DOCSLIB.ORG

2020 Zlatareva Iva 1521303 E

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
2020 Zlatareva Iva 1521303 E This electronic thesis or dissertation has been downloaded from the King’s Research Portal at https://kclpure.kcl.ac.uk/portal/ Tissue-specific butyrophilin-like proteins are TCR selecting ligands distinct from antigens Zlatareva, Iva Awarding institution: King's College London The copyright of this thesis rests with the author and no quotation from it or information derived from it may be published without proper acknowledgement. END USER LICENCE AGREEMENT Unless another licence is stated on the immediately following page this work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International licence. https://creativecommons.org/licenses/by-nc-nd/4.0/ You are free to copy, distribute and transmit the work Under the following conditions: Attribution: You must attribute the work in the manner specified by the author (but not in any way that suggests that they endorse you or your use of the work). Non Commercial: You may not use this work for commercial purposes. No Derivative Works - You may not alter, transform, or build upon this work. Any of these conditions can be waived if you receive permission from the author. Your fair dealings and other rights are in no way affected by the above. Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 10. Oct. 2021 Tissue-specific butyrophilin-like proteins are gdTCR selecting ligands distinct from antigens Iva Ivanova Zlatareva King’s College London PhD Supervisors: Professor Adrian C. Hayday and Dr James N. Arnold A thesis suBmitted for the degree of DoCtor of Philosophy King’s College London January 2020 1 Declaration I Iva Zlatareva confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. The majority of the data presented in chapters III, IV and V were published in Melandri, et al., 2018 and Willcox et al., 2019. 2 Abstract Tissue-resident gd T cells are a population of unconventional lymphocytes able to mount rapid immune responses following tissue damage. It has long been debated whether selecting elements for gd T cells exist, akin to MHC for ab T cells. In mice, gd T lymphocytes show tissue- restricted T cell receptor (TCR) repertoires, which are dependent, at least in the epidermis and gut, on the tissue-specific expression of butyrophilin-like proteins (Btnl). Hence, we hypothesised that the Btnl family of proteins are physiological ligands modulating gd T cell selection and function. We have previously established in vitro that BTNL3 and BTNL8, specifically expressed in the human intestinal epithelium, induce selective TCR-dependent responses in a subset of colonic gd T cells. The aim of this project was to investigate the mechanism of interaction between BTNL3 plus BTNL8 and the TCR of responding cells. To this end, responding, human colonic intraepithelial lymphocytes (IELs) co-cultured with BTNL3 plus BTNL8-expressing cells were single cell-sorted and sequenced. Majority of responding cells were clonally diverse Vg4+ lymphocytes and several paired gdTCR sequences were expressed in TCR-deficient Jurkat cells. In co-culture assays, Vg4-expressing Jurkats downregulated their TCR and upregulated CD69 when exposed to BTNL3 plus BTNL8. Site- directed mutagenesis showed unexpectedly, that the hypervariable loop 4 (HV4) of the Vg4 chain was critical for BNTL3-specific recognition. Intriguingly, CD1c-phosphatidylcholine- reactive Vg4Vd1 and endothelial protein C receptor (EPCR)-reactive Vg4Vd5 cells were capable of mounting a response against BTNL3 plus BTNL8 deeming them dually reactive. Importantly, CD1c and EPCR recognitions were CDR3-mediated. Thus, human Vg4+ TCRs appear to have two spatially distinct regions involved in antigen recognition. The adaptive, non-germline encoded gdCDR3 loops are required for binding to clonally-restricted ligands whereas the innate, germline-encoded HV4g loop is required for interaction with the tissue-specific complex BTNL3/8. The same phenomenon is true for murine intestinal Vg7+ cells which require Btnl1/4/6 for their development and tissue retention. Although these molecules are not direct human orthologues, an evolutionarily conserved mechanism emerges. BTNL3/8 are perhaps selecting elements of intestinal Vγ4+ IELs and future studies should investigate the biological significance of these interactions in humans. Of note, early studies presented in this thesis suggest that BTNL3 and BTNL8 heteromeric complex is partially depleting the Vg4 TCR from the lymphocyte surface, suggesting an immunoregulatory role for this interaction. 