US 20130205440A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0205440 A1 Lira et al. (43) Pub. Date: Aug. 8, 2013

(54) SYNTHETIC BRASSICA-DERIVED Publication Classification CHLOROPLAST TRANSIT PEPTIDES (51) Int. Cl. (71) Applicant: Dow AgroSciences LLC, Indianapolis, C07K I4/45 (2006.01) IN (US) (52) U.S. Cl. CPC ...... C07K 14/415 (2013.01) (72) Inventors: Justin M. Lira, Zionsville, IN (US); USPC ...... 800/278:536/23.6:536/23.4:530/370; Robert M. Cicchillo, Zionsville, IN 435/189: 536/23.2:435/232; 435/183; (US); Carla N. Yerkes, Crawfordsville, 435/320.1; 435/419: 800/298; 800/306; IN (US); Andrew E. Robinson, 800/313; 800/314: 800/307; 800/317: 800/305; Brownsburg, IN (US) 800/309: 800/317.1: 800/317.2: 800/312: 800/322; 800/317.3; 800/3174: 800/308; 800/320.1; 800/320.2: 800/320:800/320.3: (73) Assignee: DOWAGROSCIENCES LLC, 435/411; 435/412: 435/.414; 435/416: 435/468; Indianapolis, IN (US) 800/300: 800/301; 800/302:435/415 (57) ABSTRACT (21) Appl. No.: 13/757,435 This disclosure concerns compositions and methods for tar geting peptides, polypeptides, and proteins to plastids of plas tid-containing cells. In some embodiments, the disclosure (22) Filed: Feb. 1, 2013 concerns chloroplast transit peptides that may direct a polypeptide to a plastid, and nucleic acid molecules encoding O O the same. In some embodiments, the disclosure concerns Related U.S. Application Data methods for producing a transgenic plant material (e.g., a (60) Provisional application No. 61/593,555, filed on Feb. transgenic plant) comprising a chloroplast transit peptide, as 1, 2012, provisional application No. 61/625.222, filed well as plant materials produced by Such methods, and plant on Apr. 17, 2012. commodity products produced therefrom. Patent Application Publication Aug. 8, 2013 Sheet 1 of 16 US 2013/0205440 A1

FIG. 1 mRNA molecule comprising a Brassica-derived chloroplast transit peptidc-encoding scquence

Brassica-derived CTP Nucleotide sequence of interest 53

NOptional nucleotide scquences

FIG. 2 Alignment of the predicted chloroplast transit peptides for the EPSPS protein from Brassica napus (SEQ ID NO:2) and Arabidopsis thaliana (SEQ ID NO:4). The asterisk indicates where the sequences were spit and recombined to form TraP12 and Trap 13.

Brassica rapus (SEC) D NO: 2) Arabidopsis thaliana (SEC D NO: 4)

Bria S8iCa rap us (SEC) D NO : 2) Arabidcps is thaliana (SEC D NO: 4) 3IIPRAYPI: Brassica rapus (SEO ID NO: 2) ArabidCps is thali and (SEC D NO: 4) Patent Application Publication Aug. 8, 2013 Sheet 2 of 16 US 2013/0205440 A1

FIG. 3

Plasmid map pDAB101981

TDNA BOrder B

SpnRoverdrive Atubi? 0 promoter N At Ubi? 0 promoter intron 3. Trap 12

pDAB101981 AtuORF23 3' UTR 10955bp CSVMV promoter

PAT

OriT S. w AtuoRF1 3' UTR s TDNA BOrder A TDNA BOrder A TDNA BOrder A Patent Application Publication Aug. 8, 2013 Sheet 3 of 16 US 2013/0205440 A1

FIG. 4 Plasmid map pDAB 101989

OVerdrive / SpnR S. TDNA BOrder B Atubi? 0 promoter At Jbil O promoter intron Trap 13

pDAB101989 1O937 bp i-- AtuORF233' UTR

CSVMV promoter

u- Y OriTf N X PAT AtuORF13' UTR TDNA BOrder A/ r TDN A BOrder A TDNA BOrder A Patent Application Publication Aug. 8, 2013 Sheet 4 of 16 US 2013/0205440 A1

FIGS

Plasmid map of pDAB 101908

TDNA BOrder B w Overdrive \ Š. Atubi? 0 promoter Š ------Atubifo promoter intron STLS1 intron

YFP

pDAB101908 AtuORF23 3' UTR 1O931 bp

CsVMV promoter

a PAT

oriT AtuORF13' UTR N \ TDNA BOrder A \ T-DNA Border A TDNA BOrder A Patent Application Publication Aug. 8, 2013 Sheet 5 of 16 US 2013/0205440 A1

FIG. 6

TraP12-YFP infiltrated into tobacco leaf tissue was translocated into the chloroplasts of the tobacco leaf tissue

FIG. 7

Trap 13-YFP infiltrated into tobacco leaf tissue was translocated into the chloroplasts of the tobacco leaf tissue.

Patent Application Publication Aug. 8, 2013 Sheet 6 of 16 US 2013/0205440 A1

FIG. 8

Non-targeted YFP controls that were infiltrated into tobacco leaf tissue were not incorporated into the chloroplasts of the tobacco leaf tissue.

FIG. 9

TraP12-YFP transformed into maize protoplasts was translocated into the chloroplasts of the maize protoplast.

Patent Application Publication Aug. 8, 2013 Sheet 7 of 16 US 2013/0205440 A1

FIG 10

Plasmid map pDAB 105528

TDNA BOrder B

Overdrive \ SpnR Atubi10 promoter Atubi10 promoter intron Tap 12 W2

pDAB105528 11564 bp S s AtuORF233' UTR

\ CSWMV Promoter oriT SS DSM2 Š N s AtuORF1 3' UTR TDNA BOrder A/ r TDNA BOrder A TDNA BOrder A Patent Application Publication Aug. 8, 2013 Sheet 8 of 16 US 2013/0205440 A1

FIG 11

Plasmid map pDAB105529

TDNA BOrder B Overdriv SpnR N AtUbi?10 promoter X Š --- S Atubi?0 promoter intron Trap 13 W2

DGT14 pDAB105529 115466 bp iS - AtuORF233' UTR

CsVMV Promoter OriT xx DSM2 AtuORF13' UTR TDNA BOrder A TDNA BOrder A TDNA BOrder A Patent Application Publication Aug. 8, 2013 Sheet 9 of 16 US 2013/0205440 A1

FIG. 12

Plasmid map pDAB 107686

OV erdrive T-DNA Border B SpnR ZmUbi1 promoter ZmUbi1 intron

TraP12 v 4

pDAB107686 TraP12 Cry2Aa 14349bp oriT TDNA BOrder A ZmLip 3' UTR -> T-DNA Border A--- N.s ,

T-DNA Border A \

ZmLip3' UTR I X. SCBW promoter Msv leader Adh 1 intron 6 Patent Application Publication Aug. 8, 2013 Sheet 10 of 16 US 2013/0205440 A1

FIG. 13

Plasmid map pDAB 107687

Overdriv e T-DNA Border B SpnR Zmubi1 promoter ^ Zmubi1 intron

Cry2Aa pDAB107687 14127 bp

s S oriT . SX

ZmLip 3' UTR

T-DNA Border A s & s --- & as ------T-DNA Border AuŠ to TDNA Border A / / SCBV promoter ZmLip 3' UTRw / MSV leader \ AAD-1 Adh1 intron 6 Patent Application Publication Aug. 8, 2013 Sheet 11 of 16 US 2013/0205440 A1

F.G. 14

Plasmid map of pDAB 112711

OW erdrive T-DNA BOrder B / Zmubi1 promoter

pDAB112711 Trap 12 Wip3Ab1 v6 oriT 14831 bp

TDNA BOrder A is s^ is T-DNA Border A s SN ZmPer5 3' UTR TDNA Border A × / --- ZmLip3' UTR v 1 x SCBW promoter AAD-1 usy leader Adh1 intron 6 Patent Application Publication Aug. 8, 2013 Sheet 12 of 16 US 2013/0205440 A1

FIG. 1S

Plasmid map of pDAB11479

Overdrive T-DNA BOrder B SpnR ^ Zmubi1 promoter Zm Ubi?1 intron

pDAB111479 Wip3Ab1 v6 14606bp oriT T-DNA Border A T-DNA Border A. M. N. ZmPer53' UTR

TDNA BOrder

ZmLip 3' UTR SCBV promoter AAD-1 & Msv leader Adh1 intron 6 Patent Application Publication Aug. 8, 2013 Sheet 13 of 16 US 2013/0205440 A1

Plasmid map of pDAB 112712

Overdrive TDNA BOrder B s Zmubi1 promoter SS Zm Ubi?1 intron

trfA :

pDAB112712 TraP12 Wip3Ab1 v 7

14831 bp oriT as

T-DNA Border A TDNA Border A- / S. ZmPer5 3' UTR TDNA BOrder A

ZmLip3' UTR SCBW promoter MSW leader Adh 1 intron 6 Patent Application Publication Aug. 8, 2013 Sheet 14 of 16 US 2013/0205440 A1

FIG.17

Plasmid map of pDAB 112710

Overdriv e T-DNA Border B SpnR x × Zmubi1 promoter Zm Ubi1 intron

p DAB11271 O u Wip3Ab1 v7 14606bp

oriT T-DNA Border A T-DNA Border ASM S N ZmPer53' UTR TDNA BOrder ---a S / ZmLip 3' UTR SCBV promoter y AAD-1 Msv leader Adh1 intron 6 Patent Application Publication Aug. 8, 2013 Sheet 15 of 16 US 2013/0205440 A1

FIG. 18

Plasmid map of pDAB017540

Overdrive T-DNA BOrder B SpnR ^ Atubil O promoter Atubi10 promoter intron

TraP12 v 3 Y

pDAB107540 Crv2Ary2Aa 12113 bp

-- oriT

? TDNA BOrder A Patent Application Publication Aug. 8, 2013 Sheet 16 of 16 US 2013/0205440 A1

FIG. 19

Plasmid map of pDAB 107617

Overdrive T-DNA Border B SpnR ^ - Atubil 0 promoter Atubi10 promoter intron s

trfA Cry2Aa v3 pDAB107617 12O78bp

AtuORF233' UTR

OriT assassa & CSVMV Promoter T-DNA Border A -S y \ DSM2 //I T-DNA Border A / AtuORF13' UTR ? TDNA BOrder A US 2013/0205440 A1 Aug. 8, 2013

SYNTHETIC BRASSCA-DERVED have identified the specific target of several herbicides. For CHLOROPLAST TRANSIT PEPTIDES instance, triazine-derived herbicides inhibit photosynthesis by displacing a plastoquinone molecule from its binding site CROSS-REFERENCE TO RELATED in the 32 kD polypeptide of the photosystem II. This 32 kD APPLICATIONS polypeptide is encoded in the chloroplast genome and Syn 0001. This application claims the benefit of U.S. Provi thesized by the organelle machinery. Mutant plants have been sional Patent Application Ser. No. 61/593,555 filed Feb. 1, obtained which are resistant to triazine herbicides. These 2012, and also to U.S. Provisional Patent Application Ser. No. plants contain a mutant 32 kD polypeptide from which the 61/625.222, filed Apr. 17, 2012, the disclosure of each of plastoquinone can no longer be displaced by triazine herbi which is hereby incorporated herein in its entirety by this cides. Sulfonylureas inhibit acetolactate synthase in the chlo reference. roplast. Acetolactate synthase is involved in isoleucine and valine synthesis. Glyphosate inhibits the function of 5-enol STATEMENT ACCORDING TO 37 C.F.R. pyruvyl-3-phosphoshikimate synthase (EPSPS), which is an S1.821(c) or (e) SEQUENCE LISTING enzyme involved in the synthesis of aromatic amino acids. All SUBMITTED AS ASCII TEXT FILE these enzymes are encoded by the nuclear genome, but they are translocated into the chloroplast where the actual amino 0002 Pursuant to 37 C.F.R. S1.821(c) or (e), a file con acid synthesis takes place. taining an ASCII text version of the Sequence Listing has 0007 Most chloroplast proteins are encoded in the been Submitted concomitant with this application, the con nucleus of the plant cell, synthesized as larger precursor pro tents of which are hereby incorporated by reference. teins in the cytosol, and post-translationally imported into the chloroplast. Import across the outer and inner envelope mem FIELD OF THE DISCLOSURE branes into the stroma is the major means for entry of proteins 0003. This disclosure relates to compositions and methods destined for the stroma, the thylakoid membrane, and the for genetically encoding and expressing polypeptides that are thylakoid lumen. Localization of imported precursor proteins targeted to plastids of plastid-containing cells. In certain to the thylakoid membrane and thylakoid lumen is accom embodiments, the disclosure relates to amino acid sequences plished by four distinct mechanisms, including two that are that target polypeptides to chloroplasts (e.g., of higher homologous to bacterial protein transport systems. Thus, plants), and/or nucleic acid molecules encoding the same. In mechanisms for protein localization in the chloroplast are, in certain embodiments, the disclosure relates to chimeric part, derived from the prokaryotic endosymbiont. Cline and polypeptides comprising an amino acid sequence that con Henry (1996), Annu. Rev. Cell. Dev. Biol. 12:1-26. trols the transit of the chimeric polypeptides to plastids, and/ 0008 Precursor proteins destined for chloroplastic or nucleic acid molecules encoding the same. expression contain N-terminal extensions known as chloro plast transit peptides (CTPs). The transit peptide is instru BACKGROUND mental for specific recognition of the chloroplast Surface and 0004 Plant cells contain distinct subcellular organelles, in mediating the post-translational translocation of pre-pro referred to generally as “plastids.' that are delimited by char teins across the chloroplastic envelope and, thence, to the acteristic membrane systems and perform specialized func various Sub-compartments within the chloroplast (e.g., tions within the cell. Particular plastids are responsible for stroma, thylakoid, and thylakoid membrane). These N-termi photosynthesis, as well as the synthesis and storage of certain nal transit peptide sequences contain all the information nec chemical compounds. All plastids are derived from proplas essary for the import of the chloroplast protein into plastids; tids that are present in the meristematic regions of the plant. the transit peptide sequences are necessary and Sufficient for Proplastids may develop into, for example: chloroplasts, etio plastid import. plasts, chromoplasts, gerontoplasts, leucoplasts, amylo 0009 Plant genes reported to have naturally-encoded tran plasts, elaioplasts, and proteinoplasts. Plastids existina semi sit peptide sequences at their N-terminus include the chloro autonomous fashion within the cell, containing their own plast small subunit of ribulose-1,5-bisphosphate caroxylase genetic system and protein synthesis machinery, but relying (RuBisCo) (de Castro Silva-Filho et al. (1996), Plant Mol. upon a close cooperation with the nucleo-cytoplasmic system Biol. 30:769-80; Schnell et al. (1991), J. Biol. Chem. 266: in their development and biosynthetic activities. 3335-42); EPSPS (see, e.g., Archer et al. (1990), J. Bioenerg. 0005. In photosynthetic leaf cells of higher plants, the and Biomemb. 22:789-810 and U.S. Pat. Nos. 6,867,293, most conspicuous plastids are the chloroplasts. The most 7,045,684, and Re. 36,449); tryptophan synthase (Zhao et al. essential function of chloroplasts is the performance of the (1995), J. Biol. Chem. 270:6081-7); plastocyanin (Lawrence light-driven reactions of photosynthesis. But, chloroplasts et al. (1997), J. Biol. Chem. 272:20357-63); chorismate syn also carry out many other biosynthetic processes of impor thase (Schmidt et al. (1993), J. Biol. Chem. 268:27447-57): tance to the plant cell. For example, all of the cell's fatty acids the light harvesting chlorophyll afb binding protein (LHBP) are made by enzymes located in the chloroplast stroma, using (Lamppa et al. (1988), J. Biol. Chem. 263:14996-14999); and the ATP NAOPH, and carbohydrates readily available there. chloroplast protein of Arabidopsis thaliana (Lee et al. (2008), Moreover, the reducing power of light-activated electrons Plant Cell 20:1603-22). United States Patent Publication No. drives the reduction of nitrite (NO) to ammonia (NH) in US 2010/007 1090 provides certain chloroplast targeting pep the chloroplast; this ammonia provides the plant with nitro tides from Chlamydomonas sp. gen required for the synthesis of amino acids and nucleotides. 0010. However, the structural requirements for the infor 0006. The chloroplast also takes part in processes of par mation encoded by chloroplast targeting peptides remains ticular importance in the agrochemical industry. For example, elusive, due to their high level of sequence diversity and lack it is known that many herbicides act by blocking functions of common or consensus sequence motifs, though it is pos which are performed within the chloroplast. Recent studies sible that there are distinct subgroups of chloroplast targeting US 2013/0205440 A1 Aug. 8, 2013

peptides with independent structural motifs. Lee et al. (2008), embodiments. Such nucleic acid molecules may be useful for Supra. Further, not all of these sequences have been useful in expression and targeting of a polypeptide encoded by the the heterologous expression of chloroplast-targeted proteins nucleotide sequence of interest in a monocot or dicot plant. in higher plants. For the purposes of the present disclosure, a Brassica-derived means for targeting a polypeptide to a chloroplast refers to BRIEF SUMMARY OF THE DISCLOSURE particular synthetic nucleotide sequences. In particular 0011. Described herein are compositions and methods for embodiments, a Brassica-derived means for targeting a plastid targeting of polypeptides in a plant. In some embodi polypeptide to a chloroplast is selected from the group con ments, a composition comprises a nucleic acid molecule com sisting of the nucleotide sequences referred to herein as prising at least one nucleotide sequence encoding a synthetic TraP12, and TraP13. Brassica-derived chloroplast transit peptide (e.g., a TraP12 0015. Also described herein are plant materials (for peptide, and a TraP13 peptide) operably linked to a nucleotide example and without limitation, plants, plant tissues, and sequence of interest. In particular embodiments, such nucleic plant cells) comprising a nucleic acid molecule comprising at acid molecules may be useful for expression and targeting of least one nucleotide sequence encoding a synthetic Brassica a polypeptide encoded by the nucleotide sequence of interest derived CTP operably linked to a nucleotide sequence of in a monocot or dicot plant. Further described are vectors interest. In some embodiments, a plant material may have comprising a nucleic acid molecule comprising at least one Such a nucleic acid molecule stably integrated in its genome. nucleotide sequence encoding a synthetic Brassica-derived In some embodiments, a plant material may transiently chloroplast transit peptide operably linked to a nucleotide express a product of a nucleic acid molecule comprising at sequence of interest. least one nucleotide sequence encoding a synthetic Brassica 0012. In some embodiments, a nucleotide sequence derived CTP operably linked to a nucleotide sequence of encoding a synthetic Brassica-derived CTP may be a nucle interest. otide sequence that is derived from a reference nucleotide 0016 Methods are also described for expressing a nucle sequence obtained from a Brassica sp. gene (e.g., B. napus, B. otide sequence in a plastid-containing cell (e.g., a plant) in a rapa, B. juncea, and B. carinata), or a functional variant plastid (e.g., a chloroplast) of the plastid-containing cell. In thereof. In some embodiments, a nucleotide sequence encod particular embodiments, a nucleic acid molecule comprising ing a synthetic Brassica-derived CTP may be a chimeric at least one nucleotide sequence encoding a synthetic Bras nucleotide sequence comprising a partial CTP-encoding sica-derived CTP operably linked to a nucleotide sequence of nucleotide sequence from a Brassica sp. gene, or a functional interest may be used to transform a plant cell. Such that a variant thereof. In specific embodiments, a nucleotide precursor fusion polypeptide comprising the synthetic Bras sequence encoding a synthetic Brassica-derived CTP may sica-derived CTP fused to an expression product of the nucle contain contiguous nucleotide sequences obtained from each otide sequence of interest is produced in the cytoplasm of the of a reference Brassica sp. CTP, and a CTP from a different plant cell, and the fusion polypeptide is then transported in gene of the Brassica sp., a different Brassica sp., or a different vivo into a chloroplast of the plant cell. organism (e.g., a plant, prokaryote, and lower photosynthetic 0017. Further described are methods for the production of eukaryote), or functional variants of any of the foregoing. In a transgenic plant comprising a nucleic acid molecule com particular embodiments, a contiguous nucleotide sequence prising at least one nucleotide sequence encoding a synthetic may be obtained from a orthologous nucleotide sequence of Brassica-derived CTP operably linked to a nucleotide the reference Brassica CTP that is obtained from a different sequence of interest. Also described are plant commodity organisms ortholog of the reference Brassica sp. gene (e.g., products (e.g., seeds) produced from Such transgenic plants. a different Brassica sp. genome). In these and further embodi 0018. The foregoing and other features will become more ments, a nucleotide sequence encoding a synthetic Brassica apparent from the following detailed description of several derived CTP may be a chimeric nucleotide sequence com embodiments, which proceeds with reference to the accom prising more than one CTP-encoding nucleotide sequence. panying figures. 0013 In some examples, a nucleotide sequence encoding a synthetic Brassica-derived CTP may be a chimeric nucle BRIEF DESCRIPTION OF THE FIGURES otide sequence comprising a partial CTP nucleotide sequence (0019 FIG. 1 illustrates mRNA molecules that are repre from B. napus, or functional variants thereof. In specific sentative of particular examples of a synthetic Brassica-de examples, a nucleotide sequence encoding a synthetic Bras rived CTP-encoding nucleotide sequence (for example, sica-derived CTP may contain contiguous nucleotide TraP12, and TraP13) operably linked to a nucleotide sequences obtained from B. napus, or functional variants sequence of interest. In some embodiments, an mRNA mol thereof. In still further examples, a nucleotide sequence ecule (such as the ones shown) may be transcribed from a encoding a synthetic Brassica-derived CTP may contain a DNA molecule comprising an open reading frame including contiguous nucleotide sequence obtained from a Brassica sp. the synthetic Brassica-derived CTP-encoding sequence oper gene, or functional variant thereof, and a contiguous nucle ably linked to the nucleotide sequence of interest. The nucle otide sequence obtained from an Arabidopsis sp. gene, or otide sequence of interest may be, in some embodiments, a functional variant thereof. sequence encoding a peptide of interest, for example and 0014. In some embodiments, a composition comprises a without limitation, a marker gene product or peptide to be nucleic acid molecule comprising at least one Brassica-de targeted to a plastid. rived means for targeting a polypeptide to a chloroplast. Fur 0020 FIG. 2 includes an alignment of the predicted chlo ther described are nucleic acid molecules comprising a roplast transit peptides for the EPSPS protein from Brassica nucleic acid molecule comprising at least one Brassica-de napus (SEQ ID NO:2) and Arabidopsis thaliana (SEQ ID rived means for targeting a polypeptide to a chloroplast oper NO:4). The asterisk indicates where the sequences were spit ably linked to a nucleotide sequence of interest. In particular and recombined to form TraP12 and Trap 13. US 2013/0205440 A1 Aug. 8, 2013

0021 FIG. 3 illustrates a plasmid map p)AB101981. tion and were found to exhibit plastid targeting that was at 0022 FIG. 4 illustrates a plasmid map p)AB101989. least as favorable as that observed for the native Brassica 0023 FIG. 5 illustrates a plasmid map p)AB101908. sequences individually. 0024 FIG. 6 includes a microscopy image ofTraP12-YFP 0040. In a further exemplary embodiment, nucleic acid infiltrated into tobacco leaf tissue was translocated into the sequences, each encoding a synthetic TraP peptide of the chloroplasts of the tobacco leaf tissue. invention, were synthesized independently and operably 0025 FIG. 7 includes a microscopy image ofTraP13-YFP linked to a nucleic acid sequence encoding a yellow fluores infiltrated into tobacco leaf tissue was translocated into the cent protein (YFP) to produce synthetic nucleic acid mol chloroplasts of the tobacco leaf tissue. ecules, each encoding a chimeric TraP:YFP fusion polypep 0026 FIG. 8 includes a microscopy image of non-targeted tide. Such nucleic acid molecules, each encoding a chimeric YFP controls that were infiltrated into tobacco leaf tissue TraP:YFP polypeptide, were each introduced into a binary were not incorporated into the chloroplasts of the tobacco leaf vector, such that each TraP:YFP-encoding nucleic acid tissue. sequence was operably linked to an AtlJbi 10 promoter. 0027 FIG.9 includes a microscopy image ofTraP12-YFP 0041. In yet a further exemplary embodiment, binary vec transformed into maize protoplasts was translocated into the tors comprising a TraP:YFP-encoding nucleic acid sequence chloroplasts of the maize protoplast. operably linked to an AtlJbi 10 promoter each were indepen 0028 FIG. 10 illustrates a plasmid map p)AB105528. dently, transiently transformed into tobacco (Nicotiana 0029 FIG. 11 illustrates a plasmid map p)AB105529. benthamiana) via Agrobacterium-mediated transformation. 0030 FIG. 12 illustrates a plasmid map of pDAB 107686. Confocal microscopy and Western blot analysis confirmed 0031 FIG. 13 illustrates a plasmid map of pDAB 107687. that each TraP successfully targeted YFP to tobacco chloro 0032 FIG. 14 illustrates a plasmid map of pDAB 112711. plasts. 0033 FIG. 15 illustrates a plasmid map of pDAB11479. 0042. In a further exemplary embodiment, nucleic acid 0034 FIG. 16 illustrates a plasmid map of pDAB 112712. sequences, each encoding a synthetic TraP peptide of the 0035 FIG. 17 illustrates a plasmid map of pDAB 112710. invention, were synthesized independently and operably 0036 FIG. 18 illustrates a plasmid map of pDAB017540. linked to a nucleic acid sequence encoding an agronomically 0037 FIG. 19 illustrates a plasmid map of pDAB 107617. important gene sequence. The TraP sequences were fused to herbicide tolerant traits (e.g. dgt-28 and dgt-14) to produce DETAILED DESCRIPTION synthetic nucleic acid molecules, each encoding a chimeric TraP:DGT-28 or TraP:DGT-14 fusion polypeptide. Such I. Overview of Several Embodiments nucleic acid molecules, each encoding a chimeric TraP:DGT 0038 A chloroplast transit peptide (CTP) (or plastid tran 28 or TraP:DGT-14 polypeptide, were each introduced into a sit peptide) functions co-translationally or post-translation binary vector, such that each TraP:dgt-28 or TraP:dgt-14 ally to direct a polypeptide comprising the CTP to a plastid encoding nucleic acid sequence was operably linked to a (e.g., a chloroplast). In some embodiments of the invention, promoter and other gene regulatory elements. The binary either endogenous chloroplast proteins or heterologous pro containing the TraP:dgt-28 or TraP:dgt-14-encoding nucleic teins may be directed to a chloroplast by expression of such a acid sequence was used to transform Varopis plant species. protein as a larger precursor polypeptide comprising a CTP. The transgenic plants were assayed for herbicide tolerance as In particular embodiments, the CTP may be derived from a a result of the expression and translocation of the DGT-28 or nucleotide sequence obtained from a Brassica sp. gene, for DGT-14 enzymes to the chloroplast. example and without limitation, by incorporating at least one 0043. In a further exemplary embodiment, nucleic acid contiguous sequence from a orthologous gene obtained from sequences, each encoding a synthetic TraP peptide of the a different organism, or a functional variant thereof. invention, were synthesized independently and operably 0039. In an exemplary embodiment, nucleic acid linked to a nucleic acid sequence encoding an agronomically sequences, each encoding a CTP were isolated from EPSPS important gene sequence. The TraP sequences were fused to gene sequences obtained from Brassica napus (NCBI Data insect tolerant traits (e.g. cry2Aa, vip3ab1, cry 1F, cry1Ac, base Accession No. P17688). The CTP-encoding nucleic acid and cry 1Ca) to produce synthetic nucleic acid molecules, sequences were isolated by analyzing the EPSPS gene each encoding a chimeric TraP:Cry2Aa, TraP:Vip3Ab1, sequence with the ChloroP prediction server. Emanuelsson et TraP:Cry1F, TraP:Cry1Ac, or TraP:Cry1Ca fusion polypep al. (1999), Protein Science 8:978-84 (available at cbs.dtu.dk/ tide. Such nucleic acid molecules, each encoding a chimeric services/ChloroP). The predicted protein products of the iso TraP:cry2Aa, TraP: vip3ab1, TraP:cry 1F, TraP:cry1Ac, or lated CTP-encoding sequences are approximately 60-70 TraP:cry 1Capolypeptide, were each introduced into a binary amino acid-long transit peptides. CTP-encoding nucleic acid vector, such that each TraP:cry2Aa, TraP: vip3ab1, TraP: sequences were isolated from orthologous EPSPS genes cry 1F, TraP:cry1Ac, or TraP:cry1Ca-encoding nucleic acid obtained from Arabidopsis thaliana (NCBI Accession No. sequence was operably linked to a promoter and other gene NP 182055). In this example, the native B. napus CTP was regulatory elements. The binary containing the TraP:cry2Aa, used as a reference sequence to design exemplary synthetic TraP: vip3ab1, TraP:cry1F, TraP:cry1Ac, or TraP:cry1Ca-en Brassica-derived CTPS by fusing contiguous sequences from coding nucleic acid sequence was used to transform various an Arabidopsis CTP at a particular position in the B. napus plant species. The transgenic plants were bioassayed for CTP. This design process illustrates the development of a insect resistance as a result of the expression and transloca novel synthetic CTP, according to some aspects, from a Bras tion of the Cry2Aa, Vip3Ab1, Cry1F, Cry1Ac, or Cry1Ca sica and Arabidopsis sp. nucleic acid sequence. These exem enzymes to the chloroplast. plary synthetic Brassica-derived CTPs are referred to 0044. In view of the aforementioned detailed working throughout this disclosure as TraPs 12 and 13. These exem examples, synthetic Brassica-derived CTP sequences of the plary synthetic TraPs were tested for plastid-targeting func invention, and nucleic acids encoding the same, may be used US 2013/0205440 A1 Aug. 8, 2013

to direct any polypeptide to a plastid in a broad range of 0054 Contact: As used herein, the term “contact with or plastid-containing cells. For example, by methods made “uptake by a cell, tissue, or organism (e.g., a plant cell; plant available to those of skill in the art by the present disclosure, tissue; and plant), with regard to a nucleic acid molecule, a chimeric polypeptide comprising a synthetic Brassica-de includes internalization of the nucleic acid molecule into the rived CTP sequence fused to the N-terminus of any second organism, for example and without limitation: contacting the peptide sequence may be introduced into (or expressed in) a organism with a composition comprising the nucleic acid plastid-containing host cell for plastid targeting of the second molecule; and soaking of organisms with a solution compris peptide sequence. Thus, in particular embodiments, a TraP ing the nucleic acid molecule. peptide of the invention may provide increased efficiency of 0055 Endogenous: As used herein, the term “endog import and processing of a peptide for which plastid expres enous” refers to Substances (e.g., nucleic acid molecules and sion is desired, when compared to a native CTP. polypeptides) that originate from within a particular organ ism, tissue, or cell. For example, an “endogenous' polypep II. Abbreviations tide expressed in a plant cell may refer to a polypeptide that is normally expressed in cells of the same type from non-ge 0045 CTP chloroplast transit peptide netically engineered plants of the same species. In some 0046 Bt bacillus thuringiensis examples, an endogenous gene (e.g., an EPSPS gene) from a 0047 EPSPS 3-enolpyruvylshikimate-5-phosphate Brassica sp. may be used to obtain a reference Brassica CTP synthetase Sequence. 0048 YFP yellow fluorescent protein 0056 Expression: As used herein, “expression of a cod 0049 T, tumor-inducing (plasmids derived from A. ing sequence (for example, a gene or a transgene) refers to the tumefaciens) process by which the coded information of a nucleic acid 0050 T-DNA transfer DNA transcriptional unit (including, e.g., genomic DNA or cDNA) is converted into an operational, non-operational, or struc III. Terms tural part of a cell, often including the synthesis of a protein. Gene expression can be influenced by external signals; for 0051. In order to facilitate review of the various embodi example, exposure of a cell, tissue, or organism to an agent ments of the disclosure, the following explanations of specific that increases or decreases gene expression. Expression of a terms are provided: gene can also be regulated anywhere in the pathway from 0052 Chloroplast transit peptide: As used herein, the term DNA to RNA to protein. Regulation of gene expression “chloroplast transit peptide' (CTP) (or “plastid transit pep occurs, for example, through controls acting on transcription, tide') may refer to an amino acid sequence that, when present translation, RNA transport and processing, degradation of at the N-terminus of a polypeptide, directs the import of the intermediary molecules such as mRNA, or through activa polypeptide into a plastid of a plastid-containing cell (e.g., a tion, inactivation, compartmentalization, or degradation of plant cell. Such as in a whole plant or plant cell culture). A specific protein molecules after they have been made, or by CTP is generally necessary and sufficient to direct the import combinations thereof. Gene expression can be measured at of a protein into a plastid (e.g., a primary, secondary, or the RNA level or the protein level by any method known in the tertiary plastid, Such as a chloroplast) of a host cell. A putative art, for example and without limitation: Northern blot; RT chloroplast transit peptide may be identified by one of several PCR; Western blot; or in vitro; in situ; and in vivo protein available algorithms (e.g., PSORT, and ChloroP (available at activity assay(s). cbs.dtu.dk/services/ChloroP)). ChloroP may provide particu 0057 Genetic material: As used herein, the term “genetic larly good prediction of CTPs. Emanuelsson et al. (1999), material includes all genes, and nucleic acid molecules, such Protein Science 8:978-84. However, prediction of functional as DNA and RNA. CTPs is not achieved at 100% efficiency by any existing 0.058 Heterologous: As used herein, the term "heterolo algorithm. Therefore, it is important to verify that an identi gous' refers to Substances (e.g., nucleic acid molecules and fied putative CTP does indeed function as intended in, e.g., an polypeptides) that do not originate from within a particular in vitro, or in Vivo methodology. organism, tissue, or cell. For example, a "heterologous' 0053 Chloroplast transit peptides may be located at the polypeptide expressed in a plant cell may refer to a polypep N-terminus of a polypeptide that is imported into a plastid. tide that is not normally expressed in cells of the same type The CTP may facilitate co- or post-translational transport of from non-genetically engineered plants of the same species a polypeptide comprising the CTP into the plastid. Chloro (e.g., a polypeptide that is expressed in different cells of the plast transit peptides typically comprise between about 40 same organism or cells of a different organism). and about 100 amino acids, and such CTPs have been 0059 Isolated: As used herein, the term “isolated refers observed to contain certain common characteristics. For to molecules (e.g., nucleic acid molecules and polypeptides) example: CTPs contain very few, if any, negatively charged that are substantially separated or purified away from other amino acids (such as aspartic acid, glutamic acid, aspar molecules of the same type (e.g., other nucleic acid molecules agines, or glutamine); the N-terminal regions of CTPS lack and other polypeptides) with which the molecule is normally charged amino acids, glycine, and proline; the central region associated in the cell of the organism in which the molecule of a CTP also is likely to contain a very high proportion of naturally occurs. For example, an isolated nucleic acid mol basic or hydroxylated amino acids (such as serine and threo ecule may be substantially separated or purified away from nine); and the C-terminal region of a CTP is likely to be rich chromosomal DNA or extrachromosomal DNA in the cell of in arginine, and have the ability to comprise an amphipathic the organism in which the nucleic acid molecule naturally beta-sheet structure. Plastid proteases may cleave the CTP occurs. Thus, the term includes recombinant nucleic acid from the remainder of a polypeptide comprising the CTP after molecules and polypeptides that are biochemically purified importation of the polypeptide into the plastid. Such that other nucleic acid molecules, polypeptides, and US 2013/0205440 A1 Aug. 8, 2013

cellular components are removed. The term also includes based on solubility in different solvents; and methods of recombinant nucleic acid molecules, chemically-synthesized genetic engineering Such as amplification, cloning, and Sub nucleic acid molecules, and recombinantly produced cloning. polypeptides. 0065. Sequence identity: The term “sequence identity” or 0060. The term “substantially purified, as used herein, “identity,” as used herein in the context of two nucleic acid or refers to a molecule that is separated from other molecules polypeptide sequences, may refer to the residues in the two normally associated with it in its native state. A substantially sequences that are the same when aligned for maximum cor purified molecule may be the predominant species present in respondence over a specified comparison window. a composition. A substantially purified molecule may be, for 0066. As used herein, the term “percentage of sequence example, at least 60% free, at least 75% free, or at least 90% identity” may refer to the value determined by comparing two free from other molecules besides a solvent present in a optimally aligned sequences (e.g., nucleic acid sequences, natural mixture. The term “substantially purified” does not and amino acid sequences) over a comparison window, refer to molecules present in their native state. wherein the portion of the sequence in the comparison win 0061 Nucleic acid molecule: As used herein, the term dow may comprise additions or deletions (i.e., gaps) as com “nucleic acid molecule' refers to a polymeric form of nucle pared to the reference sequence (which does not comprise otides, which may include both sense and anti-sense Strands additions or deletions) for optimal alignment of the two of RNA, cDNA, genomic DNA, and synthetic forms and sequences. The percentage is calculated by determining the mixed polymers of the above. A nucleotide may refer to a number of positions at which the identical nucleotide or ribonucleotide, deoxyribonucleotide, or a modified form of amino acid residue occurs in both sequences to yield the either type of nucleotide. A “nucleic acid molecule' as used number of matched positions, dividing the number of herein is synonymous with “nucleic acid' and “polynucle matched positions by the total number of positions in the otide. A nucleic acid molecule is usually at least 10 bases in comparison window, and multiplying the result by 100 to length, unless otherwise specified. The term includes single yield the percentage of sequence identity. and double-stranded forms of DNA. Nucleic acid molecules 0067 Methods for aligning sequences for comparison are include dimeric (so-called in tandem) forms, and the tran well-known in the art. Various programs and alignment algo Scription products of nucleic acid molecules. A nucleic acid rithms are described in, for example: Smith and Waterman molecule can include either or both naturally occurring and (1981), Adv. Appl. Math. 2:482; Needleman and Wunsch modified nucleotides linked together by naturally occurring (1970), J. Mol. Biol. 48:443; Pearson and Lipman (1988), and/or non-naturally occurring nucleotide linkages. Proc. Natl. Acad. Sci. U.S.A. 85:2444; Higgins and Sharp 0062) Nucleic acid molecules may be modified chemically (1988), Gene 73:237-44; Higgins and Sharp (1989), CABIOS or biochemically, or may contain non-natural or derivatized 5:151-3: Corpet et al. (1988), Nucleic Acids Res. 16:10881 nucleotide bases, as will be readily appreciated by those of 90; Huang et al. (1992), Comp. Appl. Biosci. 8:155-65; Pear skill in the art. Such modifications include, for example, son et al. (1994), Methods Mol. Biol. 24:307-31; Tatiana et al. labels, methylation, substitution of one or more of the natu (1999), FEMS Microbiol. Lett. 174:247-50. A detailed con rally occurring nucleotides with an analog, internucleotide sideration of sequence alignment methods and homology modifications (e.g., uncharged linkages: for example, methyl calculations can be found in, e.g., Altschul et al. (1990), J. phosphonates, phosphotriesters, phosphoramidates, carbam Mol. Biol. 215:403-10. ates, etc.: charged linkages: for example, phosphorothioates, 0068. The National Center for Biotechnology Information phosphorodithioates, etc.; pendent moieties: for example, (NCBI) Basic Local Alignment Search Tool (BLASTTM: peptides; intercalators: for example, acridine, psoralen, etc.; Altschul et al. (1990)) is available from several sources, chelators; alkylators; and modified linkages: for example, including the National Center for Biotechnology Information alpha anomeric nucleic acids, etc.). The term “nucleic acid (Bethesda, Md.), and on the internet, for use in connection molecule' also includes any topological conformation, with several sequence analysis programs. A description of including single-stranded, double-stranded, partially how to determine sequence identity using this program is duplexed, triplexed, hairpinned, circular, and padlocked con available on the internet under the “help' section for formations. BLASTTM. For comparisons of nucleic acid sequences, the 0063 As used herein with respect to DNA, the term "cod “Blast 2 sequences' function of the BLASTTM (Blastn) pro ing sequence.” “structural nucleotide sequence.” or 'struc gram may be employed using the default BLOSUM62 matrix tural nucleic acid molecule' refers to a nucleotide sequence set to default parameters. Nucleic acid sequences with even that is ultimately translated into a polypeptide, via transcrip greater similarity to the reference sequences will show tion and mRNA, when placed under the control of appropriate increasing percentage identity when assessed by this method. regulatory sequences. With respect to RNA, the term “coding 0069 Specifically hybridizable/Specifically complemen sequence” refers to a nucleotide sequence that is translated tary: As used herein, the terms “Specifically hybridizable' into a peptide, polypeptide, or protein. The boundaries of a and 'specifically complementary are terms that indicate a coding sequence are determined by a translation start codon Sufficient degree of complementarity, Such that stable and at the 5'-terminus and a translation stop codon at the 3'-ter specific binding occurs between the nucleic acid molecule minus. Coding sequences include, but are not limited to: and a target nucleic acid molecule. Hybridization between genomic DNA, cDNA; ESTs; and recombinant nucleotide two nucleic acid molecules involves the formation of an anti Sequences. parallel alignment between the nucleic acid sequences of the 0064. In some embodiments, the invention includes nucle two nucleic acid molecules. The two molecules are then able otide sequences that may be isolated, purified, or partially to form hydrogen bonds with corresponding bases on the purified, for example, using separation methods such as, for opposite strand to form a duplex molecule that, if it is suffi example, ion-exchange chromatography; by exclusion based ciently stable, is detectable using methods well known in the on molecular size or by affinity; by fractionation techniques art. A nucleic acid molecule need not be 100% complemen US 2013/0205440 A1 Aug. 8, 2013

