 (T1741; P178S), dgt-7 v4 (T1681; P172S), dgt-32 Huang et al., (1990).J. Bacteriol. 172:1814-1822). Plasmid v3, dgt-33 v3, and dgt-31 V3. The codon optimized version of preparations were performed using NUCLEOSPINR Plas these genes are listed as SEQIDNO:11, SEQIDNO:12, SEQ mid Kit (Macherey-Nagel Inc., Bethlehem, Pa.) or the Plas ID NO:13, SEQID NO:14, SEQID NO:15, SEQID NO:16, mid Midi Kit (Qiagen) following the instructions of the Sup SEQ ID NO:17, and SEQID NO:18, respectively. pliers. DNA fragments were isolated using QIAquickTM Gel 0147 Plant Binary Vector Construction. Extraction Kit (Qiagen) after agarose Tris-acetate gel elec 0148 Standard cloning methods were used in the con trophoresis. struction of entry vectors containing a chloroplast transit 0151 Colonies of all assembled plasmids were initially peptide polynucleotide sequence joined to dgt-28 as an in screened by restriction digestion of miniprep DNA. Plasmid frame fusion. The entry vectors containing a transit peptide DNA of selected clones was sequenced by a commercial (TraP) fused to dgt-28 were assembled using the IN-FU sequencing vendor (EurofinsTMMWG Operon, Huntsville, SIONTM Advantage Technology (Clontech, Mountain View, Ala.). Sequence data were assembled and analyzed using the Calif.). As a result of the fusion, the first amino acid, methion SEQUENCHERTM software (Gene Codes Corp., Ann Arbor, ine, was removed from dgt-28. Transit peptides TraP4 V2 Mich.). (SEQID NO:19), TraP5 v2 (SEQID NO:20), TraP8 v2 (SEQ 0152 The following binary constructs express the various ID NO:21), TraP9 v2 (SEQID NO:22), TraP12 v2 (SEQ ID TraP:dgt-28 fusion gene sequences: p)AB 107527 contains NO:23), and TraP13 v2 (SEQID NO:24) were each synthe TraP4 v2:dgt-28 v5 (SEQID NO:25); plDAB105530 contains sized by DNA2.0 (Menlo Park, Calif.) and fused to the 5' end TraP5 v2: dgt-28 v5 (SEQ ID NO:26); plDAB105531 con US 2013/0205441 A1 Aug. 8, 2013

tains TraP8 v2: dgt-28 v5 (SEQ ID NO:27): PDAB105532 TABLE 3-continued contains TraP9 v2: dgt-28 v5 (SEQIDNO:28); plDAB105533 contains TraP12 v2: dgt-28 v5 (SEQ ID NO:29); and Description of the binary vectors which contain a Class pDAB105534 contains TraP13 v2:dgt-28 v5 (SEQ ID IEPSP SYnthase gene (i.e. dgt-1, dgt-3, or digit-7). NO:30). The dgt-28 v5 sequence of pDAB105534 was modi EPSPS fied wherein the first codon (GCA) was changed to (GCT). Name Description mutation 0153. Additional Plant Binary Vector Construction. pDAB102717 At Jbi10 promoter v2/dgt-3 v4/AtuORF23 TIPS 0154 Cloning strategies similar to those described above 3'UTR v1 :: CsVMV promoter v2/pat were used to construct binary plasmids which contain dgt-31, v9/AtuORF1 3'UTR v6 binary vector dgt-32. dgt-33, dgt-1, dgt-3, and dgt-7. pDAB102785 At Jbi10 promoter v2/dgt-7 v4/AtuORF23 TIPS 0155 The microbially derived genes: dgt-31, dgt-32, and 3'UTR: CsVMV promoter v2/DSM-2 dgt-33, were fused with different chloroplast transit peptides v2/AtuORF1 3'UTR v6 binary vector than previously described. The following chloroplast transit peptides were used; TraP14 v2 (SEQID NO:31), TraP23 v2 0158 Arabidopsis thaliana Transformation. (SEQID NO:32), TraP24 v2 (SEQID NO:33). plDAB107532 0159 Arabidopsis was transformed using the floral dip (FIG. 6) contains dgt-32 v3 fused to TraP14 v2 (SEQ ID method from Clough and Bent (1998). A selected Agrobac NO:34), pIDAB 107534 (FIG. 7) contains dgt-33 v3 fused to terium colony containing one of the binary plasmids TraP24 v2 (SEQ ID NO:35), and the last construct contains described above was used to inoculate one or more 100 mL dgt-31 v3 fused to TraP23 v2 (SEQ ID NO:36). The dgt pre-cultures of YEP broth containing spectinomycin (100 expression cassettes were driven by the Arabidopsis thaliana mg/L) and kanamycin (50 mg/L). The culture was incubated Ubiquitin 10 promoter (Atl Jbi10 promoter V2) and flanked by overnight at 28°C. with constant agitation at 225 rpm. The the Agrobacterium tumefaciens open reading frame twenty cells were pelleted at approximately 5000xg for 10 minutes at three 3' untranslated region (AtuORF23 3' UTR v1). A room temperature, and the resulting Supernatant discarded. DSM-2 selectable marker cassette containing Cassaya Vein The cell pellet was gently resuspended in 400 mL dunking Mosaic Virus promoter (CsVMVV2)—DSM-2. Agrobacte media containing: 5% (w/v) Sucrose, 10 g/L 6-benzylami rium tumefaciens open reading frame one 3' untranslated nopurine, and 0.04% SilwetTML-77. Plants approximately 1 region (AtuORF1 3' UTR V6) was also present in the binary month old were dipped into the media for 5-10 minutes with Vector. gentle agitation. The plants were laid down on their sides and 0156. Additional binaries are constructed whereindgt-31 covered with transparent or opaque plastic bags for 2-3 hours, v3, dgt-32 V3, and dgt-33 v3 are fused to the previously and then placed upright. The plants were grown at 22°C., described chloroplast transit peptide sequences. For example, with a 16-hour light/8-hour darkphotoperiod. Approximately the TraP8 v2 sequence is fused to dgt-31 V3, dgt-32 V3, and 4 weeks after dipping, the seeds were harvested. dgt-33 v3, and cloned into binary vectors as described above. (0160 Selection of Transformed Plants. 0157 Binary vectors containing the Class I genes (dgt-1, 0.161 Freshly harvested T seed containing the dgt and dgt-3, and dgt-7) were constructed. The following binary DSM-2 expression cassettes was allowed to dry for 7 days at vectors were constructed and transformed into plants: room temperature. T seed was sown in 26.5x51-cm germi pDAB4104, which contains the dgt-1 v4 sequence as nation trays, each receiving a 200 mg aliquot of stratified T described in U.S. Patent Application Publication No. 2011/ seed (~10,000 seed) that had previously been suspended in 40 0.124503, which is flanked by the Nicotiana tabacum Osmo mL of 0.1% agarose solution and stored at 4°C. for 2 days to tin sequences as described in U.S. Patent Application Publi complete dormancy requirements and ensure Synchronous cation No. 2009/0064376; plDAB102715; plDAB102716; seed germination. pDAB102717; and pL)AB102785. The various TraP chloro (0162 Sunshine Mix LP5 was covered with fine vermicu plast transit peptides that were fused to dgt-28, dgt-31, dgt lite and subirrigated with Hoagland's solution until wet, then 32, and dgt-33 were not added to the Class I genes, as these allowed to gravity drain. Each 40 mLaliquot of stratified seed plant derived sequences possess native plant chloroplast tran was sown evenly onto the vermiculite with a pipette and sit peptides. These vectors are described in further detail in covered with humidity domes for 4-5 days. Domes were Table 3. removed 1 day prior to initial transformant selection using glufosinate postemergence spray (selecting for the co-trans TABLE 3 formed DSM-2 gene). Description of the binary vectors which contain a Class 0163. Seven days after planting (DAP) and again 11 DAP. IEPSP Synthase gene (i.e. dgt-1, digit-3, or digt-7). T plants (cotyledon and 2-4-1f stage, respectively) were sprayed with a 0.2% solution of Liberty herbicide (200 gai/L EPSPS glufosinate, Bayer Crop Sciences, Kansas City, Mo.) at a Name Description mutation spray volume of 10 mL/tray (703 L/ha) using a DeVilbiss pDAB4104 RB7 MAR v2 : CsVMV promoter v2/ TIPS compressed air spray tip to deliver an effective rate of 280 g NtOsm 5' UTR v2/dgt-1 v4/NtOsm ai/ha glufosinate per application. Survivors (plants actively 3' UTR v AtlORF243'UTR w:: At Jbi10 promoter v4 pat v3/AtuORF1 growing) were identified 4-7 days after the final spraying and 3'UTR v3 binary vector transplanted individually into 3-inch pots prepared with pot pDAB102715 At Jbi10 promoter v2/dgt-3 v2/AtuORF23 GA ting media (Metro Mix 360). Transplanted plants were cov 3'UTR v1 : CsVMV promoter v2/pat ered with humidity domes for 3-4 days and placed in a 22°C. v9/AtuORF1 3'UTR v6 binary vector pDAB102716 At Jbi10 promoter v2/dgt-3 v3/AtuORF23 GAPS growth chamber as before or moved to directly to the green 3'UTR v1 : CsVMV promoter v2/pat house. Domes were Subsequently removed and plants reared v9/AtuORF1 3'UTR v6 binary vector in the greenhouse (22+5°C., 50+30% RH, 14h light:10 dark, minimum 500 uE/ms' natural+supplemental light). Molecu US 2013/0205441 A1 Aug. 8, 2013 lar confirmation analysis was completed on the Surviving T. (0168 Hydrolysis Probe Assay. plants to confirm that the glyphosate tolerance gene had sta 0169 Copy number was determined in the T and T. Ara bly integrated into the genome of the plants. bidopsis plants using the hydrolysis probe assay described below. Plants with varying numbers of transgenes were iden 0164 Molecular Confirmation. tified and advanced for Subsequent glyphosate tolerance stud 0.165. The presence of the dgt-28 and DSM-2 transgenes 1CS within the genome of Arabidopsis plants that were trans 0170 Tissue samples were collected in 96-well plates and formed with plDAB107527, plDAB105530, pIDAB105531, lyophilized for 2 days. Tissue maceration was performed with pDAB105532, plDAB105533, or pl)AB105534 was con a KLECOTM tissue pulverizer and tungsten beads (Environ firmed. The presence of these polynucleotide sequences was Metal INC., Sweet Home, Oreg.). Following tissue macera confirmed via hydrolysis probe assays, gene expression cas tion, the genomic DNA was isolated in high-throughput for sette PCR (also described as plant transcription unit PCR mat using the BiosprintTM 96 Plant kit (QiagenTM, German PTUPCR), Southern blot analysis, and Quantitative Reverse town, Md.) according to the manufacturer's Suggested Transcription PCR analyses. protocol. Genomic DNA was quantified by QUANT-ITTM PICO GREEN DNA ASSAY KIT (Molecular Probes, Invit (0166 The T Arabidopsis plants were initially screened rogen, Carlsbad, Calif.). Quantified genomic DNA was via a hydrolysis probe assay, analogous to TAOMANTM, to adjusted to around 2 ng/uL for the hydrolysis probe assay confirm the presence of the DSM-2 and dgt-28 transgenes. using a BIOROBOT3000TM automated liquid handler Events were screened via gene expression cassette PCR to (Qiagen, Germantown, Md.). Transgene copy number deter determine whether the digt expression cassette completely mination by hydrolysis probe assay was performed by real integrated into the plant genomes without rearrangement. The time PCR using the LIGHTCYCLER(R) 480 system (Roche data generated from these studies were used to determine the Applied Science, Indianapolis, Ind.). Assays were designed transgene copy number and identify select Arabidopsis for DSM-2, dgt-28 and the internal reference gene, TAFII15 events for self fertilization and advancement to the Tigen (Genbank ID: NC 003075; Duarte et al., (201) BMC Evol. eration. The advanced T. Arabidopsis plants were also Biol., 10:61).\ screened via hydrolysis probe assays to confirm the presence (0171 For amplification, LIGHTCYCLERR 480 Probes and to estimate the copy number of the DSM-2 and dgt genes Master mix (Roche Applied Science, Indianapolis, Ind.) was within the plant chromosome. Finally, a Southern blot assay prepared at a 1x final concentration in a 10 uL Volume mul was used to confirm the estimated copy number on a Subset of tiplex reaction containing 0.1 uM of each primer for DSM-2 the TArabidopsis plants. and dgt-28, 0.4 uM of each primer for TAFII15 and 0.2 uMof 0167 Similar assays were used to confirm the presence of each probe. Table 4. A two-step amplification reaction was the dgt-1 transgene from plants transformed with pl)AB4101, performed with an extension at 60° C. for 40 seconds with the presence of the dgt-32 transgene from plants transformed fluorescence acquisition. All samples were run and the aver with pl)AB 107532, the presence of the dgt-33 transgene from aged Cycle threshold (Ct) values were used for analysis of plants transformed with pl)AB107534, the presence of the each sample. Analysis of real time PCR data was performed dgt-3 transgene from plants transformed with pl)AB102715, using LightCyclerTM software release 1.5 using the relative the presence of the dgt-3 transgene from plants transformed quant module and is based on the AACt method. For this, a with pl)AB102716, the presence of the dgt-3 transgene from sample of genomic DNA from a single copy calibrator and plants transformed with pl)AB102717, and the presence of known 2 copy check were included in each run. The copy the dgt-7 transgene from plants transformed with number results of the hydrolysis probe screen were deter pDAB102785. mined for the T and T transgenic Arabidopsis plants. TABLE 4

Primer and probe Information for hydrolysis probe assay of DSM-2, digt – 28 and internal reference gene (TAFII15).

Primer Name Sequence

DSM2A (SEO ID NO : 37) 5' AGCCACATCCCAGTAACGA 3

DSM2S (SEO ID NO : 38) s' CCTCCCTCTTTGACGCC 3

DSM2 Cy5 probe (SEQ ID NO: 39) 5. CAGCCCAATGAGGCATCAGC 3'

DGT28F (SEO ID NO : 4 O s' CTTCAAGGAGATTTGGGATTTGT 3"

DGT28R (SEQ ID NO: 41 5 GAGGGTCGGCATCGTAT 3

UPL154 probe Catil 046944O6 OO1 (Roche, Indianapolis, IN)

TAFFY-HEX probe (SEQ ID NO: 42) 5' AGAGAAGTTTCGACGGATTTCGGGC 3'

TAFII15-F (SEO ID NO : 43) 5 GAGGATTAGGGTTTCAACGGAG 3."

TAFII15-R (SEO ID NO : 44) 5 GAGAATTGAGCTGAGACGAGG 3." US 2013/0205441 A1 Aug. 8, 2013 20

0172 dgt-28 Integration Confirmation Via Southern Blot were prepared from a PCR fragment containing the entire Analysis. coding sequence. The PCR amplicon was purified using 0173 Southern blot analysis was used to establish the QIAEXTM II gel extraction kit and labeled with O'P-dCTP integration pattern of the inserted T-strand DNA fragment and via the Random RT Prime ITTM labeling kit (Stratagene, La identify events which contained dgt-28. Data were generated Jolla, Calif.). Blots were hybridized overnight at 65°C. with to demonstrate the integration and integrity of the transgene denatured probe added directly to hybridization buffer to inserts within the Arabidopsis genome. Southern blot data approximately 2 million counts per blot per mL. Following were used to identify simple integration of an intact copy of hybridization, blots were sequentially washed at 65°C. with the T-strand DNA. Detailed Southern blot analysis was con 0.1xSSC/0.1% SDS for 40 minutes. Finally, the blots were ducted using a PCR amplified probe specific to the dgt-28 exposed to storage phosphor imaging screens and imaged gene expression cassette. The hybridization of the probe with using a Molecular Dynamics Storm 860TM imaging system. genomic DNA that had been digested with specific restriction 0.178 The Southern blot analyses completed in this study enzymes identified genomic DNA fragments of specific were used to determine the copy number and confirm that molecular weights, the patterns of which were used to iden selected events contained the dgt-28 transgene within the tify full length, simple insertion T transgenic events for genome of Arabidopsis. advancement to the next generation. 0179 dgt-28 Gene Expression Cassette Confirmation Via 0.174 Tissue samples were collected in 2 mL conical tubes PCR Analysis. (EppendorfrTM) and lyophilized for 2 days. Tissue maceration 0180. The presence of the dgt-28 gene expression cassette was performed with a KLECKOTM tissue pulverizer and contained in the T plant events was detected by an endpoint tungsten beads. Following tissue maceration, the genomic PCR reaction. Primers (Table 5) specific to the Atl Jbi10 pro DNA was isolated using a CTAB isolation procedure. The moter v2 and AtuORF233'UTR V1 regions of the dgt-28 gene genomic DNA was further purified using the QiagenTM expression cassette were used for detection. TABLE 5 Oligonucleotide primers used for digt – 28 gene expression cassette confirmation.