3 Acknowledgements I would like to thank my supervisor Prof Adrian Hayday for giving me the opportunity to work on this exciting project, for his insight, support, contagious enthusiasm for this field and for his critical feedback on all my work, reports, presentations and this thesis. I would also like to thank my second supervisor, Dr James Arnold, and my thesis committee members, Dr Patricia Barral and Dr Susan John, for their support and advice throughout my studies. A special thanks to Dr Susan John in particular, for also providing me with moral support and the occasional shoulder to cry on. I have thoroughly enjoyed our long discussions about life and science. I would like to acknowledge the National Institute for Health Research (NIHR) Biomedical Research Centre based at Guy’s and St Thomas’ NHS Foundation Trust and King’s College London who funded this PhD. This work would not have been possible without our collaborators: Dr Salah Mansour and Dr Andrew Chancellor from the University of Southampton; Dr Daniela Wesch and Professor Dieter Kabelitz from Kiel; Dr Vivian Li and Dr Laura Novellasdemunt from the Francis Crick institute; and Dr Oxana Polyakova and Dr Oliver Nussbaumer from Gamma Delta Therapeutics, all of whom provided critical reagents or protocols for this study. Special thanks are due to Prof Benjamin Willcox, Dr Carrie Willcox, Dr Mahboob Salim and the rest of the Willcox laboratory from the University of Birmingham for conducting all the biochemical studies which helped prove a direct interaction; to Dr Peter Irving from Guy’s and St Thomas’ NHS foundation Trust who provided access to patient samples; and Raphael Chaleli and Prof Paul Bates from the Francis Crick institute who did the BTNL3 and BTNL8 modelling and docking experiments. Several members of the Hayday laboratory have been responsible for my scientific training. Particularly, I would like to thank Dr Pierre Vantourout for his mentorship and constant guidance throughout my PhD. Thank you for putting up with all my questions and teaching me the wonders of molecular biology. Thank you for being not only my teacher, but also a friend, supporting me in time of crisis, nervous breakdowns and self-doubt – I would not have survived this PhD without your support! I would also like to thank Efstathios Theodoridis, Dr Fernanda Kyle, Dr Shraddha Kamdar, Dr Abhishek Das, Dr Magdalen Joseph, Dr Adam Laing, Dr Robin Dart, Dr Yin Wu and Dr Yasmin Haque all of whom have helped me numerous times with scientific discussions, data analysis and thought me new techniques or were just there to brightened my day. It has been a pleasure working alongside you every day. I thank Daisy Melandri who conducted parallel studies in mice which helped generalize the findings in this thesis across species. Finally, I am grateful to all members of the Hayday laboratory, past and present, for 4 creating such a stimulating research environment in which I had the opportunity to develop as a scientist. Outside of the laboratory, I would like to thank my friends and family for their constant support and love throughout the years. Special thanks are due to my mother who has always supported me even though she never quite understood what I was doing and why I chose this career path. Thank you for always believing in me! Finally, I am grateful to all the brave patients who gifted pieces of their gut in the name of science, despite undergoing an incredibly uncomfortable procedure! 5 Dedication This thesis is dedicated to the strongest woman that I know - my mother, Kristina Zlatareva. Thank you for all your love and support in the pursuit of my dreams. 6 Table of contents DECLARATION ......................................................................................................................... 2 ABSTRACT................................................................................................................................ 3 ACKNOWLEDGEMENTS ........................................................................................................... 4 DEDICATION ............................................................................................................................ 6 TABLE OF CONTENTS ............................................................................................................... 7 TABLE OF FIGURES ..................................................................................................................12 LIST OF TABLES .......................................................................................................................13 ABBREVIATIONS .....................................................................................................................14 CHAPTER I. INTRODUCTION....................................................................................................19
