DOCSLIB.ORG

WO 2016/191305 Al 1 December 2016 (01.12.2016) P O P C T

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
WO 2016/191305 Al 1 December 2016 (01.12.2016) P O P C T (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2016/191305 Al 1 December 2016 (01.12.2016) P O P C T (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every C07K 14/705 (2006.01) G01N 33/68 (2006.01) kind of national protection available): AE, AG, AL, AM, G01N 33/50 (2006.01) AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, (21) Number: International Application DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, PCT/US2016/033619 HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, (22) International Filing Date: KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, 20 May 20 16 (20.05.2016) MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, (25) Filing Language: English SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, (26) Publication Language: English TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: (84) Designated States (unless otherwise indicated, for every 62/165,827 22 May 2015 (22.05.2015) US kind of regional protection available): ARIPO (BW, GH, 62/206,454 18 August 2015 (18.08.2015) US GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, (71) Applicant: THE BOARD OF TRUSTEES OF THE LE- TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, LAND STANFORD JUNIOR UNIVERSITY [US/US]; DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, Office of the General Counsel, Building 170, 3rd Floor, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, Main Quad, P.O. Box 20386, Stanford, California 94305- SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, 2038 (US). GW, KM, ML, MR, NE, SN, TD, TG). (72) Inventors: COREY, Daniel Mark; 1479 Kings Lane, Palo Published: Alto, California 94303 (US). RING, Aaron Michael; 2253 — with international search report (Art. 21(3)) Williams Street, Palo Alto, California 94306 (US). WEISSMAN, Irving L.; 747 Santa Ynez Street, Stanford, — before the expiration of the time limit for amending the California 94305 (US). claims and to be republished in the event of receipt of amendments (Rule 48.2(h)) (74) Agent: GURLEY, Kyle A.; 1900 University Avenue, Suite 200, East Palo Alto, California 94303 (US). — with sequence listing part of description (Rule 5.2(a)) © (54) Title: BTN3A ECTODOMAIN PROTEINS AND METHODS OF USE ¾ (57) Abstract: BTN3A ectodomain polypeptides are provided, which comprise a BTN3A ectodomain (e.g., a BTN3A1, BTN3A2, or BTN3A3 ectodomain) and lack a BTN3A transmembrane domain (e.g., a BTN3A1, BTN3A2, or BTN3A3 transmembrane domain). Compositions and methods are provided for activating an antigen presenting cell (APC). In some cases, the APC is activated in vivo. For example, in some cases, APC activity is stimulated (an APC is activated) in a mammal by administering a pharmaceutical com- position comprising a BTN3A ectodomain polypeptide. BTN3A Ectodomain Proteins and Methods of Use CROSS-REFERENCE This application claims the benefit of U.S. Provisional Patent Application Numbers 62/165,827 filed May 22, 2015, and 62/206,454 filed August 18, 2015, which applications are incorporated herein by reference in their entirety. GOVERNMENT SUPPORT This invention was made with Government support under contract CA086065 awarded by the National Institutes of Health. The Government has certain rights in the invention. INCORPORATION BY REFERENCE OF SEQUENCE LISTING PROVIDED AS A TEXT FILE A Sequence Listing is provided herewith as a text file, "STAN- 1168WO_SeqList_ST25.txt" created on March 22, 2016 and having a size of 54 KB. The contents of the text file are incorporated by reference herein in their entirety. INTRODUCTION The current model for T-cell activation postulates that naive T-cells require two signals for full activation: (i) a signal provided through the binding of processed antigens presented to the T-cell receptor by major histocompatibility complex (MHC) class I molecules (e.g., via an antigen producing cell (APC)); and (ii) an additional signal provided by the interaction of co- stimulatory molecules on the surface of T-cells and their ligands on antigen presenting cells (APCs). Recognition of an antigen by a naive T-cell is insufficient in itself to trigger T-cell activation. Without a co-stimulatory signal, T-cells may be eliminated either by death or by induction of anergy. The activation/stimulation of APCs is critical for an appropriate immune response. There is a need in the art for compositions and methods that can activate (e.g., increase the activation of) antigen presenting cells. The present disclosure provides BTN3A ectodomain polypeptides that activate antigen presenting cells (APCs), which can then stimulate (e.g., cross-prime) immune cells such as T cells (e.g., naive T cells) and thereby enhance an immune response. Methods of use are also provided. SUMMARY