tary to its target sequence to be specifically hybridizable. reference nucleic acid sequence. For example, nucleic acid However, the amount of sequence complementarity that must sequences that are substantially homologous to a reference exist for hybridization to be specific is a function of the nucleic acid sequence are those nucleic acid sequences that hybridization conditions used. hybridize under stringent conditions (e.g., the Moderate 0070 Hybridization conditions resulting in particular Stringency conditions set forth, Supra) to the reference degrees of stringency will vary depending upon the nature of nucleic acid sequence. Substantially homologous sequences the hybridization method of choice and the composition and may have at least 80% sequence identity. For example, sub length of the hybridizing nucleic acid sequences. Generally, stantially homologous sequences may have from about 80% the temperature of hybridization and the ionic strength (espe to 100% sequence identity, such as about 81%; about 82%; cially the Na" and/or Mg" concentration) of the hybridiza about 83%; about 84%; about 85%; about 86%; about 87%; tion buffer will determine the stringency of hybridization, about 88%; about 89%; about 90%; about 91%; about 92%; though wash times also influence Stringency. Calculations about 93%; about 94% about 95%; about 96%; about 97%; regarding hybridization conditions required for attaining par about 98%; about 98.5%; about 99%; about 99.5%; and about ticular degrees of stringency are known to those of ordinary 100%. The property of substantial homology is closely skill in the art, and are discussed, for example, in Sambrooket related to specific hybridization. For example, a nucleic acid al. (ed.) Molecular Cloning: A Laboratory Manual, 2" ed., molecule is specifically hybridizable when there is a suffi vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring cient degree of complementarity to avoid non-specific bind Harbor, N.Y., 1989, chapters 9 and 11; and Hames and Hig ing of the nucleic acid to non-target sequences under condi gins (eds.) Nucleic Acid Hybridization, IRL Press, Oxford, tions where specific binding is desired, for example, under 1985. Further detailed instruction and guidance with regard to stringent hybridization conditions. the hybridization of nucleic acids may be found, for example, (0077. As used herein, the term “ortholog” (or “ortholo in Tijssen, “Overview of principles of hybridization and the gous') refers to a gene in two or more species that has evolved strategy of nucleic acid probe assays, in Laboratory Tech from a common ancestral nucleotide sequence, and may niques in Biochemistry and Molecular Biology—Hybridiza retain the same function in the two or more species. tion with Nucleic Acid Probes, Part I, Chapter 2, Elsevier, 0078. As used herein, two nucleic acid sequence mol N.Y., 1993; and Ausubel et al., Eds., Current Protocols in ecules are said to exhibit “complete complementarity' when Molecular Biology, Chapter 2, Greene Publishing and Wiley every nucleotide of a sequence read in the 5' to 3’ direction is Interscience, NY, 1995. complementary to every nucleotide of the other sequence (0071. As used herein, “stringent conditions' encompass when read in the 3' to 5' direction. A nucleotide sequence that conditions under which hybridization will only occur if there is complementary to a reference nucleotide sequence will is less than 20% mismatch between the hybridization mol exhibit a sequence identical to the reverse complement ecule and a homologous sequence within the target nucleic sequence of the reference nucleotide sequence. These terms acid molecule. “Stringent conditions' include further particu and descriptions are well defined in the art and are easily lar levels of stringency. Thus, as used herein, "moderate strin understood by those of ordinary skill in the art. gency' conditions are those under which molecules with 0079. When determining the percentage of sequence iden more than 20% sequence mismatch will not hybridize; con tity between amino acid sequences, it is well-known by those ditions of “high Stringency are those under which sequences of skill in the art that the identity of the amino acid in a given with more than 10% mismatch will not hybridize; and con position provided by an alignment may differ without affect ditions of “very high stringency” are those under which ing desired properties of the polypeptides comprising the sequences with more than 5% mismatch will not hybridize. aligned sequences. In these instances, the percent sequence 0072 The following are representative, non-limiting identity may be adjusted to account for similarity between hybridization conditions. conservatively substituted amino acids. These adjustments 0073 High Stringency condition (detects sequences are well-known and commonly used by those of skill in the that share at least 90% sequence identity): Hybridization art. See, e.g., Myers and Miller (1988), Computer Applica in 5xSSC buffer at 65° C. for 16 hours; wash twice in tions in BioSciences 4:11-7. 2xSSC buffer at room temperature for 15 minutes each; 0080 Embodiments of the invention include functional and wash twice in 0.5xSSC buffer at 65° C. for 20 variants of exemplary plastid transit peptide amino acid minutes each. sequences, and nucleic acid sequences encoding the same. A 0074) Moderate Stringency condition (detects functional variant of an exemplary transit peptide sequence sequences that share at least 80% sequence identity): may be, for example, a fragment of an exemplary transit Hybridization in 5x-6xSSC buffer at 65-70° C. for peptide amino acid sequence (such as an N-terminal or C-ter 16-20 hours; wash twice in 2XSSC buffer at room tem minal fragment), or a modified sequence of a full-length perature for 5-20 minutes each; and wash twice in exemplary transit peptide amino acid sequence or fragment of 1XSSC buffer at 55-70° C. for 30 minutes each. an exemplary transit peptide amino acid sequence. An exem 0075 Non-stringent control condition (sequences that plary transit peptide amino acid sequence may be modified in share at least 50% sequence identity will hybridize): Some embodiments be introducing one or more conservative Hybridization in 6xSSC buffer at room temperature to amino acid Substitutions. A "conservative' amino acid Sub 55° C. for 16-20 hours; wash at least twice in 2x-3XSSC stitution is one in which the amino acid residue is replaced by buffer at room temperature to 55° C. for 20-30 minutes an amino acid residue having a similar functional side chain, each. similar size, and/or similar hydrophobicity. Families of 0076. As used herein, the term “substantially homolo amino acids that may be used to replace anotheramino acid of gous' or 'substantial homology, with regard to a contiguous the same family in order to introduce a conservative Substi nucleic acid sequence, refers to contiguous nucleotide tution are known in the art. For example, these amino acid sequences that hybridize under Stringent conditions to the families include: Basic amino acids (e.g., lysine, arginine, US 2013/0205440 A1 Aug. 8, 2013

and histidine); acidic amino acids (e.g., aspartic acid and roots or leaves. An “inducible' promoter may be a promoter glutamic acid); uncharged (at physiological pH) polar amino which may be under environmental control. Examples of acids (e.g., glycine, asparagines, glutamine, serine, threonine, environmental conditions that may initiate transcription by tyrosine, and cytosine); non-polar amino acids (e.g., alanine, inducible promoters include anaerobic conditions and the Valine, leucine, isoleucine, proline, phenylalanine, methion presence of light. Tissue-specific, tissue-preferred, cell type ine, and tryptophan); beta-branched amino acids (e.g., threo specific, and inducible promoters constitute the class of “non nine, Valine, and isoleucine); and aromatic amino acids (e.g., constitutive' promoters. A "constitutive' promoter is a pro tyrosine, phenylalanine, tryptophan, and histidine). See, e.g., moter which may be active under most environmental condi Sambrooketal. (Eds.), supra; and Innis et al., PCR Protocols: tions. A Guide to Methods and Applications, 1990, Academic Press, I0085. Any inducible promoter can be used in some NY, USA. embodiments of the invention. See Ward et al. (1993), Plant 0081. Operably linked: A first nucleotide sequence is Mol. Biol. 22:361-366. With an inducible promoter, the rate “operably linked with a second nucleotide sequence when of transcription increases in response to an inducing agent. the first nucleotide sequence is in a functional relationship Exemplary inducible promoters include, but are not limited with the second nucleotide sequence. For instance, a pro to: Promoters from the ACEI system that responds to copper; moter is operably linked to a coding sequence if the promoter In2 gene from maize that responds to benzenesulfonamide affects the transcription or expression of the coding sequence. herbicide safeners; Tet repressor from Tn 10; and the induc When recombinantly produced, operably linked nucleotide ible promoter from a steroid hormone gene, the transcrip sequences are generally contiguous and, where necessary to tional activity of which may be induced by a glucocorticos join two protein-coding regions, in the same reading frame. teroid hormone (Schena et al. (1991), Proc. Natl. Acad. Sci. However, nucleotide sequences need not be contiguous to be USA 88:0421). operably linked. I0086 Exemplary constitutive promoters include, but are 0082. The term, “operably linked, when used in reference not limited to: Promoters from plant viruses, such as the 35S to a regulatory sequence and a coding sequence, means that promoter from CaMV; promoters from rice actingenes; ubiq the regulatory sequence affects the expression of the linked uitin promoters; pEMU; MAS; maize H3 histone promoter; coding sequence. "Regulatory sequences.” or “control ele and the ALS promoter, Xbal/NcoI fragment 5' to the Brassica ments.” refer to nucleotide sequences that influence the tim napus ALS3 structural gene (or a nucleotide sequence simi ing and level/amount of transcription, RNA processing or larity to said Xbal/NcoI fragment) (International PCT Pub Stability, or translation of the associated coding sequence. lication No. WO 96/30530). Regulatory sequences may include promoters; translation I0087 Additionally, any tissue-specific or tissue-preferred leader sequences; introns; enhancers; stem-loop structures; promoter may be utilized in some embodiments of the inven repressor binding sequences; termination sequences; poly tion. Plants transformed with a nucleic acid molecule com adenylation recognition sequences; etc. Particular regulatory prising a coding sequence operably linked to a tissue-specific sequences may be located upstream and/or downstream of a promoter may produce the product of the coding sequence coding sequence operably linked thereto. Also, particular exclusively, or preferentially, in a specific tissue. Exemplary regulatory sequences operably linked to a coding sequence tissue-specific or tissue-preferred promoters include, but are may be located on the associated complementary strand of a not limited to: A root-preferred promoter, such as that from double-stranded nucleic acid molecule. the phaseolin gene; a leaf-specific and light-induced pro 0083. When used in reference to two or more amino acid moter Such as that from cab or rubisco; an anther-specific sequences, the term “operably linked' means that the first promoter Such as that from LAT52; a pollen-specific pro amino acid sequence is in a functional relationship with at moter such as that from Zm13; and a microspore-preferred least one of the additional amino acid sequences. For promoter Such as that from apg. instance, a transit peptide (e.g., a CTP) is operably linked to a 0088 Transformation: As used herein, the term “transfor second amino acid sequence within a polypeptide comprising mation' or “transduction” refers to the transfer of one or more both sequences if the transit peptide affects expression or nucleic acid molecule(s) into a cell. A cell is “transformed by trafficking of the polypeptide or second amino acid sequence. a nucleic acid molecule transduced into the cell when the 0084 Promoter: As used herein, the term “promoter' nucleic acid molecule becomes stably replicated by the cell, refers to a region of DNA that may be upstream from the start either by incorporation of the nucleic acid molecule into the of transcription, and that may be involved in recognition and cellular genome, or by episomal replication. As used herein, binding of RNA polymerase and other proteins to initiate the term “transformation' encompasses all techniques by transcription. A promoter may be operably linked to a coding which a nucleic acid molecule can be introduced into Such a sequence for expression in a cell, or a promoter may be cell. Examples include, but are not limited to: transfection operably linked to a nucleotide sequence encoding a signal with viral vectors; transformation with plasmid vectors; elec sequence which may be operably linked to a coding sequence troporation (Fromm et al. (1986), Nature 319:791-3); lipo for expression in a cell. A "plant promoter may be a promoter fection (Felgner et al. (1987), Proc. Natl. Acad. Sci. USA capable of initiating transcription in plant cells. Examples of 84:7413-7); microinjection (Mueller et al. (1978), Cell promoters under developmental control include promoters 15:579-85); Agrobacterium-mediated transfer (Fraley et al. that preferentially initiate transcription in certain tissues, (1983), Proc. Natl. Acad. Sci. USA 80:4803-7); direct DNA Such as leaves, roots, seeds, fibers, xylem vessels, tracheids, uptake; and microprojectile bombardment (Klein et al. or sclerenchyma. Such promoters are referred to as “tissue (1987), Nature 327:70). preferred.” Promoters which initiate transcription only in cer 0089 Transgene: An exogenous nucleic acid sequence. In tain tissues are referred to as “tissue-specific. A “cell type Some examples, a transgene may be a sequence that encodes specific' promoter primarily drives expression in certain cell a polypeptide comprising at least one synthetic Brassica types in one or more organs, for example, Vascular cells in derived CTP. In particular examples, a transgene may encode US 2013/0205440 A1 Aug. 8, 2013 a polypeptide comprising at least one synthetic Brassica sequence encoding a synthetic Brassica-derived CTP oper derived CTP and at least an additional peptide sequence (e.g., ably linked to a nucleotide sequence of interest. In particular a peptide sequence that confers herbicide-resistance), for embodiments, the nucleotide sequence of interest may be a which plastid expression is desirable. In these and other nucleotide sequence that encodes a polypeptide of interest. In examples, a transgene may contain regulatory sequences particular examples, a single nucleic acid molecule is pro operably linked to a coding sequence of the transgene (e.g., a vided that encodes a polypeptide wherein a TraP12, or TraP13 promoter). For the purposes of this disclosure, the term sequence is fused to the N-terminus of a polypeptide of inter “transgenic.” when used to refer to an organism (e.g., a plant), eSt. refers to an organism that comprises the exogenous nucleic (0095. A synthetic Brassica-derived CTP may be derived acid sequence. In some examples, the organism comprising from a Brassica EPSPS gene. In particular examples of such the exogenous nucleic acid sequence may bean organism into embodiments, the Brassica EPSPS gene may comprise the which the nucleic acid sequence was introduced via molecu nucleic acid sequence set forth as SEQID NO:1, a homolo lar transformation techniques. In other examples, the organ gous nucleic acid sequence from a different EPSPS gene, or ism comprising the exogenous nucleic acid sequence may be an ortholog of the Brassica EPSPS gene comprising the an organism into which the nucleic acid sequence was intro nucleic acid sequence set forth as SEQID NO:1. duced by, for example, introgression or cross-pollination in a 0096. In some embodiments, a synthetic Brassica-derived plant. chloroplast transit peptide may be a chimeric Brassica-de 0090 Transport: As used herein, the terms “transport(s). rived CTP. A synthetic chimeric Brassica-derived CTP may “target(s), and “transfer(s)' refers to the property of certain be derived from a reference Brassica CTP sequence by join amino acid sequences of the invention that facilitates the ing a first contiguous amino acid sequence comprised within movement of a polypeptide comprising the amino acid the reference Brassica CTP sequence to a second contiguous sequence from the nucleus of a host cell into a plastid of the amino acid sequence comprised within a different CTP host cell. In particular embodiments, such an amino acid sequence (e.g., a CTP sequence obtained from an Arabidopsis sequence (i.e., a synthetic Brassica-derived CTP sequence) sp.). In particular embodiments, the different CTP sequence may be capable of transporting about 100%, at least about comprising the second contiguous amino acid sequence may 95%, at least about 90%, at least about 85%, at least about be encoded by a homologous gene sequence from a genome 80%, at least about 70%, at least about 60%, and/or at least other than that of the Brassica sp. from which the reference about 50% of a polypeptide comprising the amino acid sequence was obtained (e.g., a different Brassica sp., a plant sequence into plastids of a host cell. other than a Brassica sp.: a lower photosynthetic eukaryote, 0.091 Vector: A nucleic acid molecule as introduced into a for example, a Chlorophyte; and a prokaryote, for example, a cell, for example, to produce a transformed cell. A vector may Cyanobacterium or Agrobacterium). Thus, a nucleotide include nucleic acid sequences that permit it to replicate in the sequence encoding a synthetic Brassica-derived CTP may be host cell. Such as an origin of replication. Examples of vectors derived from a reference Brassica CTP-encoding gene include, but are not limited to: a plasmid, cosmid; bacterioph sequence by fusing a nucleotide sequence that encodes a age; or virus that carries exogenous DNA into a cell. A vector contiguous amino acid sequence of the reference Brassica may also include one or more genes, antisense molecules, CTP sequence with a nucleotide sequence that encodes the and/or selectable marker genes and other genetic elements contiguous amino acid sequence from a different CTP known in the art. A vector may transduce, transform, or infect sequence that is homologous to the remainder of the reference a cell, thereby causing the cell to express the nucleic acid Brassica CTP sequence. In these and other examples, the molecules and/or proteins encoded by the vector. A vector optionally includes materials to aid in achieving entry of the contiguous amino acid sequence of the reference Brassica nucleic acid molecule into the cell (e.g., a liposome, protein CTP sequence may be located at the 5' end or the 3' end of the coating, etc.). synthetic Brassica-derived CTP. 0097. In some embodiments, a synthetic chimeric Bras 0092 Unless specifically indicated or implied, the terms sica-derived CTP may be derived from a plurality of Brassica “a,” “an and “the signify "at least one as used herein. CTP sequences (including a reference Brassica CTP 0093. Unless otherwise specifically explained, all techni sequence) by joining a contiguous amino acid sequence com cal and Scientific terms used herein have the same meaning as prised within one Brassica CTP sequence to a contiguous commonly understood by those of ordinary skill in the art to amino acid sequence comprised within a different Brassica which this disclosure belongs. Definitions of common terms CTP sequence. In particular embodiments, the plurality of in molecular biology can be found in, for example, Lewin B., Brassica CTP sequences may be encoded by orthologous Genes V, Oxford University Press, 1994 (ISBN 0-19-854287 gene sequences in different Brassica species. In some 9); Kendrew et al. (eds.). The Encyclopedia of Molecular examples, the plurality of Brassica CTP sequences may be Biology, Blackwell Science Ltd., 1994 (ISBN 0-632-02182 exactly two Brassica CTP sequences. Thus, a nucleotide 9); and Meyers R. A. (ed.), Molecular Biology and Biotech sequence encoding a synthetic chimeric Brassica-derived nology: A Comprehensive Desk Reference, VCH Publishers, CTP may be derived from two homologous (e.g., substan Inc., 1995 (ISBN 1-56081-569-8). All percentages are by tially homologous) Brassica CTP-encoding gene sequences weight and all solvent mixture proportions are by Volume (e.g., orthologous gene sequences) by fusing the nucleotide unless otherwise noted. All temperatures are in degrees Cel sequence that encodes a contiguous amino acid sequence of S1S. one of the Brassica CTP sequences with the nucleotide sequence that encodes the contiguous amino acid sequence IV. Nucleic Acid Molecules Comprising a Synthetic from the other of the Brassica CTP sequences that is homolo Brassica-Derived CTP-Encoding Sequence gous to the remainder of the first Brassica CTP sequence. 0094. In some embodiments, this disclosure provides a TraP12 and TraP13 are illustrative examples of such a syn nucleic acid molecule comprising at least one nucleotide thetic chimeric Brassica-derived CTP. US 2013/0205440 A1 Aug. 8, 2013

0098. In some embodiments, a synthetic chimeric Bras acid that encodes a synthetic Brassica-derived CTP compris sica-derived CTP may be derived from a reference Brassica ing a contiguous amino acid sequence within one of SEQID CTP sequence by joining a contiguous amino acid sequence NOs:6 and 8, and/or a CTP encoded thereby; a nucleic acid comprised within the reference Brassica CTP sequence to a that encodes a synthetic Brassica-derived CTP comprising a contiguous amino acid sequence comprised within a second contiguous amino acid sequence within one of SEQID NOS:6 CTP sequence obtained from a different organism. In particu and 8 that has one or more conservative amino acid substitu lar embodiments, the second CTP sequence may be encoded tions, and/or a CTP encoded thereby; and a nucleic acid that by an orthologous gene sequence in the different organism. A encodes a synthetic Brassica-derived CTP comprising a con nucleotide sequence encoding a synthetic chimeric Brassica tiguous amino acid sequence within one of SEQ ID NOS:6 derived CTP may be derived from a reference Brassica CTP and 8 that has one or more non-conservative amino acid sequence by fusing a nucleotide sequence that encodes a substitutions that are demonstrated to direct an operably contiguous amino acid sequence of the reference Brassica linked peptide to a plastid in a plastid-containing cell, and/or CTP sequence with a nucleotide sequence that encodes the a CTP encoded thereby. contiguous amino acid sequence from a homologous (e.g., 0102 Thus, some embodiments of the invention include a Substantially homologous) CTP-encoding gene sequence nucleic acid molecule comprising a nucleotide sequence (e.g., an orthologous gene sequence) from the CTP sequence encoding a synthetic chimeric Brassica-derived CTP com from the different organism that is homologous to the remain prising one or more conservative amino acid Substitutions. der of the reference Brassica CTP sequence. TraPs 12 and 13 Such a nucleic acid molecule may be useful, for example, in are illustrative examples of such a synthetic chimeric CTP. facilitating manipulation of a CTP-encoding sequence of the comprising CTP sequences which are derived from Brassica invention in molecular biology techniques. For example, in and Arabidopsis thaliana. Some embodiments, a CTP-encoding sequence of the inven 0099. One of ordinary skill in the art will understand that, tion may be introduced into a suitable vector for Sub-cloning following the selection of a first contiguous amino acid of the sequence into an expression vector, or a CTP-encoding sequence within a reference Brassica CTP sequence, the sequence of the invention may be introduced into a nucleic identification and selection of the contiguous amino acid acid molecule that facilitates the production of a further sequence from the remainder of a homologous CTP sequence nucleic acid molecule comprising the CTP-encoding according to the foregoing derivation process is unambiguous sequence operably linked to a nucleotide sequence of interest. and automatic. In some examples, the first contiguous amino In these and further embodiments, one or more amino acid acid sequence may be between about 25 and about 41 amino positions in the sequence of a synthetic chimeric Brassica acids in length (e.g., 24, 25, 26, 27, 28, 29, 30, 31, 32,33, 34, derived CTP may be deleted. For example, the sequence of a 35, 36, 37, 38, 39, 40, 41, and 42 amino acids in length). In synthetic chimeric Brassica-derived CTP may be modified Some embodiments, the first contiguous amino acid sequence such that the amino acid(s) at 1,2,3,4,5,6,7,8,9, 10, 11, 12. within the reference Brassica CTP sequence is defined by the 13, 14, 15, 16, 17, 18, 19, or 20 positions in the sequence are position at the 3' end of a “SVSL (SEQID NO:9) motif that deleted. An alignment of homologous CTP sequences may be is conserved within some Brassica EPSPS genes. used to provide guidance as to which amino acids may be 0100 Examples of synthetic chimeric Brassica-derived deleted without affecting the function of the synthetic CTP. CTP sequences according to the foregoing process are repre 0103) In particular examples, a synthetic Brassica-derived sented by SEQID NOs: 6 and 8. In view of the degeneracy of chloroplast transit peptide is less than 80 amino acids in the genetic code, the genus of nucleotide sequences encoding length. For example, a synthetic Brassica-derived CTP may these peptides will be immediately envisioned by one of be 79,78, 77,76, 75, 74,73, 72, 71, 70, 69,68, 67,66, 65,64, ordinary skill in the art. These particular examples illustrate 63, 62. 61, 60, or fewer amino acids in length. In certain the structural features of synthetic chimeric Brassica-derived examples, a synthetic Brassica-derived CTP may be about CTPS by incorporating contiguous sequences from a homolo 65, about 68, about 72, or about 74 amino acids in length. In gous CTP from one of several ESPSP orthologs of a B. napus these and further examples, a synthetic Brassica-derived CTP ESPSP gene. may comprise an amino acid sequence set forth in one of SEQ 0101 Some embodiments include functional variants of a ID NOS:6 and 8, or a functional variant of any of the forego synthetic Brassica-derived chloroplast transit peptide, and/or ing. Thus, a synthetic Brassica-derived CTP may comprise an nucleic acids encoding the same. Such functional variants amino acid sequence comprising one of SEQID NOS:6 and 8. include, for example and without limitation: a synthetic Bras or a functional variant thereof, wherein the length of the sica-derived CTP-encoding sequence that is derived from a synthetic Brassica-derived CTP is less than 80 amino acids in homolog and/or ortholog of a Brassica CTP-encoding length. In certain examples, a synthetic Brassica-derived sequences set forth as SEQID NO:1 and/or a CTP encoded CTP may comprise an amino acid sequence that is, e.g., at thereby, a nucleic acid that encodes a synthetic Brassica least 80%, at least 85%, at least 90%, at least 92%, at least derived CTP that comprises a contiguous amino acid 94%, at least 95%, at least 96%, at least 97%, at least 98%, at sequence within SEQ ID NO:2 and/or a CTP encoded least 99%, or 100% identical to one of SEQID NOS:6 and 8. thereby; a truncated synthetic Brassica-derived CTP-encod 0104 All of the nucleotide sequences that encode a par ing sequence that comprises a contiguous nucleic acid ticular synthetic Brassica-derived CTP for example, the sequence within one of SEQID NOS:5, 7, 11, 12, 13, 15, 17, TraP12 peptide of SEQID NO:6, the TraP13 peptide of SEQ and 19; a truncated synthetic Brassica-derived CTP-encod ID NO:8, or functional variants of any of the foregoing ing sequence that comprises a contiguous nucleic acid including any specific deletions and/or conservative amino sequence that is substantially homologous to one of SEQID acid substitutions, will be recognizable by those of skill in the NOs:5, 7, 11, 12, 13, 15, 17, and 19; a truncated synthetic art in view of the present disclosure. The degeneracy of the Brassica-derived CTP that comprises a contiguous amino genetic code provides a finite number of coding sequences for acid sequence within one of SEQID NOS:6 and 8; a nucleic a particularamino acid sequence. The selection of a particular US 2013/0205440 A1 Aug. 8, 2013

sequence to encode a synthetic Brassica-derived CTP is tion, a polypeptide targeted to a plastid by incorporation of a within the discretion of the practitioner. Different coding synthetic Brassica-derived CTP sequence may be a polypep sequences may be desirable in different applications. For tide involved in herbicide resistance, virus resistance, bacte example, to increase expression of the synthetic Brassica rial pathogen resistance, insect resistance, nematode resis derived CTP in a particular host, a coding sequence may be tance, or fungal resistance. See, e.g., U.S. Pat. Nos. 5,569, selected that reflects the codon usage bias of the host. By way 823: 5,304,730; 5,495,071; 6,329,504; and 6,337,431. A of example, a synthetic Brassica-derived CTP may be polypeptide targeted to a plastid by incorporation of a syn encoded by a nucleotide sequence set forth as one of SEQID thetic Brassica-derived CTP sequence may alternatively be, NOs:5, 7, 11, 12, 13, 15, 17, and 19. for example and without limitation, a polypeptide involved in 0105. In nucleic acid molecules provided in some embodi plant vigor or yield (including polypeptides involved in tol ments of the invention, the last codon of a nucleotide erance for extreme temperatures, soil conditions, light levels, sequence encoding a synthetic Brassica-derived CTP and the water levels, and chemical environment), or a polypeptide first codon of a nucleotide sequence of interest may be sepa that may be used as a marker to identify a plant comprising a rated by any number of nucleotide triplets, e.g., without cod trait of interest (e.g., a selectable marker gene product, a ing for an intron or a “STOP’. In some examples, a sequence polypeptide involved in seed color, etc.). encoding the first amino acids of a mature protein normally 0108) Non-limiting examples of polypeptides involved in associated with a chloroplast transit peptide in a natural pre herbicide resistance that may be linked to a synthetic Bras cursor polypeptide may be present between the last codon of sica-derived CTP sequence in some embodiments of the a nucleotide sequence encoding a synthetic Brassica-derived invention include: acetolactase synthase (ALS), mutated CTP and the first codon of a nucleotide sequence of interest. ALS, and precursors of ALS (see, e.g., U.S. Pat. No. 5,013, A sequence separating a nucleotide sequence encoding a 659); EPSPS (see, e.g., U.S. Pat. Nos. 4,971,908 and 6.225, synthetic Brassica-derived CTP and the first codon of a 114), such as a CP4 EPSPS or a class III EPSPS: enzymes that nucleotide sequence of interest may, for example, consist of modify a physiological process that occurs in a plastid, any sequence, such that the amino acid sequence encoded is including photosynthesis, and synthesis of fatty acids, amino not likely to significantly alter the translation of the chimeric acids, oils, arotenoids, terpenoids, starch, etc. Other non polypeptide and its translocation to a plastid. In these and limiting examples of polypeptides that may be linked to a further embodiments, the last codon of a nucleotide sequence synthetic Brassica-derived chloroplast transit peptide in par encoding a synthetic Brassica-derived chloroplast transit ticular embodiments include: Zeaxanthin epoxidase, choline peptide may be fused in phase-register with the first codon of monooxygenase, ferrochelatase, omega-3 fatty acid desatu the nucleotide sequence of interest directly contiguous rase, glutamine synthetase, starch modifying enzymes, thereto, or separated therefrom by no more than a short pep polypeptides involved in synthesis of essential amino acids, tide sequence. Such as that encoded by a synthetic nucleotide provitamin A, hormones, Bt toxin proteins, etc. Nucleotide linker (e.g., a nucleotide linker that may have been used to sequences encoding the aforementioned peptides are known achieve the fusion). in the art, and Such nucleotide sequences may be operably 0106. In some embodiments, it may be desirable to modify linked to a nucleotide sequence encoding a synthetic Bras the nucleotides of a nucleotide sequence of interest and/or a sica-derived CTP to be expressed into a polypeptide compris synthetic Brassica-derived CTP-encoding sequence fused ing the polypeptide of interest linked to the synthetic Bras thereto in a single coding sequence, for example, to enhance sica-derived CTP. Furthermore, additional nucleotide expression of the coding sequence in a particular host. The sequences encoding any of the aforementioned polypeptides genetic code is redundant with 64 possible codons, but most may be identified by those of skill in the art (for example, by organisms preferentially use a Subset of these codons. The cloning of genes with high homology to other genes encoding codons that are utilized most often in a species are called the particular polypeptide). Once such a nucleotide sequence optimal codons, and those not utilized very often are classi has been identified, it is a straightforward process to design a fied as rare or low-usage codons. Zhang et al. (1991), Gene nucleotide sequence comprising a synthetic Brassica-derived 105:61-72. Codons may be substituted to reflect the preferred CTP-encoding sequence operably linked to the identified codon usage of a particular host in a process sometimes nucleotide sequence, or a sequence encoding an equivalent referred to as “codon optimization. Optimized coding polypeptide. sequences containing codons preferred by a particular prokaryotic or eukaryotic host may be prepared, for example, V. Expression of Polypeptides Comprising a to increase the rate of translation or to produce recombinant Synthetic Brassica-Derived Chloroplast Transit RNA transcripts having desirable properties (e.g., a longer Peptide half-life, as compared with transcripts produced from a non 0109. In some embodiments, at least one nucleic acid mol optimized sequence). ecule(s) comprising a nucleotide sequence encoding a 0107 Any polypeptide may be targeted to a plastid of a polypeptide comprising at least one synthetic Brassica-de plastid-containing cell by incorporation of a synthetic Bras rived CTP, or functional equivalent thereof, may be intro sica-derived CTP sequence. For example, a polypeptide may duced into a cell, tissue, or organism for expression of the be linked to a synthetic Brassica-derived CTP sequence in polypeptide therein. In particular embodiments, a nucleic Some embodiments, so as to direct the polypeptide to a plastid acid molecule may comprise a nucleotide sequence of interest in a cell wherein the linked polypeptide-CTP molecule is operably linked to a nucleotide sequence encoding a synthetic expressed. In particular embodiments, a polypeptide targeted Brassica-derived CTP. For example, a nucleic acid molecule to a plastid by incorporation of a synthetic Brassica-derived may comprise a coding sequence encoding a polypeptide CTP sequence may be, for example, a polypeptide that is comprising at least one synthetic Brassica-derived CTP and normally expressed in a plastid of a cell wherein the polypep at least an additional peptide sequence encoded by a nucle tide is natively expressed. For example and without limita otide sequence of interest. In some embodiments, a nucleic US 2013/0205440 A1 Aug. 8, 2013

acid molecule of the invention may be introduced into a molecules of the invention include those that are inducible, plastid-containing host cell, tissue, or organism (e.g., a plant viral, synthetic, or constitutive, all of which are well known in cell, plant tissue, and plant). Such that a polypeptide may be the art. Non-limiting examples of promoters that may be expressed from the nucleic acid molecule in the plastid-con useful in embodiments of the invention are provided by: U.S. taining host cell, tissue, or organism, wherein the expressed Pat. Nos. 6,437,217 (maize RS81 promoter); 5,641,876 (rice polypeptide comprises at least one synthetic Brassica-de actin promoter); 6,426,446 (maize RS324 promoter); 6,429, rived CTP and at least an additional peptide sequence 362 (maize PR-1 promoter); 6.232,526 (maize A3 promoter); encoded by a nucleotide sequence of interest. In certain 6,177,611 (constitutive maize promoters); 5,322,938, 5.352, examples, the synthetic Brassica-derived CTP of such an 605, 5,359,142, and 5,530,196 (35S promoter); 6,433,252 expressed polypeptide may facilitate targeting of a portion of (maize L3 oleosin promoter); 6,429.357 (rice actin 2 pro the polypeptide comprising at least the additional peptide moter, and rice actin 2 intron); 6.294.714 (light-inducible sequence to a plastid of the host cell, tissue, or organism. promoters); 6,140,078 (salt-inducible promoters); 6.252,138 0110. In some embodiments, a nucleic acid molecule of (pathogen-inducible promoters); 6,175,060 (phosphorous the invention may be introduced into a plastid-containing cell deficiency-inducible promoters); 6,388,170 (bidirectional by one of any of the methodologies known to those of skill in promoters); 6,635,806 (gamma-coixin promoter); and U.S. the art. In particular embodiments, a host cell, tissue, or patent application Ser. No. 09/757,089 (maize chloroplast organism may be contacted with a nucleic acid molecule of aldolase promoter). the invention in order to introduce the nucleic acid molecule 0114. Additional exemplary promoters include the nopa into the cell, tissue, or organism. In particular embodiments, line synthase (NOS) promoter (Ebert etal. (1987), Proc. Natl. a cell may be transformed with a nucleic acid molecule of the Acad. Sci. USA 84(16):5745-9); the octopine synthase (OCS) invention Such that the nucleic acid molecule is introduced promoter (which is carried on tumor-inducing plasmids of into the cell, and the nucleic acid molecule is stably integrated Agrobacterium tumefaciens); the caulimovirus promoters into the genome of the cell. In some embodiments, a nucleic such as the cauliflower mosaic virus (CaMV) 19S promoter acid molecule comprising at least one nucleotide sequence (Lawton et al. (1987), Plant Mol. Biol. 9:315-24); the CaMV encoding a synthetic Brassica-derived CTP operably linked 35S promoter (Odell et al. (1985), Nature 313:810-2: the to a nucleotide sequence of interest may be used for transfor figwort mosaic virus 35S-promoter (Walker et al. (1987), mation of a cell, for example, a plastid-containing cell (e.g., a Proc. Natl. Acad. Sci. USA 84(19):6624-8); the sucrose syn plant cell). In order to initiate or enhance expression, a nucleic thase promoter (Yang and Russell (1990), Proc. Natl. Acad. acid molecule may comprise one or more regulatory Sci. USA 87:4144-8); the R gene complex promoter (Chan sequences, which regulatory sequences may be operably dler et al. (1989), Plant Cell 1:1175-83); the chlorophylla/b linked to the nucleotide sequence encoding a polypeptide binding protein gene promoter: CaMV35S (U.S. Pat. Nos. comprising at least one synthetic Brassica-derived CTP. 5,322,938, 5,352,605, 5,359,142, and 5,530,196); FMV35S 0111. A nucleic acid molecule may, for example, be a (U.S. Pat. Nos. 6,051,753, and 5,378,619); a PC1SV pro vector system including, for example, a linear or a closed moter (U.S. Pat. No. 5,850,019); the SCP1 promoter (U.S. circular plasmid. In particular embodiments, the vector may Pat. No. 6,677.503); and AGRtu.nos promoters (GenBank be an expression vector. Nucleic acid sequences of the inven Accession No. V00087: Depicker et al. (1982), J. Mol. Appl. tion may, for example, be inserted into a vector, Such that the Genet. 1:561-73; Bevanet al. (1983), Nature 304:184-7). nucleic acid sequence is operably linked to one or more 0.115. In particular embodiments, nucleic acid molecules regulatory sequences. Many vectors are available for this of the invention may comprise a tissue-specific promoter. A purpose, and selection of the particular vector may depend, tissue-specific promoter is a nucleotide sequence that directs for example, on the size of the nucleic acid to be inserted into a higher level of transcription of an operably linked nucle the vector and the particular host cell to be transformed with otide sequence in the tissue for which the promoter is specific, the vector. A vector typically contains various components, relative to the other tissues of the organism. Examples of the identity of which depend on a function of the vector (e.g., tissue-specific promoters include, without limitation: tape amplification of DNA and expression of DNA), and the par tum-specific promoters; anther-specific promoters; pollen ticular host cell(s) with which the vector is compatible. specific promoters (see, e.g., U.S. Pat. No. 7,141,424, and 0112 Some embodiments may include a plant transfor International PCT Publication No. WO 99/042587); ovule mation vector that comprises a nucleotide sequence compris specific promoters; (see, e.g., U.S. Patent Application No. ing at least one of the above-described regulatory sequences 2001/047525 A1); fruit-specific promoters (see, e.g., U.S. operatively linked to one or more nucleotide sequence(s) Pat. Nos. 4,943,674, and 5,753,475); and seed-specific pro encoding a polypeptide comprising at least one synthetic moters (see, e.g., U.S. Pat. Nos. 5,420,034, and 5,608,152). In Brassica-derived CTP. The one or more nucleotide sequences Some embodiments, a developmental stage-specific promoter may be expressed, under the control of the regulatory (e.g., a promoter active at a later stage in development) may sequence(s), in a plant cell, tissue, or organism to produce a be used in a composition or method of the invention. polypeptide comprising a synthetic Brassica-derived CTP 011.6 Additional regulatory sequences that may in some that targets at least a portion of the polypeptide to a plastid of embodiments be operably linked to a nucleic acid molecule the plant cell, tissue, or organism. include 5' UTRs located between a promoter sequence and a 0113. In some embodiments, a regulatory sequence oper coding sequence that function as a translation leader ably linked to a nucleotide sequence encoding a polypeptide sequence. The translation leader sequence is present in the comprising at least one synthetic Brassica-derived CTP may fully-processed mRNA, and it may affect processing of the be a promoter sequence that functions in a host cell. Such as a primary transcript, and/or RNA stability. Examples of trans bacterial cell wherein the nucleic acid molecule is to be lation leader sequences include maize and petunia heat shock amplified, or a plant cell wherein the nucleic acid molecule is protein leaders (U.S. Pat. No. 5,362,865), plant virus coat to be expressed. Promoters suitable for use in nucleic acid protein leaders, plant rubisco leaders, and others. See, e.g., US 2013/0205440 A1 Aug. 8, 2013