Primer Name Sequence Forward oligo (SEO ID NO: 45) 5' CTGCAGGTCAACGGATCAGGATAT 3' Reverse oligo (SEO ID NO: 46) 5' TGGGCTGAATTGAAGACATGCTCC 3'

Genomic Tips kit. Genomic DNA was quantified by Quant 0181. The PCR reactions required a standard three step ITTM Pico Green DNA assay kit (Molecular Probes, Invitro PCR cycling protocol to amplify the gene expression cassette. gen, Carlsbad, Calif.). Quantified genomic DNA was All of the PCR reactions were completed using the following adjusted to 4 Jug for a consistent concentration. PCR conditions: 94° C. for three minutes followed by 35 0175 For each sample, 4 ug of genomic DNA was thor cycles of 94°C. for thirty seconds, 60°C. for thirty seconds, oughly digested with the restriction enzyme Swal (New and 72° C. for three minutes. The reactions were completed England Biolabs, Beverley, Mass.) and incubated at 25°C. using the EX-TAQTM PCR kit (TaKaRa Biotechnology Inc. overnight, then NsiI was added to the reaction and incubated Otsu, Shiga, Japan) per manufacturers instructions. Follow at 37°C. for 6 hours. The digested DNA was concentrated by ing the final cycle, the reaction was incubated at 72°C. for 10 precipitation with Quick Precipitation SolutionTM (Edge Bio minutes. TAE agarose gel electrophoresis was used to deter systems, Gaithersburg, Md.) according to the manufacturers mine the PCR amplicon size. PCR amplicons of an expected Suggested protocol. The genomic DNA was then resuspended size indicated the presence of a full length gene expression in 25 uL of water at 65°C. for 1 hour. Resuspended samples cassette was present in the genome of the transgenic Arabi were loaded onto a 0.8% agarose gel prepared in 1xTAE and dopsis events. electrophoresed overnight at 1.1 V/cm in 1xTAE buffer. The 0182 dgt-28 Relative Transcription Confirmation Via gel was sequentially subjected to denaturation (0.2 MNaOH/ Quantitative Reverse Transcription PCR Analysis. 0.6 M NaCl) for 30 minutes, and neutralization (0.5 M Tris 0183 Tissue samples of dgt-28 transgenic plants were HCl (pH 7.5)/1.5 M NaCl) for 30 minutes. collected in 96-well plates and frozen at 80°C. Tissue mac 0176 Transfer of DNA fragments to nylon membranes eration was performed with a KLECOTM tissue pulverizer and was performed by passively wicking 20xSSC solution over tungsten beads (Environ Metal INC., Sweet Home, Oreg.). night through the gel onto treated IMMOBILONTM NY+ Following tissue maceration, the Total RNA was isolated in transfer membrane (Millipore, Billerica, Mass.) by using a high-throughput format using the QiagenTM Rineasy 96 kit chromatography paper wick and paper towels. Following (QiagenTM, Germantown, Md.) according to the manufactur transfer, the membrane was briefly washed with 2xSSC, er's Suggested protocol which included the optional Dnase cross-linked with the STRATALINKERTTM 1800 (Strat treatment on the column. This step was Subsequently fol agene, LaJolla, Calif.), and vacuum baked at 80° C. for 3 lowed by an additional Dnase (AmbionTM, Austin, Tex.) hours. treatment of the eluted total RNA. cDNA synthesis was car 0177 Blots were incubated with pre-hybridization solu ried out using the total RNA as template with the High Capac tion (Perfect Hyb plus, Sigma, St. Louis, Mo.) for 1 hour at ity cDNA Reverse TranscriptionTM kit (Applied Biosystems, 65°C. in glass roller bottles using a model 400 hybridization Austin, Tex.) following the manufacturers suggested proce incubator (Robbins Scientific, Sunnyvale, Calif.). Probes dure with the addition of the oligonucleotide, TVN. Quanti US 2013/0205441 A1 Aug. 8, 2013 21 fication of expression was completed by hydrolysis probe A typical 1.x field usage rate of glyphosate is 1120 gae/ha. assay and was performed by real-time PCR using the LIGHT The T Arabidopsis plants that were used in this study were CYCLER(R) 480 system (Roche Applied Science, Indianapo variable copy number for the dgt-28 transgene. The low copy lis, Ind.). Assays were designed for dgt-28 and the internal dgt-28 TArabidopsis plants were self-pollinated and used to reference gene “unknown protein’ (Genbank Accession Number: AT4G24610) using the LIGHTCYCLER(R) Probe produce T plants. Table 7 shows the comparison of dgt-28 Design Software 2.0. For amplification, LIGHTCY transgenic plants, drawn to a glyphosate herbicide resistance CLER(R)480 Probes Master mix (Roche Applied Science, gene, dgt-1, and wildtype controls. Table 8 shows the com Indianapolis, Ind.) was prepared at 1x final concentration in a parison of digt-32, and dgt-33 drawn to aglyphosate herbicide 10 uL Volume singleplex reaction containing 0.4LM of each resistance gene, dgt-1, and wildtype controls. Table 9 shows primer, and 0.2 uM of each probe. Table 6. the comparison of the novel bacterial EPSP synthase enzymes TABLE 6 PCR primers used for quantitative reverse transcription PCR analysis of cat 28. Primer Name Sequence AT2641. OLP (SEO ID NO: 47) 5' CGTCCACAAAGCTGAATGTG 3' AT2641 ORP (SEO ID NO : 48) 5' CGAAGTCATGGAAGCCACTT3'

UPL146 Catil 04694325 OO1 (Roche, Indianapolis, IN)

DGT28F (SEO ID NO : 49) s' CTTCAAGGAGATTTGGGATTTGT3' DGT28R (SEO ID NO : 50) 5 GAGGGTCGGCATCGTAT 3 UPL154 probe Catil 046944O6 OO1 (Roche, Indianapolis, IN)

0184. A two-step amplification reaction was performed to the Class I EPSP synthase enzymes and the controls at a with an extension at 60° C. for 40 seconds with fluorescence glyphosate rate of 1,680 gae/ha. acquisition. All samples were run in triplicate and the aver aged Cycle threshold (Ct) values were used for analysis of 0188 Results of Glyphosate Selection of Transformed each sample. A minus reverse transcription reaction was run dgt-28 Arabidopsis Plants. for each sample to ensure that no g|DNA contamination was (0189 The Arabidopsis T transformants were first present. Analysis of real time PCR data was performed based selected from the background of untransformed seed using a on the AACt method. This assay was used to determine the relative expression ofdgt-28 in transgenic Arabidopsis events glufosinate selection scheme. Three flats or 30,000 seed were which were determined to be hemizygous and homozygous. analyzed for each T construct. The T plants selected above The relative transcription levels of the dgt-28 mRNA ranged were molecularly characterized and the high copy number from 2.5 fold to 207.5 fold higher than the internal control. plants were Subsequently transplanted to individual pots and These data indicate that dgt-28 transgenic plants contained a sprayed with various rates of commercial glyphosate as pre functional dgt-28 gene expression cassette, and the plants viously described. The response of these plants is presented in were capable of transcribing the dgt-28 transgene. 0185. Western Blotting Analysis. terms of% visual injury 2 weeks after treatment (WAT). Data 0186 DGT-28 was detected in leaf samples obtained from are presented in a table which shows individual plants exhib transgenic Arabidopsis thaliana plants. Plant extracts from iting little or no injury (<20%), moderate injury (20–40%), or dgt-28 transgenic plants and DGT-28 protein standards were severe injury (>40%). An arithmetic mean and standard incubated with NUPAGE(R) LDS sample buffer (Invitrogen, deviation is presented for each construct used for Arabidopsis Carlsbad, Calif.) containing DTT at 90° C. for 10 minutes and transformation. The range in individual response is also indi electrophoretically separated in an acrylamide precast gel. cated in the last column for each rate and transformation. Proteins were then electro-transferred onto nitrocellulose Wild-type, non-transformed Arabidopsis (c.V. Columbia) membrane using the manufacturer's protocol. After blocking with the WESTERNBREEZE(R) Blocking Mix (Invitrogen) served as a glyphosate sensitive control. the DGT-28 protein was detected by anti-DGT-28 antiserum 0190. The level of plant response varied. This variance can followed by goat anti-rabbit phosphatase. The detected pro be attributed to the fact each plant represents an independent tein was visualized by chemiluminescence substrate BCIP/ transformation event and thus the copy number of the gene of NBT Western Analysis Reagent (KPL, Gaithersburg, Md.). interest varies from plant to plant. It was noted that some Production of an intact DGT-28 protein via Western blot plants which contained the transgene were not tolerant to indicated that the dgt-28 transgenic plants which were glyphosate; a thorough analysis to determine whether these assayed expressed the DGT-28 protein. plants expressed the transgene was not completed. It is likely 0187 Transgenic T Arabidopsis plants containing the that the presence of high copy numbers of the transgene dgt-28 transgene were sprayed with differing rates of glypho within the TArabidopsis plants resulted in transgene silenc sate. Elevated rates were applied in this study to determine the ing or other epigenetic effects which resulted in sensitivity to relative levels of resistance (105,420, 1,680 or 3.360 gae/ha). glyphosate, despite the presence of the dgt-28 transgene.

US 2013/0205441 A1 Aug. 8, 2013 23

TABLE 9 dgt-28, dgt-32, digt-33, dgt-3, and dgt-7 transformed T Arabidopsis response to glyphosate applied postemergence at 1,680 gae?ha, compared to a digit-1 (T4) homozygous resistant population, and a non-transformed control. Visual % injury 14 days after application. 90 Intury %. Iniury Std Range <20%. 20-40% -40% Awe dev (%) Bacterial plDAB107527 TraP4 v2 -- dgt- O 2 2 55.0 26.8 35-85 Enzymes 28 wis pDAB105530 TraP5 v2 - dgt- O 4 2 47.5 27.5 25-85 28 wis pDAB105531 TraP8 v2 - dgt- 4 O O 5.3 3.8 O-8 28 wis pDAB105532 TraP9 v2 - dgt- 3 O 1 26.3 36.1 S-80 28 wis pDAB105533 Trap12 v2 - dgt- 4 1 O 11.0 8.2 O-2O 28 wis pDAB105534 TraP13 v2 - dgt- 3 O 2 39.0 47.1 S-100 28 wis bDAB107S32 Trap14 w- 3 O 1 17.5 21.8 S-SO gt-32 v3 bDAB107534 Trap24 w-- 1 O 3 62.5 38.8 S-90 gt-33 v3 Class I bDAB10271S gt-3 v2 4 O 3 42 Enzymes plDAB102716 gt-3 v3 2 O 1 14 23 O-40 bDAB102717 gt-3 v4 3 2 1 28 35 10-100 bDAB102.785 gt-7 v4 O 1 1 45 21 30-60 bDAB4104 gt-1 O O 4 8O.O (transformed control) WT (non- O O 4 1OOO OO 100 transformed control)

(0196. Heritability. (0193 dgt-28 as a Selectable Marker. (0197) Confirmed transgenic T Arabidopsis events were 0194 The use of dgt-28 as a selectable marker for glypho self-pollinated to produce T seed. These seed were progeny sate selection agent is tested with the Arabidopsis trans tested by applying IgniteTM herbicide containing glufosinate (200 gae/ha) to 100 random T. siblings. Each individual T. formed plants described above. Approximately 50T genera plant was transplanted to 7.5-cm square pots prior to spray tion Arabidopsis seed (homozygous for dgt-28) are spiked application (track sprayer at 187 L/ha applications rate). The into approximately 5,000 wildtype (sensitive to glyphosate) T families (T plants) segregated in the anticipated 3 Resis seed. The seeds are germinated and plantlets are sprayed with tant: 1 Sensitive model for a dominantly inherited single locus a selecting dose of glyphosate. Several treatments of glypho with Mendelian inheritance as determined by Chi square sate are compared; each tray of plants receives either one or analysis (P-0.05). The percentage of T families that segre two application timings of glyphosate in one of the following gated with the expected Mendelian inheritance are illustrated treatment schemes: 7 DAP (days after planting), 11 DAP, or 7 in Table 10, and demonstrate that the dgt-28 trait is passed via followed by 11 DAP. Since all plants also contain a glufosi Mendelian inheritance to the T. generation. Seed were col nate resistance gene in the same transformation vector, dgt-28 lected from 5 to 15 T individuals (T. seed). Twenty-five T. containing plants selected with glyphosate can be directly siblings from each of 3-4 randomly-selected T families were progeny tested as previously described. Data showed no seg compared to DSM-2 or pat containing plants selected with regation and thus demonstrated that dgt-28 and dgt-3 are glufosinate. stably integrated within the chromosome and inherited in a 0.195 Glyphosate treatments are applied with a DeVil Mendelian fashion to at least three generations. bissTM spray tip as previously described. Transgenic plants containing dgt-28 are identified as “resistant” or “sensitive' TABLE 10 17 DAP. Treatments of 26.25-1680 g ae/ha glyphosate Percentage of T families (T2 plants) segregating as single applied 7 and 11 days after planting (DAP), show effective Mendelian inheritance for a progeny test of 100 plants. selection for transgenic Arabidopsis plants that contain dgt 28. Sensitive and resistant plants are counted and the number T1 Families Tested of glyphosate tolerant plants is found to correlate with the Gene of Interest Segregating at 1 Locus (%) original number of transgenic seed containing the dgt-28 64% 60% transgene which are planted. These results indicate that dgt 80% 28 can be effectively used as an alternative selectable marker 63% for a population of transformed Arabidopsis. US 2013/0205441 A1 Aug. 8, 2013 24

TABLE 10-continued sentative event that is characteristic of the response to gly phosate for each construct. For the dgt-3 characterization, Percentage of T families (T. plants) segregating as single constructs containing a single PTU (plant transformation Mendelian inheritance for a progeny test of 100 plants. unit) with the dgt-3 gene being driven by the Atubil0 pro T1 Families Tested moter (pDAB102716 and pL)AB102715) were compared to Gene of Interest Segregating at 1 Locus (%) constructs with the same gene containing 2 PTUs of the gene TraP5 v2 - dgt-28 v5 100% (pDAB102719 and plDAB102718). The constructs which TraP8 v2 - dgt-28 v5 100% contained 2 PTU used the Atl Jbi10 promoter to drive one TraP9 v2 - dgt-28 v5 100% TraP12 v2 - dgt-28 v5 SO% copy of the gene and the CsVMV promoter to drive the other TraP13 v2 - dgt-28 v5 75% copy. The use of the double PTU was incorporated to compare yfp Transgenic Control 100% the dgt-3 transgenic plants with dgt-28 transgenic plants Plants which contained two copies of the transgene. Data demon strated that single copy T. dgt-3 events with only a single PTU (0198 T. Arabidopsis Data. were more Susceptible to glyphosate than single copy dgt-28 (0199 The second generation plants (T,) of selected T events tested, but were more tolerant than the non-trans Arabidopsis events which contained low copy numbers of the formed control. T families containing 2 PTUs of the dgt-3 dgt-28 transgene were further characterized for glyphosate gene provided a higher level of visual tolerance to glyphosate tolerance. Glyphosate was applied as described previously. compared to the 1 PTU constructs. In both instances the T The response of the plants is presented in terms of% visual families were compared to the dgt-1 and wildtype controls.T. injury 2 weeks after treatment (WAT). Data are presented as a data demonstrate that dgt-28 provides robust tolerance as histogram of individuals exhibiting little or no injury (<20%), single copy events. moderate injury (20–40%), or severe injury (>40%). An arith metic mean and standard deviation are presented for each TABLE 11 construct used for Arabidopsis transformation. The range in Response of selected individual T2 Arabidopsis events containing individual response is also indicated in the last column for dgt-28 to glyphosate applied postemergence at varying rates, each rate and transformation. Wild-type, non-transformed compared to a dgt-1 (T,) homozygous resistant population, and a Arabidopsis (cv. Columbia) served as a glyphosate sensitive non-transformed control. Visual 90 injury 14 days after application. control. In the T2 generation hemizygous and homozygous %. Iniury plants were available for testing for each event and therefore were included for each rate of glyphosate tested. Hemizygous 90 Iniury Std Range plants contain two different alleles at a locus as compared to homozygous plants which contain the same two alleles at a 1 copy <20% 20-40% -40% Ave dev (%) locus. Variability of response to glyphosate is expected in the pDAB105530: TraP5 T generation as a result of the difference in gene dosage for v2 - dgt-28 v5 hemizygous as compared to homozygous plants. The Vari Ogae?ha glyphosate 4 O O O.O O.O O ability in response to glyphosate is reflected in the standard 420 gae?ha glyphosate O O 4 7S.O. 17.8 SO-90 deviation and range of response. 840 gae?ha glyphosate O O 4 8O.O 20.O SO-90 1680 gae?ha glyphosate O O 4 7S.O. 10.8 60-85 0200. In the T. generation both single copy and multi 3360 gae?ha glyphosate O O 4 76.3 4.8 70-80 copy dgt-28 events were characterized for glyphosate toler pDAB105531: TraP8 ance. Within an event, single copy plants showed similar v2 - dgt-28 v5 levels of tolerance to glyphosate. Characteristic data for a Ogae?ha glyphosate 4 O O O.O O.O O single copy T. event are presented in Table 11. Events con 420 gae?ha glyphosate 4 O O O.S 1.O O-2 taining dgt-28 linked with TraP5 v2 did not provide robust 840 gae?ha glyphosate 4 O O 1.3 2.5 O-5 tolerance to glyphosate as compared with the dgt-28 con 1680 gae?ha glyphosate 4 O O 7.5 S.O 5-15 structs which contained other TraP transit peptides. However, 3360 gae?ha glyphosate 4 O O 7.5 6.5 O-15 the dgt-28 TraP5 constructs did provide a low level of gly pDAB105532: TraP9 phosate tolerance as compared to the non-transformed v2 - dgt-28 v5 Columbia control. There were instances when events that Ogae?ha glyphosate 4 O O O.O O.O O 420 gae?ha glyphosate 4 O O 2.0 4.0 O-8 were shown to contain two or more copies of digt-28 were 840 gae?ha glyphosate 4 O O 9.0 2.0 8-12 more Susceptible to elevated rates of glyphosate (data not 1680 gae?ha glyphosate 4 O O 7.3 4.6 2-12 shown). This increase in sensitivity to glyphosate is similar to 3360 gae?ha glyphosate 4 O O 11.O 12 10-12 the data previously described for the T plants which also pDAB105533: contained high copy numbers of the dgt-28 transgene. It is TraP12 v2 - dgt-28 v5 likely that the presence of high copy numbers of the transgene Ogae?ha glyphosate 4 O O O.O O.O O within the Arabidopsis plants result in transgene silencing or 420 gae?ha glyphosate 4 O O O.O O.O O other epigenetic effects which resulted in sensitivity to gly 840 gae?ha glyphosate 4 O O O.O O.O O phosate, despite the presence of the dgt-28 transgene. 1680 gae?ha 4 O O O.O O.O O 3360 gae?ha glyphosate 3 1 O 13.3 7.9 8-2S 0201 These events contained dgt-28 linked with TraP5 v2 pDAB105534: (pDAB105530), TraP12 v2 (pDAB105533) and TraP13 v2 TraP13 v2 - dgt-28 v5 (pDAB105534). Ogae?ha glyphosate 4 O O O.O O.O O 0202 In addition to dgt-28, T. Arabidopsis events trans 420 gae?ha glyphosate 3 1 O S.O. 10.O O-2O formed withdgt-3 are presented in Table 12. As described for 840 gae?ha glyphosate 3 1 O S.O. 10.O O-2O the dgt-28 events in Table 11, the data table contains a repre US 2013/0205441 A1 Aug. 8, 2013

