DOCSLIB.ORG

Blimp-1 Attenuates Th1 Differentiation by Repression of Ifng, Tbx21, and Bcl6 Gene Expression

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Blimp-1 Attenuates Th1 Differentiation by Repression of ifng, tbx21, and bcl6 Gene Expression This information is current as Luisa Cimmino, Gislaine A. Martins, Jerry Liao, Erna of September 24, 2021. Magnusdottir, Gabriele Grunig, Rocio K. Perez and Kathryn L. Calame J Immunol 2008; 181:2338-2347; ; doi: 10.4049/jimmunol.181.4.2338 http://www.jimmunol.org/content/181/4/2338 Downloaded from References This article cites 68 articles, 29 of which you can access for free at: http://www.jimmunol.org/content/181/4/2338.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 24, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Blimp-1 Attenuates Th1 Differentiation by Repression of ifng, tbx21, and bcl6 Gene Expression Luisa Cimmino,* Gislaine A. Martins,† Jerry Liao,† Erna Magnusdottir,‡ Gabriele Grunig,† Rocio K. Perez,‡ and Kathryn L. Calame1*§ T cell-specific deletion of Blimp-1 causes abnormal T cell homeostasis and function, leading to spontaneous, fatal colitis in mice. Herein we explore the role of Blimp-1 in Th1/Th2 differentiation. Blimp-1 mRNA and protein are more highly expressed in Th2 cells compared with Th1 cells, and Blimp-1 attenuates IFN-␥ production in CD4 cells activated under nonpolarizing conditions. Although Blimp-1-deficient T cells differentiate normally to Th2 cytokines in vitro, Blimp-1 is required in vivo for normal Th2 humoral responses to NP-KLH (4-hydroxy-3-nitrophenylacetyl/keyhole lymphocyte hemocyanin) immunization. Lack of Blimp-1 in CD4 T cells causes increased IFN-␥, T-bet, and Bcl-6 mRNA. By chromatin immunoprecipitation we show that Blimp-1 binds directly to a distal regulatory region in the ifng gene and at multiple sites in tbx21 and bcl6 genes. Our data provide evidence that Downloaded from Blimp-1 functions in Th2 cells to reinforce Th2 differentiation by repressing critical Th1 genes. The Journal of Immunology, 2008, 181: 2338–2347. ifferentiation of the CD4 Th cell lineages is dictated IL-13 genes (7) and can autoactivate its own expression both by the strength of antigenic stimulation, cytokine en- independently and as a result of IL-4-mediated STAT-6 signal- D vironment, and the complement of transcription fac- ing (8). How T-bet and GATA-3 compete to drive Th1 or Th2 http://www.jimmunol.org/ tors activated by these processes. T-bet and GATA-3 transcrip- differentiation has been intensively studied and has laid the tion factors are master regulators of Th1 and Th2 lineage foundation for understanding how other transcription factors differentiation, respectively; Foxp3 is critical for regulatory T influence the way CD4 lineage decisions are made. cell development and function, and, more recently, ROR␥t (ret- The transcriptional repressor B lymphocyte-induced maturation ␥ 2 inoid-related orphan receptor t) has been shown to act as a protein-1 (Blimp-1) has recently been identified as a regulator of master regulator of Th17 development (1–3). Additionally, T cell homeostasis and function (9, 10). Encoded by the prdm1 complicated regulatory pathways and feedback loops cooperate gene, Blimp-1 is well established as a master regulator of plasma with the master regulators to establish and maintain CD4 dif- cell differentiation and maintenance (11, 12). Blimp-1 also plays a ferentiation states. role in multiple developmental checkpoints in nonlymphoid lin- by guest on September 24, 2021 Th polarization into Th1 and Th2 lineages can be divided into eages including germ cell formation during embryogenesis (13– hierarchical steps of initiation, reinforcement, and maintenance 15), myeloid differentiation (16), keratinocyte maturation (17), and (1). Initiation of lineage differentiation begins upon T cell recog- sebocyte differentiation (18). nition of Ag presented by APCs and response to the initial cyto- In the T cell lineage Blimp-1 is strongly induced upon TCR kine environment. Reinforcement of commitment is driven by the activation (10), with IL-2 playing an important role in the induc- up-regulation of cytokine production, positive feedback loops, and tion (19). In two independent studies, T cell-specific deletion of repression of genes necessary for the alternative fate. Maintenance Blimp-1 in mice caused spontaneous colitis (10) and a multiorgan of the differentiated state is conferred by heritable epigenetic inflammatory disease (9). These autoimmune pathologies were at- changes. Transcription factors activated by TCR-signaling such tributed in part to altered homeostasis within the CD4 T cell lin- ␬ as AP-1, NF- B, and NFAT can