Methods and compositions are provided for stimulating the activity of antigen presenting cells (APCs) (stimulating APC activity) in an individual (e.g., in a mammal). In some cases, the methods include a step of administering a composition that includes a BTN3A ectodomain polypeptide (e.g., administering a therapeutic dose of a pharmaceutical composition comprising a BTN3A ectodomain polypeptide). BTN3A ectodomain polypeptides and compositions that include a BTN3A ectodomain polypeptide are also provided. The polypeptides include a BTN3A ectodomain and do not include a BTN3A transmembrane domain. Subject BTN3A ectodomain polypeptides have utility for in vivo and in vitro methods that stimulate antigen presenting cell (APC) activity (e.g., by promoting differentiation of Dendritic Cells (DCs), by activating APCs, etc.). In the subject methods and compositions, a BTN3A ectodomain polypeptide can be post-translationally modified, for example by glycosylation, PEGylation, etc. A BTN3A ectodomain polypeptide can be a fusion protein (i.e., can include an amino acid sequence in addition to a BTN3A ectodomain), for example a fusion with antibody Fc sequences and/or binding polypeptide (e.g., an antigen binding region of a polypeptide, an ectodomain from a protein other than BTN3A) that provides for specific binding to a target molecule of interest (e.g., an antigen of interest); and the like. BTN3A ectodomain polypeptides can be monomeric or multimeric, i.e. dimer, trimer, tetramer, etc. For example, in some cases, a BTN3A ectodomain polypeptide includes a dimerization moiety. In some cases, a BTN3A ectodomain polypeptide is multispecific, and thus includes a region (in addition to the BTN3A ectodomain) that specifically binds to a target molecule other than BTN3A. The disclosure also includes pharmaceutical formulations having a BTN3A ectodomain polypeptide in combination with a pharmaceutically acceptable excipient (a pharmaceutical excipient). Such formulations may be provided as a unit dose (a unit dose formulation), e.g. a dose effective to stimulate APC activity. Pharmaceutical formulations also include lyophilized or other preparations of the BTN3A ectodomain polypeptides, which may be reconstituted for use. In some embodiments, BTN3A ectodomain polypeptides can be administered in combination (co-administered) with another agent, e.g., an opsonizing agent (e.g., an ADCC- inducing antibody) that selectively binds to the targeted cell. For example, in some cases, methods are provided to stimulate an immune response, e.g. by targeting the destruction of living cancer cells by the immune system. In such methods, APC activity is stimulated (e.g., by the administration of a subject BTN3A ectodomain polypeptide), and specific cells are targeted by means of a binding agent (e.g., an antibody, an ectodomain of protein other than BTN3A, etc.) that specifically binds to target cells. Inflicted individuals that can be treated with a BTN3A ectodomain polypeptide include individuals that have cancer, individuals that harbor an infection (e.g., a chronic infection, a viral infection, etc.), individuals that have an immunological disorder (e.g., a disorder associated with immunosuppression, e.g., primary or combined immunodeficiency), individuals that have an inflammatory disorder, and/or individuals that have other hyper-proliferative conditions, for example sclerosis, fibrosis, and the like, etc. In some cases, cancer cells, e.g. tumor cells, are targeted for elimination by contacting the cells of the immune system with a dose of a BTN3A ectodomain polypeptide that is effective to stimulate APC activity (activate APCs), allowing for increased stimulation of the immune system. Administration of an effective dose of a BTN3A ectodomain polypeptide to a patient stimulates APC activity (activates APCs) which can increase the clearance of tumor cells and/or infected cells (e.g., chronically infected cells). In some cases, the BTN3A ectodomain polypeptide can be combined (co-administered) with ADCC-inducing antibodies (e.g., opsonizing antibodies, monoclonal antibodies) directed against one or more tumor cell markers, which combination therapy can be synergistic in enhancing elimination of cancer cells as compared to the administration of either agent as a single entity. In other embodiments the BTN3A ectodomain polypeptide comprises a detectable label. Such a labeled reagent can be used, for example, for imaging purposes in vitro or in vivo, e.g. in the imaging of a tumor, in the imaging of APC/T cell interactions, etc.. In some cases, a BTN3A ectodomain polypeptide can be used as a diagnostic tool for the detection of cells expressing a receptor (e.g., a counter receptor such as, e.g., , FLT1, HLA-E, CD163, and/or ROR2) for BTN3A (e.g., BTN3A1 , BTN3A2, and/or BTN3A3), and can be used as a companion diagnostic to assess whether a particular treatment regimen has been successful.