Load more

Recommended publications
  • Genome-Wide Approach to Identify Risk Factors for Therapy-Related Myeloid Leukemia
    Leukemia (2006) 20, 239–246 & 2006 Nature Publishing Group All rights reserved 0887-6924/06 $30.00 www.nature.com/leu ORIGINAL ARTICLE Genome-wide approach to identify risk factors for therapy-related myeloid leukemia A Bogni1, C Cheng2, W Liu2, W Yang1, J Pfeffer1, S Mukatira3, D French1, JR Downing4, C-H Pui4,5,6 and MV Relling1,6 1Department of Pharmaceutical Sciences, The University of Tennessee, Memphis, TN, USA; 2Department of Biostatistics, The University of Tennessee, Memphis, TN, USA; 3Hartwell Center, The University of Tennessee, Memphis, TN, USA; 4Department of Pathology, The University of Tennessee, Memphis, TN, USA; 5Department of Hematology/Oncology St Jude Children’s Research Hospital, The University of Tennessee, Memphis, TN, USA; and 6Colleges of Medicine and Pharmacy, The University of Tennessee, Memphis, TN, USA Using a target gene approach, only a few host genetic risk therapy increases, the importance of identifying host factors for factors for treatment-related myeloid leukemia (t-ML) have been secondary neoplasms increases. defined. Gene expression microarrays allow for a more 4 genome-wide approach to assess possible genetic risk factors Because DNA microarrays interrogate multiple ( 10 000) for t-ML. We assessed gene expression profiles (n ¼ 12 625 genes in one experiment, they allow for a ‘genome-wide’ probe sets) in diagnostic acute lymphoblastic leukemic cells assessment of genes that may predispose to leukemogenesis. from 228 children treated on protocols that included leukemo- DNA microarray analysis of gene expression has been used to genic agents such as etoposide, 13 of whom developed t-ML. identify distinct expression profiles that are characteristic of Expression of 68 probes, corresponding to 63 genes, was different leukemia subtypes.13,14 Studies using this method have significantly related to risk of t-ML.
    [Show full text]
  • REPORTER No 6396 W E D N E S D Ay 23 S E P T E M B E R 2015 V O L C X Lv I N O 1
    CAMBRIDGE UNIVERSITY REPORTER NO 6396 W ED N E S D AY 23 S EPTEMBER 2015 V OL CXLV I N O 1 CONTENTS Notices Notices by Faculty Boards, etc. Calendar 2 Natural Sciences Tripos, Part II (Biological Notice of a Discussion on Tuesday, 13 October and Biomedical Sciences), 2015–16 11 2015 2 Natural Sciences Tripos, Part III (Experimental Preacher at Mere’s Commemoration in 2016 2 and Theoretical Physics) and Master of Nomination of the Proctors and Deputy Advanced Studies in Physics, 2015–16 12 Proctors for 2015–16 2 Form and conduct of examinations, 2016 Annual Reports 2 Asian and Middle Eastern Studies Tripos, Examination results statistics 2 Part II, 2016: correction 13 Vacancies, appointments, etc. Obituaries Electors to the Professorship of Comparative Obituary Notices 14 Philology 3 Graces Electors to the Professorship of Immunology 3 Grace submitted to the Regent House on Electors to the Sir Patrick Sheehy 23 September 2015 14 Professorship of International Relations 3 Acta Electors to the Professorship of Medieval History 4 Approval of Grace submitted to the Regent Electors to the William Wyse Professorship of House on 29 July 2015 14 Social Anthropology 4 Vacancies in the University 4 End of the Official Part of the ‘Reporter’ Elections, appointments, reappointment, and College Notices grants of title 5 Elections 15 Awards, etc. Vacancies 16 Scholarships and Prizes, etc. awarded 7 Other Notices 17 Events, courses, etc. Notice by the University Bellringer 17 Announcement of lectures, seminars, etc. 8 External Notices Notices by the General Board University of Oxford 17 Regulations for the University Library 9 The Cambridge Humanities Research Grants Scheme 9 Regulations for examinations Classical Tripos, Part II 10 Modern and Medieval Languages Tripos, Part IB 10 Bachelor of Theology for Ministry 10 PLISUB HED BY AUTHORITY 2 CAMBRIDGE UNIVERSITY REPORTER 23 September 2015 NOTICES Calendar 1 October, Thursday.