Turner and Foster (1995), Molecular Biotech, 3(3):225-36. 41); a gene which encodes an enzyme for which various Non-limiting examples of 5' UTRs are provided by: GmHsp chromogenic Substrates are known (e.g., PADAC, a chro (U.S. Pat. No. 5,659,122); PhDnaK (U.S. Pat. No. 5,362, mogenic cephalosporin); a luciferase gene (Ow et al. (1986), 865); AtAnt1; TEV (Carrington and Freed (1990), J. Virol. Science 234:856-9); a xylE gene that encodes a catechol 64:1590-7); and AGRtunos (GenBank Accession No. dioxygenase that can convert chromogenic catechols V00087; and Bevan et al. (1983), Nature 304:184-7). (Zukowski et al. (1983), Gene 46(2-3):247-55); an amylase 0117. Additional regulatory sequences that may in some gene (Ikatu et al. (1990), Bio/Technol. 8:241-2); a tyrosinase embodiments be operably linked to a nucleic acid molecule gene which encodes an enzyme capable of oxidizing tyrosine also include 3' non-translated sequences, 3' transcription ter to DOPA and dopaquinone which in turn condenses to mela mination regions, or poly-adenylation regions. These are nin (Katz et al. (1983), J. Gen. Microbiol. 129:2703-14); and genetic elements located downstream of a nucleotide an O-galactosidase. sequence, and include polynucleotides that provide polyade 0120 Suitable methods for transformation of host cells nylation signal, and/or other regulatory signals capable of include any method by which DNA can be introduced into a affecting transcription or mRNA processing. The polyadeny cell, for example and without limitation: by transformation of lation signal functions in plants to cause the addition of poly protoplasts (see, e.g., U.S. Pat. No. 5,508,184); by desicca adenylate nucleotides to the 3' end of the mRNA precursor. tion/inhibition-mediated DNA uptake (see, e.g., Potrykus et The polyadenylation sequence can be derived from a variety al. (1985), Mol. Gen. Genet. 199:183-8); by electroporation of plant genes, or from T-DNA genes. A non-limiting (see, e.g., U.S. Pat. No. 5,384.253); by agitation with silicon example of a 3' transcription termination region is the nopa carbide fibers (see, e.g., U.S. Pat. Nos. 5,302,523 and 5,464, line synthase 3' region (nos 3'; Fraley et al. (1983), Proc. Natl. 765); by Agrobacterium-mediated transformation (see, e.g., Acad. Sci. USA 80:4803-7). An example of the use of different U.S. Pat. Nos. 5,563,055, 5,591,616, 5,693,512, 5,824,877, 3' nontranslated regions is provided in Ingelbrecht et al., 5,981,840, and 6,384.301); and by acceleration of DNA (1989), Plant Cell 1:671-80. Non-limiting examples of poly coated particles (see, e.g., U.S. Pat. Nos. 5,015,580, 5,550, adenylation signals include one from a Pisum sativum RbcS2 318, 5.538,880, 6,160,208, 6,399,861, and 6,403,865); etc. gene (Ps. RbcS2-E9; Coruzzi et al. (1984), EMBO.J. 3:1671 Through the application oftechniques such as these, the cells 9) and AGRtu.nos (GenBank Accession No. E01312). of virtually any species may be stably transformed. In some 0118. A recombinant nucleic acid molecule or vector of embodiments, transforming DNA is integrated into the the present invention may comprise a selectable marker that genome of the host cell. In the case of multicellular species, confers a selectable phenotype on a transformed cell, such as transgenic cells may be regenerated into a transgenic organ a plant cell. Selectable markers may also be used to select for ism. Any of these techniques may be used to produce a trans plants or plant cells that comprise recombinant nucleic acid genic plant, for example, comprising one or more nucleic acid molecule of the invention. The marker may encode biocide sequences of the invention in the genome of the transgenic resistance, antibiotic resistance (e.g., kanamycin, Geneticin plant. (G418), bleomycin, hygromycin, etc.), or herbicide resis I0121 The most widely utilized method for introducing an tance (e.g., glyphosate, etc.). Examples of selectable markers expression vector into plants is based on the natural transfor include, but are not limited to: a neogene which codes for mation system of Agrobacterium. A. tumefaciens and A. kanamycin resistance and can be selected for using kanamy rhizogenes are plant pathogenic soil bacteria which geneti cin, G418, etc.; a bar gene which codes for bialaphos resis cally transform plant cells. The T, and R, plasmids of A. tance; a mutant EPSP synthase gene which encodes glypho tumefaciens and A. rhizogenes, respectively, carry genes sate resistance; a nitrilase gene which confers resistance to responsible for genetic transformation of the plant. The T, bromoxynil; a mutant acetolactate synthase gene (ALS) (tumor-inducing)-plasmids contain a large segment, known which confers imidazolinone or Sulfonylurea resistance; and as T-DNA, which is transferred to transformed plants. a methotrexate resistant DHFR gene. Multiple selectable Another segment of the T, plasmid, the vir region, is respon markers are available that confer resistance to ampicillin, sible for T-DNA transfer. The T-DNA region is bordered by bleomycin, chloramphenicol, gentamycin, hygromycin, terminal repeats. In some modified binary vectors, the tumor kanamycin, lincomycin, methotrexate, phosphinothricin, inducing genes have been deleted, and the functions of the vir puromycin, spectinomycin, rifampicin, Streptomycin and tet region are utilized to transfer foreign DNA bordered by the racycline, and the like. Examples of Such selectable markers T-DNA border sequences. The T-region may also contain, for are illustrated in, e.g., U.S. Pat. Nos. 5,550,318; 5.633,435: example, a selectable marker for efficient recovery of trans 5,780,708 and 6,118,047. genic plants and cells, and a multiple cloning site for inserting 0119. A recombinant nucleic acid molecule or vector of sequences for transfer Such as a synthetic Brassica-derived the present invention may also or alternatively include a CTP-encoding nucleic acid. screenable marker. Screenable markers may be used to moni 0.122 Thus, in some embodiments, a plant transformation tor expression. Exemplary Screenable markers include a vector may be derived from a T, plasmid of A. tumefaciens B-glucuronidase or uidA gene (GUS) which encodes an (see, e.g., U.S. Pat. Nos. 4,536,475, 4,693.977, 4,886,937, enzyme for which various chromogenic Substrates are known and 5,501,967; and European Patent EP 0122 791) or a Ri (Jefferson et al. (1987), Plant Mol. Biol. Rep. 5:387-405); an plasmid of A. rhizogenes. Additional plant transformation R-locus gene, which encodes a product that regulates the vectors include, for example and without limitation, those production of anthocyanin pigments (red color) in plant tis described by Herrera-Estrella et al. (1983), Nature 303:209 sues (Dellaporta et al. (1988), “Molecular cloning of the 13; Bevanet al. (1983), Nature 304:184-7; Klee et al. (1985), maize R-ni allele by transposon tagging with Ac.” In 18" Bio/Technol. 3:637-42; and in European Patent EP 0120516, Stadler Genetics Symposium, P. Gustafson and R. Appels, and those derived from any of the foregoing. Other bacteria eds. (New York: Plenum), pp. 263–82); a B-lactamase gene such as Sinorhizobium, Rhizobium, and Mesorhizobium that (Sutcliffe et al. (1978), Proc. Natl. Acad. Sci. USA 75:3737 interact with plants naturally can be modified to mediate gene US 2013/0205440 A1 Aug. 8, 2013 transfer to a number of diverse plants. These plant-associated tains a single exogenous gene sequence to itself, for example, symbiotic bacteria can be made competent for gene transfer an Fo plant, to produce F seed. One fourth of the F seed by acquisition of both a disarmed T, plasmid and a Suitable produced will be homozygous with respect to the transgene. binary vector. Germinating F seed results in plants that can be tested for 0123. After providing exogenous DNA to recipient cells, heterozygosity, typically using a SNP assay or a thermal transformed cells are generally identified for further culturing amplification assay that allows for the distinction between and plant regeneration. In order to improve the ability to heterozygotes and homozygotes (i.e., a Zygosity assay). identify transformed cells, one may desire to employ a select I0128. In particular embodiments, copies of at least one able or screenable marker gene, as previously set forth, with polypeptide comprising at least one synthetic Brassica-de the vector used to generate the transformant. In the case where rived CTP are produced in a plastid-containing cell, into a selectable marker is used, transformed cells are identified which has been introduced at least one nucleic acid molecule within the potentially transformed cell population by expos (s) comprising a nucleotide sequence encoding the at least ing the cells to a selective agent or agents. In the case where one polypeptide comprising at least one synthetic Brassica a screenable marker is used, cells may be screened for the derived CTP. Each polypeptide comprising at least one syn desired marker gene trait. thetic Brassica-derived CTP may be expressed from multiple 0.124 Cells that survive the exposure to the selective nucleic acid sequences introduced in different transformation agent, or cells that have been scored positive in a screening events, or from a single nucleic acid sequence introduced in a assay, may be cultured in media that Supports regeneration of single transformation event. In some embodiments, a plural plants. In some embodiments, any Suitable plant tissue cul ity of Such polypeptides are expressed under the control of a ture media (e.g., MS and N6 media) may be modified by single promoter. In other embodiments, a plurality of Such including further Substances, such as growth regulators. Tis polypeptides are expressed under the control of multiple pro Sue may be maintained on a basic media with growth regula moters. Single polypeptides may be expressed that comprise tors until Sufficient tissue is available to begin plant regenera multiple peptide sequences, each of which peptide sequences tion efforts, or following repeated rounds of manual selection, is to be targeted to a plastid. until the morphology of the tissue is Suitable for regeneration I0129. In addition to direct transformation of a plant with a (e.g., at least 2 weeks), then transferred to media conducive to recombinant nucleic acid molecule, transgenic plants can be shoot formation. Cultures are transferred periodically until prepared by crossing a first plant having at least one trans sufficient shoot formation has occurred. Once shoots are genic event with a second plant lacking such an event. For formed, they are transferred to media conducive to root for example, a recombinant nucleic acid molecule comprising a mation. Once Sufficient roots are formed, plants can be trans nucleotide sequence encoding a polypeptide comprising at ferred to soil for further growth and maturity. least one synthetic Brassica-derived CTP may be introduced 0.125 To confirm the presence of a nucleic acid molecule into a first plant line that is amenable to transformation, to of interest (for example, a nucleotide sequence encoding a produce a transgenic plant, which transgenic plant may be polypeptide comprising at least one synthetic Brassica-de crossed with a second plant line to introgress the nucleotide rived CTP) in a regenerating plant, a variety of assays may be sequence that encodes the polypeptide into the second plant performed. Such assays include, for example: molecular bio line. logical assays, such as Southern and Northern blotting, PCR, and nucleic acid sequencing; biochemical assays, such as VI. Plant Materials Comprising a Synthetic detecting the presence of a protein product, e.g., by immuno Brassica-Derived Chloroplast Transit logical means (ELISA and/or Western blots) or by enzymatic Peptide-Directed Polypeptide function; plant part assays, such as leaf or root assays; and 0.130. In some embodiments, a plant is provided, wherein analysis of the phenotype of the whole regenerated plant. the plant comprises a plant cell comprising a nucleotide 0126. By way of example, integration events may be ana sequence encoding a polypeptide comprising at least one lyzed by PCR amplification using, e.g., oligonucleotideprim synthetic Brassica-derived CTP. In particular embodiments, ers specific for a nucleotide sequence of interest. PCR geno Such a plant may be produced by transformation of a plant typing is understood to include, but not be limited to, tissue or plant cell, and regeneration of a whole plant. In polymerase-chain reaction (PCR) amplification of genomic further embodiments, such a plant may be obtained from a DNA derived from isolated host plant tissue predicted to commercial source, or through introgression of a nucleic acid contain a nucleic acid molecule of interest integrated into the comprising a nucleotide sequence encoding a polypeptide genome, followed by Standard cloning and sequence analysis comprising at least one synthetic Brassica-derived CTP into of PCR amplification products. Methods of PCR genotyping a germplasm. Plant materials comprising a plant cell com have been well described (see, e.g., Rios, G. et al. (2002), prising a nucleotide sequence encoding a polypeptide com Plant J. 32:243-53), and may be applied to genomic DNA prising at least one synthetic Brassica-derived CTP are also derived from any plant species (e.g., Z. mays or G. max) or provided. Such a plant material may be obtained from a plant tissue type, including cell cultures. comprising the plant cell. In further embodiments, the plant 0127. A transgenic plant formed using Agrobacterium material is a plant cell that is incapable of regeneration to dependent transformation methods typically contains a single produce a plant. recombinant DNA sequence inserted into one chromosome. 0131 A transgenic plant or plant material comprising a The single recombinant DNA sequence is referred to as a nucleotide sequence encoding a polypeptide comprising at “transgenic event' or “integration event. Such transgenic least one synthetic Brassica-derived CTP may in some plants are heterozygous for the inserted DNA sequence. In embodiments exhibit one or more of the following character Some embodiments, a transgenic plant homozygous with istics: expression of the polypeptide in a cell of the plant; respect to a transgene may be obtained by sexually mating expression of a portion of the polypeptide in a plastid of a cell (selfing) an independent segregant transgenic plant that con of the plant; import of the polypeptide from the cytosol of a US 2013/0205440 A1 Aug. 8, 2013 cell of the plant into a plastid of the cell; plastid-specific VII. Synthetic Brassica-Derived Chloroplast Transit expression of the polypeptide in a cell of the plant; and/or Peptide-Mediated Localization of Gene Products to localization of the polypeptide in a cell of the plant. Such a Plastids plant may additionally have one or more desirable traits other 0.135 Some embodiments of the present invention provide than expression of the encoded polypeptide. Such traits may a method for expression and/or localization of a gene product include, for example: resistance to insects, other pests, and to a plastid (e.g., a chloroplast). In particular embodiments, disease-causing agents; tolerances to herbicides; enhanced the gene product may be a marker gene product, for example, stability, yield, or shelf-life; environmental tolerances; phar a fluorescent molecule. Expression of the gene product as part maceutical production; industrial product production; and of a polypeptide also comprising a synthetic Brassica-derived nutritional enhancements. CTP may provide a system to evaluate the plastid-localizing capabilities of a particular synthetic Brassica-derived CTP 0132 A transgenic plant according to the invention may sequence. In some embodiments, expression of a marker gene be any plant capable of being transformed with a nucleic acid product as part of a synthetic Brassica-derived CTP-contain molecule of the invention. Accordingly, the plant may be a ing polypeptide is utilized to target expression of the marker dicot or monocot. Non-limiting examples of dicotyledonous gene product to a plastid of a cell wherein the polypeptide is plants usable in the present methods include Arabidopsis, expressed. In certain embodiments, such a marker gene prod alfalfa, beans, broccoli, cabbage, carrot, cauliflower, celery, uct is localized in plastid(s) of the host cell. For example, the Chinese cabbage, cotton, cucumber, eggplant, lettuce, melon, marker gene product may be expressed at higher levels in the pea, pepper, peanut, potato, pumpkin, radish, rapeseed, spin plastid(s) than in the cytosol or other organelles of the host ach, soybean, Squash, Sugarbeet, Sunflower, tobacco, tomato, cell; the marker gene product may be expressed at much and watermelon. Non-limiting examples of monocotyledon higher levels in the plastid(s); the marker gene product may be ous plants usable in the present methods include corn, Bras expressed essentially only in the plastid(s); or the marker Sica, onion, rice, Sorghum, wheat, rye, millet, Sugarcane, oat, gene product may be expressed entirely in the plastid(s). Such triticale, Switchgrass, and turfgrass. Transgenic plants that expression in the cytosol or non-plastid organelles cannot according to the invention may be used or cultivated in any be detected. a. 0.136. In some embodiments, a polypeptide comprising a functional variant of a synthetic Brassica-derived CTP. 0.133 Some embodiments also provide commodity prod wherein the polypeptide is operably linked to a marker gene ucts containing one or more nucleotide sequences encoding a product is used to evaluate the characteristics of the func polypeptide comprising at least one synthetic Brassica-de tional variant peptide. For example, the sequence of a syn rived CTP, for example, a commodity product produced from thetic Brassica-derived CTP may be varied, e.g., by introduc a recombinant plant or seed containing one or more of Such ing at least one conservative mutation(s) into the synthetic nucleotide sequences. Commodity products containing one Brassica-derived CTP, and the resulting variant peptide may or more nucleotide sequences encoding a polypeptide com be linked to a marker gene product. After expression in a prising at least one synthetic Brassica-derived CTP include, suitable host cell (for example, a cell wherein one or more for example and without limitation: food products, meals, regulatory elements in the expression construct are operable), oils, or crushed or whole grains or seeds of a plant comprising expression of the marker gene product may be determined. one or more nucleotide sequences encoding a polypeptide By comparing the sub-cellular localization of the marker comprising at least one synthetic Brassica-derived CTP. The gene product between the reference synthetic Brassica-de detection of one or more nucleotide sequences encoding a rived CTP-marker construct and the variant peptide-marker polypeptide comprising at least one synthetic Brassica-de construct, it may be determined whether the variant peptide rived CTP in one or more commodity or commodity products provides, for example, greater plastid localization, or Sub is de facto evidence that the commodity or commodity prod stantially identical plastid localization. Such a variant may be uct was at least in part produced from a plant comprising one considered a functional variant. By identifying functional or more nucleotide sequences encoding a polypeptide com variants of synthetic Brassica-derived CTP that provide prising at least one synthetic Brassica-derived CTP. In par greater plastic localization, the mutations in Such variants ticular embodiments, a commodity product of the invention may be incorporated into further variants of synthetic Bras comprise a detectable amount of a nucleic acid sequence sica-derived CTPs. Performing multiple rounds of this evalu encoding a polypeptide comprising at least one synthetic ation process, and Subsequently incorporating identified Brassica-derived CTP. In some embodiments, such commod favorable mutations in a synthetic Brassica-derived CTP ity products may be produced, for example, by obtaining sequence, may yield an iterative process for optimization of a transgenic plants and preparing food or feed from them. synthetic Brassica-derived CTP sequence. Such optimized 0134. In some embodiments, a transgenic plant or seed synthetic Brassica-derived CTP sequences, and nucleotide comprising a transgene comprising a nucleotide sequence sequences encoding the same, are considered part of the encoding a polypeptide comprising at least one synthetic present invention, whether or not such optimized synthetic Brassica-derived CTP also may comprise at least one other Brassica-derived CTP sequences may be further optimized transgenic event in its genome, including without limitation: by additional mutation. a transgenic event from which is transcribed an iRNA mol 0.137 All references, including publications, patents, and ecule; a gene encoding an insecticidal protein (e.g., an Bacil patent applications, cited herein are hereby incorporated by lus thuringiensis insecticidal protein); an herbicide tolerance reference to the extent they are not inconsistent with the gene (e.g., a gene providing tolerance to glyphosate); and a explicit details of this disclosure, and are so incorporated to gene contributing to a desirable phenotype in the transgenic the same extent as if each reference were individually and plant (e.g., increased yield, altered fatty acid metabolism, or specifically indicated to be incorporated by reference and restoration of cytoplasmic male sterility). were set forth in its entirety herein. The references discussed US 2013/0205440 A1 Aug. 8, 2013

herein are provided solely for their disclosure prior to the bidopsis thaliana (NCBI Accession No. NP 182055). Uti filing date of the present application. Nothing herein is to be lizing the chloroplast transit peptide sequence alignment, construed as an admission that the inventors are not entitled to novel chimeric chloroplast transit peptides were designed by antedate such disclosure by virtue of prior invention. combining the first half of the chloroplast transit peptide 0.138. The following Examples are provided to illustrate sequence from the first organism with the second half of the certain particular features and/or aspects. These Examples chloroplast transit peptide sequence from the second organ should not be construed to limit the disclosure to the particu ism in an approximate ratio of 1:1. Exemplary sequences of lar features or aspects described. the newly designed chimeric chloroplast transit peptides are TraP12 (SEQ ID NO:6) and TraP13 (SEQ ID NO:8). These EXAMPLES novel chimeric chloroplast transit peptide sequences are derived from the EPSPS proteins of Brassica napus (NCBI Example 1 Accession No: P17688) and Arabidopsis thaliana (NCBI Accession No: NP 182055). The TraP12 (SEQ ID NO:6) Design and Production of Chimeric Chloroplast chimeric chloroplast transit peptide sequence comprises an Transit Peptide (TraP) Sequences N-terminus which is derived from Brassica napus, and the 0139 Plastids are cytoplasmic organelles found in higher C-terminus of the chloroplast transit peptide is derived from plant species and are present in all plant tissues. Chloroplasts Arabidopsis thaliana. The TraP13 (SEQ ID NO:8) chloro are a specific type of plastid found in green photosynthetic plast transit peptide sequence comprises an N-terminus tissues which are responsible for essential physiological which is derived from Arabidopsis thaliana, and the C-termi functions. For example, one such primary physiological func nus of the chloroplast transit peptide is derived from Brassica tion is the synthesis of aromatic amino acids required by the napus. The chimeric chloroplast transit peptides were tested plant. Nuclear encoded enzymes are required in this biosyn via multiple assays which included a transient in planta thetic pathway and are transported from the cytoplasm to the expression system and transgenically as a stable transforma interior of the chloroplast. These nuclear encoded enzymes tion event comprising a gene expression element fused to an usually possess an N-terminal transit peptide that interacts agronomic important transgene sequence. with the chloroplast membrane to facilitate transport of the Example 2 peptide to the stroma of the chloroplast. Bruce B. (2000) Chloroplast transit peptides: structure, function, and evolu Transient in Planta Testing of Chimeric Chloroplast tion. Trends Cell Bio. 10:440-447. Upon import, stromal pep Transit Peptide (TraP) Sequences tidases cleave the transit peptide, leaving the mature func tional protein imported within the chloroplast. Richter S, Lamppa G K. (1999) Stromal processing peptidase binds Tobacco Transient Assay: transit peptides and initiates their ATP-dependent turnover in 0.141. The Trap12 and TraP13 chimeric chloroplast transit chloroplasts. Journ. Cell Bio. 147:33-43. The chloroplast peptide sequences were initially tested via a transient in transit peptides are variable sequences which are highly planta assay. Polynucleotide sequences which encode the divergent in length, composition and organization. Bruce B. Trap12 (SEQID NO:5) and TraP13 (SEQID NO:7) chimeric (2000) Chloroplast transit peptides: structure, function, and chloroplast transit peptide sequences were synthesized. A evolution. Trends Cell Bio. 10:440-447. The sequence simi linker sequence (SEQID NO:10) was incorporated between larities of chloroplast transit peptides diverge significantly the TraPsequence and theyfp coding sequence. The resulting amongst homologous proteins from different plant species. constructs contained two plant transcription units (PTU). The The amount of divergence between chloroplast transit pep first PTU was comprised of the Arabidopsis thaliana Ubiq tides is unexpected given that the homologous proteins uitin 10 promoter (Atubil0 promoter; Callis, et al., (1990).J. obtained from different plant species typically share rela Biol. Chem., 265: 12486-12493), Trap yellow fluorescent tively high levels of sequence similarity when comparing the protein fusion gene (TraP-YFP; US Patent App. 2007/ processed mature functional protein. 0298.412), and Agrobacterium tumefaciens ORF 23 3' 0140 Novel chimeric chloroplast transit peptide untranslated region (AtuORF23 3'UTR: U.S. Pat. No. 5,428, sequences were designed, produced and tested in planta. The 147). The second PTU was comprised of the Cassava Vein novel chimeric chloroplast transit peptides were shown to Mosaic Virus promoter (CsVMV promoter; Verdaguer et al., possess efficacious translocation and processing properties (1996) Plant Molecular Biology, 31:1129-1139), phosphino for the import of agronomic important proteins within the thricin acetyl transferase (PAT: Wohleben et al., (1988) chloroplast. Initially, native 5-enolpyruvylshikimate-3-phos Gene, 70: 25-37), and Agrobacterium tumefaciens ORF 13' phate synthase (EPSPS) protein sequences from different untranslated region (AtuORF13'UTR; Huanget al., (1990).J. plant species were analyzed via the ChloroPTM computer Bacteriol., 172:1814-1822). Construct plDAB101981 con program to identify putative chloroplast transit peptide tains the TraP12 chimeric chloroplast transit peptide (FIG.3). sequences (Emanuelsson O, Nielsen H. von Heijne G. (1999) Construct pI)AB101989 contains the TraP13 chimeric chlo ChloroP, a neural network-based method for predicting chlo roplast transit peptide (FIG. 4). A control plasmid, 101908, roplast transit peptides and their cleavage sites, Protein Sci which did not contain a chloroplast transit peptide sequence ence 8: 978-984), available at http://www.cbs.dtu.dk/ser upstream of they fp gene was built and included in the studies vices/ChloroP/. After the native chloroplast transit peptides (FIG. 5). The constructs were confirmed via restriction were identified, a first chloroplast transit peptide sequence enzyme digestion and sequencing. Finally, the constructs was aligned with a second chloroplast transit peptide were transformed into Agrobacterium tumefaciens and stored sequences from a second organism. FIG. 2 illustrates the as glycerol stocks. alignment of the EPSPS chloroplast transit peptide sequences 0142. From an Agrobacterium glycerol stock, a loop full of Brassica napus (NCBI Accession No: P17688) and Ara of frozen culture was inoculated into 2 ml of YPD (100 ug/ml US 2013/0205440 A1 Aug. 8, 2013

spectinomycin) in a 14 ml sterile tube. The inoculated media and subjected to bead-milling. About 100-200 mg of leaf was incubated at 28°C. overnight with shaking at 200 rpm. material was mixed with 2 BBs (Daisy; Rogers, Ark.) and 500 The following day about 100 ul of the culture was used to ml of PBST for 3 minutes in a KlecoTM bead mill. The inoculate 25 ml of YPD (100 ug/ml spectinomycin) in a 125 samples were then spun down in a centrifuge at 14,000xg at ml sterile tri-baffled flask, and incubated overnight at 28°C. 4° C. The supernatant was removed and either analyzed overnight with shaking at 200 rpm. The following day the directly via Western blot or immunoprecipitated. The immu cultures were diluted to an ODoo of 0.5 in sterile ddH-0 (pH noprecipitations were performed using the Pierce Direct IP 8.0). The diluted Agrobacterium strain was mixed with a KitTM (Thermo Scientific; Rockford, Ill.) following the manu second Agrobacterium strain containing the P19 helper pro facturer's protocol. Approximately, 50 g of anti-YFP was tein at a ratio of 1:1. The culture were used for tobacco leaf bound to the resin. The samples were incubated with the resin infiltration via the method of Voinnet P. Rivas S. Mestre P, and overnight at 4°C. Next, the samples were washed and eluted Baulcombe D., (2003) An enhanced transient expression sys the following morning and prepped for analysis by combining tem in plants based on Suppression of gene silencing by the equal volumes of 2x8M Urea sample buffer and then boiling p19 protein of tomato bushy stunt virus. The Plant Journal, the samples for 5 minutes. The boiled samples were run on a 33:949-956. Infiltrated tobacco plants were placed in a Con 4-12% SDS-Bis Tris gel in MOPS buffer for 40 minutes. The vironTM set at 16 hr of light at 24°C. for at least three days gel was then blotted using the Invitrogen iBlot TM (Life Tech until being assayed. nologies; Carlsbad, Calif.) following the manufacturer's pro tocol. The blotted membrane was blocked for 10 minutes Microscopy Results: using 5% non-fat dry milk in PBS-Tween solution. The mem brane was probed with the primary antibody (monoclonal 0143 Agrobacterium-infiltrated tobacco leaves were sev anti-GFP in rabbit) used at a 1:1000 dilution in the 5% non-fat ered from the plant, and placed into a petri-dish with water to dry milk in PBS-Tween solution for 1 hour. Next, the mem prevent dehydration. The infiltrated tobacco leaves were brane was rinsed three times for five minutes with PBS observed under blue light excitation with long-pass filter Tween to remove all unbound primary antibody. The mem glasses held in place using a Dark Reader Hand LampTM brane was probed with a secondary monoclonal anti-rabbit in (Clare Chemical Research Co.; Dolores, Colo.) to identify goat antibody (Life Technologies) used at a 1:1000 dilution, undamaged areas of the leaf that were successfully express for 60 minutes. The membrane was washed as previously ing the YFP reporter proteins. Specifically identified leaf described and developed by adding Themo BCIP/NBT sub areas were dissected from the leaf and mounted in water for strate. The colormetric substrate was allowed to develop for imaging by confocal microscopy (Leica TCS-SP5 AOBSTM; 5-10 minutes and then the blots were rinsed with water before Buffalo Grove, Ill.). The YFP reporter protein was excited by being dried. a 514 nm laser line, using a multi-line argon-ion laser. The 0146 The Western blot results indicated that the YFP pro width of the detection slits was adjusted using a non-express tein was expressed in the infiltrated tobacco cells. Both, the ing (dark) control leaf sample to exclude background leaf pDAB101981 and pL)AB101989 infiltrated tobacco plant leaf autofluoresence. Chlorophyll autofluorescence was simulta tissues expressed the YFP proteinas indicated by the presence neously collected in a second channel for direct comparison of a proteinband which reacted to the YFP antibodies and was to the fluorescent reporter protein signal for determination of equivalent in size to the YFP protein band obtained from chloroplastic localization. tobacco plant leaf tissue infiltrated with the YFP control con 0144. The microscopy imaging results indicated that the struct. Moreover, these results indicated that the TraP chi YFP fluorescent protein comprising a TraP12 or TraP13 chlo meric chloroplast transit peptides were processed and cleaved roplast transit peptide accumulated within the chloroplasts from the YFP protein. The TraP12-YFP and TraP13-YFP located in the cytoplasm of the tobacco cells as compared to constructs express a pre-processed protein band that is larger the control YFP fluorescent proteins which did not translocate in molecular weight than the control YFP protein. The pres into the chloroplasts of the cytoplasm of the tobacco cells ence of bands on the Western blot which are equivalent in size (FIG. 6 and FIG. 7). These microscopy imaging results sug to the control YFP indicate that the TraP12 and TraP13 chlo gest that the translocation of the YFP protein into the chloro roplast transit peptide sequences were processed, thereby plast was a result of the TraP12 or TraP13 chloroplast transit reducing the size of the YFP to a molecular weight size which peptide. As shown in FIG. 6 and FIG. 7 the YFP fluorescence is equivalent to the YFP control. signal is localized in the chloroplasts which also fluoresce red due to auto-fluorescence under the microscopy imaging con Maize Protoplast Transient Assay: ditions. Comparatively, FIG. 8 provides a microscopy image of tobacco leaf tissue infiltrated with the control construct 0147 The Trap 12 chimeric chloroplast transit peptide pDAB 101908 that does not contain a chloroplast transit pep encoding polynucleotide sequence (SEQ ID NO:5) and the tide. The chloroplasts in this image only fluoresce red due to linker sequence (SEQIDNO:10) were cloned upstream of the auto-fluorescence under the microscopy imaging conditions, yellow fluorescent protein gene and incorporated into con and are devoid of any YFP fluorescence signal that is exhib struct for testing via the maize protoplast transient in planta ited in the TraP infiltrated tobacco cells. Rather, the YFP assay. The resulting construct contained the following plant fluorescence signal in the control tobacco plant cells is transcription unit (PTU). The first PTU was comprised of the expressed diffusely throughout the cytoplasm of the tobacco Zea mays Ubiquitin 1 promoter (ZmUbi1 promoter: Chris plant cells. tensen, A., Sharrock R., and Quail P. (1992) Maize polyubiq uitingenes: structure, thermal perturbation of expression and Western Blot Results: transcript splicing, and promoter activity following transfer to protoplasts by electroporation, Plant Molecular Biology, 0145 Samples of the infiltrated tobacco plants were 18:675-689), Trap yellow fluorescent protein fusion gene assayed via Western blotting. Leaf punches were collected (TraP12-YFP:US Patent App. 2007/0298.412), and Zea mays US 2013/0205440 A1 Aug. 8, 2013

Peroxidase 53'untranslated region (ZmPer53'UTR: U.S. Pat. naturally contain an alanine at an analogous position within No. 6,384.207). The construct was confirmed via restriction the EPSP synthase enzyme as that of the G96A mutation enzyme digestion and sequencing. which was introduced into the E. coli version of the enzyme 0148. Seed of Zea mays var. B104 were surface sterilized (Padgette et al., (1991); Eschenburg et al., (2002); Priestman by shaking vigorously in 50% Clorox (3% sodium hypochlo et al., (2005); Haghani et al., (2008)). rite), containing 2-3 drops of Tween 20, for about 20 minutes. 0153. One enzyme that was identified to contain a natural The seeds were rinsed thoroughly with sterile distilled water. alanine at this position was DGT-28 (GENBANKACC NO: The sterile seed were plated onto /2 MS medium in ZP 06917240.1) from Streptomyces sviceus ATCC29083. Phytatrays or similar type boxes, and allowed to grow in the Further in silico data mining revealed three other unique dark (28°C.) for 12 to 20 days. A maize protoplast transient Streptomyces enzymes with greater homology to DGT-28; assay was used to obtain and transfect maize protoplasts from DGT-31 (GENBANK ACC NO: YP 004922608.1): DGT leaves of B104-maize. This maize protoplast assay is a modi 32 (GENBANK ACC NO: ZP 04696613); and DGT-33 fication of the system described by Yoo, S.-D., Cho, Y.-H... and (GENBANK ACC NO: NC 010572). Each of these Sheen, J., (2007), Arabidopsis Mesophyll Protoplasts: A Ver enzymes contains a natural alanine at an analogous position sitile Cell System for Transient Gene Expression Analysis, within the EPSP synthase enzyme as that of the G96A muta Nature Protocols, 2:1565-1572. The solutions were prepared tion that was introduced into the E. coli version of the as described by Yoo et. al. (2007), with the exception that the enzyme. FIG. 1. mannitol concentration used for the following experiments 0154) Because EPSP synthase proteins from different organisms are of different lengths, the numbering of the muta was change to 0.6 M. tion for the E. coli version of the EPSP synthase enzyme does 0149 Transfection of 100 to 500 ul of protoplasts (1-5x not necessarily correspond with the numbering of the muta 10) was completed by adding the protoplasts to a 2 ml tion for the EPSP synthase enzymes from the other organ microfuge tube containing about 40 ug of plasmid DNA isms. These identified EPSP synthase enzymes were not pre (pDAB106597), at room temperature. The volume of DNA viously characterized in regard to glyphosate tolerance or was preferably kept to about 10% of the protoplast volume. PEP substrate affinity. Furthermore, these EPSP synthase The protoplasts and DNA were occasionally mixed during a 5 enzymes represent a new class of EPSP synthase enzymes minute incubation period. An equal volume of PEG solution and do not contain any sequence motifs that have been used to was slowly added to the protoplasts and DNA, 2 drops at a characterize previously described Class I (plant derived time with mixing inbetween the addition of the drops of PEG sequences further described in U.S. Pat. No. RE39,247), II solution. The tubes were allowed to incubate for about 10 (bacterially derived sequences further described in U.S. Pat. minutes with occasional gentle mixing. Next, 1 ml of W5+ No. RE39,247), and III (bacterially derived sequences further solution was added and mixed by inverting the tube several described in International Patent Application WO 2006/ times. The tube(s) were centrifuged for 5 minutes at 75xg at 110586) EPSP synthase enzymes. a temperature of 4°C. Finally, the supernatant was removed O155 The novel DGT-14, DGT-28, DGT-31, DGT-32, and and the pellet was resuspended in 1 ml of WI solution and the DGT-33 enzymes were characterized for glyphosate toler protoplasts were placed into a small Petri plate (35x10 mm) ance and PEP substrate affinity by comparison to Class I or into 6-well multiwell plates and incubated overnight in the EPSP synthase enzymes. The following Class I enzymes: dark at room temperature. Fluorescence of YFP was viewed DGT-1 from Glycine max, DGT-3 from Brassica napus by microscopy after 12 hours of incubation. The microscopy (GENBANK ACC NO: P17688), and DGT-7 from Triticum aestivum (GENBANK ACC NO: EU977181) were for com conditions previously described were used for the imaging. parison. The Class I EPSP synthase enzymes and mutant 0150. The microscopy imaging results indicated that the variants thereof were synthesized and evaluated. A mutation YFP fluorescent protein comprising a TraP12 chimeric chlo introduced into the plant EPSP synthase enzymes consisted roplast transit peptide accumulated within the chloroplasts of the Glycine to Alanine mutation made within the EPSP located in the cytoplasm of the tobacco cells as compared to synthase enzyme at a similar location as that of the G96A the control YFP fluorescent proteins which did not translocate mutation from the E. coli version of the enzyme. In addition, into the chloroplasts of the cytoplasm of the tobacco cells Threonine to Isoleucine and Proline to Serine mutations were (FIG. 9). These microscopy imaging results suggest that the introduced within these Class I EPSP synthase enzymes at translocation of the YFP protein into the chloroplast was a analogous positions as that of amino acid 97 (T to I) and result of the TraP 12 chimeric chloroplast transit peptide. amino acid 101 (P to S) in the EPSP synthase of E. coli as Example 3 described in Funke et al., (2009). Chimeric Chloroplast Transit Peptide (TraP) DGT14: Sequences for Expression of Agronomically 0156 Transgenic T Arabidopsis plants containing the Important Transgenes in Arabidopsis TraP12 and TraP13 chimeric chloroplast transit peptides 0151. A single amino acid mutation (G96A) in the fused to the dgt-14 transgene were produced as described in Escherichia coli 5-enolpyruvylshikimate 3-phosphate syn U.S. patent application Ser. No. 1 1/975,658. The transgenic thase enzyme (EPSP synthase) can resultinglyphosate insen plants were sprayed with differing rates of glyphosate. A sitivity (Padgette et al., (1991); Eschenburg et al., (2002); distribution of varying concentrations of glyphosate rates, Priestman et al., (2005); Haghani et al., (2008)). While this including elevated rates, were applied in this study to deter mutation confers tolerance to glyphosate, it is also known to mine the relative levels of resistance (105,420, 1,680 or 3.360 adversely affect binding of EPSP synthase with its natural gae/ha). The typical 1x field usage rate of glyphosate is 1,120 substrate, phosphoenolpyruvate (PEP). The resulting change gae/ha. The TArabidopsis plants that were used in this study in Substrate binding efficiency can render a mutated enzyme were variable in copy number for the dgt-14 transgene. The unsuitable for providing in planta tolerance to glyphosate. low copy dgt-14 Ti Arabidopsis plants were identified using 0152 The NCBIGenbank database was screened in silico molecular confirmation assays, and self-pollinated and used for EPSP synthase protein and polynucleotide sequences that to produce T plants. Table 1 shows the resistance for dgt-14 US 2013/0205440 A1 Aug. 8, 2013

transgenic plants, as compared to control plants comprising a TABLE 1-continued glyphosate herbicide resistance gene, dgt-1 (as described in U.S. patent Ser. No. 12/558,351, incorporated herein by ref dgt-14 transformed TArabidopsis response to a range erence in its entirety), and wildtype controls. of glyphosate rates applied postemergence, compared to a dgt-1 0157. The Arabidopsis T transformants were first (T2) segregating population, and a non-transformed control. selected from the background of untransformed seed using a Visual % injury 2 weeks after application. glufosinate selection scheme. Three flats, or 30,000 seed, % Injury Range were analyzed for each T construct. The selected T plants No. Replicates %. Iniury Analysis were molecularly characterized and the plants were subse quently transplanted to individual pots and sprayed with vari 20- Std Range ous rates of commercial glyphosate as previously described. Application Rate <20% 40% -40% Ave dew (%) The dose response of these plants is presented in terms of% 1680 gae?ha glyphosate 3 1 1 204 14.3 10-45 visual injury 2 weeks after treatment (WAT). Data are pre 3360 gae?ha glyphosate 2 3 O 19.0 4.2 15-25 sented in the tables below which show individual plants TraP13 v2::dgt-14 exhibiting little or no injury (<20%), moderate injury (20 (pDAB105529) 40%), or severe injury (>40%). An arithmetic mean and stan Ogae?ha glyphosate 4 O O O.O O.O O dard deviation is presented for each construct used for Ara 105 gae?ha glyphosate 2 O 2 34.S. 32.4 S-6S bidopsis transformation. The range in individual response is 420 gae?ha glyphosate 2 1 1 21.3 27.2 0-60 also indicated in the last column for each rate and transfor 1680 gae?ha glyphosate 3 O 1 27.0 35.6 S-80 mation. Wildtype, non-transformed Arabidopsis (c.V. Colum 3360 gae?ha glyphosate 3 1 O 32.8 31.S 15-8O bia) served as a glyphosate sensitive control. dgt-1 (pDAB3759) 0158. The level of plant response varied in the TArabi Ogae?ha glyphosate 4 O O O.O O.O O dopsis plants. This variance can be attributed to the fact each 105 gae?ha glyphosate O 3 1 40.O 14.1 30-60 plant represents an independent transformation event and 420 gae?ha glyphosate O 4 O 3O.O O.O 30 thus the copy number of the gene of interest varies from plant 1680 gae?ha glyphosate O 3 1 SSO 3O.O 40-100 to plant. An overall population injury average by rate is pre 3360 gae?ha glyphosate O O 4 57.5 8.7 45-65 sented in Table 1 to demonstrate the tolerance provided by Non-transformed control each of the dgt-14 constructs linked with either the TraP12 V2 Ogae?ha glyphosate 4 O O O.O O.O O or TraP13 V2 chloroplast transit peptide versus the dgt-1 and 105 gae?ha glyphosate O O 4 100.O O.O 100 non-transformed wildtype controls for varying rates of gly 420 gae?ha glyphosate O O 4 100.O O.O 100 phosate. The events contained dgt-14 linked with TraP12 V2 1680 gae?ha glyphosate O O 4 100.O O.O 100 (SEQ ID NO:11) which is contained in construct 3360 gae?ha glyphosate O O 4 100.O O.O 100 pDAB105528 (FIG. 10) and TraP13 v2 (SEQ ID NO:12) which is contained in construct pIDAB105529 (FIG. 11). Data from the glyphosate selection of T plants demonstrated that 0159. Selected T Arabidopsis plants which were identi when dgt-14 was linked with these chloroplast transit pep fied to contain low-copy numbers of transgene insertions (1-3 tides, robust tolerance to high levels of glyphosate was pro copies) were self-fertilized to produce a second generation vided. Comparatively, the non-transformed (or wild-type) for additional assessment of glyphosate tolerance. The sec controls did not provide tolerance to the treatment of high ond generation Arabidopsis plants (T,) which contained 1-3 concentrations of glyphosate when treated with similar rates copies of the dgt-14 transgene fused to the TraP12 and TraP13 of glyphosate. In addition, there were instances when events chimeric chloroplast transit peptides were further character that were shown to contain three or more copies of dgt-14 ized for glyphosate tolerance and glufosinate tolerance (glu were more susceptible to elevated rates of glyphosate. These fosinate resistance indicated that the PAT expression cassette instances are demonstrated within the percent visual injury was intact and did not undergo rearrangements during the range shown in Table 1. It is likely that the presence of high selfing of the T plants). In the T. generation hemizygous and copy numbers of the transgenes within the Arabidopsis plants homozygous plants were available for testing for each event result in transgene silencing or other epigenetic effects which and therefore were included for each rate of glyphosate resulted in sensitivity to glyphosate, despite the presence of tested. Hemizygous plants contain two different alleles at a the dgt-14 transgene. locus as compared to homozygous plants which contain the same two alleles at a locus. The copy number and ploidy TABLE 1. levels of the T plants were confirmed using molecular analy dgt-14 transformed TArabidopsis response to a range sis protocols. Likewise, glyphosate was applied using the of glyphosate rates applied postemergence, compared to a dgt-1 methods and rates as previously described. The dose response (T2) segregating population, and a non-transformed control. of the plants is presented in terms of% visual injury 2 weeks Visual % injury 2 weeks after application. after treatment (WAT). Data are presented as a histogram of % Injury Range individuals exhibiting little or no injury (<20%), moderate No. Replicates 90 Iniury Analysis injury (20-40%), or severe injury (>40%). An arithmetic mean and standard deviation are presented for each construct 20- Std Range used for Arabidopsis transformation. The range in individual Application Rate <20% 40% -40% Ave dew (%) response is also indicated in the last column for each rate and TraP12 v2::dgt-14 transformation. Wildtype, non-transformed Arabidopsis (cv. (pDAB105528) Columbia) served as a glyphosate sensitive control. In addi Ogae?ha glyphosate 5 O O O.O O.O O tion, plants comprising a glyphosate herbicide resistance 105 gae?ha glyphosate 5 O O 6.O 6.5 O-15 gene, dgt-1 (as described in U.S. patent Ser. No. 12/558.351, 420 gae?ha glyphosate 4 1 O 11.0 S.S S-20 incorporated herein by reference in its entirety) were included as a positive control. US 2013/0205440 A1 Aug. 8, 2013 19