TABLE 11-continued TABLE 12-continued Response of selected individual T2 Arabidopsis events containing Response of selected T. Arabidopsis events transformed with digit-3 dgt-28 to glyphosate applied postemergence at varying rates, to glyphosate applied postemergence at varying rates. compared to a digit-1 (T4) homozygous resistant population, and a Visual % injury 14 days after application. non-transformed control. Visual % injury 14 days after application. %. Iniury %. Injury %. Iniury Std Range %. Injury Std Range 1 copy Seg <20% 20-40% -40% Ave dev (%) 1 copy <20% 20-40% -40% Ave dev (%) 1680 gae?ha glyphosate 3 O 1 2O 2O 5-50 3360 gae?ha glyphosate 1 1 2 36 22 15-60 1680 gae?ha glyphosate 2 2 O 1O.O. 11.5 O-2O 3360 gae?ha glyphosate 2 2 O 1S.O. 12.2 S-30 WT (non-transformed 0203 T Arabidopsis Data. control) 0204. The third generation plants (T,) of selected T Ara bidopsis events which contained low copy numbers of the Ogae?ha glyphosate 4 O O O.O O.O O dgt-28 transgene were further characterized for glyphosate 420 gae?ha glyphosate O O 4 1OOO O.O 100 840 gae?ha glyphosate O O 4 1OOO O.O 100 tolerance. Glyphosate was applied as described previously. 1680 gae?ha glyphosate O O 4 1OOO O.O 100 The response of the plants is presented in terms of% visual 3360 gae?ha glyphosate O O 4 1OOO O.O 100 injury 2 weeks after treatment (WAT). Data are presented as a pDAB4104: dgt-1 histogram of individuals exhibiting little or no injury (<20%), (transformed control) moderate injury (20–40%), or severe injury (>40%). An arith metic mean and standard deviation are presented for each Ogae?ha glyphosate 4 O O O.O O.O O construct used for Arabidopsis transformation. The range in 420 gae?ha glyphosate O 4 O 37.5 2.9 35-40 individual response is also indicated in the last column for 840 gae?ha glyphosate O O 4 45.O O.O 45 each rate and transformation. Wild-type, non-transformed 1680 gae?ha glyphosate O O 4 47.5 2.9 45-50 Arabidopsis (cv. Columbia) served as a glyphosate sensitive 3360 gae?ha glyphosate O O 4 SO.O O.O 50 control. In the T. generation hemizygous and homozygous plants were available for testing for each event and therefore were included for each rate of glyphosate tested. Hemizygous TABLE 12 plants contain two different alleles at a locus as compared to homozygous plants which contain the same two alleles at a Response of selected T. Arabidopsis events transformed with dgt-3 locus. Variability of response to glyphosate is expected in the to glyphosate applied postemergence at varying rates. T generation as a result of the difference in gene dosage for Visual % iniury 14 days after application. hemizygous as compared to homozygous plants. The vari %. Iniury ability in response to glyphosate is reflected in the standard 90 Intury Std Range deviation and range of response. 1 copy Seg <20% 20-40% -40% Ave dev (%) TABLE 13 pDAB102716: dgt-3 Response of selected individual TArabidopsis events containing v3 (1 PTU) dgt-28 to glyphosate applied postemergence at varying rates, compared to a dgt-1 (T,) homozygous resistant population, and a non-transformed Ogae?ha glyphosate 4 O O O O O control. Visual % injury 14 days after application. 420 gae?ha glyphosate 1 1 2 39 25 15-65 840 gae?ha glyphosate O 2 2 50 23 30-70 % Injury Range 1680 gae?ha glyphosate O 1 3 69 19 40-80 (No. Replicates) % Injury Analysis 3360 gae?ha glyphosate O O 4 79 6 70-85 pDAB102719: dgt-3 Application Rate <20% 20-40% >40% Ave Std dev Range (%) v3 (2 PTU) dgt-28 Ogae?ha glyphosate 4 O O O O O (pDAB107602) 420 gae?ha glyphosate O 4 O 2O O 2O 840 gae?ha glyphosate O 3 1 38 5 35-45 1680 gae?ha glyphosate 3 1 O 15 7 10-2S glyphosate 3360 gae?ha glyphosate 2 2 O 21 8 15-30 420 gae?ha O O 4 73.8 2.5 70-75 pDAB102715: dgt-3 glyphosate v2 (1 PTU) 840 gae?ha O O 4 71.3 7.5 60-75 yphosate Ogae?ha glyphosate 4 O O O O O 680 gae?ha O O 4 77.5 2.9 75-80 420 gae?ha glyphosate 2 2 O 26 16 1O-40 yphosate 840 gae?ha glyphosate O 2 2 55 17 40-70 360 gae?ha O O 4 77.5 2.9 75-80 1680 gae?ha glyphosate O 2 2 56 22 35-75 yphosate 3360 gae?ha glyphosate O O 4 65 17 SO-80 raP4::dgt-28 pDAB102718: dgt-3 pDAB107527) v2 (2 PTU) Ogae?ha glyphosate 4 O O O O O glyphosate 420 gae?ha glyphosate 4 O O 5 7 O-15 420 gae?ha 4 O O O.O O.O O 840 gae?ha glyphosate 2 2 O 23 10 15-35 glyphosate

US 2013/0205441 A1 Aug. 8, 2013 27 evenly onto the vermiculite with a pipette and covered with bia) served as a glyphosate sensitive control. The DGT-31 humidity domes (KORDTM Products, Bramalea, Ontario, (v1) gene with transit peptide (TraP23) imparted slight her Canada) for 4-5 days. Domes were removed once plants had bicide tolerance to individual T Arabidopsis plants com germinated prior to initial transformant selection using glu pared to the negative control. Both DGT-32 and DGT-33 fosinate postemergence spray (selecting for the co-trans demonstrated robust tolerance to glyphosate at the rates formed dsm-2 gene). tested with their respective chloroplast transit peptide 0208 Six days after planting (DAP) and again 10 DAP. T. (TraP14 and TraP24 respectively). Within a given treatment, plants (cotyledon and 2-4-1f stage, respectively) were the level of plant response varied greatly, which can be attrib sprayed with a 0.1% solution of IGNITETM herbicide (280 g uted to the fact each plant represents an independent trans ai/L glufosinate, Bayer CropSciences, Kansas City, Mo.) at a spray volume of 10 mL/tray (703 L/ha) using a DeVilbissTM formation event and thus the copy number of the gene of compressed air spray tip to deliver an effective rate of 200 g interest varies from plant to plant. Of important note, at each ae/ha glufosinate per application. Survivors (plants actively glyphosate rate tested, there were individuals that were more growing) were identified 4-7 days after the final spraying. tolerant than others. An overall population injury average by Surviving plants were transplanted individually into 3-inch rate is presented in Table 15 to demonstrate the significant pots prepared with potting media (Metro Mix 360TM). Plants difference between the plants transformed with dgt-31, dgt reared in the greenhouse at least 1 day prior to tissue sampling 32, and dgt-33 v1 versus the dgt-1 V1 or Wild-type controls. for copy number analyses. 0209 T plants were sampled and copy number analysis TABLE 1.5 for the dgt-31, dgt-32, and dgt-33 v1 gene were completed.T. dgt-31, dgt-32, and digit-33 v1 transformed TArabidopsis response to plants were then assigned to various rates of glyphosate so a range of glyphosate rates applied postemergence, compared to a dgt-1 that a range of copies were among each rate. For Arabidopsis, (T4) homozygous resistant population, or a non-transformed control. 26.25 gae/ha glyphosate is an effective dose to distinguish Visual % injury 2 weeks after treatment. sensitive plants from ones with meaningful levels of resis 90 Iniury 90 Iniury tance. Elevated rates were applied to determine relative levels of resistance (105, 420, 1680, or 3360 gae/ha). Table 15 Averages <20% 20-40% >40% Ave Stol. Dev. Range (%) shows the comparisons drawn to dgt-1. 0210 All glyphosate herbicide applications were made by TraP23 dgt-31 track sprayer in a 187 L/ha spray Volume. Glyphosate used 0 g ae?ha 4 O O O.O O.O O glyphosate was of the commercial Durango dimethylamine salt formu 105 gae?ha O O 4 813 2.5 80-85 lation (480 gae/L, Dow AgroSciences, LLC). Low copy T. 420 gae?ha O O 4 97.3 4.9 90-100 plants that exhibited tolerance to either glufosinate or glypho 1680 gae?ha O O 4 90.0 7.1 85-100 sate were further accessed in the T. generation. 3360 gae?ha O O 4 91.3 6.3 85-100 0211. The first Arabidopsis transformations were con TraP14 dgt-32 ducted using dgt-31, dgt-32, and dgt-33 v1.T. transformants Ogae?ha 4 O O O.O O.O O were first selected from the background of untransformed glyphosate seed using a glufosinate selection scheme. Three flats or 105 gae?ha 4 O O O.O O.O O 420 gae?ha 2 O 2 3O.O 29.4 O-60 30,000 seed were analyzed for each T construct. Transfor 1680 gae?ha 3 O 1 17.5 21.8 5-50 mation frequency was calculated and results of T1 dgt-31, 3360 gae?ha O 3 1 3S.O 3O.O 20-80 dgt-32, and dgt-33 constructs are listed in Table 14. TraP24 dgt-33 Ogae?ha 4 O O O.O O.O O TABLE 1.4 glyphosate 105 gae?ha 2 2 O 21.3 14.9 5-40 Transformation frequency of T1 dgt-31, dgt-32, and dgt-33 420 gae?ha 1 1 2 46.3 30.9 5-70 Arabidopsis constructs selected with glufosinate for 1680 gae?ha 1 O 3 62.5 38.8 S-90 Selection of the Selectable marker gene DSM-2. 3360 gae?ha 1 O 3 62.O 36.0 8-8O dgt-1 Transformation (transformed Construct Cassette Frequency (%) control) pDAB107532 At Jbi10/TraP14 dgt-32 v1 O.47 pDAB107533 At Jbi10/TraP23 dgt-31 v1 O.36 Ogae?ha 4 O O O.O O.O O pDAB107534 At Jbi10/TraP24 dgt-33 v1 O.68 glyphosate 105 gae?ha O 1 3 42.5 1S.O 20-50 420 gae?ha O 2 2 38.8 11.1 25-50 0212 T,1 plantsp. selected above were subsequentlyC y trans 1680 gae?ha O O 4 79.0 19.4 SO-90 3360 gae?ha O O 4 SO.O O.O 50 planted to individual pots and sprayed with various rates of WT commercial glyphosate. Table 15 compares the response of (non-transformed dgt-31, dgt-32, and dgt-33 v1 and control genes to impart control) glyphosate resistance to Arabidopsis T transformants. Response is presented interms of% visual injury 2WAT. Data Ogae?ha 4 O O O.O O.O O are presented as a histogram of individuals exhibiting little or glyphosate 105 gae?ha O O 4 85.0 O.O 85 no injury (<20%), moderate injury (20-40%), or severe injury 420 gae?ha O O 4 100.O O.O 100 (>40%). An arithmetic mean and standard deviation is pre 1680 gae?ha O O 4 100.O O.O 100 sented for each treatment. The range in individual response is 3360 gae?ha O O 4 100.O O.O 100 also indicated in the last column for each rate and transfor mation. Wild-type non-transformed Arabidopsis (cv. Colum US 2013/0205441 A1 Aug. 8, 2013 28