    [Show full text]
  • Immune Homeostasis
    IMMUNE HOMEOSTASIS FUNDED PROJECTS FROM THE INNOVATION WORKSHOP 18-20 JULY 2017 AIMS THE SANDPIT PROCESS CAN BE BROKEN DOWN The immune system continues to intrigue and test us: as we get closer to finding ways of harnessing or modulating immune responses, new and unexpected consequences and INTO SEVERAL STAGES: challenges present themselves, often testing even our most fundamental understanding. Cancer Research UK and Arthritis Research UK came together to engage the research community to tackle the specific challenge of understanding how the immune system regulates itself under normal physiological conditions (immune homeostasis), how it is • Defining the scope of the challenge dysregulated in different diseases and how we can stimulate the immune response to prevent • Sharing understanding of the challenge and expertise brought to the sandpit by or treat disease (immunotherapy). participants We brought together researchers and clinicians in the fields of inflammatory disease, cancer, • Evolving common languages and terminologies amongst people from a diverse theoretical physics, computational medicine and other areas, whose expertise could be applied range of backgrounds and disciplines to the key questions concerning immune homeostasis. This workshop encouraged participants from a diverse range of backgrounds to melt barriers, develop a common language to promote • Breaking down preconceptions of researchers and stakeholders collaboration, and suggest new ways to harness the immune system to treat disease. • Taking part in break-out sessions focussed on challenges, using creative thinking techniques Director • Capturing outputs in the form of highly innovative feasibility study proposals The role of the Director was to work with the facilitators to lead the event and guide the process • A funding decision on those proposals at the sandpit, using “real time” peer-review.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • BTN3A3 (NM 197974) Human Untagged Clone – SC107714
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC107714 BTN3A3 (NM_197974) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: BTN3A3 (NM_197974) Human Untagged Clone Tag: Tag Free Symbol: BTN3A3 Synonyms: BTF3; BTN3.3 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 BTN3A3 (NM_197974) Human Untagged Clone – SC107714 Fully Sequenced ORF: >OriGene sequence for NM_197974 edited GAATTCGGCACGAGTGCTTTCTTTTTCCTTTCTTCGGAATGAGAGACTCAACCATAATAG AAAGAATGGAGAACTATTAACCACCATTCTTCAGTGGGCTGTGATTTTCAGAGGGGAATA CTAAGAAATGGTTTTCCATACTGGAACCCAAAGGTAAAGACACTCAAGGACAGACATTTT TGGCAGAGCTCAGTTTTCTGTGCTTGGACCCTCTGGGCCCATCCTGGCCATGGTGGGTGA AGACGCTGATCTGCCCTGTCACCTGTTCCCGACCATGAGTGCAGAGACCATGGAGCTGAG GTGGGTGAGTTCCAGCCTAAGGCAGGTGGTGAACGTGTATGCAGATGGAAAGGAAGTGGA AGACAGGCAGAGTGCACCGTATCGAGGGAGAACTTCGATTCTGCGGGATGGCATCACTGC AGGGAAGGCTGCTCTCCGAATACACAACGTCACAGCCTCTGACAGTGGAAAGTACTTGTG TTATTTCCAAGATGGTGACTTCTACGAAAAAGCCCTGGTGGAGCTGAAGGTTGCAGCATT GGGTTCTGATCTTCACATTGAAGTGAAGGGTTATGAGGATGGAGGGATCCATCTGGAGTG CAGGTCCACTGGCTGGTACCCCCAACCCCAAATAAAGTGGAGCGACACCAAGGGAGAGAA CATCCCGGCTGTGGAAGCACCTGTGGTTGCAGATGGAGTGGGCCTGTATGCAGTAGCAGC ATCTGTGATCATGAGAGGCAGCTCTGGTGGGGGTGTATCCTGCATCATCAGAAATTCCCT
    [Show full text]
  • Pnas11052ackreviewers 5098..5136