0160. In the T. generation both single copy and low-copy cols as previously described. The Events tested in the T (two or three copy) dgt-14 events were characterized for generation contained replicates from each line that were glyphosate tolerance. An overall population injury average by homozygous (as determined by using a glufosinate resistance rate is presented in Table 2 to demonstrate the tolerance screen to identify if any of the advanced plants showed seg provided by each of the dgt-14 constructs linked with a chlo regation of the transgenes). These Events were assayed via roplast transit peptide versus the dgt-1 and non-transformed LC-MS-MS to confirm that the plants expressed the DGT-14 wildtype controls for varying rates of glyphosate. The T protein. The results of the T generation for overall population generation events contained dgt-14 linked with TraP12 V2 injury average by rate of glyphosate is presented in Table 3 (pDAB105528) and TraP13 v2 (pDAB105529). Both of these which shows the tolerance to glyphosate provided by each of events are highly resistant to glyphosate. The results indicated the dgt-14 constructs for varying rates of glyphosate. Exem that the injury range for the T. Arabidopsis plants was less plary resistant T. Events comprised dgt-14 linked with than 20% for all concentrations of glyphosate that were TraP12 v2 (pDAB105528) and TraP13 v2 (pDAB105529). tested. Comparatively, the non-transformed (or wild-type) Both of these Events are highly resistant to glyphosate. The controls did not provide tolerance to the treatment of high results indicated that the injury range for the T. Arabidopsis concentrations of glyphosate when treated with similar rates plants was less than 20% for all concentrations of glyphosate of glyphosate. Overall, the results showed that plants contain that were tested. Comparatively, the non-transformed (or ing and expressing DGT-14 fused to the TraP12 and TraP13 wild-type) controls did not provide tolerance to the treatment chimeric transit peptide proteins yielded commercial level of high concentrations of glyphosate when treated with simi resistance to glyphosate at levels of up to 3 times the field rate lar rates of glyphosate. Overall, the results showed that plants (1120 gae/ha). containing and expressing DGT-14 yielded commercial level resistance to glyphosate at levels of up to 3 times the field rate TABLE 2 (11202 ae/ha). dgt-14 transformed T. Arabidopsis response to a range of glyphosate rates applied postemergence, compared to a digit-1 TABLE 3 (T2) segregating population, and a non-transformed control. dgt-14 transformed T. Arabidopsis response to a range of Visual % injury 2 weeks after application. Data represents glyphosate rates applied postemergence, compared to a digt-1 (T2) a selected single copy line from each construct that segregated segregating population, and a non-transformed control. Visual as a single locus in the heritability Screen. % injury 2 weeks after application. Data represents a selected single %. Injury Range copy population from each construct that segregated as a single locus No. Replicates %. Iniury Analysis in the T heritability Screen. 20- Std Range % Injury Range Application Rate <20% 40% -40% Ave dew (%) No. Replicates 90 Iniury Analysis TraP12 v2::dgt-14 20- Std Range (pDAB105528) Application Rate <20% 40% -40% Ave dew (%) Ogae?ha glyphosate 4 O O O.O O.O O TraP12 v2::dgt-14 420 gae?ha glyphosate 4 O O 1.8 24 O-5 (pDAB105528) 840 gae?ha glyphosate 4 O O 2.5 2.9 O-5 Ogae?ha glyphosate 4 O O O.O O.O O 1680 gae?ha glyphosate 4 O O 2.0 4.0 O-8 3360 gae?ha glyphosate 4 O O 3.8 4.8 O-10 420 gae?ha glyphosate 4 O O O.O O.O O 840 gae?ha glyphosate 4 O O O.O O.O O TraP13 v2::dgt-14 1680 gae?ha glyphosate 4 O O 2.5 SO O-10 (pDAB105529) 3360 gae?ha glyphosate 4 O O 4.8 2.1 2-7 TraP13 v2::dgt-14 Ogae?ha glyphosate 4 O O O O O (pDAB105529) 420 gae?ha glyphosate 4 O O O O O 840 gae?ha glyphosate 4 O O 1.3 2.5 O-5 1680 gae?ha glyphosate 4 O O 1.8 24 O-5 Ogae?ha glyphosate 4 O O O.O O.O O 3360 gae?ha glyphosate 4 O O 3.8 4.8 O-10 420 gae?ha glyphosate 4 O O O.O O.O O 840 gae?ha glyphosate 4 O O O.O O.O O dgt-1 (pDAB3759) 1680 gae?ha glyphosate 4 O O O.O O.O O Ogae?ha glyphosate 4 O O O.O O.O O 3360 gae?ha glyphosate 4 O O 1.8 24 O-5 420 gae?ha glyphosate 2 O 2 40.O 40.4 5-75 dgt-1 (pDAB3759) 840 gae?ha glyphosate O 2 2 47S 31.8 20-75 Ogae?ha glyphosate 4 O O O.O O.O O 1680 gae?ha glyphosate O 2 2 41.3 23.9 20-70 3360 gae?ha glyphosate O 4 O 3S.O. O.O 35 420 gae?ha glyphosate O 2 2 42.5 9.6 30-50 Non-transformed control 840 gae?ha glyphosate O 4 O 40.O O.O 40 1680 gae?ha glyphosate O 3 1 47S 15.O 40-70 Ogae?ha glyphosate 4 O O O.O O.O O 3360 gae?ha glyphosate O O 4 77.S 17.1 60-100 420 gae?ha glyphosate O O 4 100.0 OO 100 Non-transformed control 840 gae?ha glyphosate O O 4 100.0 OO 100 Ogae?ha glyphosate 4 O O O.O O.O O 1680 gae?ha glyphosate O O 4 100.0 OO 100 420 gae?ha glyphosate O O 4 100.0 OO 100 3360 gae?ha glyphosate O O 4 100.0 OO 100 840 gae?ha glyphosate O O 4 100.0 OO 100 1680 gae?ha glyphosate O O 4 100.0 OO 100 0161 Randomly selected T. Arabidopsis plants which 3360 gae?ha glyphosate O O 4 100.0 OO 100 were identified to contain low-copy numbers of transgene insertions (1-3 copies) were self-fertilized to produce a third generation for additional assessment of glyphosate tolerance. DGT28 Arabidopsis seed from the third generation (T) were planted 0162 The newly-designed, dicotyledonous plant opti and evaluated for glyphosate tolerance using the same proto mized dgt-28 v5 polynucleotide sequence is listed in SEQID US 2013/0205440 A1 Aug. 8, 2013 20

NO:18. The newly-designed, monocotyledonous plant opti mid Midi Kit (Qiagen) following the instructions of the Sup mized dgt-28 v6 polynucleotide sequence is listed in SEQID pliers. DNA fragments were isolated using QIAquickTM Gel NO:19; this sequence was slightly modified by including an Extraction Kit (Qiagen) after agarose Tris-acetate gel elec alanine at the second amino acid position to introduce a trophoresis. restriction enzyme site. The resulting DNA sequences have a higher degree of codon diversity, a desirable base composi 0169 Colonies of all assembled plasmids were initially tion, contains strategically placed restriction enzyme recog screened by restriction digestion of miniprep DNA. Plasmid nition sites, and lacks sequences that might interfere with DNA of selected clones was sequenced by a commercial transcription of the gene, or translation of the product mRNA. sequencing vendor (EurofinsTMMWG Operon, Huntsville, 0163 Synthesis of DNA fragments comprising SEQ ID Ala.). Sequence data were assembled and analyzed using the NO:18 and SEQID NO:19 containing additional sequences, SEQUENCHERTM software (Gene Codes Corp., Ann Arbor, Such as 6-frame stops (stop codons located in all six reading Mich.). frames that are added to the 3' end of the coding sequence), 0170 The following binary constructs express the various and a 5' restriction site for cloning were performed by com TraP:dgt-28 fusion gene sequences: p)AB 107527 contains mercial suppliers (DNA2.0, Menlo Park, Calif.). The syn TraP4 V2:dgt-28 v5 (SEQID NO:34); plDAB105530 contains thetic nucleic acid molecule was then cloned into expression TraP5 v2: dgt-28 v5 (SEQ ID NO:35); plDAB105531 con vectors and transformed into plants or bacteria as described in tains TraP8 v2: dgt-28 v5 (SEQ ID NO:36): PDAB105532 the Examples below. contains TraP9 v2: dgt-28 v5 (SEQIDNO:37); plDAB105533 0164. Similar codon optimization strategies were used to contains TraP12 v2: dgt-28 v5 (SEQ ID NO:38); and design dgt-1, dgt-3 v2 (G173A), dgt-3 v3 (G173A, P178S), pDAB105534 contains TraP13 v2:dgt-28 v5 (SEQ ID dgt-3 v4 (T174I; P178S), dgt-7 v4 (T168I; P172S), dgt-32v3, NO:39). The dgt-28 v5 sequence of pDAB105534 was modi dgt-33 v3, and dgt-31 V3. The codon optimized version of fied wherein the first codon (GCA) was changed to (GCT). these genes are listed as SEQIDNO:20, SEQIDNO:21, SEQ 0171 Additional Plant Binary Vector Construction. ID NO:22, SEQID NO:23, SEQID NO:24, SEQID NO:25, SEQ ID NO:26, and SEQID NO:27, respectively. 0172 Cloning strategies similar to those described above (0165 Plant Binary Vector Construction. were used to construct binary plasmids which contain dgt-31, 0166 Standard cloning methods were used in the con dgt-32. dgt-33, dgt-1, dgt-3, and dgt-7. struction of entry vectors containing a chloroplast transit 0173 The microbially derived genes: dgt-31, dgt-32, and peptide polynucleotide sequence joined to dgt-28 as an in dgt-33, were fused with different chloroplast transit peptides frame fusion. The entry vectors containing a transit peptide than previously described. The following chloroplast transit (TraP) fused to dgt-28 were assembled using the IN-FU peptides were used; TraP14 v2 (SEQID NO:40), TraP23 v2 SIONTM Advantage Technology (Clontech, Mountain View, (SEQID NO:41), TraP24 v2 (SEQID NO:42), plDAB107532 Calif.). As a result of the fusion, the first amino acid, methion contains dgt-32 v3 fused to TraP14 v2 (SEQ ID NO:43), ine, was removed from dgt-28. Transit peptides TraP4 V2 pDAB107534 contains dgt-33 v3 fused to TraP24 v2 (SEQID (SEQID NO:28), TraP5 v2 (SEQID NO:29), TraP8 v2 (SEQ NO:44), and the last construct contains dgt-31 V3 fused to ID NO:30), TraP9 v2 (SEQID NO:31), TraP12 v2 (SEQ ID TraP23 v2 (SEQ ID NO:45). The dgt expression cassettes NO:32), and TraP13 v2 (SEQID NO:33) were each synthe were driven by the Arabidopsis thaliana Ubiquitin 10 pro sized by DNA2.0 (Menlo Park, Calif.) and fused to the 5' end moter (Atubil0 promoter V2) and flanked by the Agrobacte fragment of digt-28, up to and including a unique AccI restric rium tumefaciens open reading frame twenty-three 3' untrans tion endonuclease recognition site. lated region (AtuORF23 3' UTR v1). A DSM-2 selectable 0167 Binary plasmids which contained the various TraP marker cassette containing Cassava Vein Mosaic Virus pro and dgt-28 expression cassettes were driven by the Arabidop moter (CsVMV V2)-DSM-2-Agrobacterium tumefaciens sis thaliana Ubiquitin 10 promoter (Atubil0 V2: Callis, et al., open reading frame one 3' untranslated region (AtuORF13' (1990).J. Biol. Chem., 265: 12486-12493) and flanked by the UTR V6) was also present in the binary vector. Agrobacterium tumefaciens open reading frame twenty-three 3' untranslated region (AtuORF23 3' UTR v1; U.S. Pat. No. 0.174. Additional binaries are constructed whereindgt-31 5,428, 147). v3, dgt-32 V3, and dgt-33 v3 are fused to the previously 0168 The assembled TraP and dgt-28 expression cassettes described chloroplast transit peptide sequences. For example, were engineered using GATEWAYR Technology (Invitro the TraP8 v2 sequence is fused to dgt-31 V3, dgt-32 V3, and gen, Carlsbad, Calif.) and transformed into plants via Agro dgt-33 v3, and cloned into binary vectors as described above. bacterium-mediated plant transformation. Restriction endo 0.175 Binary vectors containing the Class I genes (dgt-1, nucleases were obtained from New England BioLabs (NEB; dgt-3, and dgt-7) were constructed. The following binary Ipswich, Mass.) and T4 DNA Ligase (Invitrogen) was used vectors were constructed and transformed into plants: for DNA ligation. Gateway reactions were performed using pDAB4104, which contains the dgt-1 v4 sequence as GATEWAYR LR CLONASER enzyme mix (Invitrogen) for described in U.S. Patent Application Publication No. 2011/ assembling one entry vector into a single destination vector 0.124503, which is flanked by the Nicotiana tabacum Osmo which contained the selectable marker cassette Cassava Vein tin sequences as described in U.S. Patent Application Publi Mosaic Virus promoter (CsVMV V2; Verdaguer et al., (1996) cation No. 2009/0064376; plDAB102715; plDAB102716; Plant Mol. Biol., 31: 1129-1139) DSM-2 (U.S. Pat. App. pDAB102717; and pL)AB102785. The various TraP chloro No. 2007/086813) Agrobacterium tumefaciens open read plast transit peptides that were fused to dgt-28, dgt-31, dgt ing frame one 3' untranslated region (AtuORF1 3' UTR V6; 32, and dgt-33 were not added to the Class I genes, as these Huang et al., (1990).J. Bacteriol. 172:1814-1822). Plasmid plant derived sequences possess native plant chloroplast tran preparations were performed using NUCLEOSPINR Plas sit peptides. These vectors are described in further detail in mid Kit (Macherey-Nagel Inc., Bethlehem, Pa.) or the Plas Table 4. US 2013/0205440 A1 Aug. 8, 2013

TABLE 4 growing) were identified 4-7 days after the final spraying and transplanted individually into 3-inch pots prepared with pot Description of the binary vectors which contain a Class I EPSP ting media (Metro Mix 360). Transplanted plants were cov Synthase gene (i.e. dgt-1, dgt-3, or digit-7). ered with humidity domes for 3-4 days and placed in a 22°C. EPSPS growth chamber as before or moved to directly to the green Name Description mutation house. Domes were Subsequently removed and plants reared pDAB4104 RB7 MAR v2::CsVMV promoter v2/NtOsm TIPS in the greenhouse (22+5°C., 50+30% RH, 14h light:10 dark, 5'UTR v2/dgt-1 v4/NtOsm 3'UTR v2/ minimum 500 uE/ms' natural+supplemental light). Molecu AtuORF243'UTR v2::Atubi10 promoter v4/ lar confirmation analysis was completed on the Surviving T. pat v3/AtuORF13'UTR v3 binary vector plants to confirm that the glyphosate tolerance gene had sta pDAB102715 AtlJbi10 promoter v2/dgt-3 v2/AtuORF23 GA bly integrated into the genome of the plants. 3' UTR v1:CsVMV promoter v2/patv9/ A tuORF13'UTR v6 binary vector 0182 Molecular Confirmation. pDAB102716 A Ubi10 promoter v2/dgt-3 v3/AtuORF23 GAPS 0183 The presence of the dgt-28 and DSM-2 transgenes 3' UTR v1:CsVMV promoter v2/patv9/ within the genome of Arabidopsis plants that were trans A tuORF13'UTR v6 binary vector pDAB102717 AtlJbi10 promoter v2/dgt-3 v4/AtuORF23 TIPS formed with plDAB107527, plDAB105530, pIDAB105531, 3' UTR v1:CsVMV promoter v2/patv9/ pDAB105532, plDAB105533, or pl)AB105534 was con A tuORF13'UTR v6 binary vector firmed. The presence of these polynucleotide sequences was pDAB102785 A Ubi10 promoter v2/dgt-7 v4/AtuORF23 confirmed via hydrolysis probe assays, gene expression cas 3' UTR::Cs VMV promoter v2/DSM-2 v2/ sette PCR (also described as plant transcription unit PCR A tuORF13'UTR v6 binary vector TIPS PTUPCR), Southern blot analysis, and Quantitative Reverse Transcription PCR analyses. 0176 Arabidopsis thaliana Transformation. 0.184 The T Arabidopsis plants were initially screened 0177 Arabidopsis was transformed using the floral dip via a hydrolysis probe assay, analogous to TAOMANTM, to method from Clough and Bent (1998). A selected Agrobac confirm the presence of the DSM-2 and dgt-28 transgenes. terium colony containing one of the binary plasmids Events were screened via gene expression cassette PCR to described above was used to inoculate one or more 100 mL determine whether the digt expression cassette completely pre-cultures of YEP broth containing spectinomycin (100 integrated into the plant genomes without rearrangement. The mg/L) and kanamycin (50 mg/L). The culture was incubated data generated from these studies were used to determine the overnight at 28°C. with constant agitation at 225 rpm. The transgene copy number and identify select Arabidopsis cells were pelleted at approximately 5000xg for 10 minutes at events for self fertilization and advancement to the Tigen room temperature, and the resulting Supernatant discarded. eration. The advanced T. Arabidopsis plants were also The cell pellet was gently resuspended in 400 mL dunking screened via hydrolysis probe assays to confirm the presence media containing: 5% (w/v) Sucrose, 10 ug/L 6-benzylami and to estimate the copy number of the DSM-2 and dgt genes nopurine, and 0.04% SilwetTML-77. Plants approximately 1 within the plant chromosome. Finally, a Southern blot assay month old were dipped into the media for 5-10 minutes with was used to confirm the estimated copy number on a Subset of gentle agitation. The plants were laid down on their sides and the TArabidopsis plants. covered with transparent or opaque plastic bags for 2-3 hours, 0185. Similar assays were used to confirm the presence of and then placed upright. The plants were grown at 22°C., the dgt-1 transgene from plants transformed with pl)AB4101, with a 16-hour light/8-hour dark photoperiod. Approximately the presence of the dgt-32 transgene from plants transformed 4 weeks after dipping, the seeds were harvested. with pl)AB107532, the presence of the dgt-33 transgene from 0.178 Selection of Transformed Plants. plants transformed with pl)AB107534, the presence of the 0179 Freshly harvested T seed containing the dgt and dgt-3 transgene from plants transformed with pl)AB102715, DSM-2 expression cassettes was allowed to dry for 7 days at the presence of the dgt-3 transgene from plants transformed room temperature. T seed was sown in 26.5x51-cm germi with pl)AB102716, the presence of the dgt-3 transgene from nation trays, each receiving a 200 mg aliquot of stratified T plants transformed with pl)AB102717, and the presence of seed (~10,000 seed) that had previously been suspended in 40 the dgt-7 transgene from plants transformed with mL of 0.1% agarose solution and stored at 4°C. for 2 days to pDAB102785. complete dormancy requirements and ensure Synchronous 0186. Hydrolysis Probe Assay. seed germination. 0187 Copy number was determined in the T and T. Ara 0180 Sunshine Mix LP5 was covered with fine vermicu bidopsis plants using the hydrolysis probe assay described lite and subirrigated with Hoagland's solution until wet, then below. Plants with varying numbers of transgenes were iden allowed to gravity drain. Each 40 mLaliquot of stratified seed tified and advanced for Subsequent glyphosate tolerance stud was sown evenly onto the vermiculite with a pipette and ies covered with humidity domes for 4-5 days. Domes were 0188 Tissue samples were collected in 96-well plates and removed 1 day prior to initial transformant selection using lyophilized for 2 days. Tissue maceration was performed with glufosinate postemergence spray (selecting for the co-trans a KLECOTM tissue pulverizer and tungsten beads (Environ formed DSM-2 gene). Metal INC., Sweet Home, Oreg.). Following tissue macera 0181. Seven days after planting (DAP) and again 11 DAP. tion, the genomic DNA was isolated in high-throughput for T plants (cotyledon and 2-4-1f stage, respectively) were mat using the BiosprintTM 96 Plant kit (QiagenTM, German sprayed with a 0.2% solution of Liberty herbicide (200 gai/L town, Md.) according to the manufacturer's Suggested glufosinate, Bayer CropSciences, Kansas City, Mo.) at a protocol. Genomic DNA was quantified by QUANT-ITTM spray volume of 10 mL/tray (703 L/ha) using a DeVilbiss PICO GREEN DNA ASSAY KIT (Molecular Probes, Invit compressed air spray tip to deliver an effective rate of 280 g rogen, Carlsbad, Calif.). Quantified genomic DNA was ai/ha glufosinate per application. Survivors (plants actively adjusted to around 2 ng/uL for the hydrolysis probe assay US 2013/0205440 A1 Aug. 8, 2013 22 using a BIOROBOT3000TM automated liquid handler was performed with a KLECKOTM tissue pulverizer and (Qiagen, Germantown, Md.). Transgene copy number deter tungsten beads. Following tissue maceration, the genomic mination by hydrolysis probe assay was performed by real DNA was isolated using a CTAB isolation procedure. The time PCR using the LIGHTCYCLER(R480 system (Roche genomic DNA was further purified using the QiagenTM Applied Science, Indianapolis, Ind.). Assays were designed Genomic Tips kit. Genomic DNA was quantified by Quant for DSM-2, dgt-28 and the internal reference gene, TAFIII5 ITTM Pico Green DNA assay kit (Molecular Probes, Invitro (Genbank ID: NC 003075; Duarte et al., (201) BMC Evol. gen, Carlsbad, Calif.). Quantified genomic DNA was Biol., 10:61).\ adjusted to 4 Jug for a consistent concentration. (0189 For amplification, LIGHTCYCLERR480 Probes 0193 For each sample, 4 ug of genomic DNA was thor Master mix (Roche Applied Science, Indianapolis, Ind.) was oughly digested with the restriction enzyme Swal (New prepared at a 1x final concentration in a 10 uL Volume mul England Biolabs, Beverley, Mass.) and incubated at 25°C. tiplex reaction containing 0.1 uM of each primer for DSM-2 overnight, then NsiI was added to the reaction and incubated and dgt-28, 0.4 uM of each primer for TAFIII5 and 0.2 uM of at 37°C. for 6 hours. The digested DNA was concentrated by each probe. Table 5. A two-step amplification reaction was precipitation with Quick Precipitation SolutionTM (Edge Bio performed with an extension at 60° C. for 40 seconds with systems, Gaithersburg, Md.) according to the manufacturers fluorescence acquisition. All samples were run and the aver Suggested protocol. The genomic DNA was then resuspended aged Cycle threshold (Ct) values were used for analysis of in 25 uL of water at 65° C. for 1 hour. Resuspended samples each sample. Analysis of real time PCR data was performed were loaded onto a 0.8% agarose gel prepared in 1xTAE and using LightCyclerTM software release 1.5 using the relative electrophoresed overnight at 1.1 V/cm in 1xTAE buffer. The quant module and is based on the AACt method. For this, a gel was sequentially subjected to denaturation (0.2 MNaOH/ sample of genomic DNA from a single copy calibrator and 0.6 M NaCl) for 30 minutes, and neutralization (0.5 M Tris known 2 copy check were included in each run. The copy HCl (pH 7.5)/1.5 M NaCl) for 30 minutes. number results of the hydrolysis probe screen were deter 0194 Transfer of DNA fragments to nylon membranes mined for the T and T transgenic Arabidopsis plants. was performed by passively wicking 20xSSC solution over TABL E 5 Primer and probe Information for hydrolysis probe assay of DSM-2, dest - 28 and internal reference gene (TAFII15) - Primer Name Sequence DSM2A (SEQ ID NO: 46) 5' AGCCACATCCCAGTAACGA 3

DSM2S (SEO ID NO: 47) s' CCTCCCTCTTTGACGCC 3

DSM2 Cy5 probe (SEQ ID NO : 48 5. CAGCCCAATGAGGCATCAGC 3'

DGT28F (SEO ID NO : 49) s' CTTCAAGGAGATTTGGGATTTGT 3. ' DGT28R (SEO ID NO : 50) 5 GAGGGTCGGCATCGTAT 3 UPL154 probe Catt O46944O6OO1 (Roche, Indianapolis, IN) TAFFY-HEX probe (SEQ ID NO. 51) 5' AGAGAAGTTTCGACGGATTTCGGGC 3' TAFII15-F (SEO ID NO : 52) 5 GAGGATTAGGGTTTCAACGGAG 3."

TAFII15-R (SEO ID NO. 53) 5 GAGAATTGAGCTGAGACGAGG 3."

0.190 dgt-28 Integration Confirmation via Southern Blot night through the gel onto treated IMMOBILONTM NY+ Analysis. transfer membrane (Millipore, Billerica, Mass.) by using a 0191 Southern blot analysis was used to establish the chromatography paper wick and paper towels. Following integration pattern of the inserted T-strand DNA fragment and transfer, the membrane was briefly washed with 2xSSC, identify events which contained dgt-28. Data were generated cross-linked with the STRATALINKERTM 1800 (Stratagene, to demonstrate the integration and integrity of the transgene LaJolla, Calif.), and vacuum baked at 80° C. for 3 hours. inserts within the Arabidopsis genome. Southern blot data were used to identify simple integration of an intact copy of 0.195 Blots were incubated with pre-hybridization solu the T-strand DNA. Detailed Southern blot analysis was con tion (Perfect Hyb plus, Sigma, St. Louis, Mo.) for 1 hour at ducted using a PCR amplified probe specific to the dgt-28 65°C. in glass roller bottles using a model 400 hybridization gene expression cassette. The hybridization of the probe with incubator (Robbins Scientific, Sunnyvale, Calif.). Probes genomic DNA that had been digested with specific restriction were prepared from a PCR fragment containing the entire enzymes identified genomic DNA fragments of specific coding sequence. The PCR amplicon was purified using molecular weights, the patterns of which were used to iden QIAEXTM II gel extraction kit and labeled with O'P-dCTP tify full length, simple insertion T transgenic events for via the Random RT Prime ITTM labeling kit (Stratagene, La advancement to the next generation. Jolla, Calif.). Blots were hybridized overnight at 65°C. with 0.192 Tissue samples were collected in 2 mL conical tubes denatured probe added directly to hybridization buffer to (EppendorftM) and lyophilized for 2 days. Tissue maceration approximately 2 million counts per blot per mL. Following US 2013/0205440 A1 Aug. 8, 2013 hybridization, blots were sequentially washed at 65°C. with Design Software 2.0. For amplification, LIGHTCY 0.1xSSC/0.1% SDS for 40 minutes. Finally, the blots were CLER(R)480 Probes Master mix (Roche Applied Science, exposed to storage phosphor imaging screens and imaged Indianapolis, Ind.) was prepared at 1x final concentration in a using a Molecular Dynamics Storm 860TM imaging system. 10 uL Volume singleplex reaction containing 0.4LM of each 0196. The Southern blot analyses completed in this study primer, and 0.2 LM of each probe. Table 7. were used to determine the copy number and confirm that selected events contained the dgt-28 transgene within the TABLE 7 genome of Arabidopsis. 0.197 dgt-28 Gene Expression Cassette Confirmation Via PCR primers used for quantitative reverse PCR Analysis. transcription PCR analysis of digt – 28. 0198 The presence of the dgt-28 gene expression cassette Primer Name Sequence contained in the T plant events was detected by an endpoint PCR reaction. Primers (Table 6) specific to the Atl Jbi10 pro AT2641. OLP 5' CGTCCACAAAGCTGAATGTG 3." moter V2 and AtuORF233'UTR V1 regions of the dgt-28 gene (SEO ID NO. 56) expression cassette were used for detection. AT2641 ORP 5' CGAAGTCATGGAAGCCACTT 3 (SEO ID NO : 57)

TABLE 6 UPL146 Cat. O4694,325 OO1 Oligonucleotide primers used for digt – 28 gene (Roche, Indianapolis, IN) expression cassette confirmation. DGT28F s' CTTCAAGGAGATTTGGGATTTGT 3" Primer Name Sequence (SEO ID NO. 58) Forward oligo 5' CTGCAGGTCAACGGATCAGGATAT 3 DGT28R 5 GAGGGTCGGCATCGTAT 3 (SEQ ID NO: 54) (SEO ID NO. 59)

Reverse oligo 5 TGGGCTGAATTGAAGACATGCTCC 3' UPL154 probe Cat. O46944O6OO1 (SEO ID NO : 55) (Roche, Indianapolis, IN)

0199 The PCR reactions required a standard three step 0202) A two-step amplification reaction was performed PCR cycling protocol to amplify the gene expression cassette. with an extension at 60° C. for 40 seconds with fluorescence All of the PCR reactions were completed using the following acquisition. All samples were run in triplicate and the aver PCR conditions: 94° C. for three minutes followed by 35 aged Cycle threshold (Ct) values were used for analysis of cycles of 94°C. for thirty seconds, 60°C. for thirty seconds, each sample. A minus reverse transcription reaction was run and 72°C. for three minutes. The reactions were completed using the EX-TAQTM PCR kit (TaKaRa Biotechnology Inc. for each sample to ensure that no g|DNA contamination was Otsu, Shiga, Japan) per manufacturers instructions. Follow present. Analysis of real time PCR data was performed based ing the final cycle, the reaction was incubated at 72°C. for 10 on the AACt method. This assay was used to determine the minutes. TAE agarose gel electrophoresis was used to deter relative expression ofdgt-28 in transgenic Arabidopsis events mine the PCR amplicon size. PCR amplicons of an expected which were determined to be hemizygous and homozygous. size indicated the presence of a full length gene expression The relative transcription levels of the dgt-28 mRNA ranged cassette was present in the genome of the transgenic Arabi from 2.5 fold to 207.5 fold higher than the internal control. dopsis events. These data indicate that dgt-28 transgenic plants contained a 0200 dgt-28 Relative Transcription Confirmation Via functional dgt-28 gene expression cassette, and the plants Quantitative Reverse Transcription PCR Analysis. were capable of transcribing the dgt-28 transgene. 0201 Tissue samples of dgt-28 transgenic plants were 0203 Western Blotting Analysis. collected in 96-well plates and frozen at 80°C. Tissue mac eration was performed with a KLECOTM tissue pulverizer and 0204 DGT-28 was detected in leaf samples obtained from tungsten beads (Environ Metal INC., Sweet Home, Oreg.). transgenic Arabidopsis thaliana plants. Plant extracts from Following tissue maceration, the Total RNA was isolated in dgt-28 transgenic plants and DGT-28 protein standards were high-throughput format using the QiagenTM Rineasy 96 kit incubated with NUPAGE(R) LDS sample buffer (Invitrogen, (QiagenTM, Germantown, Md.) according to the manufactur Carlsbad, Calif.) containing DTT at 90° C. for 10 minutes and er's Suggested protocol which included the optional Dnase electrophoretically separated in an acrylamide precast gel. treatment on the column. This step was Subsequently fol Proteins were then electro-transferred onto nitrocellulose lowed by an additional Dnase (AmbionTM, Austin, Tex.) membrane using the manufacturer's protocol. After blocking treatment of the eluted total RNA. cDNA synthesis was car with the WESTERNBREEZE(R) Blocking Mix (Invitrogen) ried out using the total RNA as template with the High Capac the DGT-28 protein was detected by anti-DGT-28 antiserum ity cDNA Reverse TranscriptionTM kit (Applied Biosystems, followed by goat anti-rabbit phosphatase. The detected pro Austin, Tex.) following the manufacturers suggested proce tein was visualized by chemiluminescence substrate BCIP/ dure with the addition of the oligonucleotide, TVN. Quanti fication of expression was completed by hydrolysis probe NBT Western Analysis Reagent (KPL, Gaithersburg, Md.). assay and was performed by real-time PCR using the LIGHT Production of an intact DGT-28 protein via Western blot CYCLER(R)480 system (Roche Applied Science, Indianapo indicated that the dgt-28 transgenic plants which were lis, Ind.). Assays were designed for dgt-28 and the internal assayed expressed the DGT-28 protein. reference gene “unknown protein’ (Genbank Accession 0205 Transgenic T Arabidopsis plants containing the Number: AT4G24610) using the LIGHTCYCLER(R) Probe dgt-28 transgene were sprayed with differing rates of glypho US 2013/0205440 A1 Aug. 8, 2013 24 sate. Elevated rates were applied in this study to determine the TABLE 8 relative levels of resistance (105,420, 1,680 or 3.360 gae/ha). dgt-28 transformed TArabidopsis response to a range of A typical 1.x field usage rate of glyphosate is 1120 gae/ha. glyphosate rates applied postemergence, compared to a dgt-1 The T Arabidopsis plants that were used in this study were (Tl) homozygous resistant population, and a non-transformed variable copy number for the dgt-28 transgene. The low copy control. Visual % injury 14 days after application. dgt-28 TArabidopsis plants were self-pollinated and used to produce T plants. Table 8 shows the comparison of dgt-28 90 Iniury 90 Iniury transgenic plants, drawn to a glyphosate herbicide resistance 20- Std Range gene, dgt-1, and wildtype controls. Table 9 shows the com Averages <20% 40% -40% Ave dew (%) parison of digt-32, and dgt-33 drawn to aglyphosate herbicide pDAB107527: TraP4 v2 -- resistance gene, dgt-1, and wildtype controls. Table 10 shows dgt-28 v5 the comparison of the novel bacterial EPSP synthase enzymes Ogae?ha glyphosate 4 O O O.O O.O O to the Class I EPSP synthase enzymes and the controls at a 105 gae?ha glyphosate 4 O O 3.8 7.5 O-15 glyphosate rate of 1,680 gae/ha. 420 gae?ha glyphosate 2 1 1 28.8 28.1 O-65 1680 gae?ha glyphosate O 2 2 SS.O 26.8 35-85 0206 Results of Glyphosate Selection of Transformed 3360 gae?ha glyphosate O 2 2 43.8 18.0 30-70 dgt-28 Arabidopsis Plants. pDAB105530: TraP5 v2 dgt-28 v5 0207. The Arabidopsis T transformants were first Ogae?ha glyphosate 6 O O O.O O.O O selected from the background of untransformed seed using a 105 gae?ha glyphosate 2 2 2 39.3 37.4 8-100 glufosinate selection scheme. Three flats or 30,000 seed were 420 gae?ha glyphosate 1 4 1 330 26.6 8-85 1680 gae?ha glyphosate O 4 2 47.5 27.5 25-85 analyzed for each T construct. The T plants selected above 3360 gae?ha glyphosate O O 6 76.7 13.7 50-85 were molecularly characterized and the high copy number pDAB105531: TraP8 v2 -- plants were Subsequently transplanted to individual pots and dgt-28 v5 sprayed with various rates of commercial glyphosate as pre Ogae?ha glyphosate 4 O O O.O O.O O viously described. The response of these plants is presented in 105 gae?ha glyphosate 3 1 O 10.8 10.4 O-25 420 gae?ha glyphosate 3 O 1 228. 18.6 8-SO terms of% visual injury 2 weeks after treatment (WAT). Data 1680 gae?ha glyphosate 4 O O 5.3 3.8 O-8 are presented in a table which shows individual plants exhib 3360 gae?ha glyphosate O 4 O 29.3 6.8 22-3S pDAB105532: TraP9 v2 -- iting little or no injury (<20%), moderate injury (20–40%), or dgt-28 v5 severe injury (>40%). An arithmetic mean and standard Ogae?ha glyphosate 4 O O O.O O.O O deviation is presented for each construct used for Arabidopsis 105 gae?ha glyphosate 3 O 1 17.5 28.7 0-60 transformation. The range in individual response is also indi 420 gae?ha glyphosate 1 1 2 39S 25.1 18-70 cated in the last column for each rate and transformation. 1680 gae?ha glyphosate 3 O 1 26.3 36.1 S-80 3360 gae?ha glyphosate 3 O 1 25.8 32.9 8-75 Wild-type, non-transformed Arabidopsis (c.V. Columbia) pDAB105533: TraP12 v2 -- served as a glyphosate sensitive control. dgt-28 v5 0208. The level of plant response varied. This variance can Ogae?ha glyphosate 5 O O O.O O.O O be attributed to the fact each plant represents an independent 105 gae?ha glyphosate 4 1 O 1OO 10.0 O-25 420 gae?ha glyphosate 1 1 3 53.6 34.6 8-85 transformation event and thus the copy number of the gene of 1680 gae?ha glyphosate 4 1 O 11.0 8.2 O-2O interest varies from plant to plant. It was noted that some 3360 gae?ha glyphosate O 2 3 55.0 25.5 25-8O plants which contained the transgene were not tolerant to pDAB105534: TraP13 v2 -- glyphosate; a thorough analysis to determine whether these dgt-28 v5 plants expressed the transgene was not completed. It is likely Ogae?ha glyphosate 5 O O O.O O.O O that the presence of high copy numbers of the transgene 105 gae?ha glyphosate 4 O 1 14.O 20.6 O-50 within the TArabidopsis plants resulted in transgene silenc 420 gae?ha glyphosate 3 1 1 17.6 19.5 O-SO ing or other epigenetic effects which resulted in sensitivity to 1680 gae?ha glyphosate 3 O 2 39.0 47.1 S-100 glyphosate, despite the presence of the dgt-28 transgene. 3360 gae?ha glyphosate 2 2 1 31.2 22.3 18-70 pDAB4104: dgt-1 0209. An overall population injury average by rate is pre (transformed control) sented in Table 10 for rates of glyphosate at 1,680 gae/ha to Ogae?ha glyphosate 5 O O O.O O.O O demonstrate the significant difference between the plants 105 gae?ha glyphosate O O 4 8O.O. O.O 8O transformed with dgt-3, dgt-7, dgt-28, dgt-32, and dgt-33 420 gae?ha glyphosate O O 4 8O.O. O.O 8O Versus the dgt-1 and wild-type controls. 1680 gae?ha glyphosate O O 4 8O.O. O.O 8O 3360 gae?ha glyphosate O O 4 813 2.5 80-85 0210. The tolerance provided by the novel bacterial EPSP WT (non-transformed synthases varied depending upon the specific enzyme. DGT control) 28, DGT-32, and DGT-33 unexpectedly provided significant tolerance to glyphosate. The digt genes imparted herbicide Ogae?ha glyphosate 5 O O O.O O.O O 105 gae?ha glyphosate O O 4 100.0 OO 100 resistance to individual TArabidopsis plants across all tran 420 gae?ha glyphosate O O 4 100.0 OO 100 sit peptides tested. As such, the use of additional chloroplast 1680 gae?ha glyphosate O O 4 100.0 OO 100 transit peptides (i.e., TraP8-dgt-32 or TraP8-dgt-33) would 3360 gae?ha glyphosate O O 4 100.0 OO 100 provide protection to glyphosate with similar injury levels as reported within a given treatment. US 2013/0205440 A1 Aug. 8, 2013 25