0213 Maize Transformation. TABLE 16-continued 0214 Standard cloning methods, as described above, were used in the construction of binary vectors for use in Agrobac Maize Transformation Vectors terium tumefaciens-mediated transformation of maize. Table Plasmid No. Description of Gene Elements 16 lists the vectors which were constructed for maize trans DAB107666 Ubi1/TraP5 dgt-28/ZmLip formation. The following gene elements were used in the TR: Zm Jbi1.faad-1/ZmLip vectors which contained dgt-28; the Zea mays Ubiquitin 1 TR binary vector promoter (ZmUbi1; U.S. Pat. No. 5,510.474) was used to DAB109812 bi1/yfp/ZmPers drive the dgt-28 coding sequence which is flanked by a Zea CR: SCBVlaad-1/ZmLip mays Lipase 3' untranslated region (ZmLip 3'UTR; U.S. Pat. Rbinary vector DAB1 O1556 Ubi1/yfp/ZmPers No. 7,179,902), the selectable marker cassette consists of the TR: Zm Jbi1.faad-1/ZmLip Zea mays Ubiquitin 1 promoter which was used to drive the TR binary vector aad-1 coding sequence (U.S. Pat. No. 7,838,733) which is DAB107698 Ubil TraP8 dgt-28/ZmLip TR: Zm Jbi1?yfp/ZmLip flanked by a Zea mays Lipase 3' untranslated region. The CR::SCBV/aad-1/ZmLip 3'UTR aad-1 coding sequence confers tolerance to the phenoxy DAB108384 Ubil TraP4 dgt-28/ZmLip auxin herbicides, such as, 2,4-dichlorophenoxyacetic acid TR: Zm Jbi1/aad-1/ZmLip (2,4-D) and to aryloxyphenoxypropionate (AOPP) herbi TRSuperbinary vector cides. DAB108385 Ubil TraP8 dgt-28/ZmLip TR: Zm Jbi1.faad-1/ZmLip 0215. The dgt-28 constructs were built as standard binary TR Superbinary precursor vectors and Agrobacterium Superbinary system vectors (Ja DAB108386 Ubi1/TraP23 dgt-28/ZmLip pan Tobacco, Tokyo, JP). The standard binary vectors TR: Zm Jbi1.faad-1/ZmLip include: pdAB107663, pIDAB107664, pIDAB107665, and TR Superbinary precursor DAB108387 Ubi1/TraP5 dgt-28/ZmLip pDAB 107665. The Agrobacterium superbinary system vec TR::Zml Jbi1/aad-1/ZmLip tors include plDAB108384, pIDAB108385, pIDAB108386, TR Superbinary precursor and plDAB108387. 0216. Additional constructs were completed which con tain a yellow fluorescent protein (yfp; US Patent Application 0217 Ear Sterilization and Embryo Isolation. 2007/0298.412) reporter gene. p.)AB109812 contains a yfp reporter gene cassette which is driven by the Zea mays Ubiq 0218. To obtain maize immature embryos, plants of the uitin1 promoter and flanked by the Zea mays per 53' untrans Zea mays inbred line B104 were grown in the greenhouse and lated region (Zm perS 3'UTR: U.S. Pat. No. 7,179,902), the were self or sib-pollinated to produce ears. The ears were selectable marker cassette consists of the Sugar cane bacilli harvested approximately 9-12 days post-pollination. On the form virus promoter (SCBV: U.S. Pat. No. 5,994,123) which experimental day, ears were surface-sterilized by immersion is used to drive the expression of aad-1 and is flanked by the in a 20% solution of sodium hypochlorite (5%) and shaken for Zea mays Lipase 3' untranslated region. pl.)AB101556 con 20-30 minutes, followed by three rinses insterile water. After tains ayfp cassette which is driven by the Zea mays Ubiquitin sterilization, immature Zygotic embryos (1.5-2.4 mm) were 1 promoter and flanked by the Zea mays per 53' untranslated aseptically dissected from each ear and randomly distributed region, the selectable marker cassette consists of the Zea into micro-centrifuge tubes containing liquid infection media mays Ubiquitin 1 promoter which is used to drive the expres (LS Basal Medium, 4.43 gm/L. N6 Vitamin Solution 1000x. sion ofaad-1 and is flanked by the Zea may’s Lipase 3' untrans 1.00 mL/L: L-proline, 700.0 mg/L. Sucrose, 68.5gm/L: D(+) lated region. pl.)AB 107698 contains adgt-28 cassette which Glucose, 36.0 gm/L; 10 mg/ml of 2,4-D, 150 uL/L). For a is driven by the Zea mays Ubiquitin1 promoter and is flanked given set of experiments, pooled embryos from three ears by a Zea mays Lipase 3' untranslated region, any fp cassette were used for each transformation. which is driven by the Zea mays Ubiquitin 1 promoter and flanked by the Zea mays per 5 3' untranslated region, the 0219 Agrobacterium Culture Initiation: selectable marker cassette consists of the Sugar cane bacilli 0220 Glycerol stocks of Agrobacterium containing the form virus promoter which is used to drive the expression of binary transformation vectors described above were streaked aad-1 and is flanked by the Zea mays Lipase 3' untranslated on AB minimal medium plates containing appropriate anti region. All three of these constructs are standard binary vec biotics and were grown at 20°C. for 3-4 days. A single colony tOrS. was picked and streaked onto YEP plates containing the same antibiotics and was incubated at 28°C. for 1-2 days. TABLE 16 0221 Agrobacterium Culture and Co-Cultivation. Maize Transformation Vectors 0222 Agrobacterium colonies were taken from the YEP Plasmid No. Description of Gene Elements plate, suspended in 10 mL of infection medium in a 50 mL disposable tube, and the cell density was adjusted to ODoo pDAB107663 ZmUbi1/TraP4 dgt-28/ZmLip 3'UTR: Zml Jbi1/aad-1/ZmLip nm of 0.2-0.4 using a spectrophotometer. The Agrobacterium 3'UTR binary vector cultures were placed on a rotary shaker at 125 rpm, room pDAB107664 ZmUbi1/TraP8 dgt-28/ZmLip temperature, while embryo dissection was performed. Imma 3'UTR: Zml Jbi1/aad-1/ZmLip ture Zygotic embryos between 1.5-2.4 mm in size were iso 3'UTR binary vector pDAB107665 ZmUbi1/TraP23 dgt-28/ZmLip lated from the sterilized maize kernels and placed in 1 mL of 3'UTR: Zml Jbi1/aad-1/ZmLip the infection medium) and washed once in the same medium. 3'UTR binary vector The Agrobacterium Suspension (2 mL) was added to each tube and the tubes were placed on a shaker platform for 10-15 US 2013/0205441 A1 Aug. 8, 2013 29 minutes. The embryos were transferred onto co-cultivation 0228 Embryogenic calli with shoot-like buds were trans media (MS Salts, 4.33 gm/L; L-proline, 700.0 mg/L. Myo ferred onto Regeneration media containing 0.5 mM glypho inositol, 100.0 mg/L. Casein enzymatic hydrolysate 100.0 sate (MS Salts, 4.33 gm/L: 1,2,3,5/4.6-Hexahydroxycyclo mg/L.; 30 mM Dicamba-KOH, 3.3 mg/L. Sucrose, 30.0gm/L.; hexane, 100.0 mg/L. Sucrose, 60.0 gm/L: Gellan Gum GelzanTM, 3.00 gm/L; Modified MS-Vitamin (1000x, 1.00 G434TM 3.00 gm/L; Modified MS-Vitamin 1000x, 1.00 ml/L; 8.5 mg/ml AgNo. 15.0 mg/L. DMSO, 100 uM), ori ml/L. Carbenicillin, 125.0 mg/L) and cultured under 24-hour ented with the scutellum facing up and incubated at 25°C., light at 50 umolem sec' light intensity for 7 days. under 24-hour light at 50 umole m' sec light intensity for 0229 Small shoots with primary roots were transferred to 3 days. rooting media (MS Salts, 4.33 gm/L; Modified MS-Vitamin 0223 Callus Selection and Regeneration of Putative 1000x, 1.00 ml/L. 1.2.3,5/4.6-Hexahydroxycyclohexane, Events. 100 mg/L. Sucrose, 60.0 gm/L: Gellan Gum G434TM 3.00 0224 Following the co-cultivation period, embryos were gm/L. Carbenicillin, 250.0 mg/L) in phytotrays and were transferred to resting media (MS Salts, 4.33 gm/L: L-proline, incubated under 16/8 hr. light/dark at 140-190 umole m' 700.0 mg/L.; 1,2,3,5/4.6-Hexahydroxycyclohexane, 100 sec' light intensity for 7 days at 27°C. Putative transgenic mg/L. MES (2-(n-morpholino)-ethanesulfonic acid), free plantlets were analyzed for transgene copy number using the acid 0.500gm/L. Casein enzymatic hydrolysate 100.0 mg/L.; protocols described above and transferred to soil. 30 mM Dicamba-KOH, 3.3 mg/L. Sucrose, 30.0gm/L: Gel 0230 Molecular Confirmation of the Presence of the dgt Zan 2.30 gm/L: Modified MS-Vitamin (1000x, 1.00 ml/L: 28 and aad-1 Transgenes within Maize Plants. 8.5 mg/ml AgNo3, 15.0 mg/L. Carbenicillin, 250.0 mg/L) 0231. The presence of the dgt-28 and aad-1 polynucle without selective agent and incubated under 24-hour light at otide sequences were confirmed via hydrolysis probe assays. 50 umole m° sec light intensity and at 25°C. for 3 days. Isolated To Maize plants were initially screened via a 0225 Growth inhibition dosage response experiments hydrolysis probe assay, analogous to TAOMANTM, to con Suggested that glyphosate concentrations of 0.25 mM and firm the presence of a aad-1 and dgt-28 transgenes. The data higher were sufficient to inhibit cell growth in the untrans generated from these studies were used to determine the transgene copy number and used to select transgenic maize formed B104 maize line. Embryos were transferred onto events for back crossing and advancement to the T genera Selection 1 media containing 0.5 mM glyphosate (MS Salts, tion. 4.33 gm/L: L-proline, 700.0 mg/L. Myo-inositol, 100.0 mg/L. MES (2-(n-morpholino)-ethanesulfonic acid), free 0232 Tissue samples were collected in 96-well plates, tissue maceration was performed with a KLECOTM tissue acid 0.500gm/L. Casein enzymatic hydrolysate 100.0 mg/L.; pulverizer and stainless steel beads (Hoover Precision Prod 30 mM Dicamba-KOH, 3.3 mg/L. Sucrose, 30.0gm/L: Gel ucts, Cumming, Ga.), in QiagenTM RLT buffer. Following ZanTM 2.30gm/L; Modified MS-Vitamin 1000x, 1.00 ml/L: tissue maceration, the genomic DNA was isolated in high 8.5 mg/ml AgNo3, 15.0 mg/L. Carbenicillin, 250.0 mg/L) throughput format using the Biosprint 96TM Plant kit (Qiagen, and incubated in either dark and/or under 24-hour light at 50 Germantown, Md.) according to the manufacturer's Sug umolem'sec light intensity for 7-14 days at 28°C. gested protocol. Genomic DNA was quantified by Quant ITTM Pico Green DNA assay kit (Molecular Probes, Invitro 0226 Proliferating embryogenic calli were transferred gen, Carlsbad, Calif.). Quantified genomic DNA was onto Selection 2 media containing 1.0 mM glyphosate (MS adjusted to around 2 ng/uL for the hydrolysis probe assay Salts, 4.33 gm/L; 1.2.3,5/4.6-Hexahydroxycyclohexane, 100 using a BIOROBOT3000TM automated liquid handler mg/L: L-proline, 700.0 mg/L. MES (2-(n-morpholino)- (Qiagen, Germantown, Md.). Transgene copy number deter ethanesulfonic acid), free acid 0.500 gm/L. Casein enzy mination by hydrolysis probe assay, analogous to TAC matic hydrolysate 100.0 mg/L; 30 mM Dicamba-KOH, 3.3 MANR assay, was performed by real-time PCR using the mg/L. Sucrose, 30.0 gm/L: GelzanTM 2.30 gm/L: Modified LIGHTCYCLER(R480 system (Roche Applied Science, MS-Vitamin (1000x, 1.00 ml/L; 8.5 mg/mL AgNo3, 15.0 Indianapolis, Ind.). Assays were designed for aad-1. dgt-28 mg/L. Carbenicillin, 250.0 mg/L.; R-Haloxyfop acid 0.1810 and an internal reference gene Invertase (Genbank Accession mg/L), and were incubated in either dark and/or under No: U16123.1) using the LIGHTCYCLER(R) Probe Design 24-hour light at 50 umolem sec' light intensity for 14 days Software 2.0. For amplification, LIGHTCYCLER(R480 at 28°C. This selection step allowed transgenic callus to Probes Master mix (Roche Applied Science, Indianapolis, further proliferate and differentiate. The callus selection Ind.) was prepared at 1x final concentrationina 10LL Volume period lasted for three to four weeks. multiplex reaction containing 0.4LM of each primer foraad-l 0227 Proliferating, embryogenic calli were transferred and dgt-28 and 0.2 uM of each probe (Table 17). onto PreReg media containing 0.5 mM glyphosate (MSSalts, 0233. A two-step amplification reaction was performed 4.33 gm/L: 1,2,3,5/4.6-Hexahydroxycyclohexane, 100 mg/L.; with an extension at 60° C. for 40 seconds with fluorescence L-proline, 350.0 mg/L. MES (2-(n-morpholino)-ethane acquisition. All samples were run and the averaged Cycle sulfonic acid), free acid 0.250 gm/L. Casein enzymatic threshold (Ct) values were used for analysis of each sample. hydrolysate 50.0 mg/L. NAA-NaOH 0.500 mg/L, ABA Analysis of real time PCR data was performed using Light EtOH 2.50 mg/L.; BA 1.00 mg/L. Sucrose, 45.0 gm/L: Gel Cycler(R) software release 1.5 using the relative quant module ZanTM 2.50gm/L; Modified MS-Vitamin 1000x, 1.00 ml/L: and is based on the AACt method. Controls included a sample 8.5 mg/ml AgNo3, 1.00 mg/L. Carbenicillin, 250.0 mg/L) of genomic DNA from a single copy calibrator and known and cultured under 24-hour light at 50 umole m° sec light two copy check that were included in each run. Table 18 lists intensity for 7 days at 28°C. the results of the hydrolysis probe assays. US 2013/0205441 A1 Aug. 8, 2013 30

TABL E 17 Primer and probe sequences used for hydrolysis probe assay of aad l, dat-28 and internal reference (Invertase) . Oligonucleotide Gene SEQ ID Name Detected NO: Oligo Sequence

GAAD1F aad-1 51. TGTTCGGTTCCCTCTACCAA forward primer

GAAD1P aad-1 52 CACAGAACCGTCGCTTCAGCAACA probe

GAAD1R aad-1 53 CAACATCCATCACCTTGACTGA rewerse primer

IW-Probe Invertase 54 CGAGCAGACCGCCGTGTACTTCTACC probe

IVF-Taq Invertase 55 TGGCGGACGACGACTTGT forward primer

IVR-Taq Invertase 56 AAAGTTTGGAGGCTGCCGT rewerse primer

ZmDGT28 F digt -28 st TTCAGCACCCGTCAGAAT forward primer

ZmDGT28 FAM digt -28 58 TGCCGAGAACTTGAGGAGGT probe

ZmDGT28 R digt -28 9 TGGTCGCCATAGCTTGT rewerse primer

TABLE 18 0236 The results of the To dgt-28 corn plants demon strated that tolerance to glyphosate was achieved at rates up to To copy amount results for digt-28 events. Low copy events consisted 4480 g ae/ha. A specific media type was used in the To of 1-2 transgene copies, single copy numbers are listed in parenthesis. generation. Minimal stunting and overall plant growth of High copy events contained 3 or more transgene copies. transformed plants compared to the non-transformed controls Plasmid used for # of Low Copy # of High Copy demonstrated that dgt-28 provides robust tolerance to gly Transformation Events (single copy) Events phosate when linked to the TraP5, TraP8, and TraP23 chlo pDAB107663 43 (31) 10 roplast transit peptides. pDAB107664 30 (24) 5 0237 Selected To plants are selfed or backcrossed for fur pDAB107665 40 (27) 10 ther characterization in the next generation. 100 chosen dgt pDAB107666 24 (12) 12 pDAB109812 2 (1) O 28 lines containing the T plants are sprayed with 140-1120 g pDAB101556 25 (15) 10 ae/ha glufosinate or 105-1680 gae/ha glyphosate. Both the pDAB107698 3 (1) 2 selectable marker and glyphosate resistant gene are con structed on the same plasmid. Therefore, if one herbicide 0234. Herbicide Tolerance indgt-28 Transformed Corn. tolerant gene is selected for by spraying with an herbicide, 0235 Zea mays dgt-28 transformation events (T) were both genes are believed to be present. At 14 DAT resistant and allowed to acclimate in the greenhouse and were grown until sensitive plants are counted to determine the percentage of plants had transitioned from tissue culture to greenhouse lines that segregated as a single locus, dominant Mendelian growing conditions (i.e., 2-4 new, normal looking leaves had trait (3R:1S) as determined by Chi square analysis. These emerged from the whorl). Plants were grown at 27°C. under data demonstrate that dgt-28 is inheritable as a robust glypho 16 hour light:8 hour dark conditions in the greenhouse. The sate resistance gene in a monocot species. Increased rates of plants were then treated with commercial formulations of glyphosate are applied to the T or F survivors to further DURANGO DMATM (containing the herbicide glyphosate) characterize the tolerance and protection that is provided by with the addition of 2% w/v ammonium-sulfate. Herbicide the dgt-28 gene. applications were made with a track sprayer at a spray Volume 0238 Post-Emergence Herbicide Tolerance in dgt-28 of 187 L/ha, 50-cm spray height. To plants were sprayed with Transformed To Corn. a range of glyphosate from 280-4480 gae/ha glyphosate, 0239. To events ofdgt-28 linked with TraP4, TraP5, TraP8 which is capable of significant injury to untransformed corn and TraP23 were generated by Agrobacterium transformation lines. A lethal dose is defined as the rate that causes >95% and were allowed to acclimate undercontrolled growth cham injury to the B104 inbred. ber conditions until 2-4 new, normal looking leaves had US 2013/0205441 A1 Aug. 8, 2013

emerged from the whorl. Plants were assigned individual TABLE 19-continued identification numbers and sampled for copy number analy Response of Todgt-28 events of varying copy numbers to rates of ses of both dgt-28 and aad-1. Based on copy number analyses, glyphosate ranging from 280-4480 gae?ha + 2.0% w/v ammonium sulfate plants were selected for protein expression analyses. Plants 14 days after treatment. were transplanted into larger pots with new growing media and grown at 27°C. under 16 hour light:8 hour dark condi %. Iniury %. Iniury tions in the greenhouse. Remaining plants that were not Application Rate <20% 20-40% >40% Ave Std. Dev. Range (%) sampled for protein expression were then treated with com mercial formulations of DURANGO DMATM (glyphosate) 2240 gae?ha 8 O O O.O O.O O with the addition of 2% w/v ammonium-sulfate. Treatments 4480 gae?ha 8 O O O.O O.O O were distributed so that each grouping of plants contained To events of varying copy number. Herbicide applications were 0241 Protein expression analyses by standard ELISA demonstrated a mean range of DGT-28 protein from 12.6- made with a track sprayer at a spray volume of 187 L/ha, 22.5 ng/cm across the constructs tested. 50-cm spray height. To plants were sprayed with a range of 0242 Confirmation of Glyphosate Tolerance in the F glyphosate from 280-4480 g ae/ha glyphosate capable of Generation Under Greenhouse Conditions. significant injury to untransformed corn lines. A lethal dose is 0243 Single copy To plants that were not sprayed were defined as the rate that causes >95% injury to the B104 backcrossed to the non-transformed background B104 for inbred. B104 was the genetic background of the transfor further characterization in the next generation. In the Tigen mants. eration, glyphosate tolerance was assessed to confirm the inheritance of the dgt-28 gene. For T plants, the herbicide 0240 Results of Todgt-28 corn plants demonstrate that ASSURE IITM (35 gae/ha quizalofop-methyl) was applied at tolerance to glyphosate was achieved up to 4480 gae/ha. the V1 growth stage to select for the AAD-1 protein. Both the Table 19. Minimal stunting and overall plant growth of trans selectable marker and glyphosate resistant gene are con formed plants compared to the non-transformed controls structed on the same plasmid. Therefore if one gene is demonstrated that dgt-28 provides robust protection to gly selected, both genes are believed to be present. After 7 DAT, phosate when linked to TraP5, TraP8, and TraP23. resistant and sensitive plants were counted and null plants were removed from the population. These data demonstrate TABLE 19 that dgt-28 (V1) is heritable as a robust glyphosate resistance Response of Todgt-28 events of varying copy numbers to rates of gene in a monocot species. Plants were sampled for charac glyphosate ranging from 280-4480 gae?ha + 2.0% w/v ammonium sulfate terization of DGT-28 protein by standard ELISA and RNA 14 days after treatment. transcript level. Resistant plants were sprayed with 560-4480 gae/ha glyphosate as previously described. The data demon %. Iniury %. Iniury strate robust tolerance of dgt-28 linked with the chloroplast Application Rate <20% 20-40% >40% Ave Std. Dev. Range (%) transit peptides TraP4, TraP5, TraP8 and TraP23 up to 4480 g ae/ha glyphosate. Table 20. TraP4 dgt-28 Ogae?ha 4 O O O.O O.O O TABLE 20 glyphosate 280 gae?ha 5 O O 1.O 2.2 O-5 Response of F1 single copy digit-28 events to rates of glyphosate ranging 560 gae?ha 6 O O 2.0 4.0 O-10 from 560-4480 gae?ha + 2.0% w/v ammonium sulfate 14 days 1120 gae?ha 12 O O 1.3 3.1 O-10 after treatment. 2240 gae?ha 7 O O 1.7 4.5 O-12 4480 gae?ha 7 O O 1.1 3.0 O-8 90 Iniury 90 Iniury TraP8 dgt-28 Application Rate <20% 20-40% >40% Ave Std. Dev. Range (%) Ogae?ha 6 O O O.O O.O O glyphosate B104, 280 gae?ha 5 1 O 6.7 8.8 O-2O TraP4::dgt-28 560 gae?ha O 2 O 2O.O O.O 2O 1120 gae?ha 7 O O 1.4 2.4 O-5 Ogae?ha 4 O O O.O O.O O 2240 gae?ha 3 1 O 7.5 1S.O O-30 glyphosate 4480 gae?ha 6 O O 1.7 4.1 O-10 560 gae?ha 4 O O O.O O.O O TraP23 dgt-28 1120 gae?ha 4 O O 9.0 1.2 8-10 2240 gae?ha 4 O O 2.5 2.9 O-5 Ogae?ha 6 O O O.8 2.0 O-5 4480 gae?ha 4 O O O.O O.O O glyphosate B104, 280 gae?ha 7 O O O.O O.O O TraP8:dgt-28 560 gae?ha 4 O O 1.3 2.5 O-5 1120 gae?ha 10 2 O 3.3 7.8 O-2O Ogae?ha 4 O O O.O O.O O 2240 gae?ha 6 O O 1.3 3.3 O-8 glyphosate 560 gae?ha 4 O O 1.3 2.5 O-5 4480 gae?ha 6 1 O 4.3 7.9 O-2O 1120 gae?ha 4 O O O.O O.O O TraP5 dgt-28 2240 gae?ha 4 O O S.O 4.1 O-10 4480 gae?ha 4 O O 6.3 2.5 S-10 Ogae?ha 4 O O O.O O.O O B104, glyphosate TraP23:dgt-28 280 gae?ha 7 1 O S.O 14.1 O-40 560 gae?ha 8 O O.6 1.8 O-5 Ogae?ha 4 O O O.O O.O O 1120 gae?ha 7 1 O S.O 14.1 O-40 glyphosate US 2013/0205441 A1 Aug. 8, 2013 32