Load more

Recommended publications
  • Genome-Wide Approach to Identify Risk Factors for Therapy-Related Myeloid Leukemia
    Leukemia (2006) 20, 239–246 & 2006 Nature Publishing Group All rights reserved 0887-6924/06 $30.00 www.nature.com/leu ORIGINAL ARTICLE Genome-wide approach to identify risk factors for therapy-related myeloid leukemia A Bogni1, C Cheng2, W Liu2, W Yang1, J Pfeffer1, S Mukatira3, D French1, JR Downing4, C-H Pui4,5,6 and MV Relling1,6 1Department of Pharmaceutical Sciences, The University of Tennessee, Memphis, TN, USA; 2Department of Biostatistics, The University of Tennessee, Memphis, TN, USA; 3Hartwell Center, The University of Tennessee, Memphis, TN, USA; 4Department of Pathology, The University of Tennessee, Memphis, TN, USA; 5Department of Hematology/Oncology St Jude Children’s Research Hospital, The University of Tennessee, Memphis, TN, USA; and 6Colleges of Medicine and Pharmacy, The University of Tennessee, Memphis, TN, USA Using a target gene approach, only a few host genetic risk therapy increases, the importance of identifying host factors for factors for treatment-related myeloid leukemia (t-ML) have been secondary neoplasms increases. defined. Gene expression microarrays allow for a more 4 genome-wide approach to assess possible genetic risk factors Because DNA microarrays interrogate multiple ( 10 000) for t-ML. We assessed gene expression profiles (n ¼ 12 625 genes in one experiment, they allow for a ‘genome-wide’ probe sets) in diagnostic acute lymphoblastic leukemic cells assessment of genes that may predispose to leukemogenesis. from 228 children treated on protocols that included leukemo- DNA microarray analysis of gene expression has been used to genic agents such as etoposide, 13 of whom developed t-ML. identify distinct expression profiles that are characteristic of Expression of 68 probes, corresponding to 63 genes, was different leukemia subtypes.13,14 Studies using this method have significantly related to risk of t-ML.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • BTN3A3 (NM 197974) Human Untagged Clone – SC107714
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC107714 BTN3A3 (NM_197974) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: BTN3A3 (NM_197974) Human Untagged Clone Tag: Tag Free Symbol: BTN3A3 Synonyms: BTF3; BTN3.3 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 BTN3A3 (NM_197974) Human Untagged Clone – SC107714 Fully Sequenced ORF: >OriGene sequence for NM_197974 edited GAATTCGGCACGAGTGCTTTCTTTTTCCTTTCTTCGGAATGAGAGACTCAACCATAATAG AAAGAATGGAGAACTATTAACCACCATTCTTCAGTGGGCTGTGATTTTCAGAGGGGAATA CTAAGAAATGGTTTTCCATACTGGAACCCAAAGGTAAAGACACTCAAGGACAGACATTTT TGGCAGAGCTCAGTTTTCTGTGCTTGGACCCTCTGGGCCCATCCTGGCCATGGTGGGTGA