TABLE 9 0211 dgt-28 as a Selectable Marker. 0212. The use of dgt-28 as a selectable marker for glypho dgt-32, and dgt-33 transformed T Arabidopsis response to a range of glyphosate rates applied postemergence, compared to a digt sate selection agent is tested with the Arabidopsis trans 1 (T4) homozygous resistant population, and a non-transformed formed plants described above. Approximately 50T genera control. Visual % injury 14 days after application. tion Arabidopsis seed (homozygous for dgt-28) are spiked into approximately 5,000 wildtype (sensitive to glyphosate) 90 Iniury 90 Intury seed. The seeds are germinated and plantlets are sprayed with 20- Std Range a selecting dose of glyphosate. Several treatments of glypho Averages <20% 40% -40% Ave dew (%) sate are compared; each tray of plants receives either one or two application timings of glyphosate in one of the following pDAB107532: TraP14 v2 treatment schemes: 7 DAP (days after planting), 11 DAP or 7 dgt-32 v3 followed by 11 DAP. Since all plants also contain a glufosi Ogae?ha glyphosate 4 O O O.O O.O O nate resistance gene in the same transformation vector, dgt-28 105 gae?ha glyphosate 4 O O O.O O.O O containing plants selected with glyphosate can be directly 420 gae?ha glyphosate 2 O 2 3O.O 29.4 O-60 1680 gae?ha glyphosate 3 O 1 17.5 21.8 S-SO compared to DSM-2 or pat containing plants selected with 3360 gae?ha glyphosate O 3 1 3SO 3O.O 20-80 glufosinate. pDAB107534: TraP24 v2 -- 0213 Glyphosate treatments are applied with a DeVil dgt-33 v3 bissTM spray tip as previously described. Transgenic plants Ogae?ha glyphosate 4 O O O.O O.O O containing dgt-28 are identified as “resistant” or “sensitive' 105 gae?ha glyphosate 2 2 O 21.3 14.9 5-40 17 DAP. Treatments of 26.25-1680 g ae/ha glyphosate 420 gae?ha glyphosate 1 1 2 46.3 30.9 S-70 applied 7 and 11 days after planting (DAP), show effective 1680 gae?ha glyphosate 1 O 3 62.S. 38.8 S-90 selection for transgenic Arabidopsis plants that contain dgt 3360 gae?ha glyphosate 1 O 3 62.O 36.0 8-80 pDAB4104: dgt-1 28. Sensitive and resistant plants are counted and the number (transformed control) of glyphosate tolerant plants is found to correlate with the original number of transgenic seed containing the dgt-28 Ogae?ha glyphosate 4 O O O.O O.O O transgene which are planted. These results indicate that dgt 105 gae?ha glyphosate O 2 3 42.5 15.O 20-SO 420 gae?ha glyphosate O 1 2 38.8 11.1 2S-SO 28 can be effectively used as an alternative selectable marker 1680 gae?ha glyphosate O O 4 79.O. 19.4 SO-90 for a population of transformed Arabidopsis. 3360 gae?ha glyphosate O O 4 SO.O O.O 50 0214. Heritability. WT (non-transformed 0215 Confirmed transgenic T Arabidopsis events were control) self-pollinated to produce T seed. These seed were progeny Ogae?ha glyphosate 4 O O O.O O.O O tested by applying IgniteTM herbicide containing glufosinate 105 gae?ha glyphosate O O 4 8S.O. O.O 85 420 gae?ha glyphosate O O 4 100.0 OO 100 (200 gae/ha) to 100 random T. siblings. Each individual T. 1680 gae?ha glyphosate O O 4 100.0 OO 100 plant was transplanted to 7.5-cm square pots prior to spray 3360 gae?ha glyphosate O O 4 100.0 OO 100 application (track sprayer at 187 L/ha applications rate). The T families (T. plants) segregated in the anticipated 3 Resis tant: 1 Sensitive model for a dominantly inherited single locus TABLE 10 dgt-28, digt-32, dgt-33, dgt-3, and digt-7 transformed T Arabidopsis response to glyphosate applied postemergence at 1,680 gae?ha, compared to a digit-1 (T4) homozygous resistant population, and a non-transformed control. Visual % injury 14 days after application. % Injury % Injury

20 Std Range <20%, 40% -40% Ave dev (%)

Bacterial plDAB107527 TraP4 v2 -- dgt-28 v5 O 2 2 SS.O 26.8 35-85 Enzymes plDAB105530 TraP5 v2 - digt -28 v5 O 4 2 47.5 27.5 25-85 pDAB105531 TraP8 v2 - dgt -28 v5 4 O O S.3 3.8 O-8 pDAB105532 TraP9 v2 - dgt -28 v5 3 O 1 26.3 36.1 5-80 pDAB105533 TraP12 v2 - dgt-28 v5 4 1 O 11.O 8.2 O-20 pDAB105534 TraP13 v2 - dgt-28 v5 3 O 2 39.0 47.1 S-100 pDAB107532 TraP14 v2 - dgt-32 v3 3 O 1 17.5 21.8 S-SO pDAB107534 TraP24 v2 -- dgt-33 v3 1 O 3 62.S. 38.8 S-90 Class I pDAB102715 dgt-3 v2 4 O 3 42 48 O-1OO Enzymes p)AB102716 dgt-3 v3 2 O 1 14 23 O-40 pDAB102717 digit-3 v4 3 2 1 28 35 10-100 pDAB102785 dgt-7 v4 O 1 1 4S 21 30-60 pDAB4104 dgt-1 (transformed O O 4 8O.O O.O 8O control) WT (non-transformed O O 4 1OOO O.O 100 control) US 2013/0205440 A1 Aug. 8, 2013 26 with Mendelian inheritance as determined by Chi square more Susceptible to elevated rates of glyphosate (data not analysis (P-0.05). The percentage of T families that segre shown). This increase in sensitivity to glyphosate is similar to gated with the expected Mendelian inheritance are illustrated the data previously described for the T plants which also in Table 11, and demonstrate that the dgt-28 trait is passed via contained high copy numbers of the dgt-28 transgene. It is Mendelian inheritance to the T. generation. Seed were col likely that the presence of high copy numbers of the transgene lected from 5 to 15 T individuals (T. seed). Twenty-five T. within the Arabidopsis plants result in transgene silencing or siblings from each of 3-4 randomly-selected T families were other epigenetic effects which resulted in sensitivity to gly progeny tested as previously described. Data showed no seg phosate, despite the presence of the dgt-28 transgene. regation and thus demonstrated that dgt-28 and dgt-3 are 0219. These events contained dgt-28 linked with TraP5 v2 stably integrated within the chromosome and inherited in a (pDAB105530), Trap 12 v2 (pDAB105533) and TraP13 v2 Mendelian fashion to at least three generations. (pDAB105534). 0220. In addition to dgt-28, T. Arabidopsis events trans TABLE 11 formed withdgt-3 are presented in Table 13. As described for Percentage of T families (T2 plants) segregating as single Mendelian the dgt-28 events in Table 12, the data table contains a repre inheritance for a progeny test of 100 plants. sentative event that is characteristic of the response to gly phosate for each construct. For the dgt-3 characterization, T1 Families Tested constructs containing a single PTU (plant transformation Gene of Interest Segregating at 1 Locus (%) unit) with the dgt-3 gene being driven by the Atubil0 pro dgt-3 v2 64% moter (pDAB102716 and pL)AB102715) were compared to dgt-3 v3 60% constructs with the same gene containing 2 PTUs of the gene dgt-3 v4 80% (pDAB102719; p)AB102718). The constructs which con TraP5 v2 - dgt-28 v5 100% tained 2 PTU used the Atlubil0 promoter to drive one copy of TraP8 v2 - dgt-28 v5 100% the gene and the CsVMV promoter to drive the other copy. TraP9 v2 - dgt-28 v5 100% The use of the double PTU was incorporated to compare the TraP12 v2 - dgt-28 v5 SO% dgt-3 transgenic plants with dgt-28 transgenic plants which TraP13 v2 - dgt-28 v5 75% contained two copies of the transgene. Data demonstrated yfp Transgenic Control Plants 100% that single copy T. dgt-3 events with only a single PTU were more Susceptible to glyphosate than single copy dgt-28 events 0216 TArabidopsis Data. tested, but were more tolerant than the non-transformed con 0217. The second generation plants (T) of selected T trol. T families containing 2 PTUs of the dgt-3 gene provided Arabidopsis events which contained low copy numbers of the a higher level of visual tolerance to glyphosate compared to dgt-28 transgene were further characterized for glyphosate the 1 PTU constructs. In both instances the T families were tolerance. Glyphosate was applied as described previously. compared to the dgt-1 and wildtype controls. T. data demon The response of the plants is presented in terms of% visual strate that dgt-28 provides robust tolerance as single copy injury 2 weeks after treatment (WAT). Data are presented as a eVentS. histogram of individuals exhibiting little or no injury (<20%), moderate injury (20–40%), or severe injury (>40%). An arith TABLE 12 metic mean and standard deviation are presented for each Response of selected individual T. Arabidopsis events containing construct used for Arabidopsis transformation. The range in dgt-28 to glyphosate applied postemergence at varying rates, compared to individual response is also indicated in the last column for a digit-1 (T4) homozygous resistant population, and a non-transformed each rate and transformation. Wild-type, non-transformed control. Visual % injury 14 days after application. Arabidopsis (cv. Columbia) served as a glyphosate sensitive control. In the T. generation hemizygous and homozygous 90 Iniury 90 Iniury plants were available for testing for each event and therefore 20- Std Range were included for each rate of glyphosate tested. Hemizygous 1 copy <20% 40% -40% Ave dew (%) plants contain two different alleles at a locus as compared to pDAB105530: TraP5 homozygous plants which contain the same two alleles at a v2 - dgt-28 v5 locus. Variability of response to glyphosate is expected in the T generation as a result of the difference in gene dosage for Ogae?ha glyphosate 4 O O O.O O.O O 420 gae?ha glyphosate O O 4 7S.O. 17.8 SO-90 hemizygous as compared to homozygous plants. The Vari 840 gae?ha glyphosate O O 4 8O.O 20.O SO-90 ability in response to glyphosate is reflected in the standard 1680 gae?ha glyphosate O O 4 7S.O. 10.8 60-85 deviation and range of response. 3360 gae?ha glyphosate O O 4 76.3 4.8 70-80 0218. In the T. generation both single copy and multi pDAB105531: TraP8 copy dgt-28 events were characterized for glyphosate toler v2 - dgt-28 v5 ance. Within an event, single copy plants showed similar Ogae?ha glyphosate 4 O O O.O O.O O 420 gae?ha glyphosate 4 O O O.S 1.O O-2 levels of tolerance to glyphosate. Characteristic data for a 840 gae?ha glyphosate 4 O O 1.3 2.5 O-5 single copy T. event are presented in Table 12. Events con 1680 gae?ha glyphosate 4 O O 7.5 S.O 5-15 taining dgt-28 linked with TraP5 v2 did not provide robust 3360 gae?ha glyphosate 4 O O 7.5 6.5 O-15 tolerance to glyphosate as compared with the dgt-28 con pDAB105532: TraP9 structs which contained other TraP transit peptides. However, v2 - dgt-28 v5 the dgt-28 TraP5 constructs did provide a low level of gly Ogae?ha glyphosate 4 O O O.O O.O O phosate tolerance as compared to the non-transformed 420 gae?ha glyphosate 4 O O 2.0 4.O O-8 Columbia control. There were instances when events that 840 gae?ha glyphosate 4 O O 9.0 2.0 8-12 were shown to contain two or more copies of digt-28 were US 2013/0205440 A1 Aug. 8, 2013 27

TABLE 12-continued TABLE 13-continued Response of selected individual T2 Arabidopsis events containing Response of selected T. Arabidopsis events transformed dgt-28 to glyphosate applied postemergence at varying rates, compared to with digt-3 to glyphosate applied postemergence at varying a dgt-1 (T4) homozygous resistant population, and a non-transformed rates. Visual % injury 14 days after application. control. Visual % injury 14 days after application. %. Iniury %. Iniury %. Injury %. Injury 20- Std Range 1 copy Seg <20% 40% -40% Ave dew (%) 20- Std Range 1 copy <20% 40% -40% Ave dew (%) pDAB102715: dgt-3 v2 (1 PTU) 1680 gae?ha glyphosate 4 O O 7.3 4.6 2-12 3360 gae?ha glyphosate 4 O O 11.O 1.2 10-12 Ogae?ha glyphosate 4 O O O O O pDAB105533: TraP12 420 gae?ha glyphosate 2 2 O 26 16 1O-40 v2-dgt-28 v5 840 gae?ha glyphosate O 2 2 55 17 40-70 1680 gae?ha glyphosate O 2 2 56 22 35-75 Ogae?ha glyphosate 4 O O O.O O.O O 3360 gae?ha glyphosate O O 4 65 17 SO-80 420 gae?ha glyphosate 4 O O O.O O.O O pDAB102718: dgt-3 840 gae?ha glyphosate 4 O O O.O O.O O v2 (2 PTU) 1680 gae?ha glyphosate 4 O O O.O O.O O 3360 gae?ha glyphosate 3 1 O 13.3 7.9 8-2S Ogae?ha glyphosate 4 O O O O O pDAB105534: TraP13 420 gae?ha glyphosate 4 O O 5 7 O-15 v2-dgt-28 v5 840 gae?ha glyphosate 2 2 O 23 10 15-35 1680 gae?ha glyphosate 3 O 1 2O 2O 5-50 3360 gae?ha glyphosate 1 1 2 36 22 15-60 Ogae?ha glyphosate 4 O O O.O O.O O 420 gae?ha glyphosate 3 1 O S.O. 10.0 O-20 840 gae?ha glyphosate 3 1 O S.O. 10.0 O-20 1680 gae?ha glyphosate 2 2 O 1O.O. 11.5 O-20 0221 T Arabidopsis Data. 3360 gae?ha glyphosate 2 2 O 1S.O. 12.2 S-30 0222. The third generation plants (T) of selected T Ara WT (non-transformed bidopsis events which contained low copy numbers of the control) dgt-28 transgene were further characterized for glyphosate 0 g ae?ha glyphosate 4 O O O.O O.O O tolerance. Glyphosate was applied as described previously. 420 gae?ha glyphosate O O 4 100.0 OO 100 The response of the plants is presented in terms of% visual 840 gae?ha glyphosate O O 4 100.0 OO 100 injury 2 weeks after treatment (WAT). Data are presented as a 1680 gae?ha glyphosate O O 4 100.0 OO 100 3360 gae?ha glyphosate O O 4 100.0 OO 100 histogram of individuals exhibiting little or no injury (<20%), pDAB4104: dgt-1 moderate injury (20–40%), or severe injury (>40%). An arith (transformed control) metic mean and standard deviation are presented for each construct used for Arabidopsis transformation. The range in Ogae?ha glyphosate 4 O O O.O O.O O individual response is also indicated in the last column for 420 gae?ha glyphosate O 4 O 37.5 2.9 3S-40 each rate and transformation. Wild-type, non-transformed 840 gae?ha glyphosate O O 4 45.O O.O 45 1680 gae?ha glyphosate O O 4 47.5 2.9 45-50 Arabidopsis (cv. Columbia) served as a glyphosate sensitive 3360 gae?ha glyphosate O O 4 SO.O O.O 50 control. In the T generation hemizygous and homozygous plants were available for testing for each event and therefore were included for each rate of glyphosate tested. Hemizygous plants contain two different alleles at a locus as compared to TABLE 13 homozygous plants which contain the same two alleles at a locus. Variability of response to glyphosate is expected in the Response of selected T. Arabidopsis events transformed with digt-3 to glyphosate applied postemergence at varying T generation as a result of the difference in gene dosage for rates. Visual 90 injury 14 days after application. hemizygous as compared to homozygous plants. The vari ability in response to glyphosate is reflected in the standard %. Iniury %. Iniury deviation and range of response. 20- Std Range 1 copy Seg <20% 40% -40% Ave dew (%) TABLE 1.4 pDAB102716: dgt-3 Response of selected individual T. Arabidopsis events containing v3 (1 PTU) dgt-28 to glyphosate applied postemergence at varying rates, compared to a digit-1 (T4) homozygous resistant population, and a non-transformed Ogae?ha glyphosate 4 O O O O O control. Visual % injury 14 days after application. 420 gae?ha glyphosate 1 1 2 39 25 15-65 840 gae?ha glyphosate O 2 2 50 23 30-70 % Injury Range 1680 gae?ha glyphosate O 1 3 69 19 40-80 (No. Replicates) % Injury Analysis 3360 gae?ha glyphosate O O 4 79 6 70-85 pDAB102719: dgt-3 20- Std Range v3 (2 PTU) Application Rate <20% 40% -40% Ave dew (%) Ogae?ha glyphosate 4 O O O O O dgt-28 420 gae?ha glyphosate O 4 O 2O O 2O (pDAB107602) 840 gae?ha glyphosate O 3 1 38 5 35-45 1680 gae?ha glyphosate 3 1 O 15 7 10-2S Ogae?ha glyphosate O O O.O O.O O 3360 gae?ha glyphosate 2 2 O 21 8 15-30 420 gae?ha glyphosate s O 4 73.8 2.5 70-75 US 2013/0205440 A1 Aug. 8, 2013 28

TABLE 14-continued TABLE 14-continued Response of selected individual T. Arabidopsis events containing Response of selected individual T. Arabidopsis events containing dgt-28 to glyphosate applied postemergence at varying rates, compared to dgt-28 to glyphosate applied postemergence at varying rates, compared to a dgt-1 (T4) homozygous resistant population, and a non-transformed a digit-1 (T4) homozygous resistant population, and a non-transformed control. Visual % injury 14 days after application. control. Visual % injury 14 days after application. 840 gae?ha glyphosate O O 4 71.3 7.5 60-75 TraP23:dgt-28 1680 gae?ha glyphosate O O 4 77.5 2.9 75-80 (pDAB107553) 3360 gae?ha glyphosate O O 4 77.5 2.9 75-80 TraP4::dgt-28 Ogae?ha glyphosate 4 O O O.O O.O O (pDAB107527) 420 gae?ha glyphosate 4 O O O.O O.O O 840 gae?ha glyphosate 4 O O O.O O.O O Ogae?ha glyphosate 4 O O O.O O.O O 1680 gae?ha glyphosate 4 O O 7.8 2.1 S-10 420 gae?ha glyphosate 4 O O O.O O.O O 3360 gae?ha glyphosate 4 O O 10.8 3.0 8-15 840 gae?ha glyphosate 4 O O S.O O.O 5 WT (non-transformed 1680 gae?ha glyphosate 4 O O 1O.O O.O 10 control) 3360 gae?ha glyphosate 1 3 O 18.8 2.5 15-20 TraP5 v1:dgt-28 Ogae?ha glyphosate 4 O O O.O O.O O (pDAB102792) 420 gae?ha glyphosate O O 4 100.O O.O 100 840 gae?ha glyphosate O O 4 100.O O.O 100 Ogae?ha glyphosate 4 O O O.O O.O O 1680 gae?ha glyphosate O O 4 100.O O.O 100 420 gae?ha glyphosate 3 O O O.O O.O O 3360 gae?ha glyphosate O O 4 100.O O.O 100 840 gae?ha glyphosate 3 O O O.O O.O O 1680 gae?ha glyphosate 3 O O 6.O 1.7 S-8 3360 gae?ha glyphosate 2 O O 6.5 2.1 S-8 0223 Selection of Transformed Plants. 0224 Freshly harvested T seed dgt-31, dgt-32, and dgt % Injury Range 33 v1 gene were allowed to dry at room temperature and TraP5 v2:dgt-28 (No. Replicates) % Injury Analysis shipped to Indianapolis for testing. T seed was sown in (pDAB105530) 20- Std Range 26.5x51-cm germination trays (T.O. Plastics Inc., Clearwa Averages <20% 40% -40% Ave dew (%) ter, Minn.), each receiving a 200 mg aliquots of Stratified T seed (~10,000 seed) that had previously been suspended in 40 Ogae?ha glyphosate O.O O.O O mL of 0.1% agarose solution and stored at 4°C. for 2 days to 420 gae?ha glyphosate 6.O 1.7 S-8 complete dormancy requirements and ensure Synchronous 840 gae?ha glyphosate 8.0 O.O 8 1680 gae?ha glyphosate 14.3 1.S 12-15 Seed germination. 3360 gae?ha glyphosate 18.7 2.5 15-20 0225 Sunshine Mix LP5 (Sun Gro Horticulture Inc., Bellevue, Wash.) was covered with fine vermiculite and Subir % Injury Range rigated with Hoagland's solution until wet, then allowed to (No. Replicates) % Injury Analysis gravity drain. Each 40 mL aliquot of stratified seed was sown 20- Std Range evenly onto the vermiculite with a pipette and covered with Application Rate <20% 40% -40% Ave dew (%) humidity domes (KORDTM Products, Bramalea, Ontario, Canada) for 4-5 days. Domes were removed once plants had germinated prior to initial transformant selection using glu (pDAB105531) fosinate postemergence spray (selecting for the co-trans Ogae?ha glyphosate 4 O O O.O O.O O formed dsm-2 gene). 420 gae?ha glyphosate 4 O O 2.5 S.O O-10 0226 Six days after planting (DAP) and again 10 DAP. T. 840 gae?ha glyphosate 4 O O 3.3 3.9 O-8 plants (cotyledon and 2-4-1f stage, respectively) were 1680 gae?ha glyphosate 4 O O 2.5 2.9 O-5 3360 gae?ha glyphosate 4 O O 7.3 64 2-15 sprayed with a 0.1% solution of IGNITETM herbicide (280 g TraP9 v2:dgt-28 ai/L glufosinate, Bayer CropSciences, Kansas City, Mo.) at a (pDAB105532) spray volume of 10 mL/tray (703 L/ha) using a DeVilbissTM compressed air spray tip to deliver an effective rate of 200 g Ogae?ha glyphosate 4 O O O.O O.O O ae/ha glufosinate per application. Survivors (plants actively 420 gae?ha glyphosate 4 O O 1.3 2.5 O-5 growing) were identified 4-7 days after the final spraying. 840 gae?ha glyphosate 4 O O 1.8 24 O-5 Surviving plants were transplanted individually into 3-inch 1680 gae?ha glyphosate 4 O O O.O O.O O 3360 gae?ha glyphosate 4 O O 1O.O 4.4 5-15 pots prepared with potting media (Metro Mix 360TM). Plants TraP12 v2::dgt-28 reared in the greenhouse at least 1 day prior to tissue sampling (pDAB105533) for copy number analyses. 0227 T plants were sampled and copy number analysis Ogae?ha glyphosate 4 O O O.O O.O O forthedgt-31, dgt-32, and dgt-33 v1 gene were completed.T. 420 gae?ha glyphosate 4 O O O.O O.O O 840 gae?ha glyphosate 4 O O O.O O.O O plants were then assigned to various rates of glyphosate so 1680 gae?ha glyphosate 4 O O 3.8 7.5 O-15 that a range of copies were among each rate. For Arabidopsis, 3360 gae?ha glyphosate 4 O O 6.3 4.8 O-10 26.25 gae/ha glyphosate is an effective dose to distinguish TraP13 v2::dgt-28 sensitive plants from ones with meaningful levels of resis (pDAB105534) tance. Elevated rates were applied to determine relative levels Ogae?ha glyphosate 4 O O O.O O.O O of resistance (105, 420, 1680, or 3360 gae/ha). Table 16 420 gae?ha glyphosate 2 2 O 1.O.O. 11.5 O-2O shows the comparisons drawn to dgt-1. 840 gae?ha glyphosate 4 O O 1.3 2.5 O-5 0228 All glyphosate herbicide applications were made by 1680 gae?ha glyphosate 4 O O 2.8 1.5 2-5 track sprayer in a 187 L/ha spray volume. Glyphosate used 3360 gae?ha glyphosate 4 O O 8.0 O.O 8 was of the commercial Durango dimethylamine salt formu lation (480 gae/L, Dow AgroSciences, LLC). Low copy T. US 2013/0205440 A1 Aug. 8, 2013 29 plants that exhibited tolerance to either glufosinate or glypho TABLE 16-continued sate were further accessed in the T. generation. dgt-31, dgt-32, and dgt-33 v1 transformed TArabidopsis response 0229. The first Arabidopsis transformations were con to a range of glyphosate rates applied postemergence, compared ducted using dgt-31, dgt-32, and dgt-33 v1.T. transformants to a dgt-1 (T4) homozygous resistant population, or a non-transformed were first selected from the background of untransformed control. Visual % injury 2 weeks after treatment. seed using a glufosinate selection scheme. Three flats or 30,000 seed were analyzed for each T construct. Transfor 90 Iniury 90 Iniury mation frequency was calculated and results of T1 dgt-31, 20- Std. Range dgt-32, and dgt-33 constructs are listed in Table 15. Averages <20%. 40% -40% Ave Dew. (%) 420 gae?ha O O 4 97.3 4.9 90-100 TABLE 1.5 1680 gae?ha O O 4 90.O 7.1 85-100 3360 gae?ha O O 4 91.3 6.3 85-100 Transformation frequency of T1 dgt-31, dgt-32, and dgt-33 TraP14 dgt-32 Arabidopsis constructs selected with glufosinate for selection of the selectable marker gene DSM-2. Ogae?ha glyphosate 4 O O O.O O.O O 105 gae?ha 4 O O O.O O.O O Transformation 420 gae?ha 2 O 2 3O.O 29.4 O-60 Construct Cassette Frequency (%) 1680 gae?ha 3 O 1 17.5 21.8 S-SO 3360 gae?ha O 3 1 3SO 3O.O 20-80 pDAB107532 At Jbi10/TraP14 dgt-32 v1 O.47 TraP24 dgt-33 pDAB107533 AtlJbi10/TraP23 dgt-31 v1 O.36 pDAB107534 AtlJbi10/TraP24dgt-33 v1 O.68 Ogae?ha glyphosate 4 O O O.O O.O O 105 gae?ha 2 2 O 21.3 14.9 5-40 420 gae?ha 1 1 2 46.3 30.9 S-70 0230 T plants selected above were subsequently trans 1680 gae?ha 1 O 3 62.S. 38.8 S-90 planted to individual pots and sprayed with various rates of 3360 gae?ha 1 O 3 62.O 36.0 8-80 commercial glyphosate. Table 16 compares the response of dgt-1 (transformed dgt-31, dgt-32, and dgt-33 v1 and control genes to impart control) glyphosate resistance to Arabidopsis T transformants. Ogae?ha glyphosate 4 O O O.O O.O O Response is presented interms of% visual injury 2WAT. Data 105 gae?ha O 1 3 42.5 15.O 20-50 420 gae?ha O 2 2 38.8 11.1 2S-SO are presented as a histogram of individuals exhibiting little or 1680 gae?ha O O 4 79.O. 19.4 SO-90 no injury (<20%), moderate injury (20-40%), or severeinjury 3360 gae?ha O O 4 SO.O O.O 50 (>40%). An arithmetic mean and standard deviation is pre WT (non-transformed sented for each treatment. The range in individual response is control) also indicated in the last column for each rate and transfor Ogae?ha glyphosate 4 O O O.O O.O O mation. Wild-type non-transformed Arabidopsis (cv. Colum 105 gae?ha O O 4 8S.O. O.O 85 bia) served as a glyphosate sensitive control. The DGT-31 420 gae?ha O O 4 100.0 OO 100 (v1) gene with transit peptide (TraP23) imparted slight her 1680 gae?ha O O 4 100.0 OO 100 bicide tolerance to individual T Arabidopsis plants com 3360 gae?ha O O 4 100.0 OO 100 pared to the negative control. Both DGT-32 and DGT-33 demonstrated robust tolerance to glyphosate at the rates tested with their respective chloroplast transit peptide 0231 Maize Transformation. (TraP14 and TraP24 respectively). Within a given treatment, 0232 Standard cloning methods, as described above, were the level of plant response varied greatly, which can be attrib used in the construction of binary vectors for use in Agrobac uted to the fact each plant represents an independent trans terium tumefaciens-mediated transformation of maize. Table formation event and thus the copy number of the gene of 17 lists the vectors which were constructed for maize trans interest varies from plant to plant. Of important note, at each formation. The following gene elements were used in the glyphosate rate tested, there were individuals that were more vectors which contained dgt-28; the Zea mays Ubiquitin 1 tolerant than others. An overall population injury average by promoter (ZmUbi1; U.S. Pat. No. 5,510,474) was used to rate is presented in Table 16 to demonstrate the significant drive the dgt-28 coding sequence which is flanked by a Zea difference between the plants transformed with dgt-31, dgt mays Lipase 3' untranslated region (ZmLip 3'UTR; U.S. Pat. 32, and dgt-33 v1 versus the dgt-1 V1 or Wild-type controls. No. 7,179,902), the selectable marker cassette consists of the Zea mays Ubiquitin 1 promoter which was used to drive the TABLE 16 aad-1 coding sequence (U.S. Pat. No. 7,838,733) which is dgt-31, dgt-32, and digit-33 v1 transformed TArabidopsis response flanked by a Zea mays Lipase 3' untranslated region. The to a range of glyphosate rates applied postemergence, compared aad-1 coding sequence confers tolerance to the phenoxy to a dgt-1 (T4) homozygous resistant population, or a non-transformed auxin herbicides, such as, 2,4-dichlorophenoxyacetic acid control. Visual % iniury 2 weeks after treatment. (2,4-D) and to aryloxyphenoxypropionate (AOPP) herbi %. Iniury %. Iniury cides. 20- Std. Range 0233. The dgt-28 constructs were built as standard binary Averages <20% 40% -40% Ave Dew. (%) vectors and Agrobacterium Superbinary system vectors (Ja pan Tobacco, Tokyo, JP). The standard binary vectors TraP23 dgt-31 include: pdAB107663, pIDAB107664, plDAB107665, and Ogae?ha glyphosate 4 O O O.O O.O O pDAB 107665. The Agrobacterium superbinary system vec 105 gae?ha O O 4 81.3 2.5 80-85 tors include pDAB108384, pI)AB108385, pIDAB108386, and plDAB108387. US 2013/0205440 A1 Aug. 8, 2013 30

0234 Additional constructs were completed which con given set of experiments, pooled embryos from three ears tain a yellow fluorescent protein (yfp; US Patent Application were used for each transformation. 2007/0298.412) reporter gene. p.)AB109812 contains a yfp 0237 Agrobacterium Culture Initiation: reporter gene cassette which is driven by the Zea mays Ubiq 0238 Glycerol stocks of Agrobacterium containing the uitin1 promoter and flanked by the Zea mays per 53' untrans binary transformation vectors described above were streaked lated region (Zm perS 3'UTR: U.S. Pat. No. 7,179,902), the on AB minimal medium plates containing appropriate anti selectable marker cassette consists of the Sugar cane bacilli biotics and were grown at 20°C. for 3-4 days. A single colony form virus promoter (SCBV: U.S. Pat. No. 5,994,123) which was picked and streaked onto YEP plates containing the same is used to drive the expression of aad-1 and is flanked by the antibiotics and was incubated at 28°C. for 1-2 days. Zea mays Lipase 3' untranslated region. pl.)AB101556 con 0239 Agrobacterium Culture and Co-Cultivation. tains ayfp cassette which is driven by the Zea mays Ubiquitin 0240 Agrobacterium colonies were taken from the YEP 1 promoter and flanked by the Zea mays per 53' untranslated plate, suspended in 10 mL of infection medium in a 50 mL region, the selectable marker cassette consists of the Zea disposable tube, and the cell density was adjusted to ODoo mays Ubiquitin 1 promoter which is used to drive the expres nm of 0.2-0.4 using a spectrophotometer. The Agrobacterium sion ofaad-1 and is flanked by the Zea may’s Lipase 3' untrans cultures were placed on a rotary shaker at 125 rpm, room lated region. pl.)AB 107698 contains adgt-28 cassette which temperature, while embryo dissection was performed. Imma is driven by the Zea mays Ubiquitin1 promoter and is flanked ture Zygotic embryos between 1.5-2.4 mm in size were iso by a Zea mays Lipase 3' untranslated region, any fp cassette lated from the sterilized maize kernels and placed in 1 mL of which is driven by the Zea mays Ubiquitin 1 promoter and the infection medium) and washed once in the same medium. flanked by the Zea mays per 5 3' untranslated region, the The Agrobacterium Suspension (2 mL) was added to each selectable marker cassette consists of the Sugar cane bacilli tube and the tubes were placed on a shaker platform for 10-15 form virus promoter which is used to drive the expression of minutes. The embryos were transferred onto co-cultivation aad-1 and is flanked by the Zea mays Lipase 3' untranslated media (MS Salts, 4.33 gm/L: L-proline, 700.0 mg/L. Myo region. All three of these constructs are standard binary vec inositol, 100.0 mg/L. Casein enzymatic hydrolysate 100.0 tOrS. mg/L.; 30 mM Dicamba-KOH, 3.3 mg/L. Sucrose, 30.0gm/L.; GelzanTM, 3.00 gm/L; Modified MS-Vitamin (1000x, 1.00 TABLE 17 ml/L; 8.5 mg/ml AgNo. 15.0 mg/L. DMSO, 100 uM), ori ented with the scutellum facing up and incubated at 25°C., Maize Transformation Vectors under 24-hour light at 50 umolem sec' light intensity for Plasmid No. Description of Gene Elements 3 days. plDAB107663 Zml Jbi1/TraP4 dgt-28/ZmLip 3'UTR::Zm Ubi1/aad-1/ 0241 Callus Selection and Regeneration of Putative ZmLip 3'UTR binary vector Events. plDAB107664 Zml Jbi1/TraP8 dgt-28/ZmLip 3'UTR::Zm Ubi1/aad-1/ 0242 Following the co-cultivation period, embryos were ZmLip 3'UTR binary vector transferred to resting media (MS Salts, 4.33 gm/L: L-proline, plDAB107665 Zml Jbi1/TraP23 dgt-28/ZmLip 3'UTR::Zml Jbi1/aad-1/ ZmLip 3'UTR binary vector 700.0 mg/L. 1.2.3,5/4.6-Hexahydroxycyclohexane, 100 plDAB107666 Zml Jbi1/TraP5 dgt-28/ZmLip 3'UTR::Zm Ubi1/aad-1/ mg/L. MES (2-(n-morpholino)-ethanesulfonic acid), free ZmLip 3'UTR binary vector acid 0.500gm/L. Casein enzymatic hydrolysate 100.0 mg/L.; plDAB10.9812 Zml Jbi1/yfp/ZmPerS 3'UTR::SCBVlaad-1/ZmLip 3'UTR binary vector 30 mM Dicamba-KOH, 3.3 mg/L. Sucrose, 30.0gm/L: Gel plDAB101556 Zml Jbi1/yfp/ZmPerS 3'UTR::Zm Ubi1/aad-1/ZmLip Zan 2.30 gm/L: Modified MS-Vitamin (1000x, 1.00 ml/L: 3'UTR binary vector 8.5 mg/ml AgNo3, 15.0 mg/L. Carbenicillin, 250.0 mg/L) plDAB107698 Zml Jbi1/TraP8 dgt-28/ZmLip 3'UTR::Zm Ubi1/yfp/ without selective agent and incubated under 24-hour light at ZmLip 3'UTR::SCBVlaad-1/ZmLip 3'UTR plDAB108384 Zml Jbi1/TraP4 dgt-28/ZmLip 3'UTR::Zm Ubi1/aad-1/ 50 umole m sec' light intensity and at 25°C. for 3 days. ZmLip 3'UTR Superbinary vector 0243 Growth inhibition dosage response experiments plDAB108385 Zml Jbi1/TraP8 dgt-28/ZmLip 3'UTR::Zm Ubi1/aad-1/ Suggested that glyphosate concentrations of 0.25 mM and ZmLip 3'UTR Superbinary precursor higher were sufficient to inhibit cell growth in the untrans plDAB108386 Zml Jbi1/TraP23 dgt-28/ZmLip 3'UTR::Zml Jbi1/aad-1/ ZmLip 3'UTR Superbinary precursor formed B104 maize line. Embryos were transferred onto plDAB108387 Zml Jbi1/TraP5 dgt-28/ZmLip 3'UTR::Zm Ubi1/aad-1/ Selection 1 media containing 0.5 mM glyphosate (MS Salts, ZmLip 3'UTR Superbinary precursor 4.33 gm/L: L-proline, 700.0 mg/L. Myo-inositol, 100.0 mg/L. MES (2-(n-morpholino)-ethanesulfonic acid), free acid 0.500gm/L. Casein enzymatic hydrolysate 100.0 mg/L.; 0235 Ear Sterilization and Embryo Isolation. 30 mM Dicamba-KOH, 3.3 mg/L. Sucrose, 30.0gm/L: Gel 0236. To obtain maize immature embryos, plants of the ZanTM 2.30gm/L: Modified MS-Vitamin 1000x, 1.00 ml/L: Zea mays inbred line B104 were grown in the greenhouse and 8.5 mg/ml AgNo3, 15.0 mg/L. Carbenicillin, 250.0 mg/L) were self or sib-pollinated to produce ears. The ears were and incubated in either dark and/or under 24-hour light at 50 harvested approximately 9-12 days post-pollination. On the umolem'sec light intensity for 7-14 days at 28°C. experimental day, ears were surface-sterilized by immersion 0244 Proliferating embryogenic calli were transferred in a 20% solution of sodium hypochlorite (5%) and shaken for onto Selection 2 media containing 1.0 mM glyphosate (MS 20-30 minutes, followed by three rinses insterile water. After Salts, 4.33 gm/L; 1.2.3.5/4.6-Hexahydroxycyclohexane, 100 sterilization, immature Zygotic embryos (1.5-2.4 mm) were mg/L: L-proline, 700.0 mg/L. MES (2-(n-morpholino)- aseptically dissected from each ear and randomly distributed ethanesulfonic acid), free acid 0.500 gm/L. Casein enzy into micro-centrifuge tubes containing liquid infection media matic hydrolysate 100.0 mg/L; 30 mM Dicamba-KOH, 3.3 (LS Basal Medium, 4.43 gm/L. N6 Vitamin Solution 1000x. mg/L. Sucrose, 30.0 gm/L: GelzanTM 2.30 gm/L; Modified 1.00 mL/L L-proline, 700.0 mg/L. Sucrose, 68.5gm/L: D(+) MS-Vitamin (1000x, 1.00 ml/L; 8.5 mg/mL AgNo3, 15.0 Glucose, 36.0 gm/L; 10 mg/ml of 2,4-D, 150 uL/L). For a mg/L. Carbenicillin, 250.0 mg/L.; R-Haloxyfop acid 0.1810 US 2013/0205440 A1 Aug. 8, 2013

mg/L), and were incubated in either dark and/or under Ind.) was prepared at 1x final concentrationina 10LL Volume 24-hour light at 50 umolem sec light intensity for 14 days multiplex reaction containing 0.4LM of each primer foraad-l at 28°C. This selection step allowed transgenic callus to and dgt-28 and 0.2 uM of each probe (Table 18). further proliferate and differentiate. The callus selection period lasted for three to four weeks. 0251 A two-step amplification reaction was performed 0245 Proliferating, embryogenic calli were transferred with an extension at 60° C. for 40 seconds with fluorescence onto PreReg media containing 0.5 mM glyphosate (MSSalts, acquisition. All samples were run and the averaged Cycle 4.33 gm/L: 1,2,3,5/4.6-Hexahydroxycyclohexane, 100 mg/L.; threshold (Ct) values were used for analysis of each sample. L-proline, 350.0 mg/L. MES (2-(n-morpholino)-ethane Analysis of real time PCR data was performed using Light sulfonic acid), free acid 0.250 gm/L. Casein enzymatic Cycler(R) software release 1.5 using the relative quant module hydrolysate 50.0 mg/L. NAA-NaOH 0.500 mg/L, ABA and is based on the AACt method. Controls included a sample EtOH 2.50 mg/L.; BA 1.00 mg/L. Sucrose, 45.0 gm/L: Gel of genomic DNA from a single copy calibrator and known ZanTM 2.50gm/L; Modified MS-Vitamin 1000x, 1.00 ml/L: two copy check that were included in each run. Table 19 lists 8.5 mg/ml AgNo3, 1.00 mg/L. Carbenicillin, 250.0 mg/L) the results of the hydrolysis probe assays. and cultured under 24-hour light at 50 umolem sec' light intensity for 7 days at 28°C. TABL E 18 0246 Embryogenic calli with shoot-like buds were trans Primer and probe sequences used for hydrolysis ferred onto Regeneration media containing 0.5 mM glypho probe assay of aad-1 digt – 28 and sate (MS Salts, 4.33 gm/L. 1.2.3.5/4.6-Hexahydroxycyclo internal reference (Invertase). hexane, 100.0 mg/L. Sucrose, 60.0 gm/L: Gellan Gum G434TM 3.00 gm/L: Modified MS-Vitamin (1000x, 1.00 Oligonucleotide Gene SEO ID ml/L. Carbenicillin, 125.0 mg/L) and cultured under 24-hour Name Detected NO: Oligo Sequence light at 50 umolem sec' light intensity for 7 days. GAAD1F aad-1 60 TGTTCGGTTCCCTC 0247 Small shoots with primary roots were transferred to forward TACCAA rooting media (MS Salts, 4.33 gm/L; Modified MS-Vitamin primer 1000x, 1.00 ml/L: 1,2,3,5/4.6-Hexahydroxycyclohexane, GAAD1P aad-1 61 CACAGAACCGTCGC 100 mg/L. Sucrose, 60.0 gm/L: Gellan Gum G434TM 3.00 probe TTCAGCAACA gm/L. Carbenicillin, 250.0 mg/L) in phytotrays and were GAAD1R aad-1 62 CAACATCCATCACC incubated under 16/8 hr. light/dark at 140-190 umole m' rewerse TTGACTGA sec' light intensity for 7 days at 27°C. Putative transgenic primer plantlets were analyzed for transgene copy number using the protocols described above and transferred to soil. IW-Probe Invertase 63 CGAGCAGACCGCCG 0248 Molecular Confirmation of the Presence of the dgt probe TGTACT TO TACC 28 and aad-1 Transgenes within Maize Plants. IVF-Taq Invertase 64 TGGCGGACGACGAC 0249. The presence of the dgt-28 and aad-1 polynucle forward TTGT otide sequences were confirmed via hydrolysis probe assays. primer Isolated To Maize plants were initially screened via a IVR-Taq Invertase 65 AAAGTTTGGAGGCT hydrolysis probe assay, analogous to TAOMANTM, to con rewerse GCCGT firm the presence of a aad-1 and dgt-28 transgenes. The data primer generated from these studies were used to determine the transgene copy number and used to select transgenic maize ZmDGT28 F digt – 28 66 TTCAGCACCCGTCA forward GAAT events for back crossing and advancement to the T genera primer tion. 0250 Tissue samples were collected in 96-well plates, ZmDGT28 FAM digt – 28 67 TGCCGAGAACTTGA tissue maceration was performed with a KLECOTM tissue probe GGAGGT pulverizer and stainless steel beads (Hoover Precision Prod ucts, Cumming, Ga.), in QiagenTM RLT buffer. Following ZmDGT28 R digt – 28 68 TGGTCGCCATAGCT rewerse TGT tissue maceration, the genomic DNA was isolated in high primer throughput format using the Biosprint 96TM Plant kit (Qiagen, Germantown, Md.) according to the manufacturer's Sug gested protocol. Genomic DNA was quantified by Quant ITTM Pico Green DNA assay kit (Molecular Probes, Invitro TABLE 19 gen, Carlsbad, Calif.). Quantified genomic DNA was To copy amount results for dgt-28 events. Low copy events consisted adjusted to around 2 ng/uL for the hydrolysis probe assay of 1-2 transgene copies, single copy numbers are listed in parenthesis. using a BIOROBOT3000TM automated liquid handler High copy events contained 3 or more transgene copies. (Qiagen, Germantown, Md.). Transgene copy number deter # of Low # of High mination by hydrolysis probe assay, analogous to TAC Plasmid used for Copy Events Copy MANR assay, was performed by real-time PCR using the Transformation (single copy) Events LIGHTCYCLER(R480 system (Roche Applied Science, Indianapolis, Ind.). Assays were designed for aad-1. dgt-28 pDAB 107663 43 (31) 10 pDAB 107664 30 (24) 5 and an internal reference gene Invertase (Genbank Accession pDAB107665 40 (27) 10 No: U16123.1) using the LIGHTCYCLER(R) Probe Design pDAB 107666 24 (12) 12 Software 2.0. For amplification, LIGHTCYCLER(R480 pDAB10.9812 2 (1) O Probes Master mix (Roche Applied Science, Indianapolis, US 2013/0205440 A1 Aug. 8, 2013 32