    Acknowledgment of Reviewers, 2013 The PNAS editors would like to thank all the individuals who dedicated their considerable time and expertise to the journal by serving as reviewers in 2013. Their generous contribution is deeply appreciated. A Harald Ade Takaaki Akaike Heather Allen Ariel Amir Scott Aaronson Karen Adelman Katerina Akassoglou Icarus Allen Ido Amit Stuart Aaronson Zach Adelman Arne Akbar John Allen Angelika Amon Adam Abate Pia Adelroth Erol Akcay Karen Allen Hubert Amrein Abul Abbas David Adelson Mark Akeson Lisa Allen Serge Amselem Tarek Abbas Alan Aderem Anna Akhmanova Nicola Allen Derk Amsen Jonathan Abbatt Neil Adger Shizuo Akira Paul Allen Esther Amstad Shahal Abbo Noam Adir Ramesh Akkina Philip Allen I. Jonathan Amster Patrick Abbot Jess Adkins Klaus Aktories Toby Allen Ronald Amundson Albert Abbott Elizabeth Adkins-Regan Muhammad Alam James Allison Katrin Amunts Geoff Abbott Roee Admon Eric Alani Mead Allison Myron Amusia Larry Abbott Walter Adriani Pietro Alano Isabel Allona Gynheung An Nicholas Abbott Ruedi Aebersold Cedric Alaux Robin Allshire Zhiqiang An Rasha Abdel Rahman Ueli Aebi Maher Alayyoubi Abigail Allwood Ranjit Anand Zalfa Abdel-Malek Martin Aeschlimann Richard Alba Julian Allwood Beau Ances Minori Abe Ruslan Afasizhev Salim Al-Babili Eric Alm David Andelman Kathryn Abel Markus Affolter Salvatore Albani Benjamin Alman John Anderies Asa Abeliovich Dritan Agalliu Silas Alben Steven Almo Gregor Anderluh John Aber David Agard Mark Alber Douglas Almond Bogi Andersen Geoff Abers Aneel Aggarwal Reka Albert Genevieve Almouzni George Andersen Rohan Abeyaratne Anurag Agrawal R. Craig Albertson Noga Alon Gregers Andersen Susan Abmayr Arun Agrawal Roy Alcalay Uri Alon Ken Andersen Ehab Abouheif Paul Agris Antonio Alcami Claudio Alonso Olaf Andersen Soman Abraham H.
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]
  • The Intracellular B30.2 Domain of Butyrophilin 3A1 Binds Phosphoantigens to Mediate Activation of Human Vg9vd2tcells
    Immunity Article The Intracellular B30.2 Domain of Butyrophilin 3A1 Binds Phosphoantigens to Mediate Activation of Human Vg9Vd2TCells Andrew Sandstrom,1 Cassie-Marie Peigne´ ,2,3,4 Alexandra Le´ ger,2,3,4 James E. Crooks,5 Fabienne Konczak,2,3,4 Marie-Claude Gesnel,2,3,4 Richard Breathnach,2,3,4 Marc Bonneville,2,3,4 Emmanuel Scotet,2,3,4,* and Erin J. Adams1,6,* 1Department of Biochemistry and Molecular Biology, University of Chicago, Chicago, IL 60637, USA 2INSERM, Unite´ Mixte de Recherche 892, Centre de Recherche en Cance´ rologie Nantes Angers, 44000 Nantes, France 3University of Nantes, 44000 Nantes, France 4Centre National de la Recherche Scientifique (CNRS), Unite´ Mixte de Recherche 6299, 44000 Nantes, France 5Program in Biophysical Sciences, University of Chicago, Chicago, IL 60637, USA 6Committee on Immunology, University of Chicago, Chicago, IL 60637, USA *Correspondence: [email protected] (E.S.), [email protected] (E.J.A.) http://dx.doi.org/10.1016/j.immuni.2014.03.003 SUMMARY et al., 1999). In vitro, Vg9Vd2 T cells target certain cancer cell lines or cells treated with microbial extracts (Tanaka et al., 1994). In humans, Vg9Vd2 T cells detect tumor cells and mi- Vg9Vd2 T cell reactivity has been traced to accumulation of crobial infections, including Mycobacterium tubercu- organic pyrophosphate molecules commonly known as phos- losis, through recognition of small pyrophosphate phoantigens (pAgs) (Constant et al., 1994; Hintz et al., 2001; containing organic molecules known as phospho- Puan et al., 2007; Tanaka et al., 1995). These molecules are pro- antigens (pAgs). Key to pAg-mediated activation duced either endogenously, such as isopentenyl pyrophosphate of Vg9Vd2 T cells is the butyrophilin 3A1 (BTN3A1) (IPP), an intermediate of the mevalonate pathway in human cells that can accumulate intracellularly during tumorigenesis, or protein that contains an intracellular B30.2 domain by microbes, such as hydroxy-methyl-butyl-pyrophosphate critical to pAg reactivity.