AGACGCTGATCTGCCCTGTCACCTGTTCCCGACCATGAGTGCAGAGACCATGGAGCTGAG GTGGGTGAGTTCCAGCCTAAGGCAGGTGGTGAACGTGTATGCAGATGGAAAGGAAGTGGA AGACAGGCAGAGTGCACCGTATCGAGGGAGAACTTCGATTCTGCGGGATGGCATCACTGC AGGGAAGGCTGCTCTCCGAATACACAACGTCACAGCCTCTGACAGTGGAAAGTACTTGTG TTATTTCCAAGATGGTGACTTCTACGAAAAAGCCCTGGTGGAGCTGAAGGTTGCAGCATT GGGTTCTGATCTTCACATTGAAGTGAAGGGTTATGAGGATGGAGGGATCCATCTGGAGTG CAGGTCCACTGGCTGGTACCCCCAACCCCAAATAAAGTGGAGCGACACCAAGGGAGAGAA CATCCCGGCTGTGGAAGCACCTGTGGTTGCAGATGGAGTGGGCCTGTATGCAGTAGCAGC ATCTGTGATCATGAGAGGCAGCTCTGGTGGGGGTGTATCCTGCATCATCAGAAATTCCCT
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]
  • The Intracellular B30.2 Domain of Butyrophilin 3A1 Binds Phosphoantigens to Mediate Activation of Human Vg9vd2tcells
    Immunity Article The Intracellular B30.2 Domain of Butyrophilin 3A1 Binds Phosphoantigens to Mediate Activation of Human Vg9Vd2TCells Andrew Sandstrom,1 Cassie-Marie Peigne´ ,2,3,4 Alexandra Le´ ger,2,3,4 James E. Crooks,5 Fabienne Konczak,2,3,4 Marie-Claude Gesnel,2,3,4 Richard Breathnach,2,3,4 Marc Bonneville,2,3,4 Emmanuel Scotet,2,3,4,* and Erin J. Adams1,6,* 1Department of Biochemistry and Molecular Biology, University of Chicago, Chicago, IL 60637, USA 2INSERM, Unite´ Mixte de Recherche 892, Centre de Recherche en Cance´ rologie Nantes Angers, 44000 Nantes, France 3University of Nantes, 44000 Nantes, France 4Centre National de la Recherche Scientifique (CNRS), Unite´ Mixte de Recherche 6299, 44000 Nantes, France 5Program in Biophysical Sciences, University of Chicago, Chicago, IL 60637, USA 6Committee on Immunology, University of Chicago, Chicago, IL 60637, USA *Correspondence: [email protected] (E.S.), [email protected] (E.J.A.) http://dx.doi.org/10.1016/j.immuni.2014.03.003 SUMMARY et al., 1999). In vitro, Vg9Vd2 T cells target certain cancer cell lines or cells treated with microbial extracts (Tanaka et al., 1994). In humans, Vg9Vd2 T cells detect tumor cells and mi- Vg9Vd2 T cell reactivity has been traced to accumulation of crobial infections, including Mycobacterium tubercu- organic pyrophosphate molecules commonly known as phos- losis, through recognition of small pyrophosphate phoantigens (pAgs) (Constant et al., 1994; Hintz et al., 2001; containing organic molecules known as phospho- Puan et al., 2007; Tanaka et al., 1995). These molecules are pro- antigens (pAgs). Key to pAg-mediated activation duced either endogenously, such as isopentenyl pyrophosphate of Vg9Vd2 T cells is the butyrophilin 3A1 (BTN3A1) (IPP), an intermediate of the mevalonate pathway in human cells that can accumulate intracellularly during tumorigenesis, or protein that contains an intracellular B30.2 domain by microbes, such as hydroxy-methyl-butyl-pyrophosphate critical to pAg reactivity.