TABLE 20-continued of necrosis, percentage of growth inhibition and total visual injury at 7, 14 and 21 DAT (days after treatment). Assess Response of F single copy dgt-28 events to rates of glyphosate ranging ments were compared to the untreated checks for each line from 560-4480 gae?ha + 2.0% w/v ammonium sulfate 14 days after treatment. and the negative controls. 0249 Visual injury data for all assessement timings dem %. Iniury %. Iniury onstrated robust tolerance up to 4480 gae/ha DURANGO Application Rate <20% 20-40% >40% Ave Std. Dev. Range (%) DMATM at both locations and application timings. Represen tative events for the V4 application are presented from one 560 gae?ha 3 1 O 1O.O 1O.O 5-25 1120 gae?ha 2 2 O 18.8 11.8 1O-35 location and are consistent with other events, application 2240 gae?ha 4 O O 12.5 2.9 10-15 timings and locations. Table 21. One event from the construct 4480 gae?ha 3 1 O 1O.O 7.1 S-20 containing dgt-28 linked with TraP23 (pDAB 107665) was B104, tolerant to the ASSURE IITM selection for the AAD-1 protein, TraP5:dgt-28 but was sensitive to all rates of glyphosate applied. Ogae?ha 4 O O O.O O.O O glyphosate TABLE 21 560 gae?ha 4 O O 8.0 O.O 8 1120 gae?ha 4 O O 11.3 3.0 8-15 Response of dgt-28 events applied with a range of glyphosate from 2240 gae?ha 4 O O 12.5 2.9 10-15 1120-4480 gae/ha + 2.5% w/v annonium sulfate at the V4 growth stage. 4480 gae?ha 4 O O 1O.O 2.5 10-15 Non 90 Iniury 90 Iniury transformed B104 Application Rate <20% 20-40% >40% Ave Std. Dev. Range (%) Ogae?ha 4 O O O.O O.O O glyphosate 4XPB11. B104f 560 gae?ha O O 4 100.0 O.O 1OO TraP4::dgt-28 1120 gae?ha O O 4 100.0 O.O 1OO 2240 gae?ha O O 4 100.0 O.O 1OO Ogae?ha 4 O O O.O O.O O 4480 gae?ha O O 4 100.0 O.O 1OO glyphosate 120 gae?ha 4 O O O.O O.O O 2240 gae?ha 4 O O O.O O.O O 0244 Protein expression data demonstrate a range of 4480 gae?ha 4 O O O.O O.O O mean DGT-28 protein from 42.2-88.2 ng/cm across T. 4XPB11. B104f events and constructs tested, establishing protein expression TraP8:dgt-28 in the T generation. Ogae?ha 4 O O O.O O.O O glyphosate 0245 Characterization of dgt-28 Corn Under Field Con 120 gae?ha 4 O O O.O O.O O ditions. 2240 gae?ha 4 O O O.O O.O O 0246 Single copy Tevents were sent to a field location to 4480 gae?ha 4 O O O.O O.O O create both hybrid hemizygous and inbred homozygous seed 4XPB11. B104f for additional characterization. Hybrid seeds were created by TraP23:dgt-28 crossing T events in the maize transformation line B104 to Ogae?ha 4 O O O.O O.O O the inbred line 4XP811 generating hybrid populations segre glyphosate gating 1:1 (hemizygous: null) for the event. The resulting 120 gae?ha 4 O O O.O O.O O 2240 gae?ha 4 O O O.O O.O O seeds were shipped to 2 Separate locations. A total of five 4480 gae?ha 4 O O O.O O.O O single copy events per construct were planted at each location 4XPB11. B104f in a randomized complete block design in triplicate. The TraP5:dgt-28 fields were designed for glyphosate applications to occur at Ogae?ha 4 O O O.O O.O O the V4 growth stage and a separate grouping of plants to be glyphosate applied at the V8 growth stage. The 4XP811/B104 conven 120 gae?ha 4 O O O.O O.O O tional hybrid was used as a negative control. 2240 gae?ha 4 O O O.O O.O O 0247 Experimental rows were treated with 184 gae?ha 4480 gae?ha 4 O O O.O O.O O ASSURE IITM (106 gai/L quizalofop-methyl) to eliminate Non-transformed null segregants. All experimental entries segregated 1:1 (sen 4XPB11. B104 sitive:resistant) (p=0.05) with respect to the ASSURE IITM Ogae?ha 4 O O O.O O.O O application. Selected resistant plants were sampled from each glyphosate 1120 gae?ha O O 4 1OO.O O.O 1OO event for quantification of the DGT-28 protein by standard 2240 gae?ha O O 4 1OO.O O.O 1OO ELISA. 4480 gae?ha O O 4 1OO.O O.O 1OO 0248 Quizalofop-methyl resistant plants were treated with the commercial herbicide DURANGO DMATM (480 g ae/L glyphosate) with the addition of 2.5% w/v ammonium 0250 Additional assessments were made during the sulfate at either the V4 or V8 growth stages. Herbicide appli reproductive growth stage for the 4480 gae/ha glyphosate cations were made with a boom sprayer calibrated to deliver rate. Visual assessments of tassels, pollination timing and ear a volume of 187 L/ha, 50-cm spray height. Plants were fill were similar to the untreated checks of each line for all sprayed with a range of glyphosate from 1120-4480 gae?ha constructs, application timings and locations. Quantification glyphosate, capable of significant injury to untransformed results for the DGT-28 protein demonstrated a range of mean corn lines. A lethal dose is defined as the rate that causes protein expression from 186.4-303.0 ng/cm. Data demon >95% injury to the 4XP811 inbred. Visual injury assessments strates robust tolerance ofdgt-28 transformed corn underfield were taken for the percentage of visual chlorosis, percentage conditions through the reproductive growth stages up to 4480 US 2013/0205441 A1 Aug. 8, 2013

gae/ha glyphosate. Data also demonstrated DGT-28 protein 28 protein by standard ELISA demonstrated a range of mean detection and function based on spray tolerance results. protein expression from 27.5-65.8 ng/cm across single copy 0251 Confirmation of Heritability and Tolerance of dgt events that were tolerant to glyphosate. Data demonstrates 28 Corn in the Homozygous State. functional protein and stability of the DGT-28 protein across 0252 Seed from the T52 were planted undergreenhouse generations. conditions as previously described. The same five single copy 0254 Postemergence Herbicide Tolerance Use of Gly lines that were characterized under field conditions were phosate as a Selectable Marker. characterized in the homogeneous state. Plants were grown 0255 As previously described. To transformed plants until the V3 growth stage and separated into three rates of were moved from tissue culture and acclimated in the green glyphosate ranging from 1120-4480 gae/ha glyphosate (DU house. The events tested contained dgt-28 linked to TraP5, RANGO DMATM) and four replicates per treatment. Appli TraP8, and TraP23 chloroplast transit peptides. It was dem cations were made in a track sprayer as previously described onstrated that these To plants provided robust tolerance up to and were formulated in 2.0% w/v ammonium sulfate. An 4480 gae/ha glyphosate, and non-transformed plants were application of ammonium Sulfate served as an untreated controlled with glyphosate at concentrations as low as 280 g check for each line. Visual assessments were taken 7 and 14 ae/ha. These data demonstrate that dgt-28 can be utilized as a days after treatment as previously described. Data demon selectable marker using a concentration of glyphosate rang strated robust tolerance up to 4480 gae/ha glyphosate for all ing from 280-4480 gae/ha. events tested. Table 22. 0256. A number of seed from fixed lines of corn which contain the dgt-28 transgene are spiked into a number of TABLE 22 non-transformed corn seed. The seed are planted and allowed to grow to the V1-V3 developmental stage, at which time the Response of homozygous dgt-28 events applied with a range of plantlets are sprayed with a selecting dose of glyphosate in the glyphosate from 1120-4480 gae/ha + 2.0% w/v annonium sulfate. range of 280-4480 gae/ha. Following 7-10 days, sensitive and %. Iniury %. Iniury resistant plants are counted, and the amount of glyphosate tolerant plants correlates with the original number of trans Application Rate <20% 20-40% >40% Ave Std. Dev. Range (%) genic seed containing the dgt-28 transgene which are planted. TraP4::dgt-28 (0257 Stacking of dgt-28 Corn. Ogae?ha 4 O O O.O O.O O 0258. The AAD-1 protein is used as the selectable marker glyphosate in dgt-28 transformed corn for research purposes. The aad-1 120 gae?ha 4 O O O.O O.O O gene can also be utilized as a herbicide tolerant trait in corn to 2240 gae?ha 4 O O 3.8 2.5 O-5 provide robust 2,4-D tolerance up to a V8 application in a 4480 gae?ha 4 O O 14.3 1.5 12-15 crop. Four events from the constructs p)AB107663 (TraP4:: TraP8:dgt-28 dgt-28), pIDAB 107664 (TraP8::dgt-28) and pL)AB107666 Ogae?ha 4 O O O.O O.O O (TraP5::dgt-28) were characterized for the tolerance of a tank glyphosate mix application of glyphosate and 2,4-D. The characteriza 120 gae?ha 4 O O O.O O.O O tion study was completed with F. Seed under greenhouse 2240 gae?ha 4 O O 9.0 1.2 8-10 4480 gae?ha 4 O O 11.3 2.5 10-15 conditions. Applications were made in a track sprayer as TraP23:dgt-28 previously described at the following rates: 1120-2240 g ae/ha glyphosate (selective for the dgt-28 gene), 1120-2240 g Ogae?ha 4 O O O.O O.O O glyphosate ae/ha 2.4-D (selective for the aad-1 gene), or a tank mixture of 120 gae?ha 4 O O 4.5 3.3 O-8 the two herbicides at the rates described. Plants were graded 2240 gae?ha 4 O O 7.5 2.9 S-10 at 7 and 14 DAT. Spray results for applications of the herbi 4480 gae?ha 4 O O 1S.O O.O 15 cides at 2240 gae/ha are shown in Table 23. TraP5:dgt-28

Ogae?ha 4 O O O.O O.O O TABLE 23 glyphosate 120 gae?ha 4 O O 1.3 2.5 O-5 Response of Flaad-1 and dgt-28 corn sprayed with 2240 gae?ha of 2240 gae?ha 4 O O 9.0 2.0 8-12 2,4-D, glyphosate and a tank mix combination of the two herbicides 4480 gae?ha 4 O O 1S.O 2.4 12-18 14 days after treatment. Non transformed B104

Ogae?ha 4 O O O.O O.O O 2240 g 2240 gae?ha 2240 gae?ha glyphosate ae?ha 2.4-D glyphosate glyphosate 120 gae?ha O O 4 1OOO O.O 1OO 2240 gae?ha O O 4 1OOO O.O 1OO Mean 96 Std. Mean 96 Mean 96 4480 gae?ha O O 4 1OOO O.O 1OO F Event injury Dev. injury Std. Dev. injury Std. Dev. 1076633- S.O 4.1 3.8 4.8 8.8 3.0 O12AJOO1 0253) The line from pl)AB107665 that was not tolerant 1076633- 2.5 S.O 1.3 2.5 S.O 5.8 under field conditions demonstrated no tolerance to glypho O29AJOO1 sate and therefore consistent with field observations (data not 1076633- 2.5 2.9 11.8 2.9 13.8 2.5 shown). With the exception of the one line previously men O27AJOO1 1076633- 3.8 2.5 11.5 1.O 12.8 1.5 tioned, all replicates that were treated with glyphosate from O11AJOO1 the lines were not sensitive to glyphosate. Therefore data B104 27.5 17.7 100.0 O.O 1OO.O O.O demonstrates heritability to a homogeneous population of dgt-28 corn in a Mendelian fashion. Expression of the DGT US 2013/0205441 A1 Aug. 8, 2013 34

0259. The results confirm that dgt-28 can be successfully formed To plants are sampled and molecular analyses is used stacked with aad-1, thus increasing the spectrum herbicides to confirm the presence of the selectable marker and the that may be applied to the crop of interest (glyphosate+phe dgt-28 transgene. Several events are identified as containing noxyactetic acids for dgt-28 and aad-1 respectively). In crop the transgenes. These To plants are advanced for further production where hard to control broadleafweeds or resistant analysis and allowed to self fertilize in the greenhouse to give weed biotypes exist the stack can be used as a means of weed rise to T seed. control and protection of the crop of interest. Additional input 0267 Confirmation of Heritability of dgt-28 to the T1 or output traits can also be stacked with the dgt-28 gene in Generation. corn and other plants. 0268 Heritability of the DGT-28 protein into T. genera 0260 Soybean Transformation. tion was assessed in one of two ways. The first method 0261 Transgenic soybean (Glycine max) containing a sta included planting T. Seed into Metro-mix media and applying bly integrated dgt-28 transgene is generated through Agro 411 gae/ha IGNITETM 280SL on germinated plants at the 1 bacterium-mediated transformation of soybean cotyledonary trifoliate growth stage. The second method consisted of node explants. A disarmed Agrobacterium strain carrying a homogenizing seed for a total of 8 replicates using a ball binary vector containing a functionaldgt-28 is used to initiate bearing and a genogrinder. ELISA strip tests to detect for the transformation. PAT protein were then used to detect heritable events as the 0262 Agrobacterium-mediated transformation is carried selectable marker was on the same plasmid as dgt-28. For out using a modified half-cotyledonary node procedure of either method if a single plant was tolerant to glufosinate or Zeng et al. (Zeng P. Vadnais D. A., Zhang Z., Polacco J. C., was detected with the PAT ELISA strip test, the event dem (2004), Plant Cell Rep., 22(7): 478-482). Briefly, soybean onstrated heritability to the T generation. seeds (cv. Maverick) are germinated on basal media and 0269. A total of five constructs were screened for herita cotyledonary nodes are isolated and infected with Agrobac bility as previously described. The plasmids contained dgt-28 terium. Shoot initiation, shoot elongation, and rooting media linked with TraP4, TraP8 and TraP23 The events across con are Supplemented with cefotaxime, timentin and Vancomycin structs demonstrated 68% heritability of the PAT:DGT-28 for removal of Agrobacterium. Selection via a herbicide is protein to the T generation. employed to inhibit the growth of non-transformed shoots. 0270 Postemergence Herbicide Tolerance in dgt-28 Selected shoots are transferred to rooting medium for root development and then transferred to soil mix for acclimati Transformed T. Soybean. (0271 Seeds from T. events that were determined to be zation of plantlets. heritable by the previously described screening methods were 0263 Terminal leaflets of selected plantlets are treated planted in Metro-mix media under greenhouse conditions. topically (leaf paint technique) with a herbicide to screen for Plants were grown until the 1 trifoliate was fully expanded putative transformants. The screened plantlets are transferred and treated with 411 gae/ha IGNITETM 280SL for selection to the greenhouse, allowed to acclimate and then leaf-painted of the pat gene as previously described. Resistant plants from with a herbicide to reconfirm tolerance. These putative trans each event were given unique identifiers and sampled for formed To plants are sampled and molecular analyses is used Zygosity analyses of the dgt-28 gene. Zygosity data were used to confirm the presence of the herbicidal selectable marker, to assign 2 hemizygous and 2 homozygous replicates to each and the dgt-28 transgene. To plants are allowed to self fer rate of glyphosate applied allowing for a total of 4 replicates tilize in the greenhouse to produce T seed. per treatment when enough plants existed. These plants were 0264. A second soybean transformation method can be compared against wildtype Petite havana tobacco. All plants used to produce additional transgenic soybean plants. A dis were sprayed with a track sprayer set at 187 L/ha. The plants armed Agrobacterium Strain carrying a binary vector contain were sprayed from a range of 560-4480 g ae?ha ing a functional dgt-28 is used to initiate transformation. DURANGOTM dimethylamine salt (DMA). All applications 0265 Agrobacterium-mediated transformation is carried were formulated in water with the addition of 2% w/v ammo out using a modified half-seed procedure of Paz et al., (Paz nium sulfate (AMS). Plants were evaluated at 7 and 14 days M., Martinez, J., Kalvig A., Fonger T., and Wang K. (2005) after treatment. Plants were assigned an injury rating with Plant Cell Rep., 25: 206-213). Briefly, mature soybean seeds respect to overall visual stunting, chlorosis, and necrosis. The are sterilized overnight with chlorine gas and imbibed with T generation is segregating, so some variable response is sterile HO twenty hours before Agrobacterium-mediated expected due to difference in Zygosity. plant transformation. Seeds are cut in half by a longitudinal cut along the hilum to separate the seed and remove the seed TABLE 24 coat. The embryonic axis is excised and any axial shoots/buds are removed from the cotyledonary node. The resulting half Spray results demonstrate at 14 DAT (days after treatment) robust seed explants are infected with Agrobacterium. Shoot initia tolerance up to 4480 gae?ha glyphosate of at least one digit-28 event per construct characterized. Representative single copy events of the tion, shoot elongation, and rooting media are Supplemented constructs all provided tolerance up to 4480 gae?ha compared to the with cefotaxime, timentin and Vancomycin for removal of Maverick negative control. Agrobacterium. Herbicidal selection is employed to inhibit the growth of non-transformed shoots. Selected shoots are %. Iniury %. Iniury transferred to rooting medium for root development and then transferred to soil mix for acclimatization of plantlets. Application Rate <20% 20-40% >40% Ave Std. Dev. Range (%) 0266 Terminal leaflets of selected plantlets are treated pDAB107543 topically (leaf paint technique) with a herbicide to screen for (TraP4::dgt-28) putative transformants. The screened plantlets are transferred Ogae?ha 4 O O O.O O.O O to the greenhouse, allowed to acclimate and then leaf-painted glyphosate with a herbicide to reconfirm tolerance. These putative trans US 2013/0205441 A1 Aug. 8, 2013

