Expression of Zebrafish Nk2.2 Is Influenced by Sonic Hedgehog

Total Page:16

File Type:pdf, Size:1020Kb

Expression of Zebrafish Nk2.2 Is Influenced by Sonic Hedgehog Development 121, 1755-1768 (1995) 1755 Printed in Great Britain © The Company of Biologists Limited 1995 Expression of zebrafish nk2.2 is influenced by sonic hedgehog/vertebrate hedgehog-1 and demarcates a zone of neuronal differentiation in the embryonic forebrain Katrin Anukampa Barth and Stephen W. Wilson Developmental Biology Research Centre, Randall Institute, King’s College London, 26-29 Drury Lane, London WC2B 5RL, UK SUMMARY We have isolated zebrafish nk2.2, a member of the Nk-2 and eyes. Moreover, cyclops mutant embryos, which family of homeobox genes. nk2.2 is expressed in a continu- initially lack neurectodermal expression of shh/vhh-1, show ous narrow band of cells along a boundary zone demar- a concomitant lack of nk2.2 expression. Together, these cating the location at which two of the earliest nuclei in the results suggest a requirement of shh/vhh-1 protein for the brain differentiate. This band of cells is located within a spatial regulation of nk2.2 expression. few cell diameters of cells expressing the signalling molecule sonic hedgehog/vertebrate hedgehog-1 (shh/vhh- 1). Injection of shh/vhh-1 RNA results in ectopic expression Key words: boundary, Nk2, hedgehog, axial, zebrafish, forebrain, of nk2.2 and concomitant abnormalities in the forebrain neuronal differentiation INTRODUCTION families, the Nk-2 family is characterised by an additional conserved motif, the Nk-2 domain (Price et al., 1992). This The last few years have seen significant advances in our under- motif, the prototype of which is found in the Drosophila NK- standing of the mechanisms underlying anteroposterior and 2 gene (Kim and Nirenberg, 1989), consists of at least 17 dorsoventral patterning of the hindbrain and spinal cord amino acids located carboxyterminal to the homeobox. Since (Krumlauf et al., 1993; Smith, 1994). However, the morpho- the isolation of the first vertebrate family member Nkx- genesis of more rostral brain regions is less well understood, 2.1/TTF-1 (Guazzi et al., 1990; Lazzaro et al., 1991; Price et and there is still debate over such basic issues as defining the al., 1992), five other family members have been isolated in neural axes in the forebrain. It has been demonstrated that, mice. Nkx-2.1 to Nkx-2.4 are all closely related (Price et al., similar to the hindbrain, distinct neuromeres are present in the 1992; Price, 1993), while Nkx-2.5 and Nkx-2.6 represent more developing forebrain (Puelles et al., 1987). However, contro- divergent members of the family (Lints et al., 1993). In versy remains as to the number and exact positions of the addition to being expressed in the thyroid and lung, Nkx- forebrain neuromeres and whether they correspond to true 2.1/TTF-1 is also transcribed in restricted regions of the segmental subdivisions (Figdor and Stern, 1993; Puelles and forebrain, as is Nkx-2.2 (Lazzaro et al., 1991; Price et al., Rubenstein, 1993; Macdonald et al., 1994). 1992). Nkx-2.5 is thought to be involved in heart development Because of its relative simplicity, the embryonic zebrafish (Lints et al., 1993), while no detailed expression data have been CNS is well suited for studies of early forebrain development. reported for Nkx-2.3, Nkx-2.4 and Nkx-2.6. Zebrafish nk2.2 is By 24 hours of development (h), a simple scaffold of axon most closely related to Nkx-2.2 and the Xenopus gene XeNk2 tracts has been established by a small number of neurons at (Saha et al., 1993). invariant locations within the brain (Chitnis and Kuwada, In this study, we suggest that the signalling molecule 1990; Wilson et al., 1990). We have recently shown that shh/vhh-1 and the transcription factor axial are involved in the neurons that pioneer this scaffold