    [Show full text]
  • 2018 IID Meeting, Orlando, Florida
    May 16-19, 2018 MEETING PROGRAM Rosen Shingle Creek Resort Orlando, Florida www.IID2018.org IID 2018 MEETING IID 2018 Program Chairs and Final Reviewers ESDR - Program Chairs JSID - Program Chairs SID - Program Chairs Michel Gilliet, MD Manabu Fujimoto, MD Nicole Ward, PhD Matthias Schmuth, MD Manabu Ohyama, MD/PhD Victoria Werth, MD ESDR – Final Reviewers JSID – Final Reviewers SID – Final Reviewers Hervé Bachelez, MD/PhD Riichiro Abe, MD/PhD Vladimir Botchkarev, MD/PhD Leopold Eckhart, PhD Manabu Fujimoto, MD Spiro Getsios, PhD Menno de Rie, MD/PhD Minoru Hasegawa, MD Daniel Kaplan, MD/PhD Bernhard Homey, MD Hironobu Ihn, MD/PhD Ethan Lerner, MD/PhD David Kelsell, PhD Kenji Kabashima, MD/PhD Lloyd Miller, MD/PhD Lionel Larue, PhD Takuro Kanekura, MD/PhD Peggy Myung, MD/PhD Caterina Missero, PhD Norito Katoh, PhD Marjana Tomic-Canic, PhD Edel O’Toole, PhD Tatsuyoshi Kawamura, MD/PhD Kevin Wang, MD/PhD Ralf Paus, MD/PhD Akiharu Kubo, MD/PhD Nicole Ward, PhD Sirkku Peltonen, MD/PhD Akimichi Morita, MD/PhD Victoria Werth, MD Neil Rajan, MD/PhD Manabu Ohyama, MD/PhD Martin Steinhoff, MD/PhD Ryuhei Okuyama, MD/PhD Marta Szell, DSc Tamio Suzuki, MD/PhD Thomas Werfel, MD Katsuto Tamai, MD/PhD Peter Wolf, MD Akemi Yamamoto, MD/PhD European Society for Japanese Society for Society for Investigative Dermatological Research Investigative Dermatology Dermatology Rue Cingria 7, Geneva 5F, 4-1-4 Hongo, Bunkyo-ku, Tokyo 526 Superior Avenue East, Suite 340 Switzerland, 1205 113-0033, Japan Cleveland, Ohio 44114, USA Tel: +41 22 321 48 90 Tel: +81-3-3830-0068 Tel: +01 216-579-9300 Email: [email protected] Email: [email protected] Email: [email protected] Web: www.esdr.org Web: www.jsid.org Web: www.sidnet.org ACKNOWLEDGEMENTS The organizers of IID 2018 gratefully acknowledge the many exhibitors and sponsors whose attendance has helped make this meeting possible.
    [Show full text]
  • Adaptor Periplakin Phosphoantigens and the Cytoskeletal Interactions Of
    Activation of Human δγ T Cells by Cytosolic Interactions of BTN3A1 with Soluble Phosphoantigens and the Cytoskeletal Adaptor Periplakin This information is current as of October 1, 2021. David A. Rhodes, Hung-Chang Chen, Amanda J. Price, Anthony H. Keeble, Martin S. Davey, Leo C. James, Matthias Eberl and John Trowsdale J Immunol published online 30 January 2015 http://www.jimmunol.org/content/early/2015/01/30/jimmun Downloaded from ol.1401064 Supplementary http://www.jimmunol.org/content/suppl/2015/01/30/jimmunol.140106 Material 4.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2015 The Authors All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published January 30, 2015, doi:10.4049/jimmunol.1401064 The Journal of Immunology Activation of Human gd T Cells by Cytosolic Interactions of BTN3A1 with Soluble Phosphoantigens and the Cytoskeletal Adaptor Periplakin David A. Rhodes,* Hung-Chang Chen,†,1 Amanda J. Price,‡,1 Anthony H.