TABLE 19-continued sampled for protein expression were then treated with com mercial formulations of DURANGO DMATM (glyphosate) To copy amount results for dgt-28 events. Low copy events consisted with the addition of 2% w/v ammonium-sulfate. Treatments of 1-2 transgene copies, single copy numbers are listed in parenthesis. were distributed so that each grouping of plants contained To High copy events contained 3 or more transgene copies. events of varying copy number. Herbicide applications were # of Low # of High made with a track sprayer at a spray volume of 187 L/ha, Plasmid used for Copy Events Copy 50-cm spray height. To plants were sprayed with a range of Transformation (single copy) Events glyphosate from 280-4480 g ae/ha glyphosate capable of pDAB101556 25 (15) 10 significant injury to untransformed corn lines. A lethal dose is pDAB107698 3 (1) 2 defined as the rate that causes >95% injury to the B104 inbred. B104 was the genetic background of the transfor 0252 Herbicide Tolerance indgt-28 Transformed Corn. mantS. 0253 Zea mays dgt-28 transformation events (T,) were 0258 Results of Todgt-28 corn plants demonstrate that allowed to acclimate in the greenhouse and were grown until tolerance to glyphosate was achieved up to 4480 g ae/ha. plants had transitioned from tissue culture to greenhouse Table 20. Minimal stunting and overall plant growth of trans growing conditions (i.e., 2-4 new, normal looking leaves had formed plants compared to the non-transformed controls emerged from the whorl). Plants were grown at 27°C. under demonstrated that dgt-28 provides robust protection to gly 16 hour light:8 hour dark conditions in the greenhouse. The phosate when linked to TraP5, TraP8, and TraP23. plants were then treated with commercial formulations of DURANGO DMATM (containing the herbicide glyphosate) TABLE 20 with the addition of 2% w/v ammonium-sulfate. Herbicide Response of Todgt-28 events of varying copy numbers applications were made with a track sprayer at a spray Volume to rates of glyphosate ranging from 280-4480 gae?ha + of 187 L/ha, 50-cm spray height. To plants were sprayed with 2.0% w/v annonium sulfate 14 days after treatment. a range of glyphosate from 280-4480 gae/ha glyphosate, which is capable of significant injury to untransformed corn %. Iniury %. Iniury lines. A lethal dose is defined as the rate that causes >95% 20- Std. Range injury to the B104 inbred. Application Rate <20%. 40% -40% Awe Dew. (%) 0254 The results of the To dgt-28 corn plants demon strated that tolerancetoglyphosate was achieved at rates up to TraP4 dgt-28 4480 g ae/ha. A specific media type was used in the To Ogae?ha glyphosate 4 O O O.O O.O O generation. Minimal stunting and overall plant growth of 280 gae?ha 5 O O 1.O 2.2 O-5 560 gae?ha 6 O O 2.0 4.0 O-10 transformed plants compared to the non-transformed controls 1120 gae?ha 12 O O 1.3 3.1 O-10 demonstrated that dgt-28 provides robust tolerance to gly 2240 gae?ha 7 O O 1.7 4.5 O-12 phosate when linked to the TraP5, TraP8, and TraP23 chlo 4480 gae?ha 7 O O 1.1 3.0 O-8 roplast transit peptides. TraP8 dgt-28 0255. Selected To plants are selfed or backcrossed for fur Ogae?ha glyphosate 6 O O O.O O.O O ther characterization in the next generation. 100 chosen dgt 280 gae?ha 5 1 O 6.7 8.8 O-2O 28 lines containing the T plants are sprayed with 140-1120 g 560 gae?ha O 2 O 2O.O O.O 2O ae/ha glufosinate or 105-1680 gae/ha glyphosate. Both the 1120 gae?ha 7 O O 1.4 2.4 O-5 2240 gae?ha 3 1 O 7.5 1S.O O-30 selectable marker and glyphosate resistant gene are con 4480 gae?ha 6 O O 1.7 4.1 O-10 structed on the same plasmid. Therefore, if one herbicide TraP23 dgt-28 tolerant gene is selected for by spraying with an herbicide, both genes are believed to be present. At 14 DAT, resistant and Ogae?ha glyphosate 6 O O O.8 2.0 O-5 280 gae?ha 7 O O O.O O.O O sensitive plants are counted to determine the percentage of 560 gae?ha 4 O O 1.3 2.5 O-5 lines that segregated as a single locus, dominant Mendelian 1120 gae?ha 10 2 O 3.3 7.8 O-2O trait (3R:1S) as determined by Chi square analysis. These 2240 gae?ha 6 O O 1.3 3.3 O-8 data demonstrate that dgt-28 is inheritable as a robust glypho 4480 gae?ha 6 1 O 4.3 7.9 O-2O sate resistance gene in a monocot species. Increased rates of TraP5 dgt-28 glyphosate are applied to the T or F survivors to further Ogae?ha glyphosate 4 O O O.O O.O O characterize the tolerance and protection that is provided by 280 gae?ha 7 1 O S.O 14.1 O-40 the dgt-28 gene. 560 gae?ha 8 O O O6 1.8 O-5 1120 gae?ha 7 1 O S.O 14.1 O-40 0256 Post-Emergence Herbicide Tolerance in dgt-28 2240 gae?ha 8 O O O.O O.O O Transformed To Corn. 4480 gae?ha 8 O O O.O O.O O 0257 To events ofdgt-28 linked with TraP4, TraP5, TraP8 and TraP23 were generated by Agrobacterium transformation and were allowed to acclimate under controlled growth cham 0259 Protein expression analyses by standard ELISA ber conditions until 2-4 new, normal looking leaves had demonstrated a mean range of DGT-28 protein from 12.6- emerged from the whorl. Plants were assigned individual 22.5 ng/cm across the constructs tested. identification numbers and sampled for copy number analy 0260 Confirmation of Glyphosate Tolerance in the F ses of both dgt-28 and aad-1. Based on copy number analyses, Generation Under Greenhouse Conditions. plants were selected for protein expression analyses. Plants 0261 Single copy To plants that were not sprayed were were transplanted into larger pots with new growing media backcrossed to the non-transformed background B104 for and grown at 27°C. under 16 hour light:8 hour dark condi further characterization in the next generation. In the Tigen tions in the greenhouse. Remaining plants that were not eration, glyphosate tolerance was assessed to confirm the US 2013/0205440 A1 Aug. 8, 2013

inheritance of the dgt-28 gene. For T plants, the herbicide crossing T events in the maize transformation line B104 to ASSURE IITM (35 gae/ha quizalofop-methyl) was applied at the inbred line 4XP811 generating hybrid populations segre the V1 growth stage to select for the AAD-1 protein. Both the gating 1:1 (hemizygous: null) for the event. The resulting selectable marker and glyphosate resistant gene are con seeds were shipped to 2 separate locations. A total of five structed on the same plasmid. Therefore if one gene is single copy events per construct were planted at each location selected, both genes are believed to be present. After 7 DAT, in a randomized complete block design in triplicate. The resistant and sensitive plants were counted and null plants fields were designed for glyphosate applications to occur at were removed from the population. These data demonstrate the V4 growth stage and a separate grouping of plants to be that dgt-28 (V1) is heritable as a robust glyphosate resistance applied at the V8 growth stage. The 4XP81 1/B104 conven gene in a monocot species. Plants were sampled for charac tional hybrid was used as a negative control. terization of DGT-28 protein by standard ELISA and RNA 0265 Experimental rows were treated with 184 gae?ha transcript level. Resistant plants were sprayed with 560-4480 ASSURE IITM (106 gai/L quizalofop-methyl) to eliminate gae/ha glyphosate as previously described. The data demon null segregants. All experimental entries segregated 1:1 (sen strate robust tolerance of dgt-28 linked with the chloroplast sitive:resistant) (p=0.05) with respect to the ASSURE IITM transit peptides TraP4, TraP5, TraP8 and TraP23 up to 4480 g application. Selected resistant plants were sampled from each ae/ha glyphosate. Table 21. event for quantification of the DGT-28 protein by standard ELISA. TABLE 21 0266 Quizalofop-methyl resistant plants were treated Response of F1 single copy dgt-28 events to rates with the commercial herbicide DURANGO DMATM (480 g of glyphosate ranging from 560-4480 gae?ha + ae/L glyphosate) with the addition of 2.5% w/v ammonium 2.0% WV annonium Sulfate 14 days after treatment. sulfate at either the V4 or V8 growth stages. Herbicide appli %. Iniury %. Iniury cations were made with a boom sprayer calibrated to deliver a volume of 187 L/ha, 50-cm spray height. Plants were 20- Std. Range sprayed with a range of glyphosate from 1120-4480 gae?ha Application Rate <20% 40% -40% Ave Dew. (%) glyphosate, capable of significant injury to untransformed B104/TraP4:dgt-28 corn lines. A lethal dose is defined as the rate that causes Ogae?ha glyphosate 4 O O O.O O.O O >95% injury to the 4XP811 inbred. Visual injury assessments 560 gae?ha 4 O O O.O O.O O were taken for the percentage of visual chlorosis, percentage 120 gae?ha 4 O O 9.O 1.2 8-10 of necrosis, percentage of growth inhibition and total visual 2240 gae?ha 4 O O 2.5 2.9 O-5 injury at 7, 14 and 21 DAT (days after treatment). Assess 4480 gae?ha 4 O O O.O O.O O ments were compared to the untreated checks for each line B104/TraP8:dgt-28 and the negative controls. Ogae?ha glyphosate 4 O O O.O O.O O 560 gae?ha 4 O O 1.3 2.5 O-5 0267 Visual injury data for all assessment timings dem 120 gae?ha 4 O O O.O O.O O onstrated robust tolerance up to 4480 gae/ha DURANGO 2240 gae?ha 4 O O S.O 4.1 O-10 DMATM at both locations and application timings. Represen 4480 gae?ha 4 O O 6.3 2.5 S-10 tative events for the V4 application are presented from one B104/TraP23:dgt-28 location and are consistent with other events, application Ogae?ha glyphosate 4 O O O.O O.O O timings and locations. Table 22. One event from the construct 560 gae?ha 3 1 O 1OO 10.O 5-25 containing dgt-28 linked with TraP23 (pDAB 107665) was 120 gae?ha 2 2 O 18.8 11.8 10-35 2240 gae?ha 4 O O 12.S 29 10-15 tolerant to the ASSURE IITM selection for the AAD-1 protein, 4480 gae?ha 3 1 O 1O.O 7.1 S-20 but was sensitive to all rates of glyphosate applied. B104/TraP5:dgt-28 TABLE 22 Ogae?ha glyphosate 4 O O O.O O.O O 560 gae?ha 4 O O 8.O O.O 8 Response of dgt-28 events applied with a range 120 gae?ha 4 O O 11.3 3.0 8-15 of glyphosate from 1120-4480 gae?ha + 2.5% 2240 gae?ha 4 O O 12.S 29 10-15 w/v annonium sulfate at the V4 growth stage. 4480 gae?ha 4 O O 1O.O 2.5 10-15 Non-transformed B104 90 Iniury 90 Iniury Ogae?ha glyphosate 4 O O O.O O.O O 20- Std. Range 560 gae?ha O O 4 100.0 OO 100 Application Rate <20%. 40% -40% Awe Dew. (%) 1120 gae?ha O O 4 100.0 OO 100 2240 gae?ha O O 4 100.0 OO 100 4XPB11. B104f 4480 gae?ha O O 4 100.0 OO 100 TraP4::dgt-28

Ogae?ha glyphosate 4 O O O.O O.O O 0262 Protein expression data demonstrate a range of 1120 gae?ha 4 O O O.O O.O O 2240 gae?ha 4 O O O.O O.O O mean DGT-28 protein from 42.2-88.2 ng/cm across T. 4480 gae?ha 4 O O O.O O.O O events and constructs tested, establishing protein expression 4XPB11. B104f in the T generation. TraP8:dgt-28 0263 Characterization of dgt-28 Corn Under Field Con ditions. Ogae?ha glyphosate 4 O O O.O O.O O 1120 gae?ha 4 O O O.O O.O O 0264. Single copy Tevents were sent to a field location to 2240 gae?ha 4 O O O.O O.O O create both hybrid hemizygous and inbred homozygous seed 4480 gae?ha 4 O O O.O O.O O for additional characterization. Hybrid seeds were created by US 2013/0205440 A1 Aug. 8, 2013 34

TABLE 22-continued TABLE 23 Response of homozygous dgt-28 events applied with a range of Response of digt-28 events applied with a range glyphosate from 1120-4480 gae/ha + 2.0% WV annonium Sulfate. of glyphosate from 1120-4480 gae?ha + 2.5% wiv ammonium sulfate at the V4 growth stage. %. Iniury %. Iniury 20- Std. Range % Injury % Injury Application Rate <20%. 40% -40% Ave Dew. (%) 20- Std. Range TraP4::dgt-28 Application Rate <20%. 40% -40% Awe Dew. (%) Ogae?ha glyphosate 4 O O O.O O.O O 120 gae?ha 4 O O O.O O.O O 4XPB11. B104, 2240 gae?ha 4 O O 3.8 2.5 O-5 TraP23:dgt-28 4480 gae?ha 4 O O 14.3 1.5 12-15 TraP8:dgt-28 Ogae?ha glyphosate 4 O O O.O O.O O Ogae?ha glyphosate 4 O O O.O O.O O 1120 gae?ha 4 O O O.O O.O O 120 gae?ha 4 O O O.O O.O O 2240 gae?ha 4 O O O.O O.O O 2240 gae?ha 4 O O 9.O 1.2 8-10 4480 gae?ha 4 O O 11.3 2.5 10-15 4480 gae?ha 4 O O O.O O.O O raP23:dgt-28 4XPB11. B104, TraP5:dgt-28 Ogae?ha glyphosate 4 O O O.O O.O O 120 gae?ha 4 O O 4S 3.3 O-8 2240 gae?ha 4 O O 7.5 2.9 S-10 Ogae?ha glyphosate 4 O O O.O O.O O 4480 gae?ha 4 O O 1S.O. O.O 15 1120 gae?ha 4 O O O.O O.O O TraP5:dgt-28 2240 gae?ha 4 O O O.O O.O O Ogae?ha glyphosate 4 O O O.O O.O O 4480 gae?ha 4 O O O.O O.O O 120 gae?ha 4 O O 1.3 2.5 O-5 Non-transformed 2240 gae?ha 4 O O 9.0 2.0 8-12 4XPB11. B104 4480 gae?ha 4 O O 15.O 2.4 12-18 Non-transformed B104

Ogae?ha glyphosate 4 O O O.O O.O O Ogae?ha glyphosate 4 O O O.O O.O O 1120 gae?ha O O 4 1OO.O O.O 100 1120 gae?ha O O 4 1OOO O.O 1OO 2240 gae?ha O O 4 1OOO O.O 1OO 2240 gae?ha O O 4 1OO.O O.O 100 4480 gae?ha O O 4 1OOO O.O 1OO 4480 gae?ha O O 4 1OO.O O.O 100 (0271 The line from pl)AB 107665 that was not tolerant 0268 Additional assessments were made during the under field conditions demonstrated no tolerance to glypho reproductive growth stage for the 4480 gae/ha glyphosate sate and therefore consistent with field observations (data not shown). With the exception of the one line previously men rate. Visual assessments of tassels, pollination timing and ear tioned, all replicates that were treated with glyphosate from fill were similar to the untreated checks of each line for all the lines were not sensitive to glyphosate. Therefore data constructs, application timings and locations. Quantification demonstrates heritability to a homogeneous population of results for the DGT-28 protein demonstrated a range of mean dgt-28 corn in a Mendelian fashion. Expression of the DGT protein expression from 186.4-303.0 ng/cm. Data demon 28 protein by standard ELISA demonstrated a range of mean strates robust tolerance ofdgt-28 transformed corn underfield protein expression from 27.5-65.8 ng/cm across single copy conditions through the reproductive growth stages up to 4480 events that were tolerant to glyphosate. Data demonstrates gae/ha glyphosate. Data also demonstrated DGT-28 protein functional protein and stability of the DGT-28 protein across detection and function based on spray tolerance results. generations. 0269 Confirmation of Heritability and Tolerance of dgt 0272 Postemergence Herbicide Tolerance Use of Gly 28 Corn in the Homozygous State. phosate as a Selectable Marker. (0273. As previously described. To transformed plants 0270. Seed from the T52 were planted undergreenhouse were moved from tissue culture and acclimated in the green conditions as previously described. The same five single copy house. The events tested contained dgt-28 linked to TraP5, lines that were characterized under field conditions were TraP8, and TraP23 chloroplast transit peptides. It was dem characterized in the homogeneous state. Plants were grown onstrated that these To plants provided robust tolerance up to until the V3 growth stage and separated into three rates of 4480 gae/ha glyphosate, and non-transformed plants were glyphosate ranging from 1120-4480 gae/ha glyphosate (DU controlled with glyphosate at concentrations as low as 280 g RANGO DMATM) and four replicates per treatment. Appli ae/ha. These data demonstrate that dgt-28 can be utilized as a cations were made in a track sprayer as previously described selectable marker using a concentration of glyphosate rang and were formulated in 2.0% w/v ammonium sulfate. An ing from 280-4480 gae/ha. application of ammonium Sulfate served as an untreated 0274. A number of seed from fixed lines of corn which check for each line. Visual assessments were taken 7 and 14 contain the dgt-28 transgene are spiked into a number of days after treatment as previously described. Data demon non-transformed corn seed. The seed are planted and allowed strated robust tolerance up to 4480 gae/ha glyphosate for all to grow to the V1-V3 developmental stage, at which time the events tested. Table 23. plantlets are sprayed with a selecting dose of glyphosate in the US 2013/0205440 A1 Aug. 8, 2013 range of 280-4480 gae/ha. Following 7-10 days, sensitive and are Supplemented with cefotaxime, timentin and Vancomycin resistant plants are counted, and the amount of glyphosate for removal of Agrobacterium. Selection via a herbicide is tolerant plants correlates with the original number of trans employed to inhibit the growth of non-transformed shoots. genic seed containing the dgt-28 transgene which are planted. Selected shoots are transferred to rooting medium for root (0275 Stacking of dgt-28 Corn. development and then transferred to soil mix for acclimati Zation of plantlets. 0276. The AAD-1 protein is used as the selectable marker 0281 Terminal leaflets of selected plantlets are treated in dgt-28 transformed corn for research purposes. The aad-l topically (leaf paint technique) with a herbicide to screen for gene can also be utilized as a herbicide tolerant trait in corn to putative transformants. The screened plantlets are transferred provide robust 2,4-D tolerance up to a V8 application in a to the greenhouse, allowed to acclimate and then leaf-painted crop. Four events from the constructs p)AB107663 (TraP4:: with an herbicide to reconfirm tolerance. These putative dgt-28), pIDAB 107664 (TraP8::dgt-28) and pL)AB107666 transformed To plants are sampled and molecular analyses is (TraP5::dgt-28) were characterized for the tolerance of a tank used to confirm the presence of the herbicidal selectable mix application of glyphosate and 2,4-D. The characteriza marker, and the dgt-28 transgene. To plants are allowed to self tion study was completed with F seed under greenhouse fertilize in the greenhouse to produce T seed. conditions. Applications were made in a track sprayer as 0282. A second soybean transformation method can be previously described at the following rates: 1120-2240 g used to produce additional transgenic soybean plants. A dis ae/ha glyphosate (selective for the dgt-28 gene), 1120-2240 g armed Agrobacterium Strain carrying a binary vector contain ae/ha 2.4-D (selective for the aad-1 gene), or a tank mixture of ing a functional dgt-28 is used to initiate transformation. the two herbicides at the rates described. Plants were graded 0283 Agrobacterium-mediated transformation is carried at 7 and 14 DAT. Spray results for applications of the herbi out using a modified half-seed procedure of Paz et al., (Paz cides at 2240 gae/ha are shown in Table 24. M., Martinez, J., Kalvig A., Fonger T., and Wang K. (2005) Plant Cell Rep., 25: 206-213). Briefly, mature soybean seeds are sterilized overnight with chlorine gas and imbibed with TABLE 24 sterile HO twenty hours before Agrobacterium-mediated Response of Faad-1 and dgt-28 corn sprayed with 2240 plant transformation. Seeds are cut in half by a longitudinal gae/ha of 2,4-D, glyphosate and a tank mix combination cut along the hilum to separate the seed and remove the seed of the two herbicides 14 days after treatment. coat. The embryonic axis is excised and any axial shoots/buds 2240 gae?ha 2240 gae?ha 2240 gae?ha 24-D + are removed from the cotyledonary node. The resulting half 2,4-D glyphosate 2240 gae/ha glyphosate seed explants are infected with Agrobacterium. Shoot initia tion, shoot elongation, and rooting media are supplemented Mean Mean Mean with cefotaxime, timentin and Vancomycin for removal of % Std. % Std. % Std. Agrobacterium. Herbicidal selection is employed to inhibit F Event injury Dev. injury Dev. injury Dew. the growth of non-transformed shoots. Selected shoots are 1076633- S.O 4.1 3.8 4.8 8.8 3.0 transferred to rooting medium for root development and then O12AJOO1 1076633- 2.5 S.O 1.3 2.5 S.O 5.8 transferred to soil mix for acclimatization of plantlets. O29AJOO1 0284 Terminal leaflets of selected plantlets are treated 1076633- 2.5 2.9 11.8 2.9 13.8 2.5 topically (leaf paint technique) with a herbicide to screen for O27AJOO1 putative transformants. The screened plantlets are transferred 1076633- 3.8 2.5 115 1.O 12.8 1.5 O11AJOO1 to the greenhouse, allowed to acclimate and then leaf-painted B104 27.5 17.7 100.0 O.O 1OO.O O.O with a herbicide to reconfirm tolerance. These putative trans formed T plants are sampled and molecular analyses is used to confirm the presence of the selectable marker and the 0277. The results confirm that dgt-28 can be successfully dgt-28 transgene. Several events are identified as containing stacked with aad-1, thus increasing the spectrum herbicides the transgenes. These T, plants are advanced for further that may be applied to the crop of interest (glyphosate+phe analysis and allowed to self fertilize in the greenhouse to give noxyactetic acids for dgt-28 and aad-1 respectively). In crop rise to T seed. production where hard to control broadleafweeds or resistant (0285 Confirmation of Heritability of dgt-28 to the T1 weed biotypes exist the stack can be used as a means of weed Generation. control and protection of the crop of interest. Additional input 0286. Heritability of the DGT-28 protein into T. genera or output traits can also be stacked with the dgt-28 gene in tion was assessed in one of two ways. The first method corn and other plants. included planting T. Seed into Metro-mix media and applying 0278 Soybean Transformation. 411 gae/ha IGNITETM 280SL on germinated plants at the 1 0279 Transgenic soybean (Glycine max) containing a sta trifoliate growth stage. The second method consisted of bly integrated dgt-28 transgene is generated through Agro homogenizing seed for a total of 8 replicates using a ball bacterium-mediated transformation of soybean cotyledonary bearing and a genogrinder. ELISA strip tests to detect for the node explants. A disarmed Agrobacterium strain carrying a PAT protein were then used to detect heritable events as the binary vector containing a functionaldgt-28 is used to initiate selectable marker was on the same plasmid as dgt-28. For transformation. either method if a single plant was tolerant to glufosinate or 0280 Agrobacterium-mediated transformation is carried was detected with the PAT ELISA strip test, the event dem out using a modified half-cotyledonary node procedure of onstrated heritability to the T generation. Zeng et al. (Zeng P. Vadnais D. A., Zhang Z., Polacco J. C., 0287. A total of five constructs were screened for herita (2004), Plant Cell Rep., 22(7): 478-482). Briefly, soybean bility as previously described. The plasmids contained dgt-28 seeds (cv. Maverick) are germinated on basal media and linked with TraP4, TraP8 and TraP23 The events across con cotyledonary nodes are isolated and infected with Agrobac structs demonstrated 68% heritability of the PAT:DGT-28 terium. Shoot initiation, shoot elongation, and rooting media protein to the T generation. US 2013/0205440 A1 Aug. 8, 2013 36

0288 Postemergence Herbicide Tolerance in dgt-28 TABLE 25-continued Transformed T. Soybean. Spray results demonstrate at 14 DAT (days after treatment) robust 0289. Seeds from T. events that were determined to be tolerance up to 4480 gae?ha glyphosate of at least one dgt-28 heritable by the previously described screening methods were event per construct characterized. Representative single copy planted in Metro-mix media under greenhouse conditions. events of the constructs all provided tolerance up to 4480 g Plants were grown until the 1 trifoliate was fully expanded ae/ha compared to the Maverick negative control. and treated with 411 gae/ha IGNITETM 280SL for selection of the pat gene as previously described. Resistant plants from %. Iniury %. Iniury each event were given unique identifiers and sampled for 20- Std. Range Zygosity analyses of the dgt-28 gene. Zygosity data were used Application Rate <20%. 40% -40% Ave Dew. (%) to assign 2 hemizygous and 2 homozygous replicates to each 1120 gae?ha O O 4 100.O O.O 100 rate of glyphosate applied allowing for a total of 4 replicates 2240 gae?ha O O 4 100.O O.O 100 per treatment when enough plants existed. These plants were 4480 gae?ha O O 4 100.O O.O 100 compared against wildtype Petite havana tobacco. All plants were sprayed with a track sprayer set at 187 L/ha. The plants 0290 dgt-28 Protection Against Elevated Glyphosate were sprayed from a range of 560-4480 g ae?ha Rates in the T. Generation. DURANGOTM dimethylamine salt (DMA). All applications 0291. A 45 plant progeny test was conducted on two to five were formulated in water with the addition of 2% w/v ammo T lines of dgt-28 per construct. Homozygous lines were nium sulfate (AMS). Plants were evaluated at 7 and 14 days chosen based on Zygosity analyses completed in the previous after treatment. Plants were assigned an injury rating with generation. The seeds were planted as previously described. respect to overall visual stunting, chlorosis, and necrosis. The Plants were then sprayed with 411 gae/ha IGNITE280SL for T generation is segregating, so some variable response is the selection of the pat selectable marker as previously expected due to difference in Zygosity. described. After 3 DAT, resistant and sensitive plants were counted. TABLE 25 0292 For constructs containing TraP4 linked with dgt-28 Spray results demonstrate at 14 DAT (days after treatment) robust (pDAB 107543 and plDAB 107548), nine out of twelve lines tolerance up to 4480 gae?ha glyphosate of at least one dgt-28 tested did not segregate, thereby confirming homogeneous event per construct characterized. Representative single copy lines in the T. generation. Lines containing TraP8 linked with events of the constructs all provided tolerance up to 4480 g dgt-28 (pDAB107545) demonstrated two out of the four lines ae/ha compared to the Maverick negative control. with no segregants and demonstrating Mendelian inheritance %. Iniury %. Iniury through at least two generation of digt-28 in soybean. Tissue samples were taken from resistant plants and the DGT-28 20- Std. Range protein was quantified by standard ELISA methods. Data Application Rate <20% 40% -40% Ave Dew. (%) demonstrated a range of mean DGT-28 protein from 32.8- pDAB107543 107.5 ng/cm for non-segregating T lines tested. Lines from (TraP4::dgt-28) the construct pIDAB107553 (TraP23:dgt-28) were not previ Ogae?ha glyphosate 4 O O O.O O.O O ously selected with glufosinate, and the dose response of 560 gae?ha O 4 O 33.8 7.5 25-40 glyphosate was utilized as both to test homogenosity and 1120 gae?ha 2 2 O 2SO 11.5 15-35 tolerance to elevated rates of glyphosate. Replicates from the 2240 gae?ha 2 2 O 17.5 2.9 15-20 4480 gae?ha O 2 2 33.8 13.1 20-45 lines from construct pl)AB 107553 were tolerant to rates pDAB107545 ranging from 560-4480 gae/ha glyphosate, and were there (TraP8:dgt-28) fore confirmed to be a homogeneous population and heritable to at least two generations. Ogae?ha glyphosate 4 O O O.O O.O O 560 gae?ha 4 O O 1.5 1.O O-2 0293 Rates of DURANGODMA ranging from 560-4480 1120 gae?ha 4 O O 2.8 1.5 2-5 gae/ha glyphosate were applied to 2-3 trifoliate Soybean as 2240 gae?ha 4 O O S.O 2.4 2-8 previously described. Visual injury data 14 DAT confirmed 4480 gae?ha 4 O O 9.5 1.9 8-12 pDAB107548 the tolerance results that were demonstrated in the Tigenera (TraP4::dgt-28) tion. Ogae?ha glyphosate 4 O O O.O O.O O TABLE 26 560 gae?ha 4 O O 1.8 24 O-5 1120 gae?ha 4 O O 2.8 1.5 2-5 The data demonstrate robust tolerance of the dgt-28 2240 gae?ha 4 O O 3.5 1.7 2-5 tobacco up to 3360 gae?ha glyphosate through two generations, 4480 gae?ha 4 O O 8.8 3.0 S-12 compared to the non-transformed control. pDAB107553 (TraP23::dgt-28) 90 Iniury 90 Iniury Ogae?ha glyphosate 4 O O O.O O.O O 20- Std. Range 560 gae?ha 4 O O S.O. O.O 5 Application Rate <20%. 40% -40% Ave Dew. (%) 1120 gae?ha 4 O O 9.0 1.2 8-10 2240 gae?ha 4 O O 1O.S 1.0 10-12 pDAB107543 4480 gae?ha 4 O O 16.5 1.7 15-18 (TraP4::dgt-28) Maverick (neg. control) Ogae?ha glyphosate 4 O O O.O O.O O Ogae?ha glyphosate 4 O O O.O O.O O 560 gae?ha 4 O O 8.O O.O 8 560 gae?ha O O 4 82.5 12.6 7.O-100 1120 gae?ha 4 O O 14.3 1.5 12-15 US 2013/0205440 A1 Aug. 8, 2013 37

TABLE 26-continued the appropriate herbicide selective agent for 3-4 weeks. Pre regeneration is performed on medium (PRHSO) consisting of The data demonstrate robust tolerance of the dgt-28 NB medium with 2,4-dichlorophenoxyacetic acid (2,4-D), 1 tobacco up to 3360 gae?ha glyphosate through two generations, mg/l C.-naphthaleneacetic acid (NAA), 5 mg/l abscisic acid compared to the non-transformed control. (ABA) and selective herbicide for 1 week. Regeneration of %. Iniury %. Iniury plantlets follow the culturing on regeneration medium (RNH5O) comprising NB medium containing 2,4-D, 0.5 mg/1 20- Std. Range NAA, and selective herbicide until putatively transgenic Application Rate <20% 40% -40% Ave Dew. (%) shoots are regenerated. Shoots are transferred to rooting 4 O O 18.0 O.O 18 medium with half-strength Murashige and Skoog basal salts 4480 gae?ha O 4 O 24.S 3.3 20-28 pDAB107545 and Gamborg's B5 vitamins, supplemented with 1% sucrose (TraP8:dgt-28) and selective herbicide. 0298 Mature desiccated seeds of Oryza sativa L. japonica Ogae?ha glyphosate 4 O O O.O O.O O 560 gae?ha 4 O O O.O O.O O cv. Taipei 309 are sterilized as described in Zhanget al. 1996. 1120 gae?ha 4 O O 2.8 1.5 2-5 Embryogenic tissues are induced by culturing sterile mature 2240 gae?ha 4 O O S.O. O.O 5 rice seeds on NB medium in the dark. The primary callus 4480 gae?ha 4 O O 1.O.O. O.O 10 approximately 1 mm in diameter, is removed from the scutel pDAB107548 lum and used to initiate cell Suspension in SZ liquid medium. (TraP4::dgt-28) Suspensions are then maintained as described in Zhang 1996. Ogae?ha glyphosate 4 O O O.O O.O O Suspension-derived embryogenic tissues are removed from 560 gae?ha 4 O O O.O O.O O liquid culture 3-5 days after the previous subculture and 1120 gae?ha 4 O O O.O O.O O 2240 gae?ha 4 O O O.O O.O O placed on NBO osmotic medium to form a circle about 2.5 cm 4480 gae?ha 4 O O 1.O.O. O.O 10 across in a petri dish and cultured for 4 h prior to bombard pDAB107553 ment. Sixteen to twenty hours after bombardment, tissues are (TraP23::dgt-28) transferred from NBO medium onto NBH50 selection Ogae?ha glyphosate medium, ensuring that the bombarded surface is facing 560 gae?ha upward, and incubated in the dark for 14-17 days. Newly 1120 gae?ha formed callus is then separated from the original bombarded 2240 gae?ha explants and placed nearby on the same medium. Following 4480 gae?ha an additional 8-12 days, relatively compact, opaque callus is Maverick (neg. control) visually identified, and transferred to PRH50 pre-regenera Ogae?ha glyphosate 4 O O O.O O.O O tion medium for 7 days in the dark. Growing callus, which 560 gae?ha O O 4 77.5 15.O 70-100 become more compact and opaque is then Subcultured onto 1120 gae?ha O O 4 97.5 2.9 95-100 2240 gae?ha O O 4 100.0 OO 100 RNH50 regeneration medium for a period of 14-21 days 4480 gae?ha O O 4 100.0 OO 100 under a 16-h photoperiod. Regenerating shoots are trans ferred to MAGENTA boxes containing /2 MSH50 medium. Multiple plants regenerated from a single explant are consid 0294 Transformation of Rice with dgt-28. ered siblings and are treated as one independent plant line. A 0295. In an exemplary transformation method, transgenic plant is scored as positive for the dgt-28 gene if it produces rice (Oryza sativa) containing a stably integrated dgt-28 thick, white roots and grows vigorously on /2 MSH50 transgene is generated through Agrobacterium-mediated medium. Once plantlets reach the top of the MAGENTA transformation of sterilized rice seed. A disarmed Agrobac boxes, they are transferred to soil in a 6-cm pot under 100% terium strain carrying a binary vector containing a functional humidity for a week, and then are moved to a growth chamber dgt-28 is used to initiate transformation. with a 14-hlight period at 30° C. and in the dark at 21°C. for 0296 Culture media are adjusted to pH 5.8 with 1 MKOH 2-3 weeks before transplanting into 13-cm pots in the green and solidified with 2.5 g/l Phytagel (Sigma-Aldrich, St. house. Seeds are collected and dried at 37° C. for one week Louis, Mo.). Embryogenic calli are cultured in 100x20 mm prior to storage at 4°C. petri dishes containing 30 ml semi-solid medium. Rice plant 0299 To Analysis of dgt-28 Rice. lets are grown on 50 ml medium in MAGENTA boxes. Cell 0300 Transplanted rice transformants produced via Agro Suspensions are maintained in 125 ml conical flasks contain bacterium transformation were transplanted into media and ing 35 mL liquid medium and rotated at 125 rpm. Induction acclimated to greenhouse conditions. All plants were and maintenance of embryogenic cultures occur in the dark at sampled for PCR detection of dgt-28 and results demonstrate 25-26°C., and plant regeneration and whole-plant culture twenty-two PCR positive events for plDAB110827 (TraP8: occur in illuminated room with a 16-hphotoperiod (Zhanget dgt-28) and a minimum of sixteen PCR positive events for al. 1996). pDAB110828 (TraP23:dgt-28). Southern analysis fordgt-28 0297 Induction and maintenance of embryogenic callus is of the PCR positive events demonstrated simple (1-2 copy) performed on a modified NB basal medium as described events for both constructs. Protein expression of selected To previously (Li et al. 1993), wherein the media is adapted to events demonstrated DGT-28 protein expression ranges from contain 500 mg/L glutamine. Suspension cultures are initi below levels of detection to 130 ng/cm. Selected T, events ated and maintained in SZ liquid medium (Zhang et al. 1998) from construct pl)AB110828 were treated with 2240 gae?ha with the inclusion of 30 g/L Sucrose in place of maltose. DURANGODMATM as previously described and assessed 7 Osmotic medium (NBO) consisting of NB medium with the and 14 days after treatment. Data demonstrated robust toler addition of 0.256 Meach of mannitol and sorbitol. Herbicide ance to the rate of glyphosate applied. All PCR positive plants resistant callus is selected on NB medium supplemented with were allowed to produce T seed for further characterization. US 2013/0205440 A1 Aug. 8, 2013