differentiate at boundaries of spatial regulation of expression of nk2.2. shh/vhh-1 is the gene expression domains (Macdonald et al., 1994). For zebrafish homologue of the Drosophila hedgehog gene (Krauss example, the nuclei of the tract of the postoptic commissure et al., 1993; Roelink et al., 1994), and axial (Strähle et al., (nTPOC) and of the medial longitudinal fasciculus (nMLF) 1993) is the homologue of mouse HNF-3β, a member of the both develop and extend axons along the ventral boundary of winged-helix family of transcription factors (Pani et al., 1992; pax6 and rtk1 expression. Lai et al., 1993). shh/vhh-1 and axial/HNF-3β are both In this study, we report the isolation of a member of the Nk- involved in regulating the patterning of midline structures in 2 family of homeobox genes, termed nk2.2, which is expressed mesoderm and in the ventral CNS (Ang and Rossant, 1994; along the boundary zone at which the nTPOC and nMLF dif- Smith, 1994; Strähle and Blader, 1994; Weinstein et al., 1994). ferentiate. Like several other homeobox-containing gene The notion that axial/HNF-3β is a key regulator of floorplate 1756 K. A. Barth and S. W. Wilson development is supported by the finding that ectopic resulted in a spatially identical signal, but gave higher background expression of HNF-3β results in the ectopic appearance of staining. For axial, shh/vhh-1 and hlx-1, full-length cDNA probes floorplate markers (Sasaki and Hogan, 1994; see also Ruiz i were synthesized. To decrease background staining, probes were frac- Altaba and Jessel, 1992). It seems likely that shh/vhh-1 is tionated over a G-50 (Sigma) drip column to remove unincorporated responsible for the induction of axial/HNF-3β in the pre- DIG-UTP. Whole-mount in situ hybridisations were carried out as sumptive floorplate since ectopic expression of shh/vhh-1 described (Xu et al., 1994). After staining with NBT/X-phosphate β (Boehringer Mannheim), embryos were refixed overnight in 4% results in ectopic axial/HNF-3 expression (Echelard et al., paraformaldehyde/PBS, washed in PBS and cleared in 70% glycerol. 1993; Krauss et al., 1993; Roelink et al., 1994), while COS Embryos were dissected from the underlying yolk and mounted in cells secreting shh/vhh-1 induce floorplate differentiation in 70% glycerol for photography. Immunohistochemistry was carried adjacent neuroectoderm (Roelink et al., 1994). out according to standard procedures (Wilson et al., 1990). In zebrafish, analysis of embryos carrying the cyclops mutation has also provided results consistent with the possi- RNA injections bility that shh/vhh-1 and axial/HNF3β regulate floorplate shh/vhh-1 RNA for injections was derived from the pSP64T-shh development. The cyclops mutation affects specification of the plasmid kindly provided by J.-P. Concordet and P. Ingham; see Krauss ventral midline of the CNS such that homozygous mutant et al., 1993. RNA for injections was transcribed in vitro and several embryos lack a floorplate and exhibit fusion of the eyes (Hatta picoliters were injected at a concentration of 0.1 mg/ml into blastomeres of 1- to 4-cell stage embryos using a pressure-pulsed Picospritzer II et al., 1991). The cyclops gene may be involved in the sig- (General Valve Corp.). To assess the extent of chimerism, lacZ RNA nalling pathway between mesoderm and neuroectoderm that was co-injected at a lower concentration of 20 µg/ml. For control injec- specifies ventral CNS cell types (Hatta et al., 1991, 1994). In tions, RNA encoding β-galactosidase was injected at the same concen- agreement with this interpretation, neither shh/vhh-1 nor axial tration (0.1 mg/ml). Analysis of β-galactosidase activity was performed are initially expressed in the neurectoderm, while mesodermal on embryos that had been fixed for 10 minutes in 4% paraformalde- expression of these genes is present (Krauss et al., 1993; hyde, 