    [Show full text]
  • 2020 Zlatareva Iva 1521303 E
    This electronic thesis or dissertation has been downloaded from the King’s Research Portal at https://kclpure.kcl.ac.uk/portal/ Tissue-specific butyrophilin-like proteins are TCR selecting ligands distinct from antigens Zlatareva, Iva Awarding institution: King's College London The copyright of this thesis rests with the author and no quotation from it or information derived from it may be published without proper acknowledgement. END USER LICENCE AGREEMENT Unless another licence is stated on the immediately following page this work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International licence. https://creativecommons.org/licenses/by-nc-nd/4.0/ You are free to copy, distribute and transmit the work Under the following conditions: Attribution: You must attribute the work in the manner specified by the author (but not in any way that suggests that they endorse you or your use of the work). Non Commercial: You may not use this work for commercial purposes. No Derivative Works - You may not alter, transform, or build upon this work. Any of these conditions can be waived if you receive permission from the author. Your fair dealings and other rights are in no way affected by the above. Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 10. Oct. 2021 Tissue-specific butyrophilin-like proteins are gdTCR selecting ligands distinct from antigens Iva Ivanova Zlatareva King’s College London PhD Supervisors: Professor Adrian C.
    [Show full text]
  • Adaptor Periplakin Phosphoantigens and the Cytoskeletal Interactions Of
    Activation of Human δγ T Cells by Cytosolic Interactions of BTN3A1 with Soluble Phosphoantigens and the Cytoskeletal Adaptor Periplakin This information is current as of October 1, 2021. David A. Rhodes, Hung-Chang Chen, Amanda J. Price, Anthony H. Keeble, Martin S. Davey, Leo C. James, Matthias Eberl and John Trowsdale J Immunol published online 30 January 2015 http://www.jimmunol.org/content/early/2015/01/30/jimmun Downloaded from ol.1401064 Supplementary http://www.jimmunol.org/content/suppl/2015/01/30/jimmunol.140106 Material 4.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2015 The Authors All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published January 30, 2015, doi:10.4049/jimmunol.1401064 The Journal of Immunology Activation of Human gd T Cells by Cytosolic Interactions of BTN3A1 with Soluble Phosphoantigens and the Cytoskeletal Adaptor Periplakin David A. Rhodes,* Hung-Chang Chen,†,1 Amanda J. Price,‡,1 Anthony H.
    [Show full text]
  • The First Nonprimate Species with a Phosphoantigen-Reactive Vγ9vδ2 T Cell Subset
    Alpaca (Vicugna pacos), the first nonprimate species with a phosphoantigen-reactive Vγ9Vδ2 T cell subset Alina S. Fichtnera,1, Mohindar M. Karunakarana, Siyi Gub,2, Christopher T. Boughterc, Marta T. Borowskab, Lisa Staricka, Anna Nöhrena, Thomas W. Göbeld, Erin J. Adamsb, and Thomas Herrmanna,3 aDepartment of Virology and Immunobiology, Julius-Maximilians University Wuerzburg, 97078 Wuerzburg, Germany; bDepartment of Biochemistry and Molecular Biophysics, University of Chicago, Chicago, IL 60637; cThe Graduate Program in Biophysical Sciences, University of Chicago, Chicago, IL 60637; and dDepartment of Veterinary Sciences, Institute for Animal Physiology, Ludwig-Maximilians-University Munich, 80539 Munich, Germany Edited by Willi K. Born, National Jewish Health, Denver, CO, and accepted by Editorial Board Member Tak W. Mak February 6, 2020 (received for review June 4, 2019) Vγ9Vδ2 T cells are a major γδ T cell population in the human blood B7 receptor family-like butyrophilin (BTN) and butyrophilin-like expressing a characteristic Vγ9JP rearrangement paired with Vδ2. (BTNL) molecules on the development of specific γδ T cell sub- This cell subset is activated in a TCR-dependent and MHC- sets has been shown in mice (Skint-1, Btnl1/Btnl6) and humans unrestricted fashion by so-called phosphoantigens (PAgs). PAgs (BTNL3/BTNL8) (14–17). can be microbial [(E)-4-hydroxy-3-methyl-but-2-enyl pyrophos- Upon activation, human Vγ9Vδ2 T cells can rapidly release phate, HMBPP] or endogenous (isopentenyl pyrophosphate, IPP) cytokines and kill transformed or infected cells by perforin and and PAg sensing depends on the expression of B7-like butyrophilin granzyme release, TCR-mediated and NKG2D-dependent mech- (BTN3A, CD277) molecules.