    [Show full text]
  • The First Nonprimate Species with a Phosphoantigen-Reactive Vγ9vδ2 T Cell Subset
    Alpaca (Vicugna pacos), the first nonprimate species with a phosphoantigen-reactive Vγ9Vδ2 T cell subset Alina S. Fichtnera,1, Mohindar M. Karunakarana, Siyi Gub,2, Christopher T. Boughterc, Marta T. Borowskab, Lisa Staricka, Anna Nöhrena, Thomas W. Göbeld, Erin J. Adamsb, and Thomas Herrmanna,3 aDepartment of Virology and Immunobiology, Julius-Maximilians University Wuerzburg, 97078 Wuerzburg, Germany; bDepartment of Biochemistry and Molecular Biophysics, University of Chicago, Chicago, IL 60637; cThe Graduate Program in Biophysical Sciences, University of Chicago, Chicago, IL 60637; and dDepartment of Veterinary Sciences, Institute for Animal Physiology, Ludwig-Maximilians-University Munich, 80539 Munich, Germany Edited by Willi K. Born, National Jewish Health, Denver, CO, and accepted by Editorial Board Member Tak W. Mak February 6, 2020 (received for review June 4, 2019) Vγ9Vδ2 T cells are a major γδ T cell population in the human blood B7 receptor family-like butyrophilin (BTN) and butyrophilin-like expressing a characteristic Vγ9JP rearrangement paired with Vδ2. (BTNL) molecules on the development of specific γδ T cell sub- This cell subset is activated in a TCR-dependent and MHC- sets has been shown in mice (Skint-1, Btnl1/Btnl6) and humans unrestricted fashion by so-called phosphoantigens (PAgs). PAgs (BTNL3/BTNL8) (14–17). can be microbial [(E)-4-hydroxy-3-methyl-but-2-enyl pyrophos- Upon activation, human Vγ9Vδ2 T cells can rapidly release phate, HMBPP] or endogenous (isopentenyl pyrophosphate, IPP) cytokines and kill transformed or infected cells by perforin and and PAg sensing depends on the expression of B7-like butyrophilin granzyme release, TCR-mediated and NKG2D-dependent mech- (BTN3A, CD277) molecules.
    [Show full text]
  • Nature Cell Biology | VOL 21 | OCTOBER 2019 | 1219–1233 | 1219 Articles Nature Cell Biology Ab
    ARTICLES https://doi.org/10.1038/s41556-019-0393-3 Molecular identification of a BAR domain- containing coat complex for endosomal recycling of transmembrane proteins Boris Simonetti1,6, Blessy Paul2,6, Karina Chaudhari3, Saroja Weeratunga2, Florian Steinberg 4, Madhavi Gorla3, Kate J. Heesom5, Greg J. Bashaw3, Brett M. Collins 2,7* and Peter J. Cullen 1,7* Protein trafficking requires coat complexes that couple recognition of sorting motifs in transmembrane cargoes with bio- genesis of transport carriers. The mechanisms of cargo transport through the endosomal network are poorly understood. Here, we identify a sorting motif for endosomal recycling of cargoes, including the cation-independent mannose-6-phosphate receptor and semaphorin 4C, by the membrane tubulating BAR domain-containing sorting nexins SNX5 and SNX6. Crystal structures establish that this motif folds into a β-hairpin, which binds a site in the SNX5/SNX6 phox homology domains. Over sixty cargoes share this motif and require SNX5/SNX6 for their recycling. These include cargoes involved in neuronal migration and a Drosophila snx6 mutant displays defects in axonal guidance. These studies identify a sorting motif and pro- vide molecular insight into an evolutionary conserved coat complex, the ‘Endosomal SNX–BAR sorting complex for promoting exit 1’ (ESCPE-1), which couples sorting motif recognition to the BAR-domain-mediated biogenesis of cargo-enriched tubulo- vesicular transport carriers. housands of transmembrane cargo proteins routinely enter into an endosomal coat complex that couples sequence-dependent the endosomal network where they transit between two fates: cargo recognition with the BAR domain-mediated biogenesis of Tretention within the network for degradation in the lysosome tubulo-vesicular transport carriers.
    [Show full text]