0.5% glutaraldehyde at stages between 12 and 24 hours. After Strähle et al., 1993). several washes in PBS, 0.1% Tween 20 (Sigma), embryos were rinsed The timing and spatially restricted expression of nk2.2 in buffer A (1 mM MgCl2, 15 mM K3Fe(CN)6, 12 mM K4Fe(CN)6) and incubated at 37°C in buffer A containing X-gal (Stratagene) to a suggests that this gene may play a role in the regulation of a µ zone of neuronal differentiation within the embryonic zebrafish final concentration of 800 g/ml. After staining, embryos were washed several times, refixed and processed for in situ hybridisation. forebrain. Furthermore, we present evidence suggesting that shh/vhh-1 may be involved in the spatial regulation of nk2.2 expression. We show that nk2.2 expression is initially absent from the neuroectoderm of cyclops mutant embryos which con- RESULTS comitantly lack shh/vhh-1 expression and that overexpression of shh/vhh-1 results in ectopic expression of nk2.2. nk2.2 is homologous to mouse Nkx-2.2 and Xenopus XeNk-2 Through screening a zebrafish neurula stage cDNA library with MATERIALS AND METHODS a fragment of XeNk-2, a single clone containing 1.5 kb of cDNA was isolated and termed nk2.2 based on its homology Fish stocks to murine Nkx-2.2 (Price et al., 1992) and Xenopus XeNk-2 Breeding fish were maintained at 28.5°C and embryos were collected (Saha et al., 1993). The sequence of the 1470 bp nk2.2 clone by natural spawning and staged up to 24h (30 somites) according to shows a single open reading frame with a coding potential of Westerfield (1993); beyond this time, embryonic stage is given as 269 amino acids (Fig. 1A). hours post fertilisation. Cyclops (cycb16) mutant carrier fish were To define the extent of homology between nk2.2 and other obtained from C. Kimmel and C. Nüsslein-Volhard. Nk-2 gene family members, we compared the nk2.2 translation product to other sequences.
Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • 1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia
    1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Liver X-Receptors Alpha, Beta (Lxrs Α , Β) Level in Psoriasis
    Liver X-receptors alpha, beta (LXRs α , β) level in psoriasis Thesis Submitted for the fulfillment of Master Degree in Dermatology and Venereology BY Mohammad AbdAllah Ibrahim Awad (M.B., B.Ch., Faculty of Medicine, Cairo University) Supervisors Prof. Randa Mohammad Ahmad Youssef Professor of Dermatology, Faculty of Medicine Cairo University Prof. Laila Ahmed Rashed Professor of Biochemistry, Faculty of Medicine Cairo University Dr. Ghada Mohamed EL-hanafi Lecturer of Dermatology, Faculty of Medicine Cairo University Faculty of Medicine Cairo University 2011 ﺑﺴﻢ اﷲ اﻟﺮﺣﻤﻦ اﻟﺮﺣﻴﻢ "وﻣﺎ ﺗﻮﻓﻴﻘﻲ إﻻ ﺑﺎﷲ ﻋﻠﻴﻪ ﺗﻮآﻠﺖ وإﻟﻴﻪ أﻧﻴﺐ" (هﻮد، ٨٨) Acknowledgement Acknowledgement First and foremost, I am thankful to God, for without his grace, this work would never have been accomplished. I am honored to have Prof.Dr. Randa Mohammad Ahmad Youssef, Professor of Dermatology, Faculty of Medicine, Cairo University, as a supervisor of this work. I am so grateful and most appreciative to her efforts. No words can express what I owe her for hers endless patience and continuous advice and support. My sincere appreciation goes to Dr. Ghada Mohamed EL-hanafi, Lecturer of Dermatology, Faculty of Medicine, Cairo University, for her advice, support and supervision during the course of this study. I am deeply thankful to Dr. Laila Ahmed Rashed, Assistant professor of biochemistry, Faculty of Medicine, Cairo University, for her immense help, continuous support and encouragement. Furthermore, I wish to express my thanks to all my professors, my senior staff members, my wonderful friends and colleagues for their guidance and cooperation throughout the conduction of this work. Finally, I would like to thank my father who was very supportive and encouraging.