    [Show full text]
  • Nature Cell Biology | VOL 21 | OCTOBER 2019 | 1219–1233 | 1219 Articles Nature Cell Biology Ab
    ARTICLES https://doi.org/10.1038/s41556-019-0393-3 Molecular identification of a BAR domain- containing coat complex for endosomal recycling of transmembrane proteins Boris Simonetti1,6, Blessy Paul2,6, Karina Chaudhari3, Saroja Weeratunga2, Florian Steinberg 4, Madhavi Gorla3, Kate J. Heesom5, Greg J. Bashaw3, Brett M. Collins 2,7* and Peter J. Cullen 1,7* Protein trafficking requires coat complexes that couple recognition of sorting motifs in transmembrane cargoes with bio- genesis of transport carriers. The mechanisms of cargo transport through the endosomal network are poorly understood. Here, we identify a sorting motif for endosomal recycling of cargoes, including the cation-independent mannose-6-phosphate receptor and semaphorin 4C, by the membrane tubulating BAR domain-containing sorting nexins SNX5 and SNX6. Crystal structures establish that this motif folds into a β-hairpin, which binds a site in the SNX5/SNX6 phox homology domains. Over sixty cargoes share this motif and require SNX5/SNX6 for their recycling. These include cargoes involved in neuronal migration and a Drosophila snx6 mutant displays defects in axonal guidance. These studies identify a sorting motif and pro- vide molecular insight into an evolutionary conserved coat complex, the ‘Endosomal SNX–BAR sorting complex for promoting exit 1’ (ESCPE-1), which couples sorting motif recognition to the BAR-domain-mediated biogenesis of cargo-enriched tubulo- vesicular transport carriers. housands of transmembrane cargo proteins routinely enter into an endosomal coat complex that couples sequence-dependent the endosomal network where they transit between two fates: cargo recognition with the BAR domain-mediated biogenesis of Tretention within the network for degradation in the lysosome tubulo-vesicular transport carriers.
    [Show full text]
  • It Is Illeg Al to P O St Th Is Co P Yrig H Ted P D F O N an Y W Eb Site. It Is Illegal
    Letters to the Editor It is Geneillegal Expression to Profiling post ofthis the xMHC copyrighted Region and HIST1H4C PDF encodeon histones.any Strong website. evidence of associations Reveals 9 Candidate Genes in Schizophrenia was observed within and around histone genes in schizophrenia.2 Abnormal expression of genes related to nucleosome and histone To the Editor: Strong association of the extended major structure and function has also been found in both schizophrenia 3 histocompatibility complex (xMHC) region on human patients and their siblings. MRPS18B encodes ribosomal protein chromosome 6 with schizophrenia has been supported by a that helps in mitochondrial protein synthesis. TUBB encodes number of genome-wide association studies.1 However, since tubulin that is the major constituent of microtubules. Altered the xMHC region is featured by numerous polymorphisms, expression of TUBB has been reported in a previous microarray 4 dense gene clusters, and strong linkage disequilibrium, it is study in schizophrenia patients. ABCF1 and BTN3A3 are difficult to attribute the association to specific genes. A targeted immune-related genes. BTN3A3 is involved in T-cell activity scrutinization of gene expression in the xMHC region can in adaptive immune response. ABCF1 enhances protein provide valuable candidate genes for future validation. Here synthesis and promotes inflammation. Decreased expression we utilize 2 real-time polymerase chain reaction (PCR)–based of ABCF1 had been found in the whole blood of patients with platforms and 2 sample sets to investigate protein-coding gene schizophrenia and identified as a hub gene in a gene expressional 5 expressions in the xMHC region in peripheral blood leukocytes subnetwork.