TABLE 24-continued the construct pIDAB107553 (TraP23:dgt-28) were not previ ously selected with glufosinate, and the dose response of Spray results demonstrate at 14 DAT (days after treatment) robust glyphosate was utilized as both to test homogenosity and tolerance up to 4480 gae?ha glyphosate of at least one digit-28 event per construct characterized. Representative single copy events of the tolerance to elevated rates of glyphosate. Replicates from the constructs all provided tolerance up to 4480 gae?ha compared to the lines from construct pl)AB 107553 were tolerant to rates Maverick negative control. ranging from 560-4480 gae/ha glyphosate, and were there fore confirmed to be a homogeneous population and heritable %. Iniury %. Iniury to at least two generations. Application Rate <20% 20-40% >40% Ave Std. Dev. Range (%) (0275 Rates of DURANGODMA ranging from 560-4480 560 gae?ha O 4 O 33.8 7.5 25-40 gae/ha glyphosate were applied to 2-3 trifoliate Soybean as 1120 gae?ha 2 2 O 2SO 11.5 15-35 previously described. Visual injury data 14 DAT confirmed 2240 gae?ha 2 2 O 17.5 2.9 15-20 the tolerance results that were demonstrated in the Tigenera 4480 gae?ha O 2 2 33.8 13.1 20-45 tion. pDAB107545 (TraP8:dgt-28) TABLE 25 Ogae?ha 4 O O O.O O.O O glyphosate The data demonstrate robust tolerance of the dgt-28 tobacco up to 560 gae?ha 4 O O 1.5 1.O O-2 3360 gae?ha glyphosate through two generations, compared to the 1120 gae?ha 4 O O 2.8 1.5 2-5 non-transformed control. 2240 gae?ha 4 O O S.O 2.4 2-8 4480 gae?ha 4 O O 9.5 1.9 8-12 20 Iniury 20 Intury pDAB107548 (TraP4::dgt-28) Application Rate <20% 20-40% >40% Ave Std. Dev. Range (%)

Ogae?ha 4 O O O.O O.O O pDAB107543 glyphosate (TraP4::dgt-28) 560 gae?ha 4 O O 1.8 2.4 O-5 1120 gae?ha 4 O O 2.8 1.5 2-5 Ogae?ha 4 O O O.O O.O O 2240 gae?ha 4 O O 3.5 1.7 2-5 glyphosate 4480 gae?ha 4 O O 8.8 3.0 S-12 560 gae?ha 4 O O 8.O O.O 8 pDAB107553 1120 gae?ha 4 O O 14.3 1.5 12-15 (TraP23::dgt-28) 2240 gae?ha 4 O O 18.0 O.O 18 4480 gae?ha O 4 O 24.5 3.3 20-28 Ogae?ha 4 O O O.O O.O O pDAB107545 glyphosate (TraP8:dgt-28) 560 gae?ha 4 O O S.O O.O 5 1120 gae?ha 4 O O 9.0 1.2 8-10 Ogae?ha 4 O O O.O O.O O 2240 gae?ha 4 O O 1O.S 1.O 10-12 glyphosate 4480 gae?ha 4 O O 16.5 1.7 15-18 560 gae?ha 4 O O O.O O.O O Maverick 1120 gae?ha 4 O O 2.8 1.5 2-5 (neg. control) 2240 gae?ha 4 O O S.O O.O 5 4480 gae?ha 4 O O 1O.O O.O 10 Ogae?ha 4 O O O.O O.O O pDAB 107548 glyphosate (TraP4::dgt-28) 560 gae?ha O O 4 82.5 12.6 70-100 1120 gae?ha O O 4 100.0 O.O 100 Ogae?ha 4 O O O.O O.O O 2240 gae?ha O O 4 100.0 O.O 100 glyphosate 4480 gae?ha O O 4 100.0 O.O 100 560 gae?ha 4 O O O.O O.O O 1120 gae?ha 4 O O O.O O.O O 2240 gae?ha 4 O O O.O O.O O 4480 gae?ha 4 O O 1O.O O.O 10 0272 dgt-28 Protection Against Elevated Glyphosate pDAB107553 Rates in the T. Generation. (TraP23:dgt-28) 0273 A45 plant progeny test was conducted on two to five Ogae?ha T lines of digt-28 per construct. Homozygous lines were glyphosate chosen based on Zygosity analyses completed in the previous 560 gae?ha generation. The seeds were planted as previously described. 1120 gae?ha Plants were then sprayed with 411 gae/ha IGNITE280SL for 2240 gae?ha 4480 gae?ha the selection of the pat selectable marker as previously Maverick described. After 3 DAT, resistant and sensitive plants were (neg. control) counted. 0274 For constructs containing TraP4 linked with dgt-28 Ogae?ha 4 O O O.O O.O O glyphosate (pDAB 107543 and plDAB 107548), nine out of twelve lines 560 gae?ha O O 4 77.5 1S.O 70-100 tested did not segregate, thereby confirming homogeneous 1120 gae?ha O O 4 97.5 2.9 95-100 lines in the T2 generation. Lines containing TraP8 linked with 2240 gae?ha O O 4 100.O O.O 100 dgt-28 (pl)AB107545) demonstrated two out of the four lines 4480 gae?ha O O 4 100.O O.O 100 with no segregants and demonstrating Mendelian inheritance through at least two generation of digt-28 in soybean. Tissue samples were taken from resistant plants and the DGT-28 0276 Transformation of Rice with dgt-28. protein was quantified by standard ELISA methods. Data 0277. In an exemplary method, transgenic rice (Oryza demonstrated a range of mean DGT-28 protein from 32.8- sativa) containing a stably integrated dgt-28 transgene is 107.5 ng/cm for non-segregating T lines tested. Lines from generated through Agrobacterium-mediated transformation US 2013/0205441 A1 Aug. 8, 2013 36 of sterilized rice seed. A disarmed Agrobacterium Strain car plant is scored as positive for the dgt-28 gene if it produces rying a binary vector containing a functional dgt-28 is used to thick, white roots and grows vigorously on /2 MSH50 initiate transformation. medium. Once plantlets reach the top of the MAGENTA (0278 Culture media are adjusted to pH 5.8 with 1 MKOH boxes, they are transferred to soil in a 6-cm pot under 100% and solidified with 2.5 g/l Phytagel (Sigma-Aldrich, St. humidity for a week, and then are moved to a growth chamber Louis, Mo.). Embryogenic calli are cultured in 100x20 mm with a 14-hlight period at 30° C. and in the dark at 21°C. for petri dishes containing 30 ml semi-solid medium. Rice plant 2-3 weeks before transplanting into 13-cm pots in the green lets are grown on 50 ml medium in MAGENTA boxes. Cell house. Seeds are collected and dried at 37° C. for one week Suspensions are maintained in 125 ml conical flasks contain prior to storage at 4°C. ing 35 mL liquid medium and rotated at 125 rpm. Induction (0281) To Analysis of dgt-28 Rice. and maintenance of embryogenic cultures occur in the dark at 0282 Transplanted rice transformants generated via Agro 25-26°C., and plant regeneration and whole-plant culture bacterium transformation were transplanted into media and occur in illuminated room with a 16-hphotoperiod (Zhanget acclimated to greenhouse conditions. All plants were al. 1996). sampled for PCR detection of dgt-28 and results demonstrate 0279 Induction and maintenance of embryogenic callus is twenty-two PCR positive events for plDAB110827 (TraP8: performed on a modified NB basal medium as described dgt-28) and a minimum of sixteen PCR positive events for previously (Li et al. 1993), wherein the media is adapted to pDAB110828 (TraP23:dgt-28). Southern analysis fordgt-28 contain 500 mg/L glutamine. Suspension cultures are initi of the PCR positive events demonstrated simple (1-2 copy) ated and maintained in SZ liquid medium (Zhang et al. 1998) events for both constructs. Protein expression of selected To with the inclusion of 30 g/L Sucrose in place of maltose. events demonstrated DGT-28 protein expression ranges from Osmotic medium (NBO) consisting of NB medium with the below levels of detection to 130 ng/cm. Selected To events addition of 0.256 Meach of mannitol and sorbitol. Herbicide from construct pl)AB110828 were treated with 2240 gae?ha resistant callus is selected on NB medium supplemented with DURANGODMATM as previously described and assessed 7 the appropriate herbicide selective agent for 3-4 weeks. Pre and 14 days after treatment. Data demonstrated robust toler regeneration is performed on medium (PRH5O) consisting of ance to the rate of glyphosate applied. All PCR positive plants NB medium with 2,4-dichlorophenoxyacetic acid (2,4-D), 1 were allowed to produced T seed for further characteriza mg/l C-naphthaleneacetic acid (NAA), 5 mg/l abscisic acid tion. (ABA) and selective herbicide for 1 week. Regeneration of plantlets follow the culturing on regeneration medium (0283 Dgt-28 Heritability in Rice. (RNH5O) comprising NB medium containing 2,4-D, 0.5 mg/1 0284. A 100 plant progeny test was conducted on four T NAA, and selective herbicide until putatively transgenic lines of dgt-28 from construct pl)AB110827 containing the shoots are regenerated. Shoots are transferred to rooting chloroplast transit peptide TraP8. The seeds were planted into medium with half-strength Murashige and Skoog basal salts pots filled with media. All plants were then sprayed with 560 and Gamborg's B5 vitamins, supplemented with 1% sucrose gae/ha DURANGO DMATM for the selection of the dgt-28 and selective herbicide. gene as previously described. After 7 DAT, resistant and sensitive plants were counted. Two out of the four lines tested 0280 Mature desiccated seeds of Oryza sativa L. japonica for each construct segregated as a single locus, dominant cv. Taipei 309 are sterilized as described in Zhang et al. 1996. Mendelian trait (3R:1S) as determined by Chi square analy Embryogenic tissues are induced by culturing sterile mature sis. Dgt-28 is a heritable glyphosate resistance gene in mul rice seeds on NB medium in the dark. The primary callus tiple species. approximately 1 mm in diameter, is removed from the Scutel lum and used to initiate cell Suspension in SZ liquid medium. 0285 Postemergence Herbicide Tolerance in Dgt-28 Suspensions are then maintained as described in Zhang 1996. Transformed T. Rice. Suspension-derived embryogenic tissues are removed from 0286 T resistant plants from each event used in the prog liquid culture 3-5 days after the previous subculture and eny testing were given unique identifiers and sampled for placed on NBO osmotic medium to form a circle about 2.5 cm Zygosity analyses of the dgt-28 gene. Zygosity data were used across in a petri dish and cultured for 4 h prior to bombard to assign 2 hemizygous and 2 homozygous replicates to each ment. Sixteen to twenty hours after bombardment, tissues are transferred from NBO medium onto NBH50 selection rate of glyphosate applied allowing for a total of 4 replicates medium, ensuring that the bombarded surface is facing per treatment. These plants were compared against wildtype upward, and incubated in the dark for 14-17 days. Newly kitaake rice. All plants were sprayed with a track sprayer set formed callus is then separated from the original bombarded at 187 L/ha. The plants were sprayed from a range of 560 explants and placed nearby on the same medium. Following 2240 gae/ha DURANGO DMATM. All applications were an additional 8-12 days, relatively compact, opaque callus is formulated in water with the addition of 2% w/v ammonium visually identified, and transferred to PRH50 pre-regenera sulfate (AMS). Plants were evaluated at 7 and 14 days after tion medium for 7 days in the dark. Growing callus, which treatment. Plants were assigned an injury rating with respect become more compact and opaque is then Subcultured onto to overall visual stunting, chlorosis, and necrosis. The T RNH50 regeneration medium for a period of 14-21 days generation is segregating, so some variable response is under a 16-h photoperiod. Regenerating shoots are trans expected due to difference in Zygosity. ferred to MAGENTA boxes containing /2 MSH50 medium. 0287 Spray results demonstrate at 7 DAT (days after treat Multiple plants regenerated from a single explant are consid ment) minimal vegetative injury to elevated rates of glypho ered siblings and are treated as one independent plant line. A sate were detected (data not shown). US 2013/0205441 A1 Aug. 8, 2013 37

TABLE 26 using molecular analysis protocols described above) are allowed to self-pollinate and seed is collected from capsules Visual injury data at 14 DAT demonstrates less than 15% mean when they are completely dried down. T seedlings are Visual iniury up to 2240 gae/ha glyphosate. screened for Zygosity and reporter gene expression (as %. Iniury %. Iniury described below) and selected plants containing the dgt-28 transgene are identified. Application Rate <20% 20-40% >40% Ave Std. Dev. Range (%) 0293 Plants were moved into the greenhouse by washing TraP8:dgt-28 the agar from the roots, transplanting into Soil in 13.75 cm Event 1 square pots, placing the pot into a ZiplocR) bag (SCJohnson Ogae?ha 4 O O O.O O.O O & Son, Inc.), placing tap water into the bottom of the bag, and glyphosate placing in indirect light in a 30° C. greenhouse for one week. 560 gae?ha 4 O O O.O O.O O 1120 gae?ha 4 O O O.O O.O O After 3-7 days, the bag was opened; the plants were fertilized 2240 gae?ha 4 O O O.O O.O O and allowed to grow in the open bag until the plants were TraP8:dgt-28 greenhouse-acclimated, at which time the bag was removed. Event 2 Plants were grown under ordinary warm greenhouse condi Ogae?ha 4 O O O.O O.O O tions (27°C. day, 24°C. night, 16 hour day, minimum natu glyphosate ral+supplemental light=1200LE/ms'). 560 gae?ha 4 O O 3.8 4.8 O-10 1120 gae?ha 4 O O 12.O 3.6 8-15 0294 Prior to propagation, To plants were sampled for 2240 gae?ha 4 O O 1S.O 6.O 8-20 DNA analysis to determine the insert dgt-28 copy number by Non-transformed real-time PCR. Fresh tissue was placed into tubes and lyo control philized at 4°C. for 2 days. After the tissue was fully dried, a Ogae?ha 4 O O O.O O.O O tungsten bead (Valenite) was placed in the tube and the glyphosate samples were subjected to 1 minute of dry grinding using a 560 gae?ha O O 4 813 2.5 80-85 Kelco bead mill. The standard DNeasyTM DNA isolation pro 1120 gae?ha O O 4 95.0 5.8 90-100 cedure was then followed (Qiagen, DNeasy 69109). An ali 2240 gae?ha O O 4 96.3 4.8 90-100 quot of the extracted DNA was then stained with Pico Green (Molecular Probes P7589) and read in the fluorometer 0288 Protein detection of DGT-28 was assessed for rep (BioTekTM) with known standards to obtain the concentration licates from all four T lines tested from pl)AB110827. Data in ng/ul. A total of 100 ng of total DNA was used as template. demonstrated DGT-28 mean protein ranges from 20-82 The PCR reaction was carried out in the 9700 GeneampTM ng/cm and 21-209 ng/cm for hemizgyous and homozygous thermocycler (Applied Biosystems), by Subjecting the replicates respectively. These results demonstrated stable samples to 94° C. for 3 minutes and 35 cycles of 94° C. for 30 protein expression to the T generation and tolerance of dgt seconds, 64°C. for 30 seconds, and 72°C. for 1 minute and 45 28 rice up to 2240 gae/ha glyphosate following an application seconds followed by 72° C. for 10 minutes. PCR products of 560 gae/ha glyphosate used for selection. were analyzed by electrophoresis on a 1% agarose gel stained 0289 Transformation of Tobacco with dgt-28. with EtBr and confirmed by Southern blots. 0290 Tobacco (cv. Petit Havana) leaf pieces are trans 0295 Five to nine PCR positive events with 1-3 copies of formed using Agrobacterium tumefaciens containing the dgt dgt-28 gene from 3 constructs containing a different chloro 28 transgene. Single colonies containing the plasmid which plast transit peptide sequence (TraP4, TraP8 and TraP23) contains the dgt-28 transgene are inoculated into 4 mL of YEP were regenerated and moved to the greenhouse. medium containing spectinomycin (50 g/mL) and strepto mycin (125 ug/mL) and incubated overnight at 28°C. on a 0296 All PCR positive plants were sampled for quantifi shaker at 190 rpm. The 4 mL seed culture is subsequently cation of the DGT-28 protein by standard ELISA. DGT-28 used to inoculatea 25 mL culture of the same medium in a 125 protein was detected in all PCR positive plants and a trend for mL baffled Erlenmeyer flask. This culture is incubated at 28° an increase in protein concentration was noted with increas C. shaking at 190 rpm until it reaches an ODoo of ~1.2. Ten ing copy number of digt-28. mL of Agrobacterium Suspension are then placed into sterile 0297 aad-12 (v1) Heritability in Tobacco. 60x20 mm PetriTM dishes. 0291 Freshly cut leaf pieces (0.5 cm) from plants asep 0298. A 100 plant progeny test was conducted on five T tically grown on MS medium (Phytotechnology Labs, Shaw lines ofdgt-28 per construct. Constructs contained one of the nee Mission, Kans.) with 30 g/L Sucrose in PhytaTraysTM following chloroplast transit peptide sequences: TraP4, (Sigma, St. Louis, Mo.) are soaked in 10 mL of overnight TraP8 or TraP23. The seeds were stratified, sown, and trans culture of Agrobacterium for a few minutes, blotted dry on planted with respect much like that of the Arabidopsis proce sterile filter paper and then placed onto the same medium with dure exemplified above, with the exception that null plants the addition of 1 mg/L indoleacetic acid and 1 mg/L 6-ben were not removed by in initial selection prior to transplanting. Zylamino purine. Three days later, leaf pieces co-cultivated All plants were then sprayed with 280 gae/ha IGNITE280SL with Agrobacterium harboring the dgt-28 transgene are trans for the selection of the pat selectable marker as previously ferred to the same medium with 5 mg/L BastaTM and 250 described. After 3 DAT, resistant and sensitive plants were mg/L cephotaxime. counted. 0292. After 3 weeks, individual Toplantlets are transferred 0299 Four out of the five lines tested for each construct to MS medium with 10 mg/L BastaTM and 250 mg/L cepho segregated as a single locus, dominant Mendelian trait (3R: taxime an additional 3 weeks prior to transplanting to Soil and 1S) as determined by Chi square analysis. Dgt-28 is a heri transfer to the greenhouse. Selected To plants (as identified table glyphosate resistance gene in multiple species. US 2013/0205441 A1 Aug. 8, 2013