    [Show full text]
  • Table S3. RAE Analysis of Well-Differentiated Liposarcoma
    Table S3. RAE analysis of well-differentiated liposarcoma Model Chromosome Region start Region end Size q value freqX0* # genes Genes Amp 1 145009467 145122002 112536 0.097 21.8 2 PRKAB2,PDIA3P Amp 1 145224467 146188434 963968 0.029 23.6 10 CHD1L,BCL9,ACP6,GJA5,GJA8,GPR89B,GPR89C,PDZK1P1,RP11-94I2.2,NBPF11 Amp 1 147475854 148412469 936616 0.034 23.6 20 PPIAL4A,FCGR1A,HIST2H2BF,HIST2H3D,HIST2H2AA4,HIST2H2AA3,HIST2H3A,HIST2H3C,HIST2H4B,HIST2H4A,HIST2H2BE, HIST2H2AC,HIST2H2AB,BOLA1,SV2A,SF3B4,MTMR11,OTUD7B,VPS45,PLEKHO1 Amp 1 148582896 153398462 4815567 1.5E-05 49.1 152 PRPF3,RPRD2,TARS2,ECM1,ADAMTSL4,MCL1,ENSA,GOLPH3L,HORMAD1,CTSS,CTSK,ARNT,SETDB1,LASS2,ANXA9, FAM63A,PRUNE,BNIPL,C1orf56,CDC42SE1,MLLT11,GABPB2,SEMA6C,TNFAIP8L2,LYSMD1,SCNM1,TMOD4,VPS72, PIP5K1A,PSMD4,ZNF687,PI4KB,RFX5,SELENBP1,PSMB4,POGZ,CGN,TUFT1,SNX27,TNRC4,MRPL9,OAZ3,TDRKH,LINGO4, RORC,THEM5,THEM4,S100A10,S100A11,TCHHL1,TCHH,RPTN,HRNR,FLG,FLG2,CRNN,LCE5A,CRCT1,LCE3E,LCE3D,LCE3C,LCE3B, LCE3A,LCE2D,LCE2C,LCE2B,LCE2A,LCE4A,KPRP,LCE1F,LCE1E,LCE1D,LCE1C,LCE1B,LCE1A,SMCP,IVL,SPRR4,SPRR1A,SPRR3, SPRR1B,SPRR2D,SPRR2A,SPRR2B,SPRR2E,SPRR2F,SPRR2C,SPRR2G,LELP1,LOR,PGLYRP3,PGLYRP4,S100A9,S100A12,S100A8, S100A7A,S100A7L2,S100A7,S100A6,S100A5,S100A4,S100A3,S100A2,S100A16,S100A14,S100A13,S100A1,C1orf77,SNAPIN,ILF2, NPR1,INTS3,SLC27A3,GATAD2B,DENND4B,CRTC2,SLC39A1,CREB3L4,JTB,RAB13,RPS27,NUP210L,TPM3,C1orf189,C1orf43,UBAP2L,HAX1, AQP10,ATP8B2,IL6R,SHE,TDRD10,UBE2Q1,CHRNB2,ADAR,KCNN3,PMVK,PBXIP1,PYGO2,SHC1,CKS1B,FLAD1,LENEP,ZBTB7B,DCST2, DCST1,ADAM15,EFNA4,EFNA3,EFNA1,RAG1AP1,DPM3 Amp 1
    [Show full text]
  • A Molecular Map of Murine Lymph Node Blood Vascular Endothelium at Single Cell Resolution
    ARTICLE https://doi.org/10.1038/s41467-020-17291-5 OPEN A molecular map of murine lymph node blood vascular endothelium at single cell resolution Kevin Brulois1,13, Anusha Rajaraman1,2,3,13, Agata Szade 1,4,13,Sofia Nordling1,13, Ania Bogoslowski 5,6, Denis Dermadi 1, Milladur Rahman 1, Helena Kiefel1, Edward O’Hara1, Jasper J. Koning3, Hiroto Kawashima7, Bin Zhou 8, Dietmar Vestweber 9, Kristy Red-Horse10, Reina E. Mebius3, Ralf H. Adams 11, ✉ Paul Kubes 5,6, Junliang Pan1,2 & Eugene C. Butcher1,2,12 1234567890():,; Blood vascular endothelial cells (BECs) control the immune response by regulating blood flow and immune cell recruitment in lymphoid tissues. However, the diversity of BEC and their origins during immune angiogenesis remain unclear. Here we profile transcriptomes of BEC from peripheral lymph nodes and map phenotypes to the vasculature. We identify multiple subsets, including a medullary venous population whose gene signature predicts a selective role in myeloid cell (vs lymphocyte) recruitment to the medulla, confirmed by videomicro- scopy. We define five capillary subsets, including a capillary resident precursor (CRP) that displays stem cell and migratory gene signatures, and contributes to homeostatic BEC turnover and to neogenesis of high endothelium after immunization. Cell alignments show retention of developmental programs along trajectories from CRP to mature venous and arterial populations. Our single cell atlas provides a molecular roadmap of the lymph node blood vasculature and defines subset specialization for leukocyte recruitment and vascular homeostasis. 1 Laboratory of Immunology and Vascular Biology, Department of Pathology, Stanford University School of Medicine, Stanford, CA, USA.