0301 Dgt-28 Heritability in Rice. 28 rice up to 2240 gae/ha glyphosate following an application 0302. A 100 plant progeny test was conducted on four T of 560 gae/ha glyphosate used for selection. lines of dgt-28 from construct pl)AB110827 containing the 0307 Transformation of Tobacco with dgt-28. chloroplast transit peptide TraP8. The seeds were planted into 0308 Tobacco (cv. Petit Havana) leaf pieces are trans pots filled with media. All plants were then sprayed with 560 formed using Agrobacterium tumefaciens containing the dgt gae/ha DURANGO DMATM for the selection of the dgt-28 28 transgene. Single colonies containing the plasmid which gene as previously described. After 7 DAT, resistant and contains the dgt-28 transgene are inoculated into 4 mL of YEP sensitive plants were counted. Two out of the four lines tested medium containing spectinomycin (50 g/mL) and strepto for each construct segregated as a single locus, dominant mycin (125 ug/mL) and incubated overnight at 28°C. on a Mendelian trait (3R:1S) as determined by Chi square analy shaker at 190 rpm. The 4 mL seed culture is subsequently sis. Dgt-28 is a heritable glyphosate resistance gene in mul used to inoculatea 25 mL culture of the same medium in a 125 tiple species. mL baffled Erlenmeyer flask. This culture is incubated at 28° C. shaking at 190 rpm until it reaches an ODoo of ~1.2. Ten 0303 Postemergence Herbicide Tolerance in dgt-28 mL of Agrobacterium Suspension are then placed into sterile Transformed T. Rice. 60x20 mm PetriTM dishes. 0304 T resistant plants from each event used in the prog (0309 Freshly cut leaf pieces (0.5 cm) from plants asep eny testing were given unique identifiers and sampled for tically grown on MS medium (Phytotechnology Labs, Shaw Zygosity analyses of the dgt-28 gene. Zygosity data were used nee Mission, Kans.) with 30 g/L Sucrose in PhytaTraysTM to assign 2 hemizygous and 2 homozygous replicates to each (Sigma, St. Louis, Mo.) are soaked in 10 mL of overnight rate of glyphosate applied allowing for a total of 4 replicates culture of Agrobacterium for a few minutes, blotted dry on per treatment. These plants were compared against wildtype sterile filter paper and then placed onto the same medium with kitaake rice. All plants were sprayed with a track sprayer set the addition of 1 mg/L indoleacetic acid and 1 mg/L 6-ben at 187 L/ha. The plants were sprayed from a range of 560 Zylamino purine. Three days later, leaf pieces co-cultivated 2240 gae/ha DURANGO DMATM. All applications were with Agrobacterium harboring the dgt-28 transgene are trans formulated in water with the addition of 2% w/v ammonium ferred to the same medium with 5 mg/L BastaTM and 250 sulfate (AMS). Plants were evaluated at 7 and 14 days after mg/L cephotaxime. treatment. Plants were assigned an injury rating with respect 0310. After 3 weeks, individual Toplantlets are transferred to overall visual stunting, chlorosis, and necrosis. The T to MS medium with 10 mg/L BastaTM and 250 mg/L cepho generation is segregating, so some variable response is taxime an additional 3 weeks prior to transplanting to soil and expected due to difference in Zygosity. transfer to the greenhouse. Selected To plants (as identified 0305 Spray results demonstrate at 7 DAT (days after treat using molecular analysis protocols described above) are ment) minimal vegetative injury to elevated rates of glypho allowed to self-pollinate and seed is collected from capsules sate were detected (data not shown). when they are completely dried down. T seedlings are screened for Zygosity and reporter gene expression (as TABLE 27 described below) and selected plants containing the dgt-28 transgene are identified. Visual injury data at 14 DAT demonstrates less than 15% mean visual injury up to 2240 gae/ha glyphosate. 0311 Plants were moved into the greenhouse by washing the agar from the roots, transplanting into Soil in 13.75 cm %. Iniury %. Iniury square pots, placing the pot into a ZiplocR) bag (SCJohnson 20- Std. Range & Son, Inc.), placing tap water into the bottom of the bag, and Application Rate <20% 40% -40% Ave Dew. (%) placing in indirect light in a 30° C. greenhouse for one week. After 3-7 days, the bag was opened; the plants were fertilized TraP8:dgt-28 Event 1 and allowed to grow in the open bag until the plants were Ogae?ha glyphosate 4 O O O.O O.O O greenhouse-acclimated, at which time the bag was removed. 560 gae?ha 4 O O O.O O.O O Plants were grown under ordinary warm greenhouse condi 1120 gae?ha 4 O O O.O O.O O tions (27°C. day, 24°C. night, 16 hour day, minimum natu 2240 gae?ha 4 O O O.O O.O O ral+supplemental light=1200LE/ms'). TraP8:dgt-28 Event 2 0312 Prior to propagation, To plants were sampled for Ogae?ha glyphosate 4 O O O.O O.O O DNA analysis to determine the insert dgt-28 copy number by 560 gae?ha 4 O O 3.8 4.8 O-10 real-time PCR. Fresh tissue was placed into tubes and lyo 1120 gae?ha 4 O O 12.O 3.6 8-15 2240 gae?ha 4 O O 1SO 6.0 8-20 philized at 4°C. for 2 days. After the tissue was fully dried, a Non-transformed control tungsten bead (Valenite) was placed in the tube and the samples were subjected to 1 minute of dry grinding using a Ogae?ha glyphosate 4 O O O.O O.O O Kelco bead mill. The standard DNeasyTM DNA isolation pro 560 gae?ha O O 4 81.3 2.5 80-85 1120 gae?ha O O 4 95.0 S.8 90-100 cedure was then followed (Qiagen, DNeasy 69109). An ali 2240 gae?ha O O 4 96.3 4.8 90-1OO quot of the extracted DNA was then stained with Pico Green (Molecular Probes P7589) and read in the fluorometer (BioTekTM) with known standards to obtain the concentration 0306 Protein detection of DGT-28 was assessed for rep in ng/ul. A total of 100 ng of total DNA was used as template. licates from all four T lines tested from plDAB110827. Data The PCR reaction was carried out in the 9700 GeneampTM demonstrated DGT-28 mean protein ranges from 20-82 thermocycler (Applied Biosystems), by Subjecting the ng/cm and 21-209 ng/cm for homozygous and homozygous samples to 94° C. for 3 minutes and 35 cycles of 94° C. for 30 replicates respectively. These results demonstrated stable seconds, 64°C. for 30 seconds, and 72°C. for 1 minute and 45 protein expression to the T generation and tolerance of dgt seconds followed by 72° C. for 10 minutes. PCR products US 2013/0205440 A1 Aug. 8, 2013 39 were analyzed by electrophoresis on a 1% agarose gel stained TABLE 28-continued with EtBr and confirmed by Southern blots. 0313 Five to nine PCR positive events with 1-3 copies of At a rate of 2240 gae?ha glyphosate, an average injury dgt-28 gene from 3 constructs containing a different chloro of 37.5% was demonstrated with the event containing TraP4, plast transit peptide sequence (TraP4, TraP8 and TraP23) where events containing TraP8 and TraP23 demonstrated were regenerated and moved to the greenhouse. an average injury of 9.3% and 9.5% respectively. 0314 All PCR positive plants were sampled for quantifi cation of the DGT-28 protein by standard ELISA. DGT-28 % Injury % Injury protein was detected in all PCR positive plants and a trend for an increase in protein concentration was noted with increas 20- Std. Range ing copy number of digt-28. Application Rate <20%. 40% -40% Awe Dew. (%) 0315 aad-12 (v1) Heritability in Tobacco. 1120 gae?ha 1 3 O 24.5 4.9 18-30 0316 A 100 plant progeny test was conducted on five T 2240 gae?ha O 3 1 37.5 6.5 30-45 lines ofdgt-28 per construct. Constructs contained one of the 4480 gae?ha O 2 2 42.5 2.9 40-45 following chloroplast transit peptide sequences: TraP4, TraP8:dgt-28 TraP8 or TraP23. The seeds were stratified, sown, and trans (pDAB107545) planted with respect much like that of the Arabidopsis proce dure exemplified above, with the exception that null plants Ogae?ha glyphosate 4 O O O.O O.O O were not removed by in initial selection prior to transplanting. 560 gae?ha 4 O O 3.3 3.9 O-8 All plants were then sprayed with 280 gae/ha IGNITE280SL 1120 gae?ha 4 O O 6.5 1.7 S-8 for the selection of the pat selectable marker as previously 2240 gae?ha 4 O O 9.3 3.0 S-12 described. After 3 DAT, resistant and sensitive plants were 4480 gae?ha 2 2 O 17.5 6.5 10-2S counted. TraP23:dgt-28 0317 Four out of the five lines tested for each construct (pDAB107553) segregated as a single locus, dominant Mendelian trait (3R: 1S) as determined by Chi square analysis. Dgt-28 is a heri Ogae?ha glyphosate 4 O O O.O O.O O table glyphosate resistance gene in multiple species. 560 gae?ha 4 O O 1O.O 1.6 8-12 0318 Postemergence Herbicide Tolerance in dgt-28 1120 gae?ha 4 O O 8.8 3.0 S-12 Transformed T Tobacco. 2240 gae?ha 4 O O 9.5 4.2 5-15 0319 Tresistant plants from each event used in the prog 4480 gae?ha 4 O O 15.8 1.5 15-18 eny testing were given unique identifiers and sampled for Petite havana Zygosity analyses of the dgt-28 gene. Zygosity data were used to assign 2 hemizygous and 2 homozygous replicates to each Ogae?ha glyphosate 4 O O O.O O.O O rate of glyphosate applied allowing for a total of 4 replicates 560 gae?ha O O 4 8S.O 4.1 80-90 per treatment. These plants were compared against wildtype 1120 gae?ha O O 4 91.3 2.5 90-95 Petite havana tobacco. All plants were sprayed with a track 2240 gae?ha O O 4 94.5 3.3 90-98 sprayer set at 187 L/ha. The plants were sprayed from a range 4480 gae?ha O O 4 98.3 2.4 95-100 of 560-4480 gae/ha DURANGO DMATM. All applications were formulated in water with the addition of 2% w/v ammo nium sulfate (AMS). Plants were evaluated at 7 and 14 days 0321. These results demonstrated tolerance of dgt-28 up to after treatment. Plants were assigned an injury rating with 4480 gae?ha glyphosate, as well as differences in tolerance respect to overall visual stunting, chlorosis, and necrosis. The provided by chloroplast transit peptide sequences linked to T generation is segregating, so some variable response is the dgt-28 gene. expected due to difference in Zygosity. 0320 Spray results demonstrate at 7 DAT (days after treat 0322 Dgt-28 Protection Against Elevated Glyphosate ment) minimal vegetative injury to elevated rates of glypho Rates in the T. Generation. sate were detected (data not shown). Following 14 DAT, 0323 A 25 plant progeny test was conducted on two to visual injury data demonstrates increased injury with single three T lines ofdgt-28 per construct. Homozygous lines were copy events of the construct containing TraP4 compared to chosen based on Zygosity analyses completed in the previous single copy events from the constructs TraP8 and TraP23. generation. The seeds were stratified, Sown, and transplanted Table 28. as previously described. All plants were then sprayed with TABLE 28 280 gae/ha Ignite 280SL for the selection of the pat select able marker as previously described. After 3 DAT, resistant At a rate of 2240 gae?ha glyphosate, an average injury and sensitive plants were counted. All lines tested for each of 37.5% was demonstrated with the event containing TraP4, construct did not segregate thereby confirming homogeneous where events containing TraP8 and TraP23 demonstrated an average iniury of 9.3% and 9.5% respectively. lines in the T2 generation and demonstrating Mendelian inheritance through at least two generation of dgt-28 in %. Iniury %. Iniury tobacco. 20- Std. Range 0324 Rates of DURANGO DMATM ranging from 420 Application Rate <20%. 40% -40% Awe Dew. (%) 3360 gae/ha glyphosate were applied to 2-3 leaf tobacco as TraP4::dgt-28 previously described. Visual injury data 14 DAT confirmed (pDAB107543) the tolerance results that were demonstrated in the T1 gen Ogae?ha glyphosate 4 O O O.O O.O O eration. Foliar results from a two copy lines from the con 560 gae?ha 2 2 O 18.0 8.1 10-2S struct containing TraP4 demonstrated similar tolerance to that of single copy TraP8 and TraP23 lines (data not shown). US 2013/0205440 A1 Aug. 8, 2013 40

TABLE 29 TABLE 30 Single copy lines from the construct containing TraP4 with Response of Flaad-12 and dgt-28 dgt-28 demonstrated increased injury compared to lines from aad-12 x aad-12 x constructs containing TraF8 and TraF23 with digit-28. TraP4::dgt-28 TraP8::dgt-28 Petite havana %. Injury %. Injury Application Rate Tolerance 1120 gae?ha 2,4-D ------20- Std. Range 1120 gae?ha glyphosate ------Application Rate <20%. 40% -40% Awe Dew. (%) 1120 gae?ha 2,4-D + ------1120 gae?ha glyphosate TraP4::dgt-28 (pDAB107543) 0329. The results confirm that dgt-28 can be successfully Ogae?ha glyphosate 4 O O O.O O.O O 420 gae?ha O 4 O 23.8 4.8. 20-30 stacked with aad-12 (v1), thus increasing the spectrum her 840 gae?ha O 4 O 3O.O 4.1 25-35 bicides that may be applied to the crop of interest (glypho 1680 gae?ha O 4 O 35.0 S.8 30-40 sate+phenoxyactetic acids for dgt-28 and aad-12, respec 3360 gae?ha O 4 O 31.3 2.5 30-35 tively). In crop production where hard to control broadleaf TraP8:dgt-28 weeds or resistant weed biotypes exist the stack can be used as (pDAB107545) a means of weed control and protection of the crop of interest. Ogae?ha glyphosate 4 O O O.O O.O O Additional input or output traits could also be stacked with the 420 gae?ha 4 O O O.O O.O O dgt-28 gene. 840 gae?ha 4 O O 2.5 2.9 O-5 0330 Resistance to Glyphosate in Wheat. 1680 gae?ha 4 O O 9.3 3.4 S-12 0331 Production of binary vectors encoding DGT-28. 3360 gae?ha 4 O O 1O.S 1.0 10-12 Binary vectors containing DGT-28 expression and PATselec TraP23:dgt-28 tion cassettes were designed and assembled using skills and (pDAB107553) techniques commonly known in the art. Each DGT-28 expres Ogae?ha glyphosate 4 O O O.O O.O O sion cassette contained the promoter, 5' untranslated region 420 gae?ha 4 O O O.O O.O O and intron from the Ubiquitin (Ubi) gene from Zea mays 840 gae?ha 4 O O 6.3 2.5 S-10 (Toki et al., Plant Physiology 1992, 100 1503-07), followed 1680 gae?ha 4 O O 1.O.O. O.O 10 by a coding sequence consisting of one of four transit peptides 3360 gae?ha 3 1 O 13.8 4.8 10-20 (TraP4, TraP8, TraP23 or TraP5) fused to the 5' end of a Petite havana synthetic version of the 5-enolpyruvylshikimate-3-phosphate synthase gene (DGT-28), which had been codon optimized Ogae?ha glyphosate 4 O O O.O O.O O for expression in plants. The DGT-28 expression cassette 420 gae?ha O O 4 95.0 O.O 95 terminated with a 3' untranslated region (UTR) comprising 840 gae?ha O O 4 98.8 1.O 98-100 the transcriptional terminator and polyadenylation site of a 1680 gae?ha O O 4 99.5 1.O 98-100 lipase gene (Vp1) from Z. mays (Paek et al., Mol. Cells 1998 3360 gae?ha O O 4 1OO OO 100 30; 8(3)336–42). The PATselection cassette comprised of the promoter, 5' untranslated region and intron from the Actin (Act1) gene from Oryza sativa (McElroy etal. The Plant Cell 0325 The data demonstrate robust tolerance of dgt-28 1990 2(2) 163-171), followed by a synthetic version of the tobacco up to 3360 gae?ha glyphosate through two genera phosphinothricin acetyl transferase (PAT) gene isolated from tions compared to the non-transformed control. Streptomyces viridochromogenes, which had been codon 0326 Selected plants from each event were sampled prior optimized for expression in plants. The PAT gene encodes a to glyphosate applications for analyses of the DGT-28 protein protein that confers resistance to inhibitors of glutamine Syn by standard DGT-28 ELISA. Data demonstrated DGT-28 thetase comprising phosphinothricin, glufosinate, and biala mean protein expression of the simple (1-2 copy) lines across phos (Wohleben et al., Gene 1988, 70(1), 25-37). The selec constructs ranging from 72.8-114.5 ng/cm. Data demon tion cassette was terminated with the 3' UTR comprising the strates dgt-28 is expressing protein in the T. generation of transcriptional terminator and polyadenylation sites from the transformed tobacco and tolerance data confirms functional 35S gene of cauliflower mosaic virus (CaMV) (Chenault et DGT-28 protein. al., Plant Physiology 1993 101 (4), 1395-1396). 0332 The selection cassette was synthesized by a com 0327 Stacking of dgt-28 to Increase Herbicide Spectrum. mercial gene synthesis vendor (GeneArt, Life Technologies) and cloned into a Gateway-enabled binary vector. The DGT 0328 Homozygous dgt-28 (pDAB 107543 and 28 expression cassettes were sub-cloned into pI)ONR221. pDAB107545) and aad-12 v1 (pDAB3278) plants (see PCT/ The resulting ENTRY clone was used in a LR Clonase II US2006/042133 for the latter, which is incorporated herein (Invitrogen, Life Technologies) reaction with the Gateway by this reference in its entirety) were both reciprocally enabled binary vector encoding the phosphinothricin acetyl crossed and F seed was collected. The F seed from two transferase (PAT) expression cassette. Colonies of all reciprocal crosses of each gene were stratified and treated 6 assembled plasmids were initially screened by restriction reps of each cross were treated with 1120 gae/ha glyphosate digestion of purified DNA using restriction endonucleases (selective for the dgt-28 gene), 1120 gae/ha 2,4-D (selective obtained from New England BioLabs (NEB; Ipswich, Mass.) for the aad-12 gene), or a tank mixture of the two herbicides and Promega (Promega Corporation, WI). Plasmid DNA at the rates described. Plants were graded at 14 DAT. Spray preparations were performed using the QIAprep Spin Mini results are shown in Table 30. prep Kit (Qiagen, Hilden) or the PureYield Plasmid Maxiprep US 2013/0205440 A1 Aug. 8, 2013

System (Promega Corporation, WI), following the instruc dose of the gene as homozygous plants, therefore variability tions of the suppliers. Plasmid DNA of selected clones was of response to glyphosate may be expected in the T genera sequenced using ABI Sanger Sequencing and Big Dye Ter tion. minator v3.1 cycle sequencing protocol (Applied Biosys tems, Life Technologies). Sequence data were assembled and 0339. The results of the T. dgt-28 wheat plants demon analyzed using the SEQUENCHERTM software (Gene Codes strated that tolerance to glyphosate was achieved at rates up to Corporation, Ann Arbor, Mich.). 3360 g ae/ha with the chloroplast transit peptides TraP4, 0333. The resulting four binary expression clones: TraP5, TraP8 and TraP23. Table 31. Data are of a low copy T. pDAS000122 (TraP4-DGT28), plDAS000123 (TraP8 event but are representative of the population for each con DGT28), pIDAS000124 (TraP23-DGT28) and plDAS000125 Struct. (TraP5-DGT28) were each transformed into Agrobacterium tumefaciens strain EHA105. TABLE 31 0334 Production of Transgenic Wheat Events withdgt-28 Response of low copy Tidgt-28 wheat events Expression Construct. to glyphosate 21 days after treatment. 0335 Transgenic wheat plants expressing one of the four %. Iniury %. Iniury DGT-28 expression constructs were generated by Agrobac terium-mediated transformation using the donor wheat line 25- SO- Std. Range Bobwhite MPB26RH, following a protocol similar to Wu et Application Rate <25% 50% 75% - 75% Ave Dev. (%) al., Transgenic Research 2008, 17:425-436. Putative T0 TraP4::dgt-28 transgenic events were selected for phosphinothricin (PPT) 420 gae?ha 5 O O O 4.OO O.OO 4 tolerance, the phenotype conferred by the PAT selectable 840 gae?ha 6 2 O O 3.75 0.46 3-4 marker, and transferred to soil. The TO plants were grown 680 gae?ha 4 2 O O 3.67 O.S2 3-4 under glasshouse containment conditions and T1 seed was 3360 gae?ha 4 2 O O 3.67 O.S2 3-4 produced. Overall, about 45 independent TO events were TraP8:dgt-28 generated for each DGT-28 expression construct. 420 gae?ha 5 3 O O 3.63 O.S2 3-4 0336 Glyphosate Resistance in To Wheat dgt-28 Wheat 840 gae?ha 3 5 O O 3.38 O.S2 3-4 Events. 680 gae?ha 4 3 O O 3.57 0.53 3-4 3360 gae?ha 5 5 O O 3.SO O.S3 3-4 0337 To events were allowed to acclimate in the green TraP23:dgt-28 house and were grown until 2-4 new, normal looking leaves 420 gae?ha 9 2 O O 3.82 0.40 3-4 had emerged from the whorl (i.e., plants had transitioned 840 gae?ha 8 1 O O 3.89 0.33 3-4 from tissue culture to greenhouse growing conditions). Plants 680 gae?ha 7 5 O O 3.58 O.O 3-4 were grown at 25°C. under 12 hour of supplemental lighting 3360 gae?ha 8 2 O O 3.8O 4.8 3-4 in the greenhouse until maturity. An initial screen of glypho TraP5:dgt-28 sate tolerance and Taqman analyses was completed on T. 420 gae?ha 5 2 O O 3.71 0.49 3-4 plants grown under the same conditions as previously 840 gae?ha 4 2 O O 3.67 O.S2 3-4 described. Data allowed for determination of heritable T 680 gae?ha 7 3 O O 3.70 0.48 3-4 events to be further characterized. Six low copy (1-2 copy) 3360 gae?ha 6 O O O 4.OO O.OO 3-4 and two multi-copy T. events were replanted under green Bobwhite house conditions and grown until the 3 leaf stage. T plants MPB26RH were sprayed with a commercial formulation of glyphosate 420 gae?ha O 1 1 10 1.25 0.62 1-3 (Durango DMATM) from a range of 420-3360 gae/ha, which 840 gae?ha O O O 10 1.OO O.OO 1 are capable of significant injury to untransformed wheat lines. 1680 gae?ha O O O 12 1.17 O.S8 1-3 The addition of 2% w/v ammonium sulfate was included in 3360 gae?ha O O O 10 1.OO O.OO 1 the application. A lethal dose is defined as the rate that causes >75% injury to the Bob White MPB26RH non-transformed 0340. At 21 DAT, resistant and sensitive plants are counted control. Herbicide was applied. to determine the percentage of lines that segregated as a single 0338. In this example, the glyphosate applications were utilized for both determining the segregation of the dgt-28 locus, dominant Mendelian trait (3R:1S) as determined by gene in the T generation as well as demonstrating tolerance Chi square analysis. Table 32. These data demonstrate that to increasing levels of glyphosate. The response of the plants dgt-28 is inheritable as a robust glyphosate resistance gene in is presented in terms of a scale of visual injury 21 days after a monocot species. treatment (DAT). Data are presented as a histogram of indi viduals exhibiting less than 25% visual injury (4), 25%-50% TABLE 32 visual injury (3), 50%-75% visual injury (2) and greater than Percentage of Tidgt-28 events by construct that demonstrated 75% injury (1). An arithmetic mean and standard deviation is heritablity in a mendelian fashion based off of a glyphosate selection presented for each construct used for wheat transformation. at rates ranging from 420-3360 gae/ha. The scoring range of individual response is also indicated in %T events % T. events the last column for each rate and transformation. Wild-type, tested that tested that No. T non-transformed wheat (c. v. Bob White MPB26RH) served segregated at segregated events as a glyphosate sensitive control. In the T generation hem ConstructID CTP:GOI a single locus as 2 loci tested izygous and homozygous plants were available for testing for pDASOOO122 TraP4::dgt-28 62.5% 37.5% 8 each event and therefore were included for each rate of gly pDAS000123 TraP8::dgt-28 87.5% 12.5% 8 phosate tested. Hemizgyous plants will contain half of the US 2013/0205440 A1 Aug. 8, 2013 42

TABLE 32-continued were then transferred to the greenhouse for normal growth with regular watering and fertilizing until seed set. Percentage of Tidgt-28 events by construct that demonstrated heritablity in a mendelian fashion based off of a glyphosate selection 0344. About 200 mg(s) of bulked T seeds were planted at rates ranging from 420-3360 gae/ha. evenly in selection trays (10.5-inchx21-inchx1 inch germi %T events % T. events nation trays T.O. Plastics Inc., Clearwater, Minn.). Seedlings tested that tested that No. T were sprayed with a 0.20% solution (20 Jul/10 mL dHO) of segregated at segregated events glufosinate herbicide (Liberty) in a spray volume of 10 ConstructID CTP:GOI a single locus as 2 loci tested ml/tray (703 L/ha) 5 days post-sowing and again at 10 days pDAS0001 24 TraP23:dgt-28 12.5% 87.5% 8 post-Sowing using a DeVilbiss compressed air spray tip. pDASOOO125 TraP5:dgt-28 62.5% O.0% 8 Between 4 to 7 days after the second application of glufosi nate, herbicide resistant plants were identified and trans planted for T. Seed production. The resulting T. Seeds were Cry2Aa: used in the studies described below. 0341 The effectiveness of the Trap12 chimeric chloro 0345. A small aliquot of T. seed (approx. 100-200 seeds) plast transit peptides on Cry2Aa protein expression in Arabi for each event were suspended in 40 mls of 0.1% agarose dopsis thaliana was assessed. Transgenic Arabidopsis plants solution and cold stratified at 4°C. for 24 hrs. The stratified which contained TraP12 chimeric chloroplast transit peptides seeds were then sown by 10 ml pipet onto the surface of four fused to the Cry2Aa protein were assayed for insect tolerance flats in a propagation flat. The flats were filled with Sunshine to soybean looper (SBL) and tobacco budworm (TBW). #5 soil media (Sun Gro; Bellevue, Wash.) and lightly covered 0342. The Trap12 chimeric chloroplast transit peptide with fine vermiculite. The trays were saturated in Hoaglands sequence was cloned into a plant expression pl)AB 107540 fertilizer prior to sowing and as needed afterward. After sow construct and tested in Arabidopsis. Polynucleotide ing, humidity domes were used to cover the trays and they sequences which encode the Trap 12 v3 (SEQ ID NO:13) were then placed into a ConvironTM growth chamber set at 24° chimeric chloroplast transit peptide sequences were synthe C. with a 16 hr. photo period. Incandescent and fluorescent sized and incorporated into a plasmid construct. The resulting lights provided a light level of 200 PAR. After 5 days the seeds construct contained two plant transcription units (PTU). The germinated and the domes were removed. The first herbicide first PTU was comprised of the Arabidopsis thaliana Ubiq selection of transformants was on day 6 and the second on day uitin 10 promoter (Atubi10 promoter: Callis, et al., (1990).J. 10. Liberty herbicide (a.i. glufosinate-ammonium) was Biol. Chem., 265: 12486-12493), TraP-cry2Aa fusion gene applied using a DeVilbiss atomizer hand sprayer at a rate of (TraP-Cry2Aa), and Agrobacterium tumefaciens ORF 233 200 g ai/ha to remove nulls. Roughly 25% were nulls as untranslated region (AtuORF23 3'UTR: U.S. Pat. No. 5,428, expected. A row of wildtype checks were also included in the 147). The second PTU was comprised of the Cassava Vein selection and they had 100% mortality after two herbicide Mosaic Virus promoter (CsVMV promoter; Verdaguer et al., applications. At 14 days the plants were ready for transplant (1996) Plant Molecular Biology, 31:1129-1139), dsm-2 gene ing. Twelve plants were taken from each event for bio-assay (DSM2; U.S. Patent Application No. 2011/0107455), and and transplanted into 3-inch pots filled with Sunshine #5 soil Agrobacterium tumefaciens ORF 1 3' untranslated region that had a light covering of fine vermiculite. The flats were (AtuORF1 3'UTR: Huang et al., (1990).J. Bacteriol., 172: presoaked with Hoagland's fertilizer prior to transplant and 1814-1822). Construct pI)AB 107540 contains the TraP12v3 afterward as needed. The transplants were propagated in a chimeric chloroplast transit peptide (FIG. 18). A control plas non-air conditioned greenhouse set at 25°C. with 14 hours of mid, 107617, which did not contain a chloroplast transit pep supplemental light. Silique development was inhibited by tide sequence upstream of the cry2Aa gene was built and trimming with Scissors and thus created more plant tissue for included in the studies (FIG. 19). The constructs were con testing. Plants were ready for DNA sampling at 16-18 days firmed via restriction enzyme digestion and sequencing. and ready for bio-assay at about 23 days. The putative trans Finally, the constructs were transformed into Agrobacterium genic plants were screened using molecular confirmation tumefaciens and stored as glycerol stocks. assays and identified events were advanced for protein analy (0343. The pDAB107540 construct was transformed into sis and bioassay results. Arabidopsis thaliana via Agrobacterium tumefaciens medi ated plant transformation. Briefly, 12 to 15 Arabidopsis 0346. The transformed plants generally showed a healthy thaliana plants (Columbia ecotype, Col-0) were grown in phenotype although some plants were Smaller in size when 4-inch pots in a greenhouse with light intensity of 250 umol/ visually compared with the wild type. Analysis of gene copy m2, 25°C., 1876 hours of light/dark. Primary flower stems number for each Arabidopsis construct showed comparable were trimmed one week before transformation. Agrobacte insertion results for all the constructs, with about 50% of the rium inoculums were prepared by incubating 10 ul of recom plants having >3 copies of the cry2Aa gene of interest and binant Agrobacterium glycerol stocks in 100 ml LB broth about 50% having 1-2 copies of the gene. (100 mg/L Spectinomycin, 50 mg/L Kanamycin) at 28°C. 0347 The Cry2Aa protein expression levels of the TAra with shaking at 225 rpm for 72 hours. A quantity Agrobacte bidopsis Events ranged widely. Protein detection was com rium cultures were measured with a spectrometer and when pleted using an ELISA assay to quantitate Cry2Aa protein the cells reached an OD 600 of 0.8 the cells were harvested by expression. Generally, the protein expression levels corre centrifugation. Next the cells were resuspended into 3-4 vol lated with the copy number of T-strand insert for each Event. umes of 5% sucrose and 0.04% Silwet-L77 and 10 g/L High T-strand copy number Events (e.g. D3 insertion Events) benzamino purine (BA) infiltration medium. The above generally produced higher mean protein expression levels ground parts of plant were dipped into the Agrobacterium than the low T-strand copy number Events for both sets of Solution for 5-10 minutes, with gentle agitation. The plants Arabidopsis transformation events (e.g. pl.)AB 107617 US 2013/0205440 A1 Aug. 8, 2013

Events expressing Cry2Aa without a TraP and pCAB 107540 Example 4 events expressing Cry2Aa with a TraP 12 chimeric chloro plast transit peptide). Chimeric Chloroplast Transit Peptide (TraP) Sequences for Expression of Agronomically 0348. The T. generation of Arabidopsis plants expressed Important Transgenes in Maize Cry2Aa protein values that were reduced in comparison to expression values of the TArabidopsis plants. These results indicated that protein expression was variable among each set 0353. The Cry2Aa protein from Bacillus thuringiensis has of events. Average protein expression levels obtained from demonstrated activity against Helicoverpa zea (CEW) and the homozygous Events was greater than the average protein Ostrinia nubilalis (ECB). A single version of the cry2Aa gene expression levels obtained from the hemizygous Events for (SEQ ID NO:14), codon biased for maize, was tested in all of the plant Events tested (e.g., Events without a TraP maize. In this experiment, Cry2Aa was evaluated alone and in pDAB 107617 and with TraP 12 plDAB 107540). The Ara conjunction with the TraP12V4 chimeric chloroplast transit bidopsis Events which contained more than two copies of a peptide in maize to determine the insect tolerance activity and T-Strand insert had higher levels of expression than Arabidop to evaluate the effect the TraP 12V4 chimeric chloroplast sis Events which contained only a single copy. Despite the transit peptide sequence would have on the expression of the decrease in protein expression levels from the T to the T. Cry2Aa protein in maize. generation, the incorporation of the TraP12 chimeric chloro 0354. The Trap 12V4 chimeric chloroplast transit peptide plast transit peptide within the constructs resulted in trans sequence (SEQ ID NO:15) and a GCA codon linker were genic Arabidopsis Events which expressed the Cry2Aa pro cloned upstream of the cry2Aa gene and incorporated into tein. construct pl)AB 107686 (FIG. 12) for insect tolerance testing in maize plant. The resulting construct contained two plant 0349. Both sets of T Arabidopsis Events were tested in transcription units (PTU). The first PTU was comprised of the insect bioassay experiments. In general, high copy number Zea mays Ubiquitin 1 promoter (ZmUbi1 promoter: Chris Events which expressed greater amounts of Cry2Aa protein tensen, A., Sharrock R., and Quail P. (1992) Maize polyubiq resulted in lower amounts of leaf damage as compared to low uitingenes: structure, thermal perturbation of expression and copy number Events. There was a correlation between protein transcript splicing, and promoter activity following transfer expression and leaf protection against both SBL and TBW for to protoplasts by electroporation, Plant Molecular Biology, Arabidopsis Events expressing Cry2Aawithout a TraP (r–0. 18:675-689), TraP12-cry2Aa fusion gene (TraP12 Cry2Aa), 49 (SBL), 0.23 (TBW)), and for Arabidopsis Events express and Zea mays Lipase 3' untranslated region (ZmLip 3'UTR; ing Cry2Aa with TraP 12 (r’=0.57 (SBL), 0.30 (TBW)). U.S. Pat. No. 7,179,902). The second PTU was comprised of Resultantly, an increase in protein expression caused signifi the Sugar Cane Bacilliform Virus promoter (SCBV promoter; cant protection against leaf damage (Pr-0.05). U.S. Pat. No. 6,489.462), aad-1 herbicide tolerance gene con 0350 Arabidopsis plants were protected from SBL in both taining a MSV leader and alcohol dehydrongenase 1 intron 6 the TraP12 and non TraP Arabidopsis Events. Expression of (AAD-1; U.S. Pat. No. 7,838,733, and MSV Leader Cry2Aa with and without a TraP12 resulted in lower than sequence; Genbank Acc. No. FJ882146.1, and the alcohol 30% leaf damage with minimum protein expression of about dehydrongenase intron; Genbank Acc. No. EF53936.8.1), and 0.75ng/cm for TraP12: Cry2AaEvents and about 1.5 ng/cm Zea mays Lipase 3' untranslated region (ZmLip 3'UTR). A for Cry2Aa Events without a TraP. Assessments of Arabidop control plasmid, pl.)AB107687, which did not contain a chlo sis Event expression of Cry2Aa with and without TraP12 roplast transit peptide sequence upstream of the cry2Aa gene resulted in lower than 20% leaf damage, with minimum pro was built and included in the studies (FIG. 13). The plasmids tein expression of about 1.1 ng/cm for TraP12 Arabidopsis were introduced into Agrobacterium tumefaciens for plant Events and about 2.0-2.5 ng/cm for non-TraP Arabidopsis transformation. Events. 0355 Ears from Zea mays cultivar B104 were harvested 10-12 days post pollination. Harvested ears were de-husked 0351 Arabidopsis plants were protected from TBW by and surface-sterilized by immersion in a 20% solution of both the TraP12 and non TraP Arabidopsis Events. TBW was commercial bleach (Ultra Clorox R Germicidal Bleach, more sensitive to Cry2Aa protein than SBL when fed with 6.15% sodium hypochlorite) and two drops of Tween 20, for plant material obtained from the Arabidopsis Events. Protein 20 minutes, followed by three rinses in sterile, deionized concentrations as low as about 0.75 and 1.5 ng/cm of Cry2Aa water inside a laminar flow hood. Immature Zygotic embryos resulted in less than 30% leaf damage when the Cry2Aa (1.8-2.2 mm long) were aseptically excised from each ear and protein was expressed in combination with TraP12 and with distributed into one or more micro-centrifuge tubes contain out TraP, respectively. At the 20% leaf damage cut-off point, ing 2.0 ml of Agrobacterium Suspension into which 2 ul of leaf protection from TraP12 Arabidopsis Events resulted 10% Break-ThruR) S233 Surfactant had been added. from levels of about 1.1 ng/cm of Cry2Aa protein while 0356. Upon completion of the embryo isolation activity 2.0-2.5 ng/cm of expressed Cry2Aa protein was required the tube of embryos was closed and placed on a rocker plat from the Arabidopsis Events which did not possess a TraP. form for 5 minutes. The contents of the tube were then poured 0352. The TraP 12 chimeric chloroplast transit peptides out onto a plate of co-cultivation medium and the liquid did not reduced the effectiveness of Cry2Aa protein expres Agrobacterium suspension was removed with a sterile, dis sion in Arabidopsis thaliana. Transgenic Arabidopsis plants posable, transfer pipette. The co-cultivation plate containing which contained the TraP12 chimeric chloroplast transit pep embryos was placed at the back of the laminar flow hood with tides fused to the Cry2Aa protein expressed high levels of the the lid ajar for 30 minutes; after which time the embryos were Cry2Aa protein which provided insect tolerance to soybean oriented with the scutellum facing up using a microscope. looper (SBL) and tobacco budworm (TBW). The co-cultivation plate with embryos was then returned to US 2013/0205440 A1 Aug. 8, 2013 44 the back of the laminar flow hood with the lid ajar for a further base. Silks were cut back the day prior to pollinations to 15 minutes. The plate was then closed, sealed with 3M provide an even brush to accept pollen and the plants were self Micropore tape, and placed in an incubator at 25°C. with 24 pollinated. hours/day light at approximately 60 Limol m-2 S-1 light inten 0361 Plants for T selection were sprayed at 7 days post sity. sowing. They were grown in 4-inchpots of Metro 360 potting 0357 Following the co-cultivation period, embryos were soil with 15 pots per flat. Seedling growth stage was V1-V1.5. transferred to Resting medium. No more than 36 embryos Pots with poor germination or contain very small plants were moved to each plate. The plates were wrapped with 3M (whorl still closed) were marked so they were not included in micropore tape and incubated at 27°C. with 24 hours/day the selection assessment. Whole flats of plants were then light at approximately 50 umolm-2s-1 light intensity for 7-10 placed in secondary carriertrays for track sprayer application. days. Callused embryos were then transferred onto Selection Trays were placed two at a time in the Mandel track sprayer, I medium. No more than 18 callused embryos were moved to calibrated to deliver a volume 187 L/ha to the target area using each plate of Selection I medium. The plates were wrapped an 8002E flat fan nozzle (Tee Jet). A solution of 35 gae?ha with 3M micropore tape and incubated at 27°C. with 24 Assure II (quizalofop)+1% COC (crop oil concentrate) was hours/day light at approximately 50 Limol m-2 S-1 light inten formulated for the application. A volume of 15 mls./spray was sity for 7 days. Callused embryos were then transferred to used to calculate the total spray Solution needed. Calcula Selection II medium. No more than 12 callused embryos were tions; (35 gae/ha)x(1 ha? 187 L)x(1 L/97.7 gae Assure II)=0. moved to each plate of Selection II. The plates were wrapped 192% solution or 28.74 ul/15 ml H2O+1% v/v). After appli with 3M micropore tape and incubated at 27°C. with 24 cation, the plants were then allowed to dry for one hour in hours/day light at approximately 50 Limol m-2 S-1 light inten spray lab before returning to greenhouse. Approximately 1-2 sity for 14 days. weeks after transplanting to larger pots plants were sampled 0358. At this stage resistant calli were moved to Pre-Re for bioassay. One plant per event was bioassayed. generation medium. No more than nine calli were moved to 0362 All of the To events that passed the molecular analy each plate of Pre-Regeneration. The plates were wrapped sis screen were analyzed for Cry2Aa protein expression lev with 3M micropore tape and incubated at 27°C. with 24 els. The Events from the control construct, pIDAB107687, hours/day light at approximately 50 Limol m-2 S-1 light inten which comprised Cry2Aa without a TraP had significantly sity for 7 days. Regenerating calli were then transferred to higher average expression level of Cry2Aa (15.0 ng/cm) as Regeneration medium in Phytatrays TM and incubated at 28° compared to Events from plDAB107686 (1.4 ng/cm) which C. with 16 hours light/8 hours dark per day at approximately contained TraP12. Despite the reduced levels of expression of 150 umol m-2s-1 light intensity for 7-14 days or until shoots the pDAB107686. Events, these Events still expressed the develop. No more than five calli were placed in each Cry2Aa protein. PhytatrayTM. Small shoots with primary roots were then iso 0363 The T events were also analyzed for Cry2Aa pro lated and transferred to Shoot/Root medium. Rooted plantlets tein expression levels. The Events from the control construct, about 6 cm or taller were transplanted into soil and moved out pDAB 107687, which comprised Cry2Aa without a TraP had to a growth chamber for hardening off. significantly higher average expression level of Cry2Aa (55 0359 Transgenic plants were assigned unique identifiers and 60 ng/cm) as compared to Events from plDAB107686 through and transferred on a regular basis to the greenhouse. (about 2 to 3.7ng/cm) which contained TraP12. Despite the Plants were transplanted from PhytatraysTM to small pots reduced levels of expression of the pDAB 107686. Events, filled with growing media (Premier Tech Horticulture, Pro these Events still expressed the Cry2Aa protein. Mix BX, 0581 P) and covered with humidomes to help accli 0364 Transgenic plants containing single copies of the mate the plants. Plants were placed in a ConvironTM growth T-strand comprising a cry2Aa gene were tested for insecti chamber (28° C./24°C., 16-hour photoperiod, 50-70% RH, cidal activity in bioassays conducted with neonate lepi 200 umol light intensity) until reaching V3-V4 stage. This dopteran larvae on leaves from the transgenic plants. The step aids in acclimating the plants to Soil and harsher tem lepidopteran species assayed were the European Corn Borer, peratures. Plants were then moved to the greenhouse (Light Ostrinia nubilalis (Hübner) (ECB), and the Corn Earworm, Exposure Type: Photo or Assimilation; High Light Limit: Helicoverpa zea (CEW). 1200 PAR; 16-hour day length; 27°C. Day/24°C. Night) and 0365 32-well trays (C-DInternational, Pitman, N.J.) were transplanted from the Small pots to 5.5 inch pots. Approxi partially filled with a 2% agar Solution and agar was allowed mately 1-2 weeks after transplanting to larger pots plants to Solidify. Leaf sections approximately one in two were were sampled for bioassay. One plant per event was bio taken from each plant and placed singly into wells of the assayed. 32-well trays. One leaf piece was placed into each well, and 0360 Select events were identified for advancement to the two leaf pieces were tested per plant and per insect. Insects next generation based on copy number of the genes, protein were mass-infested using a paintbrush, placing ten neonate detection by Western blot and activity against the bioassay larvae into each well. Trays were sealed with perforated insects. Events that contained the spectinomycin resistance sticky lids which allowed ventilation during the test. Trays gene were noted, but not necessarily omitted from advance were placed at 28°C., 40% RH. 16 hours light: 8 hours dark ment. Events selected for advancement were transplanted for three days. After the duration of the test, a simple percent into 5 gallon pots. Observations were taken periodically to damage score was taken for each leaf piece. Damage scores track any abnormal phenotypes. Shootbags were placed over for each test were averaged and used alongside protein the shoots prior to silk emergence to prevent cross-contami expression analysis to conduct correlation analyses. nation by Stray pollen. Any shoots producing silks prior to 0366. The results of the To and T bioassay indicated that covering were noted and the shoot was removed. The second the TraP12 chimeric chloroplast transit peptide sequence was shoot was then covered and used for pollinations. Plants that functional as the pl)AB 107686. Events provided protection produced abnormal or no shoots were recorded in the data against the insects tested in bioassay. In the T. Events, the US 2013/0205440 A1 Aug. 8, 2013