0300 Postemergence Herbicide Tolerance in dgt-28 0303. These results demonstrated tolerance of dgt-28 up to Transformed T Tobacco. 4480 gae?ha glyphosate, as well as differences in tolerance 0301 T resistant plants from each event used in the prog provided by chloroplast transit peptide sequences linked to eny testing were given unique identifiers and sampled for the dgt-28 gene. Zygosity analyses of the dgt-28 gene. Zygosity data were used 0304 dgt-28 Protection Against Elevated Glyphosate to assign 2 hemizygous and 2 homozygous replicates to each Rates in the T. Generation. rate of glyphosate applied allowing for a total of 4 replicates 0305 A 25 plant progeny test was conducted on two to per treatment. These plants were compared against wildtype three T lines ofdgt-28 per construct. Homozygous lines were Petite havana tobacco. All plants were sprayed with a track chosen based on Zygosity analyses completed in the previous sprayer set at 187 L/ha. The plants were sprayed from a range generation. The seeds were stratified, Sown, and transplanted of 560-4480 gae/ha DURANGO DMATM. All applications as previously described. All plants were then sprayed with were formulated in water with the addition of 2% w/v ammo 280 gae/ha Ignite 280SL for the selection of the pat select nium sulfate (AMS). Plants were evaluated at 7 and 14 days able marker as previously described. After 3 DAT, resistant after treatment. Plants were assigned an injury rating with and sensitive plants were counted. All lines tested for each respect to overall visual stunting, chlorosis, and necrosis. The construct did not segregate thereby confirming homogeneous T generation is segregating, so some variable response is lines in the T2 generation and demonstrating Mendelian expected due to difference in Zygosity. inheritance through at least two generation of dgt-28 in 0302 Spray results demonstrate at 7 DAT (days after treat tobacco. ment) minimal vegetative injury to elevated rates of glypho (0306 Rates of DURANGO DMATM ranging from 420 sate were detected (data not shown). Following 14 DAT, 3360 gae/ha glyphosate were applied to 2-3 leaf tobacco as visual injury data demonstrates increased injury with single previously described. Visual injury data 14 DAT confirmed copy events of the construct containing TraP4 compared to the tolerance results that were demonstrated in the T1 gen single copy events from the constructs TraP8 and TraP23. eration. Foliar results from a two copy lines from the con Table 27. struct containing TraP4 demonstrated similar tolerance to that of single copy TraP8 and TraP23 lines (data not shown). TABLE 27 TABLE 28 At a rate of 2240 gae?ha glyphosate, an average injury of 37.5% was demonstrated with the event containing TraP4, where events containing Single copy lines from the construct containing TraP4 with dgt-28 TraP8 and TraP23 demonstrated an average injury of 9.3% and demonstrated increased injury compared to lines from constructs 9.5% respectively. containing TraP8 and TraP23 with dgt-28. %. Iniury %. Iniury %. Iniury %. Iniury Application Rate <20% 20-40% >40% Ave Std. Dev. Range (%) Application Rate <20% 20-40% >40% Ave Std. Dev. Range (%) TraP4::dgt-28 TraP4::dgt-28 (pDAB107543) (pDAB107543)

Ogae?ha 4 O O O.O O.O O Ogae?ha 4 O O O.O O.O O glyphosate glyphosate 560 gae?ha 2 2 O 18.0 8.1 10-2S 420 gae?ha O 4 O 23.8 4.8 20-30 1120 gae?ha 1 3 O 24.5 4.9 18-30 840 gae?ha O 4 O 3O.O 4.1 25-35 2240 gae?ha O 3 1 37.5 6.5 30-45 1680 gae?ha O 4 O 3S.O 5.8 30-40 4480 gae?ha O 2 2 42.5 2.9 40-45 3360 gae?ha O 4 O 31.3 2.5 30-35 TraP8:dgt-28 TraP8:dgt-28 (pDAB107545) (pDAB107545)

Ogae?ha 4 O O O.O O.O O Ogae?ha 4 O O O.O O.O O glyphosate glyphosate 560 gae?ha 4 O O 3.3 3.9 O-8 420 gae?ha 4 O O O.O O.O O 1120 gae?ha 4 O O 6.5 1.7 S-8 840 gae?ha 4 O O 2.5 2.9 O-5 2240 gae?ha 4 O O 9.3 3.0 S-12 1680 gae?ha 4 O O 9.3 3.4 S-12 4480 gae?ha 2 2 O 17.5 6.5 10-2S 3360 gae?ha 4 O O 1O.S 1.O 10-12 TraP23:dgt-28 TraP23:dgt-28 (pDAB107553) (pDAB107553)

Ogae?ha 4 O O O.O O.O O Ogae?ha 4 O O O.O O.O O glyphosate glyphosate 560 gae?ha 4 O O 1O.O 1.6 8-12 420 gae?ha 4 O O O.O O.O O 1120 gae?ha 4 O O 8.8 3.0 S-12 840 gae?ha 4 O O 6.3 2.5 S-10 2240 gae?ha 4 O O 9.5 4.2 5-15 1680 gae?ha 4 O O 1O.O O.O 10 4480 gae?ha 4 O O 15.8 1.5 15-18 3360 gae?ha 3 1 O 13.8 4.8 1O-2O Petite havana Petite havana

Ogae?ha 4 O O O.O O.O O Ogae?ha 4 O O O.O O.O O glyphosate glyphosate 560 gae?ha O O 4 85.0 4.1 80-90 420 gae?ha O O 4 95.0 O.O 95 1120 gae?ha O O 4 91.3 2.5 90-95 840 gae?ha O O 4 98.8 1.O 98-100 2240 gae?ha O O 4 94.5 3.3 90-98 1680 gae?ha O O 4 99.5 1.O 98-100 4480 gae?ha O O 4 98.3 2.4 95-100 3360 gae?ha O O 4 100 O.O 100 US 2013/0205441 A1 Aug. 8, 2013 39

0307 The data demonstrate robust tolerance of dgt-28 nate, and bialaphos (Wohleben et al Gene 1988, 7001), tobacco up to 3360 gae?ha glyphosate through two genera 25-37). The selection cassette was terminated with the 3'UTR tions compared to the non-transformed control. comprising the transcriptional terminator and polyadenyla 0308) Selected plants from each event were sampled prior tion sites from the 35S gene of cauliflower mosaic virus to glyphosate applications for analyses of the DGT-28 protein (CaMV) (Chenaultetal Plant Physiology 1993 101 (4), 1395 by standard DGT-28 ELISA. Data demonstrated DGT-28 1396). mean protein expression of the simple (1-2 copy) lines across 0315. The selection cassette was synthesized by a com constructs ranging from 72.8-114.5 ng/cm. Data demon mercial gene synthesis vendor (GeneArt, Life Technologies) strates dgt-28 is expressing protein in the T. generation of and cloned into a Gateway-enabled binary vector. The DGT transformed tobacco and tolerance data confirms functional 28 expression cassettes were sub-cloned into pI)ONR221. DGT-28 protein. The resulting ENTRY clone was used in a LR Clonase II 0309 Stacking of dgt-28 to Increase Herbicide Spectrum. (Invitrogen, Life Technologies) reaction with the Gateway 0310 Homozygous dgt-28 (pDAB 107543 and enabled binary vector encoding the phosphinothricin acetyl pDAB107545) and aad-12 v1 (pDAB3278) plants (see PCT/ transferase (PAT) expression cassette. Colonies of all US2006/042133 for the latter, which is incorporated herein assembled plasmids were initially screened by restriction by this reference in its entirety) were both reciprocally digestion of purified DNA using restriction endonucleases crossed and F seed was collected. The F seed from two obtained from New England BioLabs (NEB; Ipswich, Mass.) reciprocal crosses of each gene were stratified and treated 6 and Promega (Promega Corporation, WI). Plasmid DNA reps of each cross were treated with 1120 gae/ha glyphosate preparations were performed using the QIAprep Spin Mini (selective for the dgt-28 gene), 1120 gae/ha 2,4-D (selective prep Kit (Qiagen, Hilden) or the Pure Yield Plasmid Max for the aad-12 gene), or a tank mixture of the two herbicides iprep System (Promega Corporation, WI), following the at the rates described. Plants were graded at 14 DAT. Spray instructions of the suppliers. Plasmid DNA of selected clones results are shown in Table 29. was sequenced using ABI Sanger Sequencing and Big Dye Terminator v3.1 cycle sequencing protocol (Applied Biosys TABLE 29 tems, Life Technologies). Sequence data were assembled and Response of Flaad-12 and dgt-28 analyzed using the SEQUENCHERTM software (Gene Codes Corporation, Ann Arbor, Mich.). aad-12 x aad-12 x Petite TraP4::dgt-28 TraP8::dgt-28 havana 0316 The resulting four binary expression clones: Application Rate Tolerance pDAS000122 (Trap4-DGT28), plDAS000123 (TraP8 DGT28), plDAS000124 (TraP23-DGT28) and plDAS000125 1120 gae?ha 2,4-D ------H--- 1120 gae?ha glyphosate ------(TraP5-DGT28) were each transformed into Agrobacterium 1120 gae?ha 2,4-D + ------tumefaciens strain EHA105. 1120 gae?ha glyphosate 0317 Production of Transgenic Wheat Events withdgt-28 Expression Construct. 0311. The results confirm that dgt-28 can be successfully 0318 Transgenic wheat plants expressing one of the four stacked with aad-12 (v1), thus increasing the spectrum her DGT-28 expression constructs were generated by Agrobac bicides that may be applied to the crop of interest (glypho terium-mediated transformation using the donor wheat line sate+phenoxyactetic acids for dgt-28 and aad-12, respec Bobwhite MPB26RH, following a protocol similar to Wu et tively). In crop production where hard to control broadleaf al. Transgenic Research 2008, 17:425-436. Putative TO trans weeds or resistant weed biotypes exist the stack can be used as genic events were selected for phosphinothricin (PPT) toler a means of weed control and protection of the crop of interest. ance, the phenotype conferred by the PAT selectable marker, Additional input or output traits could also be stacked with the dgt-28 gene. and transferred to soil. The TO plants were grown under 0312 Resistance to Glyphosate in Wheat. glasshouse containment conditions and T1 seed was pro 0313 Production of Binary Vectors Encoding DGT-28. duced. Overall, about 45 independent TO events were gener 0314 Binary vectors containing DGT-28 expression and ated for each DGT-28 expression construct. PAT selection cassettes were designed and assembled using 0319 Glyphosate Resistance in T. Wheat Dgt-28 Wheat skills and techniques commonly known in the art. Each DGT Events. 28 expression cassette contained the promoter, 5' untranslated 0320 To events were allowed to acclimate in the green region and intron from the Ubiquitin (Ubi) gene from Zea house and were grown until 2-4 new, normal looking leaves mays (Toki et al Plant Physiology 1992, 100 1503-07), fol had emerged from the whorl (i.e., plants had transitioned lowed by a coding sequence consisting of one of four transit from tissue culture to greenhouse growing conditions). Plants peptides (TraP4, TraP8, TraP23 or TraP5) fused to the 5' end were grown at 25°C. under 12 hour of supplemental lighting of a synthetic version of the 5-enolpyruvylshikimate-3-phos in the greenhouse until maturity. An initial screen of glypho phate synthase gene (DGT-28), which had been codon opti mized for expression in plants. The DGT-28 expression cas sate tolerance and Taqman analyses was completed on T. sette terminated with a 3' untranslated region (UTR) plants grown under the same conditions as previously comprising the transcriptional terminator and polyadenyla described. Data allowed for determination of heritable T tion site of a lipase gene (Vp1) from Z. mays (Paek et al Mol events to be further characterized. Six low copy (1-2 copy) Cells 199830; 8(3)336-42). The PATselection cassette com and two multi-copy T. events were replanted under green prised of the promoter, 5' untranslated region and intron from house conditions and grown until the 3 leaf stage. T plants the Actin (Act1) gene from Oryza sativa (McElroy et al The were sprayed with a commercial formulation of glyphosate Plant Cell 1990 2(2) 163-171), followed by a synthetic ver (Durango DMATM) from a range of 420-3360 gae/ha, which sion of the phosphinothricin acetyl transferase (PAT) gene are capable of significant injury to untransformed wheat lines. isolated from Streptomyces viridochromogenes, which had The addition of 2% w/v ammonium sulfate was included in been codon optimized for expression in plants. The PAT gene the application. A lethal dose is defined as the rate that causes encodes a protein that confers resistance to inhibitors of >75% injury to the Bob White MPB26RH non-transformed glutamine synthetase comprising phosphinothricin, glufosi control. Herbicide was applied. US 2013/0205441 A1 Aug. 8, 2013 40

0321. In this example, the glyphosate applications were 0323. At 21 DAT, resistant and sensitive plants are counted utilized for both determining the segregation of the dgt-28 to determine the percentage of lines that segregated as a single gene in the T generation as well as demonstrating tolerance to increasing levels of glyphosate. The response of the plants locus, dominant Mendelian trait (3R:1S) as determined by is presented in terms of a scale of visual injury 21 days after Chi square analysis. Table 31. These data demonstrate that treatment (DAT). Data are presented as a histogram of indi dgt-28 is inheritable as a robust glyphosate resistance gene in viduals exhibiting less than 25% visual injury (4), 25%-50% a monocot species. visual injury (3), 50%-75% visual injury (2) and greater than 75% injury (1). An arithmetic mean and standard deviation is TABLE 31 presented for each construct used for wheat transformation. The scoring range of individual response is also indicated in Percentage of Tidgt-28 events by construct that demonstrated the last column for each rate and transformation. Wild-type, heritablity in a mendelian fashion based off of a glyphosate non-transformed wheat (c. v. Bob White MPB26RH) served Selection at rates ranging from 420-3360 gae?ha. as a glyphosate sensitive control. In the T generation hem izygous and homozygous plants were available for testing for %T events %T events each event and therefore were included for each rate of gly phosate tested. Hemizgyous plants will contain half of the tested that tested that No. T dose of the gene as homozygous plants, therefore variability Construct segregated at segregated events of response to glyphosate may be expected in the T genera ID CTP:GOI a single locus as 2 loci tested tion. 0322 The results of the T. dgt-28 wheat plants demon pDASOOO122 TraP4:dgt-28 62.5% 37.5% 8 strated that tolerance to glyphosate was achieved at rates up to pDAS000123 TraP8:dgt-28 87.5% 12.5% 8 3360 g ae/ha with the chloroplast transit peptides TraP4, pDAS0001 24 TraP23:dgt-28 12.5% 87.5% 8 TraP5, TraP8 and TraP23. Table 30. Data are of a low copy T. pDASOOO125 TraP5:dgt-28 62.5% O.0% 8 event but are representative of the population for each con Struct. TABLE 30 Response of low copy Tidgt-28 wheat events to glyphosate 21 days after treatment. % Injury % Injury

Application Rate <25%. 25-50% 50-75% - 75% Ave St. Dev. Range (%) TraP4::dgt-28

420 gae?ha 5 O O O 4.00 O.OO 840 gae?ha 6 2 O O 3.75 O46 680 gae?ha 4 2 O O 3.67 O.S2 3360 gae?ha 4 2 O O 3.67 O.S2 TraP8:dgt-28

420 gae?ha 5 3 O O 3.63 O.S2 840 gae?ha 3 5 O O 3.38 O.S2 680 gae?ha 4 3 O O 3.57 O.S3 3360 gae?ha 5 5 O O 3.50 O.S3 TraP23:dgt-28

420 gae?ha 9 2 O O 3.82 O4O 840 gae?ha 8 1 O O 3.89 O.33 680 gae?ha 7 5 O O 3.58 O.O 3360 gae?ha 8 2 O O 3.80 4.8 TraP5:dgt-28

420 gae?ha 5 2 O O 3.71 O49 3-4 840 gae?ha 4 2 O O 3.67 O.S2 3-4 680 gae?ha 7 3 O O 3.70 O48 3-4 3360 gae?ha 6 O O O 4.00 O.OO 3-4 Bobwhite MPB26RH

420 gae?ha O 1 1 10 1.25 O.62 1-3 840 gae?ha O O O 10 1.00 O.OO 680 gae?ha O O O 12 1.17 O.S8 1-3 3360 gae?ha O O O 10 1.00 O.OO US 2013/0205441 A1 Aug. 8, 2013 41

SEQUENCE LISTING

<16O is NUMBER OF SEO ID NOS: 59

<210s, SEQ ID NO 1 &211s LENGTH: 47 212. TYPE: PRT <213> ORGANISM: Dunaliella salina

<4 OOs, SEQUENCE: 1 Met Ile Leu Gly Ser Ser Pro Thr Lieu Pro His Ala Ser His Pro Ala 1. 5 1O 15 Arg Pro Gly Pro Ala Arg Pro Asp Arg Ala Ala Ala Lieu Ala Gly Ser 2O 25 3O Thr Arg Gln Leu Lieu. Arg Gly Thr Phe Arg Pro Asn Pro Ala Pro 35 4 O 45

<210s, SEQ ID NO 2 &211s LENGTH: 71 212. TYPE: PRT <213> ORGANISM: Dunaliella salina