    [Show full text]
  • BMC Biology Biomed Central
    BMC Biology BioMed Central Research article Open Access Classification and nomenclature of all human homeobox genes PeterWHHolland*†1, H Anne F Booth†1 and Elspeth A Bruford2 Address: 1Department of Zoology, University of Oxford, South Parks Road, Oxford, OX1 3PS, UK and 2HUGO Gene Nomenclature Committee, European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, CB10 1SA, UK Email: Peter WH Holland* - [email protected]; H Anne F Booth - [email protected]; Elspeth A Bruford - [email protected] * Corresponding author †Equal contributors Published: 26 October 2007 Received: 30 March 2007 Accepted: 26 October 2007 BMC Biology 2007, 5:47 doi:10.1186/1741-7007-5-47 This article is available from: http://www.biomedcentral.com/1741-7007/5/47 © 2007 Holland et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: The homeobox genes are a large and diverse group of genes, many of which play important roles in the embryonic development of animals. Increasingly, homeobox genes are being compared between genomes in an attempt to understand the evolution of animal development. Despite their importance, the full diversity of human homeobox genes has not previously been described. Results: We have identified all homeobox genes and pseudogenes in the euchromatic regions of the human genome, finding many unannotated, incorrectly annotated, unnamed, misnamed or misclassified genes and pseudogenes.
    [Show full text]
  • Blimp-1 Attenuates Th1 Differentiation by Repression of Ifng, Tbx21, and Bcl6 Gene Expression
    Blimp-1 Attenuates Th1 Differentiation by Repression of ifng, tbx21, and bcl6 Gene Expression This information is current as Luisa Cimmino, Gislaine A. Martins, Jerry Liao, Erna of September 24, 2021. Magnusdottir, Gabriele Grunig, Rocio K. Perez and Kathryn L. Calame J Immunol 2008; 181:2338-2347; ; doi: 10.4049/jimmunol.181.4.2338 http://www.jimmunol.org/content/181/4/2338 Downloaded from References This article cites 68 articles, 29 of which you can access for free at: http://www.jimmunol.org/content/181/4/2338.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 24, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Blimp-1 Attenuates Th1 Differentiation by Repression of ifng, tbx21, and bcl6 Gene Expression Luisa Cimmino,* Gislaine A. Martins,† Jerry Liao,† Erna Magnusdottir,‡ Gabriele Grunig,† Rocio K. Perez,‡ and Kathryn L.