    [Show full text]
  • Allele-Specific Gene Expression Patterns in Primary Leukemic Cells Reveal Regulation of Gene Expression by Cpg Site Methylation
    Downloaded from genome.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Article Allele-specific gene expression patterns in primary leukemic cells reveal regulation of gene expression by CpG site methylation Lili Milani,1 Anders Lundmark,1 Jessica Nordlund,1 Anna Kiialainen,1 Trond Flaegstad,2,8 Gudmundur Jonmundsson,3,8 Jukka Kanerva,4,8 Kjeld Schmiegelow,5,8 Kevin L. Gunderson,6 Gudmar Lönnerholm,7,8 and Ann-Christine Syvänen1,9 1Molecular Medicine, Department of Medical Sciences, Uppsala University, 75185 Uppsala, Sweden; 2Department of Pediatrics, University and University Hospital, Tromsoe, 9038 Norway; 3Department of Pediatrics, Landspitalinn, 101 Reykjavik, Iceland; 4Division of Hematology/Oncology and Stem Cell Transplantation, Hospital for Children and Adolescents, University of Helsinki, 00029 HUS Helsinki, Finland; 5Pediatric Clinic II, Rigshospitalet, and the Medical Faculty, the Institute of Gynecology, Obstetrics and Pediatrics, the University of Copenhagen, Copenhagen, 2100 Denmark; 6Illumina Inc., San Diego, California 92121, USA; 7Department of Women’s and Children’s Health, University Children’s Hospital, 75185 Uppsala, Sweden To identify genes that are regulated by cis-acting functional elements in acute lymphoblastic leukemia (ALL) we determined the allele-specific expression (ASE) levels of 2529 genes by genotyping a genome-wide panel of single nucleotide polymorphisms in RNA and DNA from bone marrow and blood samples of 197 children with ALL. Using a reproducible, quantitative genotyping method and stringent criteria for scoring ASE, we found that 16% of the analyzed genes display ASE in multiple ALL cell samples. For most of the genes, the level of ASE varied largely between the samples, from 1.4-fold overexpression of one allele to apparent monoallelic expression.
    [Show full text]
  • Evolutionary and Polymorphism Analyses Reveal the Central Role Of
    Evolutionary and polymorphism analyses reveal the central role of BTN3A2 in the concerted evolution of the BTN3 gene family Hassnae Afrache, Pierre Pontarotti, Laurent Abi-Rached, Daniel Olive To cite this version: Hassnae Afrache, Pierre Pontarotti, Laurent Abi-Rached, Daniel Olive. Evolutionary and polymor- phism analyses reveal the central role of BTN3A2 in the concerted evolution of the BTN3 gene family. Immunogenetics, Springer Verlag, 2017, 69 (6), pp.379 - 390. 10.1007/s00251-017-0980-z. hal-01785307 HAL Id: hal-01785307 https://hal.archives-ouvertes.fr/hal-01785307 Submitted on 13 May 2018 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 1 Evolutionary and Polymorphism Analyses Reveal the Central Role 2 of BTN3A2 in the Concerted Evolution of the BTN3 Gene Family * * 3 Hassnae Afrache1, Pierre Pontarotti, Laurent Abi-Rached3 , Daniel Olive1 4 1 Centre de Recherche en Cancérologie de Marseille (CRCM), Inserm, U1068, Marseille, F-1300 5 9, France, CNRS, UMR7258, Marseille, F-13009, Institut Paoli-Calmettes, Marseille, F-13009, F 6 rance, Aix-Marseille University, UM 105, F-13284, Marseille, France 7 2 Institut de Mathématiques de Marseille, UMR 7373 8 3 ATIP CNRS, Institut de Mathématiques de Marseille, UMR 7373 * 9 lar and do are co-senior authors 10 Correspondence should be addressed to Daniel Olive, e-mail [email protected] 11 12 13 Conflict-of-interest disclosure: Olive D.
    [Show full text]