<4 OOs, SEQUENCE: 2 Met Lieu Ala Arg Glin Gly Gly Ser Lieu. Arg Ala Ser Glin Cys Asn Ala 1. 5 1O 15 Gly Lieu Ala Arg Arg Val Glu Val Gly Ala Lieu Val Val Pro Arg Pro 2O 25 3O Ile Ser Val Asn Asp Val Val Pro His Val Tyr Ser Ala Pro Leu Ser 35 4 O 45 Val Ala Arg Arg Ser Cys Ser Lys Ser Ser Ile Arg Ser Thr Arg Arg SO 55 6 O Lieu Gln Thr Thr Val Cys Ser 65 70

<210s, SEQ ID NO 3 &211s LENGTH: 62 212. TYPE: PRT <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: chimeric TraP14 fusion protein <4 OOs, SEQUENCE: 3 Met Ile Leu Gly Ser Ser Pro Thr Lieu Pro His Ala Ser His Pro Ala 1. 5 1O 15 Arg Pro Gly Pro Ala Arg Pro Ile Ser Val Asn Asp Val Val Pro His 2O 25 3O Val Tyr Ser Ala Pro Lieu. Ser Val Ala Arg Arg Ser Cys Ser Lys Ser 35 4 O 45 Ser Ile Arg Ser Thr Arg Arg Lieu Gln Thr Thr Val Cys Ser SO 55 6 O

<210s, SEQ ID NO 4 &211s LENGTH: 67 212. TYPE: PRT <213> ORGANISM: Chlamydomonas reinhardtii

<4 OOs, SEQUENCE: 4 Met Ala Glin Ala Thr Thr Ile Asn Asn Gly Val His Thr Gly Glin Leu 1. 5 1O 15 US 2013/0205441 A1 Aug. 8, 2013 42

- Continued His His Thr Lieu Pro Llys Thr Gln Leu Pro Llys Ser Ser Lys Thr Lieu 25

Asn. Phe Gly Ser Asn Lieu. Arg Ile Ser Pro Llys Phe Met Ser Lieu. Thir 35 4 O 45 Asn Lys Arg Val Gly Gly Glin Ser Ser Ile Val Pro Llys Ile Glin Ala SO 55 6 O

Ser Wall Ala 65

<210s, SEQ ID NO 5 &211s LENGTH: 71 212. TYPE : PRT <213> ORGANISM: Dunaliella salina

<4 OOs, SEQUENCE: 5

Met Lieu Ala Arg Glin Gly Gly Ser Luell Arg Ala Ser Glin Cys Asn Ala 1. 5 1O 15

Gly Lieu. Ala Arg Arg Wall Glu Wall Gly Ala Lieu. Wall Wall Pro Arg Pro 2O 25 3O

Ile Ser Wall Asn Asp Wall Wall Pro His Val Tyr Ser Ala Pro Luel Ser 35 4 O 45

Wall Ala Arg Arg Ser Ser Ser Ser Ile Arg Ser Thir Arg Arg SO 55 6 O

Lieu. Glin Thir Thir Wall Cys Ser 65 70

<210s, SEQ ID NO 6 &211s LENGTH: 69 212. TYPE : PRT <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: chimeric TraP24 fusion protein

<4 OOs, SEQUENCE: 6

Met Glin Lieu. Lieu. Asn Glin Arg Glin Ala Lieu. Arg Lell Gly Arg Ser Ser 1. 5 1O 15

Ala Ser Lys ASn Glin Glin Wall Ala Pro Lieu Ala Ser Arg Pro Ile Ser 2O 25 3O

Wall Asn Asp Wall Wall Pro His Wall Ser Ala Pro Lell Ser Wall Ala 35 4 O 45

Arg Arg Ser Cys Ser Ser Ser Ile Arg Ser Thir Arg Arg Lieu. Glin SO 55 6 O

Thir Thr Wall Cys Ser 65

<210s, SEQ ID NO 7 &211s LENGTH: 186 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: nucleotide encoding TraP14 v2 <4 OO > SEQUENCE: 7 atgatacttg gatctagocc aactctgcca cacgcatcac atc.ca.gc.cag acctggit cot gccagaccga titt cagtgaa coacgt.cgtt coccatgtct act cogctic c tict ct cogtg 12 O gctaggcgtt Cttgtagcaa gtc.ca.gcatt aggtotacgc gtagattgca gaccacagtic 18O tgctica

US 2013/0205441 A1 Aug. 8, 2013 51

- Continued

22 Os. FEATURE: <223> OTHER INFORMATION: Chloroplast Transit Peptide

<4 OOs, SEQUENCE: 21 atggct caat ctagoagaat ctoccacggt gtgcagaacc catgtgtgat cattt coaat 6 O citct coaaat coaaccagaa caaatcto ct ttct cagtica gcc to aagac tolaccagoag 12 O Cagcgt.cgtg Cttaccagat atctagotgg ggattgaaga agt caaacaa C9ggit cogtg 18O attcgt.ccgg tta aggca 198

<210s, SEQ ID NO 22 &211s LENGTH: 198 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Chloroplast Transit Peptide

<4 OOs, SEQUENCE: 22 atggcacaag cca.gc.cgitat ctoccagaat coatgtgtga tat coaatct c cc caaaagc 6 O aaccaccgta agt ccc ctitt citctgtctica citcaagacgc at cagcc tag agcct citt.ca 12 O tggggactta agaagttctgg cac catgctgaacggttcag tatt agaCC C9tcaaggtg 18O acagcttctg titt cogca 198

<210s, SEQ ID NO 23 &211s LENGTH: 225 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Chloroplast Transit Peptide <4 OOs, SEQUENCE: 23 atggcacaat ctagoaga at Ctgcc acggt gtgcagalacc catgtgttgat catttcaaat 6 O citct caaagt ccaatcagaa caaat cacct ttct c cqtct c cct caagac acaccagoat 12 O cCaagggcat acccgataag cagct catgg ggact caaga agagcggaat gaCtctgatt 18O ggct citgagc titcgt.cct ct taaggittatgtcc totgttt cogca 225

<210s, SEQ ID NO 24 &211s LENGTH: 2O7 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Chloroplast Transit Peptide <4 OOs, SEQUENCE: 24 atggcacaag titagcagaat ctd taatggt gtgcagaacc catct cittat citccaat ct c 6 O tcaaagttcca gccaacgtaa gttct cocctic agcgtgtct c tdaaaactica gcagoccaga 12 O gctt Cttcat ggggtttgaa gaaatctgga acgatgctta acggcticagt catt.cgt.ccg 18O gttalaggtga cagcct cogt Ctc.cgct 2O7

<210s, SEQ ID NO 25 &211s LENGTH: 1464 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: In-frame fusion of digt – 28 v5 and TraP4 v2

<4 OOs, SEQUENCE: 25

US 2013/0205441 A1 Aug. 8, 2013 60

- Continued

<210s, SEQ ID NO 4 O &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 4 O

Cttcaaggag atttgggatt tt 23

<210s, SEQ ID NO 41 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 41 gagggit cq9C atcgitat 17

<210s, SEQ ID NO 42 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide probe sequence

<4 OOs, SEQUENCE: 42 agagaagttt cacggattt C9ggc 25

<210s, SEQ ID NO 43 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 43 gaggattagg gtttcaacgg ag 22

<210s, SEQ ID NO 44 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 44 gaga attgag Ctgaga.cgag g 21

<210s, SEQ ID NO 45 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 45

Ctgcaggt ca acggat Cagg at at 24

<210s, SEQ ID NO 46 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence US 2013/0205441 A1 Aug. 8, 2013 61

- Continued

22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 46 tgggctgaat talaga catg ct cc 24

<210s, SEQ ID NO 47 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 47 cgt.ccacaaa gctgaatgtg

<210s, SEQ ID NO 48 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 48 cgaagt catg gaagcc actt

<210s, SEQ ID NO 49 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 49

Cttcaaggag atttgggatt tt 23

<210s, SEQ ID NO 50 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 50 gagggit cq9C atcgitat 17

<210s, SEQ ID NO 51 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 51 tgttcggttc cct ctaccaa

<210s, SEQ ID NO 52 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide probe sequence

<4 OOs, SEQUENCE: 52 US 2013/0205441 A1 Aug. 8, 2013 62

- Continued cacagaac cq t cqctt cago aaca 24

<210s, SEQ ID NO 53 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 53 caa.catccat caccittgact ga 22

<210s, SEQ ID NO 54 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide probe sequence

<4 OOs, SEQUENCE: 54 cgagcagacic gcc.gtgtact tct acc 26

<210s, SEQ ID NO 55 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OO > SEQUENCE: 55 tggcggacga cacttgt 18

<210s, SEQ ID NO 56 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 56 aaagtttgga ggctgc.cgt. 19

<210s, SEQ ID NO 57 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OO > SEQUENCE: 57 ttcago accc gtcagaat 18

<210s, SEQ ID NO 58 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide probe sequence

<4 OOs, SEQUENCE: 58 tgcc.gagaac ttgaggaggit

<210s, SEQ ID NO 59 &211s LENGTH: 17 US 2013/0205441 A1 Aug. 8, 2013

- Continued

&212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: oligonucleotide primer sequence

<4 OO > SEQUENCE: 59 tggit cqc.cat agcttgt 17

What is claimed is: 16. The isolated nucleic acid molecule of claim 15, wherein 1. An isolated nucleic acid molecule comprising: the peptide comprises an amino acid sequence selected from a nucleotide sequence that encodes a peptide of less than 79 the group consisting of SEQ ID NO:4, SEQ ID NO:6, and amino acids in length, wherein the peptide is at least SEQID NO:7. 80% identical to SEQID NO:2, operably linked inframe 17. The isolated nucleic acid molecule of claim 1, wherein to a nucleotide coding sequence of interest. the nucleotide sequence is operably linked to one or more 2. The isolated nucleic acid molecule of claim 1, wherein regulatory sequences. the peptide is 71 amino acids in length. 18. A polypeptide encoded by the nucleic acid molecule of 3. The isolated nucleic acid molecule of claim 1, wherein claim 1. the peptide is at least 85% identical to SEQID NO:2. 19. The polypeptide of claim 18, wherein the polypeptide is 4. The isolated nucleic acid molecule of claim 1, wherein targeted to a plastid in a plastid-containing cell. the peptide is at least 90% identical to SEQID NO:2. 20. The polypeptide of claim 19, wherein the polypeptide 5. The isolated nucleic acid molecule of claim 1, wherein comprises a chloroplast transit peptide that is removed when the peptide is at least 95% identical to SEQID NO:2. the polypeptide is targeted to the plastid. 6. The isolated nucleic acid molecule of claim 1, wherein 21. The polypeptide of claim 20, wherein the polypeptide the peptide is at least 98% identical to SEQID NO:2. comprises a chloroplast-targeted peptide that remains when 7. The isolated nucleic acid molecule of claim 1, wherein the chloroplast transit peptide is removed, wherein the chlo the peptide is SEQID NO:2. roplast-targeted peptide is encoded by the nucleotide coding 8. The isolated nucleic acid molecule of claim 1, wherein sequence of interest. the nucleotide coding sequence of interest is SEQID NO:4 or 22. The polypeptide of claim 18, wherein the nucleotide SEQID NO:6. coding sequence of interest encodes a biologically-active 9. The isolated nucleic acid molecule of claim 1, wherein peptide. the nucleotide sequence that encodes the peptide is specifi 23. The polypeptide of claim 18, wherein the nucleotide cally hybridizable to SEQID NO:1. coding sequence of interest encodes a fluorescent peptide. 10. The isolated nucleic acid molecule of claim 1, wherein at least a portion of the nucleotide sequence that encodes the 24. The polypeptide of claim 22, wherein the biologically peptide is from an organism selected from the group consist active peptide is an enzyme. ing of prokaryotes, lower photosynthetic eukaryotes, and 25. The polypeptide of claim 22, wherein the biologically Chlorophytes. active peptide is normally expressed in a plastid of a cell 11. The isolated nucleic acid molecule of claim 10, wherein wherein the peptide is natively expressed. the portion of the nucleotide sequence that encodes the pep 26. The polypeptide of claim 22, wherein the biologically tide is from Dunaliella salina or Chlamydomonas reinhardtii. active peptide is involved in a process selected from the group 12. The isolated nucleic acid molecule of claim 10, wherein consisting of herbicide resistance, virus resistance, bacterial the nucleotide sequence that encodes the peptide is from an pathogen resistance, insect resistance, nematode resistance, organism selected from the group consisting of prokaryotes, fungal resistance, plant vigor, plant yield, temperature toler lower photosynthetic eukaryotes, and Chlorophytes. ance, Soil condition tolerance, low light level tolerance, low 13. The isolated nucleic acid molecule of claim 12, wherein water level tolerance, high water level tolerance, chemical the nucleotide sequence that encodes the peptide is from environment tolerance, seed color, starch modification, Dunaliella Salina or Chlamydamonas reinhardtii. amino acid synthesis, photosynthesis, synthesis offatty acids, 14. An isolated nucleic acid molecule comprising: oil synthesis, synthesis of arotenoids, synthesis ofterpenoids, a nucleotide sequence that encodes a peptide comprising a synthesis of starch, and herbicide resistance. contiguous amino acid sequence that is at least 80% 27. The polypeptide of claim 22, wherein the biologically identical to a contiguous amino acid sequence within active peptide is selected from the group consisting of Zeax SEQID NO:2, wherein the peptide further comprises a anthin epoxidase, choline monooxygenase, ferrochelatase, second contiguous amino acid sequence that is at least omega-3 fatty acid desaturase, glutamine synthetase, provi 80% identical to a contiguous amino acid sequence from tamin A, hormones, Bt toxin proteins, and markers useful in a chloroplast transit peptide other than SEQ ID NO:2. identification of plants comprising a trait of interest. wherein the nucleotide sequence encoding the peptide is 28. The polypeptide of claim 26, wherein the biologically operably linked in frame to a nucleotide sequence of active peptide is involved in herbicide resistance. interest. 29. The polypeptide of claim 28, wherein the biologically 15. The isolated nucleic acid molecule of claim 14, wherein active peptide is selected from the group consisting of aceto the contiguous amino acid sequence from a chloroplast transit lactase synthase (ALS), mutated ALS, precursors of ALS, peptide other than SEQID NO:2 is from Dunailella, Ama 3-enolpyruvylshikimate-5-phosphate synthetase (EPSPS), ranthus, or Chlamydamonas reinhardtii. CP4 EPSPS, and a class III EPSPS. US 2013/0205441 A1 Aug. 8, 2013 64

30. A plant expression vector comprising the nucleic acid 43. A transgenic plant regenerated from the plant material molecule of claim 17. of claim 42. 31. A plant material comprising the nucleic acid molecule 44. A transgenic plant commodity product produced from of claim 1. the plant material of claim 38. 45. The transgenic plant material of claim 41, wherein the 32. The plant material of claim 31, wherein the plant mate nucleotide coding sequence of interest encodes a biologi rial is selected from the group consisting of a plant cell, a plant cally-active peptide. tissue, a plant tissue culture, a callus culture, a plant part, and 46. The transgenic plant material of claim 45, wherein the a whole plant. biologically-active peptide is involved in a process selected 33. The plant material of claim 32, further comprising a from the group consisting of herbicide resistance, virus resis polypeptide comprising the peptide. tance, bacterial pathogen resistance, insect resistance, nema 34. The plant material of claim 33, wherein the nucleotide tode resistance, fungal resistance, plant vigor, plant yield, coding sequence of interest encodes a portion of the polypep temperature tolerance, Soil condition tolerance, low light tide that is targeted to a plastid in a cell of the plant material. level tolerance, low water level tolerance, high water level 35. The plant material of claim 31, wherein the nucleic acid tolerance, chemical environment tolerance, seed color, starch molecule is stably integrated into the genome of a cell from modification, amino acid synthesis, photosynthesis, synthesis the plant material. offatty acids, oil synthesis, synthesis of arotenoids, synthesis 36. The plant material of claim 31, wherein the plant mate of terpenoids, synthesis of starch, and herbicide resistance. rial is a whole plant. 47. The transgenic plant material of claim 45, wherein the 37. The plant material of claim 31, wherein the plant mate biologically-active peptide is selected from the group consist rial is from a plant selected from the group consisting of ing of Zeaxanthin epoxidase, choline monooxygenase, ferro Arabidopsis, alfalfa, Brassica, beans, broccoli, cabbage, car chelatase, omega-3 fatty acid desaturase, glutamine Syn rot, cauliflower, celery, Chinese cabbage, cotton, cucumber, thetase, provitamin A, hormones, Bt toxin proteins, and eggplant, lettuce, melon, pea, pepper, peanut, potato, pump markers useful in identification of plants comprising a trait of kin, radish, rapeseed, spinach, Soybean, squash, Sugarbeet, interest. Sunflower, tobacco, tomato, watermelon, corn, onion, rice, 48. The transgenic plant material of claim 46, wherein the Sorghum, wheat, rye, millet, Sugarcane, oat, triticale, Switch biologically-active peptide is involved in herbicide resis grass, and turfgrass. tance. 38. A method for producing a transgenic plant material, the 49. The transgenic plant material of claim 48, wherein the method comprising: biologically-active peptide is selected from the group consist obtaining the isolated nucleic acid molecule of claim 1; and ing of acetolactase synthase (ALS), mutated ALS, precursors transforming a plant material with the nucleic acid mol of ALS, 3-enolpyruvylshikimate-5-phosphate synthetase ecule. (EPSPS), CP4 EPSPS, and a class III EPSPS. 39. The method according to claim 38, wherein the plant 50. The transgenic plant material of claim 48, wherein the material is selected from the group consisting of a plant cell, plant material exhibits increased herbicide resistance or her a plant tissue, a plant tissue culture, a callus culture, a plant bicide tolerance when compared to a wild-type plant material part, and a whole plant. of the same species. 40. The method according to claim 39, wherein the plant 51. The plant material of claim32, wherein the plant mate material is not a whole plant. rial is a plant cell that is incapable of regeneration to produce 41. A transgenic plant material produced by the method of a plant. claim 38. 52. The method of claim 39, wherein the plant material is a 42. A transgenic plant material produced by the method plant cell that is incapable of regeneration to produce a plant. according to claim 40. k k k k k