    [Show full text]
  • Supplementary File Table S1
    Supplementary file Table S1 Grouping of Homeobox genes according to their main known function. Anatomical Structure Morphogenesis EN1, HOXC10, HOXC13, HOXD3, LBX1, SIX2, SIX4 Organ Morphogenesis CDX1, CDX2, HOXA11, HOXA13, ISL1, LHX1, PAX3, PDHX, PITX2, PITX3, PROX1, SIX6 Body Pattern Formation ALX3, EMX2, HHEX, HOXA11, HOXA2, HOXA4, HOXA5, HOXA6, HOXB1, HOXB5, HOXB6, HOXC5, HOXD10, HOXD8, LMX1B, PITX2 Ectoderm Development PROX1, VAX2 Endoderm Development HOXC11 Brain & Nervous System Development Brain Development ALX1, DLX2, EMX2 Nervous System Development: ARX, DLX5, DLX6, HOXD10, LBX1, LHX1, OTP, PAX3, PHOX2A, PHOX2B Skeletal Development: ALX3, ALX4, DLX3, DLX5, DLX6, EN1, HOXA11, HOXA13, HOXA2, HOXB6, HOXD10, HOXD13, MSX2 Muscle Development: BARX2, MKX, SIRT1, SIRT2, SIX1 Other Homeobox Genes Involved In BARX1, CDX4, CUX1, DLX1, EMX1, EN2, Multicellular Organismal HOXA1, HOXA7, HOXA9, HOXB13, HOXB2, Development: HOXB3, HOXB4, HOXB7, HOXB8, HOXB9, HOXC12, HOXC8, HOXC9, HOXD1, HOXD11, HOXD12, HOXD9, ISL2, LBX2, LMX1A, MEIS1, NKX3-1, OTX1, TLX1, VAX1, VSX1, VSX2 Homeobox Genes Involved In Cell ARX, EMX2, HHEX, HLX, HOPX, LBX1, LHX1, Differentiation: LMX1B, MIXL1, OTP, PHOX2A, SIRT1, VSX2 Other Genes: PHTF1, SIRT3, SIRT6, SIRT7, ZHX1, ZHX2 Homeobox genes include two subsets of genes coding for transcription factors involved in multiple functions. The clustered HOX genes are indicated in bold. Supplementary file Figure S2 5’ Spatial collinearity 3’ HOXA Chr. 7p15.3 HOXB Chr. 17q21.3 HOXC Chr. 12q13.3 HOXD Chr. 2q31 13 12 11 10 9 8 7 6 5 4 3 2 1 Paralogous HOX groups Distribution of the 39 human HOX genes in four clusters located in different chromosomal regions*. Blue indicates anterior HOX genes. Yellow, paralogy group 3 Hox genes, green and purple indicatete central HOX genes and Red the posterior HOX genes.
    [Show full text]
  • Oxidized Phospholipids Regulate Amino Acid Metabolism Through MTHFD2 to Facilitate Nucleotide Release in Endothelial Cells
    ARTICLE DOI: 10.1038/s41467-018-04602-0 OPEN Oxidized phospholipids regulate amino acid metabolism through MTHFD2 to facilitate nucleotide release in endothelial cells Juliane Hitzel1,2, Eunjee Lee3,4, Yi Zhang 3,5,Sofia Iris Bibli2,6, Xiaogang Li7, Sven Zukunft 2,6, Beatrice Pflüger1,2, Jiong Hu2,6, Christoph Schürmann1,2, Andrea Estefania Vasconez1,2, James A. Oo1,2, Adelheid Kratzer8,9, Sandeep Kumar 10, Flávia Rezende1,2, Ivana Josipovic1,2, Dominique Thomas11, Hector Giral8,9, Yannick Schreiber12, Gerd Geisslinger11,12, Christian Fork1,2, Xia Yang13, Fragiska Sigala14, Casey E. Romanoski15, Jens Kroll7, Hanjoong Jo 10, Ulf Landmesser8,9,16, Aldons J. Lusis17, 1234567890():,; Dmitry Namgaladze18, Ingrid Fleming2,6, Matthias S. Leisegang1,2, Jun Zhu 3,4 & Ralf P. Brandes1,2 Oxidized phospholipids (oxPAPC) induce endothelial dysfunction and atherosclerosis. Here we show that oxPAPC induce a gene network regulating serine-glycine metabolism with the mitochondrial methylenetetrahydrofolate dehydrogenase/cyclohydrolase (MTHFD2) as a cau- sal regulator using integrative network modeling and Bayesian network analysis in human aortic endothelial cells. The cluster is activated in human plaque material and by atherogenic lipo- proteins isolated from plasma of patients with coronary artery disease (CAD). Single nucleotide polymorphisms (SNPs) within the MTHFD2-controlled cluster associate with CAD. The MTHFD2-controlled cluster redirects metabolism to glycine synthesis to replenish purine nucleotides. Since endothelial cells secrete purines in response to oxPAPC, the MTHFD2- controlled response maintains endothelial ATP. Accordingly, MTHFD2-dependent glycine synthesis is a prerequisite for angiogenesis. Thus, we propose that endothelial cells undergo MTHFD2-mediated reprogramming toward serine-glycine and mitochondrial one-carbon metabolism to compensate for the loss of ATP in response to oxPAPC during atherosclerosis.
    [Show full text]