plants expressing the Cry2Aa protein without a TraP. 0369. The pDAB 112712 (FIG. 16) construct which con (pDAB 107687) had a mean leaf damage that was signifi tains the Trap12 v2 chimeric chloroplast transit peptide cantly greater than the plants expressing the Cry2Aa protein sequence (SEQ ID NO:11) and a GCA codon linker were with a TraP12 (pDAB 107686) across all insect species tested. cloned upstream of the Vip3 Ablv7 gene and tested for insect Although the pDAB 107686 Events with TraP12 had more tolerance testing in maize plant. The resulting construct con leaf damage as compared to the Events without a TraP, the tained two plant transcription units (PTU). The first PTU was pDAB 107686 Events provided protection against the insects comprised of the Zea mays Ubiquitin 1 promoter (ZmUbi1 that were bio assayed. promoter: Christensen, A., Sharrock R., and Quail P., (1992) Maize polyubiquitingenes: structure, thermal perturbation of VIP3Ab 1: expression and transcript splicing, and promoteractivity fol 0367 The Vip3Ab1 protein from Bacillus thuringiensis lowing transfer to protoplasts by electroporation, Plant has demonstrated activity against Helicoverpa zea (CEW) Molecular Biology, 18:675-689), TraP12-Vip3Ablv7 fusion and Fall Armyworm (FAW) and resistant Fall Armyworm gene (TraP12-Vip3Ablv7) and Zea mays Peroxidase5 3' (rFAW). The Vip3Ab1 v6 (SEQID NO:16) and Vip3Ab1 v7 untranslated region (ZmPer 5 3'UTR). The construct was (SEQ ID NO:17) genes were expressed and tested for insect confirmed via restriction enzyme digestion and sequencing. tolerance in maize. In this experiment, Vip3 Ablv6 and The second PTU was comprised of the Sugar Cane Bacilli Vip3Ab1 v7 were evaluated alone and in conjunction with the TraP12 chimeric chloroplast transit peptide in maize to deter form Virus promoter (SCBV promoter: U.S. Pat. No. 6,489, mine the insect tolerance activity and to evaluate the effect the 462), aad-1 herbicide tolerance gene containing a MSV TraP12 V2 chimeric chloroplast transit peptide sequence leader and alcohol dehydrongenase 1 intron 6 (AAD-1; U.S. would have on the expression of the Vip3Ab1 V6 and Vip3 Ab 1 Pat. No. 7,838,733, and MSV Leader sequence; Genbank V7 protein in maize. Acc. No. FJ882146.1, and the alcohol dehydrongenase 0368. The plDAB 112711 (FIG. 14) construct contains the intron; Genbank Acc. No. EF5393.68.1), and Zea mays Lipase Trap12 V2 chimeric chloroplast transit peptide-encoding 3' untranslated region (ZmLip 3'UTR). A control plasmid, polynucleotide sequence (SEQID NO:11) and a GCA codon pDAB 112710, which did not contain a chloroplast transit linker cloned upstream of the Vip3Ablv6 gene for insect peptide sequence upstream of the Vip3Ablv7 gene was built tolerance testing in maize plant. The resulting construct con and included in the studies (FIG. 17). The plasmids were tained two plant transcription units (PTU). The first PTU was introduced into Agrobacterium tumefaciens for plant trans comprised of the Zea mays Ubiquitin 1 promoter (ZmUbil formation. promoter: Christensen, A., Sharrock R., and Quail P., (1992) 0370 Maize transformation, protein expression and insect Maize polyubiquitingenes: structure, thermal perturbation of bioassays were completed following the protocols previously expression and transcript splicing, and promoter activity fol described, and the results are shown in Table 33. The results lowing transfer to protoplasts by electroporation, Plant of insect bioassays indicated that the TraP12 chimeric chlo Molecular Biology, 18:675-689), TraP12-Vip3Ablv6 fusion roplast transit peptide sequence was functional and that the gene (TraP12-Vip3Ablv6) and Zea mays Peroxidase5 3' pDAB 112711 and pL)AB 112712 Events provided protection untranslated region (ZmPer 5 3'UTR). The construct was against the insect species tested in bioassay. In the tested confirmed via restriction enzyme digestion and sequencing. Events, the plant Events expressing the Vip3Ab1 V6 protein The second PTU was comprised of the Sugar Cane Bacilli without a TraP (pDAB111479), had a higher level of leaf form Virus promoter (SCBV promoter: U.S. Pat. No. 6,489, damage than the plant Events expressing the Vip3Ab1 V6 462), aad-1 herbicide tolerance gene containing a MSV protein with TraP12 (pDAB 112711) for both CEW and FAW leader and alcohol dehydrongenase 1 intron 6 (AAD-1; U.S. insect species. However, the plants expressing the Vip3Ab1 Pat. No. 7,838,733, and MSV Leader sequence; Genbank v7 protein without a TraP (pDAB 112710) had a mean leaf Acc. No. FJ882146.1, and the alcohol dehydrongenase damage that was not significantly different than the plant intron; Genbank Acc. No. EF5393.68.1), and Zea mays Lipase expressing the Vip3Ab1 v7 protein with TraP12 3' untranslated region (ZmLip 3'UTR). A control plasmid, (pDAB 112712). Both the Vip3Ab1 v7 protein without a TraP pDAB 111479, which did not contain a chloroplast transit (pDAB 112710), and the Vip3Ab1 v7 protein with a TraP12 peptide sequence upstream of the Vip3 Ablv6 gene was built (pDAB 112712) produced plant Events which provided insect and included in the studies (FIG. 15). The plasmids were control against the CEW and FAW species. In conclusion, the introduce into Agrobacterium tumefaciens for plant transfor Western blots and the bioassays indicated that all of the tested mation. Events expressed the Vip3 Ab1 protein. TABLE 33 Results of the biochemical and bioassay results for Vip3Ab1 v6 and Vip3Ab1 v7 coding sequences that were fused to TraP12 as compared to Vip3Ab1 V6 and Vip3Ab1 v7 coding sequences that did not possess a chloroplast transit peptide sequence. Biochemical Assay Results BioAssay Results

Method of analysis CEW FAW rFAW ELISA (ngi cm2) Western Total Mean Total Mean Total Mean Average LCMSMS positive Events CEW % Leaf FAW 96 Leaf rRAW 96 Leaf Plasmid Description expression (fmolecm2) events tested damage Damage damage Damage damage Damage

pDAB111479 Vip3Ab1 v6 59 ELISA 14.17 19 2OS.O 10.8 368.0 19.4 325.0 17.1 No Trap US 2013/0205440 A1 Aug. 8, 2013 46

TABLE 33-continued Results of the biochemical and bioassay results for Vip3Ab1 v6 and Vip3Ab1 v7 coding sequences that were fused to TraP12 as compared to Vip3Abl V6 and Vip3Abl V7 coding Sequences that did not possess a chloroplast transit peptide Sequence. Biochemical Assay Results BioAssay Results Method of analysis CEW FAW FAW ELISA (ngi cm2) Western Total Mean Total Mean Total Mean Average LCAMS, MS positive Events CEW % Leaf FAW 96 Leaf rEAW 96 Leaf Plasmid Description expression (fmolecm) events tested damage Damage damage Damage damage Damage pDAB112711 Vip3Ab1 v6 41 ELISA 1426 22 116.0 5.3 139.0 6.3 1 OSO 4.8 Trap 12 pDAB112710 Vip3Ab1 v7 143 ELISA 18,2O 2O 79.0 4.0 107.0 5.4 117.0 5.9 No Trap pDAB112712 Vip3Ab1 v7 247 ELISA 3.3 18 69.0 3.8 48.0 2.7 55.0 3.1 Trap 12

Example 5 into the Procise Sequencer. Eight cycles of Edman chemistry degradation were run for each sample to get five AA residues In Planta Cleavage of Chimeric Chloroplast Transit at N-terminus. A standard mix of 20 PTH-amino acids (Ap Peptide (TraP) Sequences plied BioSystems) was run with each sample. The amino acid 0371. The cleavage site of the TraP12 and TraP13 chi residues from each Edman degradation were determined meric chloroplast transit peptide was determined via MALDI based on their retention times from the C-18 column against spectrometry and N-terminal Edman degradation sequenc the standards. ing. Plant material was obtained from transgenic plants which 0375. The results of the MALDI sequencing indicated that contained the TraP12-dgt14, TraP12-dgt28, TraP13-dgt14. the DGT-28 and DGT14 proteins were expressed and that the and TraP13-dgt28 fusion genes and assayed to determine the TraP chimeric chloroplast transit peptide sequences were location of cleavage of the chimeric chloroplast transit pep processed. Table 34 lists the processed sequences which were tide occurred during translocation within the chloroplast. obtained by using the N-terminal Edman degradation and MALDI Results: MALDI sequencing. 0372. The semi-purified proteins from a plant sample were TABLE 34 separated by SDS-PAGE. The bands of protein of a size equivalent to the molecular weight of YFP were excised from the gel, de-stained and dried. Next, the dried protein bands Cleavage sites of TraP12 and TraP13 fused with the dgt-14 or were in-gel digested with Trypsin (Promega; Madison, Wis.) dgt-28 coding sequences. The grey box indicates the splice site. in 25 mMammonium bicarbonate for overnight at 37°C. The peptides were purified by a C18 ZipTipTM (Millipore, Bed ford, Mass.) and eluted with 50% acetonitrile/0.1%TFA. The samples were mixed with matrix C.-cyano-4-hydroxycin namic acid in a 1:1 ratio and the mix was sported onto a MALDI sample plate and air dried. 0373 The peptide mass spectrum was generated using a Voyager DE-PRO MALDI-TOF Mass SpectrometerTM (Ap plied Biosystems; Framingham, Mass.). External calibration was performed by using a Calibration Mixture 2TM (Applied Biosystems). Internal calibration was performed using the trypsin autolysis peaks at m/z. 842.508, 1045.564 and 2211. 108. All mass spectra were collected in the positive ion reflec tor model. The peptide mass fingerprint (PMF) analysis was conducted using PAWSTM (Protein Analysis WorkSheet) freeware from Proteometrics LLC by matching the PMF of the sample with theoretical PMF of target protein to verify if the sample is the target protein. The protein identification was performed by Database searching using MASCOT (Matrix Science, London, UK) against NCBINR protein database. N-Terminal Sequencing Via Edman Chemistry Degradation: 0374. The N-terminal sequencing was performed on a Procise Protein Sequencer (model 494) from Applied Biosys tems (Foster City, Calif.). The protein samples were separated first by SDS-PAGE, then blotted onto PVDF membrane. The protein bands were excised from the membrane and loaded US 2013/0205440 A1 Aug. 8, 2013 47

Example 6 TABLE 35-continued Stacking of Polynucleotide Sequences Comprising The constructs described below were transformed into Arabidopsis to Chimeric Chloroplast Transit Peptide (TraP) assess the TraP12 chimeric chloroplast transit peptide effects on Sequences protein expression. 0376. The TraP12 chimeric transit peptide was fused to the Plasmid Description 5' end of cry1Ac, cry1Ca, and cry 1F gene sequences which pDAB110815 AtlJbi10/Cry1 Cavé/AtuORF23:CsVMV/DSM-2? AtuORF1 were stacked in multi PTU plasmid constructs to determine pDAB110816 AtlJbi10/Cry1 Fv.6/AtuORF23:CsVMV/DSM-2/AtuORF1 whether the TraP12 chimeric transit peptide enhanced or pDAB110818 AtlJbi10/Cry1 Fv.6/AtuORF23::At Jbi10/Cry1Acv4/ reduced expression of the proteins within Arabidopsis. AtORF23::CSWMV, DSM-2. At ORF1 0377 The constructs listed in Table 35 were assembled pDAB110819 AtlJbi10/TraP12v2-Cry1 Fv7/AtuORF23::Atubi10/ AtORF23::CSWMV, DSM-2. At ORF1 using art recognized methods. The constructs were Subse pDAB110820 AtlJbi10/Cry1 Fv.6/AtuORF23::At Jbi10/TraP12v2 quently transformed into Arabidopsis thaliana using the Cry1Acv4/AtuORF23:CsVMV/DSM-2/AtuORF1 Agrobacterium mediated transformation protocol previously pDAB110821 AtlJbi10/TraP12v2-Cry1 Fv7/AtuORF23::Atubi10/ described. Transgenic Arabidopsis plants were obtained and TraP12v2-Cry1Acv4/AtuORF23:CsVMV/DSM-2? protein expression was determined via Western blotting and AtuORF1 ELISA assays. 0378. The results of the protein quantification indicated TABLE 35 that TraP12 had varying effects on total expression levels of the expression of Cry1Ac, Cry1Ca, and Cry 1F. The addition The constructs described below were transformed into Arabidopsis to assess the TraP12 chimeric chloroplast transit peptide effects on of the TraP12 chimeric chloroplast transit peptide resulted in protein expression. decreased expression levels of Cry 1F, and increased expres sion levels of Cry1Ca and Cry1Ac. Regardless of the vari Plasmid Description ability in expression levels, all of the tested plant Events pDAB110811 AtlJbi10/TraP12v2-Cry1Acv4/AtuORF23:CsVMV/ expressed protein, and the TraP12 chimeric chloroplast tran DSM-2FAtuORF1 sit peptide did not inhibit protein expression of a transgene. pDAB110812 At Jbi10/TraP12v2-Cry1Cavé/AtuORF23:CsVMV/ Finally, the TraP12 chimeric chloroplast transit peptide DSM-2FAtuORF1 pDAB110813 At Jbi10/TraP12v2-Cry1Fv6/AtuORF23:CsVMV/ directed the expressed proteins into the chloroplasts. The DSM-2FAtuORF1 translocation of the expressed proteins into the chloroplast pDAB110814. At Jbi10/Cry1Acv4/AtuORF23::CsVMV/DSM-2? was evidenced by Western blots which exhibited similar AtuORF1 molecular weight sizes for the expressed proteins with or without the TraP12 chimeric chloroplast transit peptide.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 68

<21 Os SEQ ID NO 1 &211s LENGTH: 2O7 212s. TYPE: PRT <213> ORGANISM: Brassica napus <4 OOs SEQUENCE: 1

Ala Thr Gly Gly Gly Cys Ala Ala Thr Thir Ala Gly Cys Ala 1. 5 15

Gly Ala Ala Thr Thr Gly Cys Ala Thr Gly Gly Cys Gly Thir 25 3 O

Gly Ala Gly Ala Ala Ala Thr Gly Thir Gly. Thir Thr 35 45

Ala Ala Thr Ala Ala Thr Thir Thir 60

Cys Ala Ala Ala Ala Ala Ala Ala Ala Ala 65 8O

Ala Ala Ala Thr Ala Thir Th Thr Thr Cys 85 90 95

Gly Thir Thir Thir Thr Gly Ala Ala Gly Ala Cys Gly 105 110

Ala Thr Cys Ala Gly Thir Gly Ala Gly Cys Thir Thr 115 12O 125 US 2013/0205440 A1 Aug. 8, 2013 48

- Continued

Thir Thr Cys Gly Thr Gly Gly Gly Gly Ala Thr Thr Gly Ala Ala Gly 13 O 135 14 O Ala Ala Gly Ala Gly. Thr Gly Gly Ala Ala Cys Gly Ala Thr Gly Cys 145 150 155 160 Thr Ala Ala Ala Cys Gly Gly Thr Thr Cys Thr Gly Thr Ala Ala Thr 1.65 17O 17s Thr Cys Gly Cys Cys Cys Gly Gly Thr Thr Ala Ala Gly Gly Thr Ala 18O 185 19 O Ala Cys Ala Gly Cys Thr Thr Cys Thr Gly. Thir Thr Thr Cys Cys 195 2OO 2O5

<210s, SEQ ID NO 2 &211s LENGTH: 69 212. TYPE: PRT <213> ORGANISM: Brassica napus <4 OOs, SEQUENCE: 2 Met Ala Glin Ser Ser Arg Ile Cys His Gly Val Glin Asn Pro Cys Val 1. 5 1O 15 Ile Ile Ser Asn Lieu. Ser Llys Ser Asn Glin Asn Llys Ser Pro Phe Ser 2O 25 3O Val Ser Lieu Lys Thr His Glin Pro Arg Ala Ser Ser Trp Gly Lieu Lys 35 4 O 45 Llys Ser Gly Thr Met Lieu. ASn Gly Ser Val Ile Arg Pro Val Llys Val SO 55 6 O

Thir Ala Ser Wal Ser 65

<210s, SEQ ID NO 3 &211s LENGTH: 219 &212s. TYPE: DNA <213> ORGANISM: Arabidopsis thaliana

<4 OOs, SEQUENCE: 3 atggcgcaag titagcagaat ctdcaatggt gtgcagaacc catct cittat citccaat ct c 6 O tcqaaatcca gtcaacgcaa atc toccitta t cqgtttct c tdaagacgca gcagoat coa 12 O cgagctitatic cattt cqtc gtcgtgggga ttgaagaaga gtgggatgac gittaattggc 18O tctgagctitc gtcct cittaa got catgtct tctgtttico 219

<210s, SEQ ID NO 4 &211s LENGTH: 73 212. TYPE: PRT <213> ORGANISM: Arabidopsis thaliana <4 OOs, SEQUENCE: 4 Met Ala Glin Val Ser Arg Ile Cys Asn Gly Val Glin Asn Pro Ser Lieu. 1. 5 1O 15 Ile Ser Asn Lieu. Ser Lys Ser Ser Glin Arg Llys Ser Pro Lieu. Ser Val 2O 25 3O Ser Leu Lys Thr Glin Gln His Pro Arg Ala Tyr Pro Ile Ser Ser Ser 35 4 O 45 Trp Gly Lieu Lys Llys Ser Gly Met Thr Lieu. Ile Gly Ser Glu Lieu. Arg SO 55 6 O

Pro Leu Lys Val Met Ser Ser Val Ser 65 70 US 2013/0205440 A1 Aug. 8, 2013 49

- Continued

<210s, SEQ ID NO 5 &211s LENGTH: 222 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TraP12 chloroplast transit peptide

<4 OOs, SEQUENCE: 5 atggct caat cittctaggat ttgccacggt gttcaaaacc cittgcgtgat catct ctaac 6 O ctitt coaagt cca.accagaa caagt citcct ttcagcgttt ct cittaagac toatcagcat 12 O cctagagctt acccitat citc ttctagotgg ggact talaga aatctggaat gaccctitatic 18O ggatctgaac ttaggcct ct taaggittatgtcct ctdtgt ct 222

<210s, SEQ ID NO 6 &211s LENGTH: 74 212. TYPE: PRT <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TraP12 chloroplast transit peptide <4 OOs, SEQUENCE: 6 Met Ala Glin Ser Ser Arg Ile Cys His Gly Val Gln Asn Pro Cys Val 1. 5 15 Ile Ile Ser Asn Lieu. Ser Llys Ser Asn Glin Asn Lys Ser Pro Phe Ser 25 3O Val Ser Lieu Lys Thr His Glin His Pro Arg Ala Tyr Pro Ile Ser Ser 35 4 O 45 Ser Trp Gly Lieu Lys Llys Ser Gly Met Thir Lieu. Ile Gly Ser Glu Lieu. SO 55 6 O Arg Pro Leu Lys Val Met Ser Ser Val Ser 65 70

<210s, SEQ ID NO 7 &211s LENGTH: 2O4 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: nucleotide sequence encoding TraP13 chloroplast transit peptide

<4 OO > SEQUENCE: 7 atggct caag tittctagaat Ctgcaacggt gttcagaacc citt ct citta t c to caac citt 6 O tctaagt cat citcagaggaa gtctocactt totgtttcto ttalagactica acagoctaga 12 O gctt Cttcat ggggacttaa gaaatccgga accatgctta acggatctgt tat caggcct 18O gttalaggtta cc.gcttctgt gtct 2O4.

<210s, SEQ ID NO 8 &211s LENGTH: 68 212. TYPE: PRT <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TraP13 chloroplast transit peptide

<4 OOs, SEQUENCE: 8 Met Ala Glin Val Ser Arg Ile Cys Asn Gly Val Glin Asn Pro Ser Lieu. 1. 5 1O 15

Ile Ser Asn Lieu. Ser Lys Ser Ser Glin Arg Llys Ser Pro Lieu. Ser Val US 2013/0205440 A1 Aug. 8, 2013 50

- Continued

2O 25 3O Ser Lieu Lys Thr Glin Glin Pro Arg Ala Ser Ser Trp Gly Lieu Lys Llys 35 4 O 45 Ser Gly Thr Met Lieu. Asn Gly Ser Val Ile Arg Pro Val Llys Val Thr SO 55 6 O

Ala Ser Wal Ser 65

<210s, SEQ ID NO 9 &211s LENGTH: 4 212. TYPE: PRT <213> ORGANISM: Brassica

<4 OOs, SEQUENCE: 9

Ser Wal Ser Lieu. 1.

<210s, SEQ ID NO 10 &211s LENGTH: 9 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Linker

<4 OOs, SEQUENCE: 10 gcttcttct

<210s, SEQ ID NO 11 &211s LENGTH: 222 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: TraP12 v2 nucleotide sequence <4 OOs, SEQUENCE: 11 atggcacaat ctagoaga at Ctgcc acggt gtgcagalacc catgtgttgat catttcaaat 6 O citct caaagt ccaatcagaa caaat cacct ttct c cqtct c cct caagac acaccagoat 12 O cCaagggcat acccgataag cagct catgg ggact caaga agagcggaat gaCtctgatt 18O ggct citgagc titcgt.cct ct taaggittatgtcc totgttt co 222

<210s, SEQ ID NO 12 &211s LENGTH: 2O4 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Trap13 v2 nucleotide sequence

<4 OOs, SEQUENCE: 12 atggcacaag titagcagaat ctd taatggt gtgcagaacc catct cittat citccaat ct c 6 O tcaaagttcca gccaacgtaa gttct cocctic agcgtgtct c tdaaaactica gcagoccaga 12 O gctt Cttcat ggggtttgaa gaaatctgga acgatgctta acggcticagt catt.cgt.ccg 18O gttalaggtga cagcct cogt CtcC 2O4.

<210s, SEQ ID NO 13 &211s LENGTH: 222 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Trap12 v3 nucleotide sequence

US 2013/0205440 A1 Aug. 8, 2013 62

- Continued <4 OOs, SEQUENCE: 28 atgcttgcta gacalaggtgg aagttctgaga gct tct caat gcaacgctgg acttgct aga 6 O agagttgaag ttggtgct ct togttgttcct agaccitat ct citgttaacga cqttgttcct 12 O cacgtt tact ctdctic cact ttctgttgct agaaggit citt gctictaagtic ct c cattagg 18O tccact agaa gogottcaaac tactgtgtgc tict 213

<210s, SEQ ID NO 29 &211s LENGTH: 186 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Chloroplast Transit Peptide

<4 OOs, SEQUENCE: 29 atgcaactico tdaatcagag goaa.gc.cctg cqt cittgg to gttcatctgc titcaaagaac 6 O cagdaagttg ctic cactggc ctic taggcct gcttct tcct tdagcgt cag cqcatccagc 12 O gtc.gcacctg. Cacctgcttg Ctcagctic ct gctggagctg. galagg.cgtgc tigttgtcgtg 18O agagca 186

<210s, SEQ ID NO 3 O &211s LENGTH: 198 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Chloroplast Transit Peptide

<4 OOs, SEQUENCE: 30 atggct caat ctagoagaat ctoccacggt gtgcagaacc catgtgtgat cattt coaat 6 O citct coaaat coaaccagaa caaatcto ct ttct cagtica gcc to aagac tolaccagoag 12 O

Cagcgt.cgtg Cttaccagat atctagotgg ggattgaaga agt caaacaa C9ggit cogtg 18O attcgt.ccgg tta aggca 198

<210s, SEQ ID NO 31 &211s LENGTH: 198 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Chloroplast Transit Peptide <4 OOs, SEQUENCE: 31 atggcacaag cca.gc.cgitat ctoccagaat coatgtgtga tat coaatct c cc caaaagc 6 O aaccaccgta agt ccc ctitt citctgtctica citcaagacgc at cagcc tag agcct citt.ca 12 O tggggactta agaagttctgg cac catgctgaacggttcag tatt agaCC C9tcaaggtg 18O acagcttctg titt cogca 198

<210s, SEQ ID NO 32 &211s LENGTH: 225 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Chloroplast Transit Peptide

<4 OOs, SEQUENCE: 32 atggcacaat ctagoaga at Ctgcc acggt gtgcagalacc catgtgttgat catttcaaat 6 O citct caaagt ccaatcagaa caaat cacct ttct c cqtct c cct caagac acaccagoat 12 O

US 2013/0205440 A1 Aug. 8, 2013 71

- Continued

&212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 46 agccacat co cagtaacga 19

<210s, SEQ ID NO 47 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 47 cctic cct citt togacgc.c 17

<210s, SEQ ID NO 48 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide probe sequence

<4 OOs, SEQUENCE: 48 Cagcc.caatg aggcatcagc

<210s, SEQ ID NO 49 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 49

Cttcaaggag atttgggatt tt 23

<210s, SEQ ID NO 50 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 50 gagggit cq9C atcgitat 17

<210s, SEQ ID NO 51 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide probe sequence

<4 OOs, SEQUENCE: 51 agagaagttt cacggattt C9ggc 25

<210s, SEQ ID NO 52 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence US 2013/0205440 A1 Aug. 8, 2013 72

- Continued <4 OOs, SEQUENCE: 52 gaggattagg gtttcaacgg ag 22

<210s, SEQ ID NO 53 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 53 gaga attgag Ctgaga.cgag g 21

<210s, SEQ ID NO 54 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 54

Ctgcaggt ca acggat Cagg at at 24

<210s, SEQ ID NO 55 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OO > SEQUENCE: 55 tgggctgaat talaga catg ct cc 24

<210s, SEQ ID NO 56 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 56 cgt.ccacaaa gctgaatgtg

<210s, SEQ ID NO 57 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OO > SEQUENCE: 57 cgaagt catg gaagcc actt

<210s, SEQ ID NO 58 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 58

Cttcaaggag atttgggatt tt 23 US 2013/0205440 A1 Aug. 8, 2013 73

- Continued <210s, SEQ ID NO 59 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OO > SEQUENCE: 59 gagggit cq9C atcgitat 17

<210s, SEQ ID NO 60 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 60 tgttcggttc cct ctaccaa

<210s, SEQ ID NO 61 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide probe sequence

<4 OOs, SEQUENCE: 61 cacaga accg tcgctt cago aa.ca 24

<210s, SEQ ID NO 62 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 62 caa.catccat caccittgact ga 22

<210s, SEQ ID NO 63 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide probe sequence

<4 OOs, SEQUENCE: 63 cgagcagacic gcc.gtgtact tct acc 26

<210s, SEQ ID NO 64 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 64 tggcggacga cacttgt 18

<210s, SEQ ID NO 65 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: US 2013/0205440 A1 Aug. 8, 2013 74

- Continued <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 65 aaagtttgga ggctgc.cgt. 19

<210s, SEQ ID NO 66 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer sequence

<4 OOs, SEQUENCE: 66 ttcago accc gtcagaat 18

<210s, SEQ ID NO 67 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide probe sequence

<4 OO > SEQUENCE: 67 tgcc.gagaac ttgaggaggit

<210s, SEQ ID NO 68 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: oligonucleotide primer sequence

<4 OOs, SEQUENCE: 68 tggit cqc.cat agcttgt 17

What may be claimed is: 8. The isolated nucleic acid molecule of claim 1, wherein the second chloroplast transit peptide is from an 3-enolpyru 1. An isolated nucleic acid molecule comprising: Vylshikimate-5-phosphate synthetase gene. a synthetic Brassica-derived nucleotide sequence that encodes a peptide comprising a contiguous amino acid 9. The isolated nucleic acid molecule of claim 1, wherein sequence of a first Brassica chloroplast transit peptide, the peptide is at least 80% identical to a chloroplast transit the peptide further comprising a contiguous amino acid peptide selected from the group consisting of SEQID NOs:6 sequence of a second chloroplast transit peptide. and 8. 2. The isolated nucleic acid molecule of claim 1, further 10. The isolated nucleic acid molecule of claim 9, wherein comprising a nucleotide sequence of interest operably linked the peptide is at least 85% identical to a chloroplast transit peptide selected from the group consisting of SEQID NOs:6 to the synthetic Brassica-derived nucleotide sequence. and 8. 3. The isolated nucleic acid molecule of claim 1, wherein 11. The isolated nucleic acid molecule of claim 10, wherein the first Brassica chloroplast transit peptide is from Brassica the peptide is at least 90% identical to a chloroplast transit napus. peptide selected from the group consisting of SEQID NOs:6 4. The isolated nucleic acid molecule of claim 3, wherein and 8. the second chloroplast transit peptide is from a Brassica sp. 12. The isolated nucleic acid molecule of claim 11, wherein other than the first Brassica chloroplast transit peptide. the peptide is at least 95% identical to a chloroplast transit 5. The isolated nucleic acid molecule of claim 1, wherein peptide selected from the group consisting of SEQID NOs:6 the second chloroplast transit peptide is from an Arabidopsis and 8. Sp. 13. The isolated nucleic acid molecule of claim 12, wherein 6. The isolated nucleic acid molecule of claim 5, wherein the peptide is at least 98% identical to a chloroplast transit the second chloroplast transit peptide is from Arabidopsis peptide selected from the group consisting of SEQID NOs:6 thaliana. and 8. 7. The isolated nucleic acid molecule of claim 1, wherein 14. The isolated nucleic acid molecule of claim 13, wherein the first Brassica chloroplast transit peptide is from an the peptide is selected from the group consisting of SEQID 3-enolpyruvylshikimate-5-phosphate synthetase gene. NOS:6 and 8. US 2013/0205440 A1 Aug. 8, 2013

15. The isolated nucleic acid molecule of claim 1, wherein 30. The chimeric polypeptide of claim 28, wherein the the nucleotide coding sequence of interest does not encode biologically-active peptide is involved in herbicide resis the peptide of SEQID NO:1 or SEQID NO:3. tance. 16. The isolated nucleic acid molecule of claim 1, wherein 31. The chimeric polypeptide of claim 26, wherein the the nucleotide sequence that encodes the peptide is specifi biologically-active peptide is selected from the group consist cally hybridizable to a nucleotide sequence selected from the ing of acetolactase synthase (ALS), mutated ALS, precursors group consisting of SEQID NOS:6 and 8. of ALS, 3-enolpyruvylshikimate-5-phosphate synthetase 17. The isolated nucleic acid molecule of claim 2, further (EPSPS), CP4 EPSPS, and a class III EPSPS. comprising at least one additional nucleotide sequence(s), 32. A plant expression vector comprising the nucleic acid each encoding a chloroplast transit peptide, wherein the addi molecule of claim 2. tional nucleotide sequence(s) are operably linked to the 33. A plant material comprising the nucleic acid molecule nucleotide sequence of interest. of claim 2. 18. The isolated nucleic acid molecule of claim 17, wherein 34. The plant material of claim33, wherein the plant mate the at least one additional nucleotide sequence(s) is from an rial is selected from the group consisting of a plant cell, a plant organism selected from the group consisting of prokaryotes, tissue, a plant tissue culture, a callus culture, a plant part, and lower photosynthetic eukaryotes, and Chlorophytes. a whole plant. 19. The isolated nucleic acid molecule of claim 2, wherein 35. The plant material of claim 33, further comprising a the synthetic Brassica-derived nucleotide sequence and polypeptide comprising the peptide. nucleotide sequence of interest are operably linked to one or 36. The plant material of claim 35, wherein the nucleotide more regulatory sequences. sequence of interest encodes a portion of the polypeptide that is targeted to a plastid in a cell of the plant material. 20. The isolated nucleic acid molecule of claim 2, wherein 37. The plant material of claim33, wherein the nucleic acid the nucleic acid molecule encodes a chimeric polypeptide molecule is stably integrated into the genome of a cell from comprising a peptide encoded by the nucleotide sequence of the plant material. interest and a peptide encoded by the synthetic Brassica 38. The plant material of claim33, wherein the plant mate derived nucleotide sequence. rial is a whole plant. 21. A chimeric polypeptide encoded by the nucleic acid 39. The plant material of claim33, wherein the plant mate molecule of claim 20. rial is from a plant selected from the group consisting of 22. The chimeric polypeptide of claim 21, wherein the Arabidopsis, alfalfa, Brassica, beans, broccoli, cabbage, car peptide encoded by the nucleotide sequence of interest is rot, cauliflower, celery, Chinese cabbage, cotton, cucumber, targeted to a plastid in a plastid-containing cell. eggplant, lettuce, melon, pea, pepper, peanut, potato, pump 23. The chimeric polypeptide of claim 22, wherein the kin, radish, rapeseed, spinach, Soybean, squash, Sugarbeet, polypeptide comprises a chloroplast transit peptide that is Sunflower, tobacco, tomato, watermelon, corn, onion, rice, removed when the peptide encoded by the nucleotide Sorghum, wheat, rye, millet, Sugarcane, oat, triticale, Switch sequence of interest is targeted to the plastid. grass, and turfgrass. 24. The chimeric polypeptide of claim 21, wherein the 40. A method for producing a transgenic plant material, the peptide encoded by the nucleotide sequence of interest is a method comprising: biologically-active peptide. obtaining the isolated nucleic acid molecule of claim2; and 25. The chimeric polypeptide of claim 21, wherein the transforming a plant material with the nucleic acid mol peptide encoded by the nucleotide sequence of interest is a ecule. fluorescent peptide. 41. The method according to claim 40, wherein the plant 26. The chimeric polypeptide of claim 24, wherein the material is selected from the group consisting of a plant cell, biologically-active peptide is an enzyme. a plant tissue, a plant tissue culture, a callus culture, a plant 27. The chimeric polypeptide of claim 24, wherein the part, and a whole plant. biologically-active peptide is normally expressed in a plastid 42. The method according to claim 40, wherein the plant of a cell wherein the peptide is natively expressed. material is not a whole plant. 28. The chimeric polypeptide of claim 24, wherein the 43. A transgenic plant material produced by the method biologically-active peptide is involved in a process selected according to claim 40. from the group consisting of herbicide resistance, virus resis 44. A transgenic plant regenerated from the transgenic tance, bacterial pathogen resistance, insect resistance, nema plant material of claim 43. tode resistance, fungal resistance, plant vigor, plant yield, 45. A transgenic plant commodity product produced from temperature tolerance, Soil condition tolerance, low light the plant material of claim 43. level tolerance, low water level tolerance, high water level 46. The transgenic plant material of claim 43, wherein the tolerance, chemical environment tolerance, seed color, starch nucleotide sequence of interest encodes a biologically-active modification, amino acid synthesis, photosynthesis, synthesis peptide. offatty acids, oil synthesis, synthesis of arotenoids, synthesis 47. The transgenic plant material of claim 46, wherein the of terpenoids, synthesis of starch, and herbicide resistance. biologically-active peptide is involved in a process selected 29. The chimeric polypeptide of claim 24, wherein the from the group consisting of herbicide resistance, virus resis biologically-active peptide is selected from the group consist tance, bacterial pathogen resistance, insect resistance, nema ing of Zeaxanthin epoxidase, choline monooxygenase, ferro tode resistance, fungal resistance, plant vigor, plant yield, chelatase, omega-3 fatty acid desaturase, glutamine Syn temperature tolerance, Soil condition tolerance, low light thetase, provitamin A, hormones, Bt toxin proteins, and level tolerance, low water level tolerance, high water level markers useful in identification of plants comprising a trait of tolerance, chemical environment tolerance, seed color, starch interest. modification, amino acid synthesis, photosynthesis, synthesis US 2013/0205440 A1 Aug. 8, 2013 76 offatty acids, oil synthesis, synthesis of arotenoids, synthesis omega-3 fatty acid desaturase, glutamine synthetase, provi of terpenoids, synthesis of starch, and herbicide resistance. tamin A, hormones, Bt toxin proteins, and markers useful in 48. The transgenic plant material of claim 46, wherein the identification of plants comprising a trait of interest. biologically-active peptide is selected from the group consist 61. The polypeptide of claim 58, wherein the biologically ing of Zeaxanthin epoxidase, choline monooxygenase, ferro active peptide is selected from the group consisting of aceto chelatase, omega-3 fatty acid desaturase, glutamine Syn lactase synthase (ALS), mutated ALS, precursors of ALS, thetase, provitamin A, hormones, Bt toxin proteins, and 3-enolpyruvylshikimate-5-phosphate synthetase (EPSPS), markers useful in identification of plants comprising a trait of CP4 EPSPS, and a class III EPSPS. interest. 62. A plant expression vector comprising the nucleic acid 49. The transgenic plant material of claim 47, wherein the molecule of claim 53. biologically-active peptide is involved in herbicide resis 63. A plant material comprising the nucleic acid molecule tance. of claim 53. 50. The transgenic plant material of claim 46, wherein the biologically-active peptide is selected from the group consist 64. The plant material of claim 63, wherein the nucleic acid ing of acetolactase synthase (ALS), mutated ALS, precursors molecule is stably integrated into the genome of a cell from of ALS, 3-enolpyruvylshikimate-5-phosphate synthetase the plant material. (EPSPS), CP4 EPSPS, and a class III EPSPS. 65. The plant material of claim 63, wherein the plant mate 51. The transgenic plant material of claim 49, wherein the rial is a whole plant. plant material exhibits increased herbicide resistance or her 66. The plant material of claim 63, wherein the plant mate bicide tolerance when compared to a wild-type plant material rial is from a plant selected from the group consisting of of the same species. Arabidopsis, alfalfa, Brassica, beans, broccoli, cabbage, car 52. An isolated nucleic acid molecule comprising a Bras rot, cauliflower, celery, Chinese cabbage, cotton, cucumber, sica-derived means for targeting a polypeptide to a chloro eggplant, lettuce, melon, pea, pepper, peanut, potato, pump plast. kin, radish, rapeseed, spinach, Soybean, squash, Sugarbeet, 53. The isolated nucleic acid molecule of claim 52, further Sunflower, tobacco, tomato, watermelon, corn, onion, rice, comprising a nucleotide sequence of interest operably linked Sorghum, wheat, rye, millet, Sugarcane, oat, triticale, Switch to the Brassica-derived means for targeting a polypeptide to a grass, and turfgrass. chloroplast. 67. A method for producing a transgenic plant material, the 54. The isolated nucleic acid molecule of claim S3, wherein method comprising: the nucleic acid molecule encodes a chimeric polypeptide obtaining the isolated nucleic acid molecule of claim 53; comprising a peptide encoded by the nucleotide sequence of and interest. transforming a plant material with the nucleic acid mol 55. A chimeric polypeptide encoded by the nucleic acid ecule. molecule of claim 54. 68. The method according to claim 67, wherein the plant 56. The chimeric polypeptide of claim 55, wherein the material is selected from the group consisting of a plant cell, peptide encoded by the nucleotide sequence of interest is a plant tissue, a plant tissue culture, a callus culture, a plant targeted to a plastid in a plastid-containing cell. part, and a whole plant. 57. The chimeric polypeptide of claim 56, wherein the polypeptide comprises a chloroplast transit peptide that is 69. The method according to claim 67, wherein the plant removed when the peptide encoded by the nucleotide material is not a whole plant. sequence of interest is targeted to the plastid. 70. A transgenic plant material produced by the method 58. The chimeric polypeptide of claim 55, wherein the according to claim 67. peptide encoded by the nucleotide sequence of interest is a 71. A transgenic plant regenerated from the transgenic biologically-active peptide. plant material of claim 70. 59. The polypeptide of claim 58, wherein the biologically 72. The plant material of claim 70, wherein the transgenic active peptide is involved in a process selected from the group plant material is a whole plant. consisting of herbicide resistance, virus resistance, bacterial 73. A transgenic plant commodity product produced from pathogen resistance, insect resistance, nematode resistance, the transgenic plant material of claim 70. fungal resistance, plant vigor, plant yield, temperature toler 74. The transgenic plant material of claim 70, wherein the ance, Soil condition tolerance, low light level tolerance, low nucleotide sequence of interest encodes a biologically-active water level tolerance, high water level tolerance, chemical peptide. environment tolerance, seed color, starch modification, 75. The plant material of claim34, wherein the plant mate amino acid synthesis, photosynthesis, synthesis offatty acids, rial is a plant cell that is incapable of regeneration to produce oil synthesis, synthesis of arotenoids, synthesis ofterpenoids, a plant. synthesis of starch, and herbicide resistance. 60. The polypeptide of claim 58, wherein the biologically 76. The method of claim 41, wherein the plant material is a active peptide is selected from the group consisting of Zeax plant cell that is incapable of regeneration to produce a plant. anthin epoxidase, choline monooxygenase, ferrochelatase, k k k k k