differentially induce both eage, including hyperproliferation in response to TCR stimulation, ␥ IFN- and IL-4 expression directly or via the induction of T-bet increased IL-2 and IFN-␥ production, and decreased IL-10 pro- and GATA-3, respectively (1, 4). In the case of Th1 differen- duction, possibly contributing to diminished regulatory T cell ␥ tiation, T-bet can be induced both by IFN- or IL-12 through function in vivo (9, 10). the transcription factors STAT-1 and STAT-4, respectively, to Blimp-1 is a transcriptional repressor. Interestingly, most of the ␥ directly reinforce expression of the IFN- gene while simulta- known direct targets of Blimp-1 are also transcription regulators, neously repressing GATA-3 function (2, 5, 6). GATA-3 acti- explaining in part its ability to control extensive developmental vates expression at the Th2 cytokine locus of IL-4, IL-5, and programs (11). In B cells Blimp-1 directly represses myc, spiB, CIITA, id3, and pax5. In the epidermis it represses myc, fos, nfat5, *The Institute of Human Nutrition, †Department of Microbiology, ‡Department of and dusp16 (17). It has also been shown to repress p53 in some Biological Sciences, and §Department of Biochemistry and Molecular Biophysicis, tumor cell lines (20). College of Physicians and Surgeons, Columbia University, New York, NY 10032 Received for publication March 18, 2008. Accepted for publication June 9, 2008. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance 2 Abbreviations used in this paper: Blimp-1, B lymphocyte-induced maturation pro- with 18 U.S.C. Section 1734 solely to indicate this fact. tein-1; Bcl-6, B cell lymphoma-6; ChIP, chromatin immunoprecipitation; CNS, con- 1 Address correspondence and reprint requests to Dr. Kathryn Calame, Department of served noncoding sequence; IP, immunoprecipitation; MFI, mean fluorescence inten- Biochemistry and Molecular Biophysicis, College of Physicians and Surgeons, Co- sity; NP-KLH, 4-hydroxy-3-nitrophenylacetyl/keyhole lymphocyte hemocyanin. lumbia University, 701 168th Street, Hammer Health Science Center 1202, Manhat- tan, NY 10032. E-mail address: [email protected] Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00 www.jimmunol.org The Journal of Immunology 2339 Direct targets for Blimp-1 in T cells have not yet been identified. In vitro CD4 Th cell differentiation However, it is known that B cell lymphoma-6 (Bcl-6) mRNA is For in vitro polarization, naive CD4 T cells were seeded at 1 ϫ 106 cells/ml elevated in Blimp-1-deficient CD4 T cell effectors (10). Mutual in 24-well plates coated with 5 ␮g/ml anti-CD3, 2.5 ␮g/ml anti-CD28 (BD repression by Bcl-6 and Blimp-1 in B cells is important for main- Pharmingen), and 25 U/ml of recombinant human IL-2 in RPMI 1640 with taining mutually exclusive programs of germinal center B cells and the addition of murine IL-12 (10 ng/ml) and anti-IL4 (10 ␮g/ml) or murine ␥ ␮ plasma cells (21). In T cells, Bcl-6 repression is involved in Th1 IL-4 (1000 U/ml) and anti-IFN- (10 g/ml). differentiation by repressing Th2 cytokine expression. It decreases GATA-3 protein levels (22), represses IL-5 transcription (23), and Western blot analysis competes for binding at STAT-6 recognition sequences in IL-4- CD4 T cells were cultured for 2 wk under polarizing conditions de- responsive genes (24, 25). scribed above, lysed in RIPA buffer (50 mM HEPES (pH 7.6), 1 mM EDTA, 0.7% sodium deoxycholate, 1% Nonidet P-40, and 0.5 M The goal of the present study was to learn how Bcl-6 and ␮ LiCl2), and 50 g of protein from the whole-cell extract was separated Blimp-1 interact during Th1/Th2 development and to determine by 8% SDS-PAGE and Western blotted using mouse monoclonal anti- the molecular mechanism(s) by which Blimp-1 alters expres- Blimp-1 (26), anti-GATA-3, and anti-␤-tubulin Abs (Santa Cruz sion of cytokines important for Th1 vs Th2 differentiation and Biotechnology). function. We show that Blimp-1 is most highly expressed in Th2 cells and that mice lacking Blimp-1 in CD4 T cells exhibit Quantitative RT-PCR impaired humoral Th2 responses, establishing a role for Total RNA was isolated according to the manufacturer’s instructions by Blimp-1 in Th2 differentiation. We also show that ifng, tbx21, using TRIzol reagent (Invitrogen) from in vitro-activated CD4 T cells and bcl6 are direct targets of Blimp-1-dependent repression in or sorted CD4 T cell subsets, and reverse transcription was performed Downloaded from CD4 T cells, providing a molecular basis for the idea that using SuperScript III (Invitrogen) following the manufacturer’s instruc- Blimp-1 helps to oppose Th1 differentiation during Th2 lineage tions.
Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis

    Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis

    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
  • 1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia

    1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia

    1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6.
  • The Title of the Dissertation

    The Title of the Dissertation

    UNIVERSITY OF CALIFORNIA SAN DIEGO Novel network-based integrated analyses of multi-omics data reveal new insights into CD8+ T cell differentiation and mouse embryogenesis A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Bioinformatics and Systems Biology by Kai Zhang Committee in charge: Professor Wei Wang, Chair Professor Pavel Arkadjevich Pevzner, Co-Chair Professor Vineet Bafna Professor Cornelis Murre Professor Bing Ren 2018 Copyright Kai Zhang, 2018 All rights reserved. The dissertation of Kai Zhang is approved, and it is accept- able in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California San Diego 2018 iii EPIGRAPH The only true wisdom is in knowing you know nothing. —Socrates iv TABLE OF CONTENTS Signature Page ....................................... iii Epigraph ........................................... iv Table of Contents ...................................... v List of Figures ........................................ viii List of Tables ........................................ ix Acknowledgements ..................................... x Vita ............................................. xi Abstract of the Dissertation ................................. xii Chapter 1 General introduction ............................ 1 1.1 The applications of graph theory in bioinformatics ......... 1 1.2 Leveraging graphs to conduct integrated analyses .......... 4 1.3 References .............................. 6 Chapter 2 Systematic
  • Genetic Variability in the Italian Heavy Draught Horse from Pedigree Data and Genomic Information

    Genetic Variability in the Italian Heavy Draught Horse from Pedigree Data and Genomic Information

    Supplementary material for manuscript: Genetic variability in the Italian Heavy Draught Horse from pedigree data and genomic information. Enrico Mancin†, Michela Ablondi†, Roberto Mantovani*, Giuseppe Pigozzi, Alberto Sabbioni and Cristina Sartori ** Correspondence: [email protected] † These two Authors equally contributed to the work Supplementary Figure S1. Mares and foal of Italian Heavy Draught Horse (IHDH; courtesy of Cinzia Stoppa) Supplementary Figure S2. Number of Equivalent Generations (EqGen; above) and pedigree completeness (PC; below) over years in Italian Heavy Draught Horse population. Supplementary Table S1. Descriptive statistics of homozygosity (observed: Ho_obs; expected: Ho_exp; total: Ho_tot) in 267 genotyped individuals of Italian Heavy Draught Horse based on the number of homozygous genotypes. Parameter Mean SD Min Max Ho_obs 35,630.3 500.7 34,291 38,013 Ho_exp 35,707.8 64.0 35,010 35,740 Ho_tot 50,674.5 93.8 49,638 50,714 1 Definitions of the methods for inbreeding are in the text. Supplementary Figure S3. Values of BIC obtained by analyzing values of K from 1 to 10, corresponding on the same amount of clusters defining the proportion of ancestry in the 267 genotyped individuals. Supplementary Table S2. Estimation of genomic effective population size (Ne) traced back to 18 generations ago (Gen. ago). The linkage disequilibrium estimation, adjusted for sampling bias was also included (LD_r2), as well as the relative standard deviation (SD(LD_r2)). Gen. ago Ne LD_r2 SD(LD_r2) 1 100 0.009 0.014 2 108 0.011 0.018 3 118 0.015 0.024 4 126 0.017 0.028 5 134 0.019 0.031 6 143 0.021 0.034 7 156 0.023 0.038 9 173 0.026 0.041 11 189 0.029 0.046 14 213 0.032 0.052 18 241 0.036 0.058 Supplementary Table S3.
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming

    Supplemental Materials ZNF281 Enhances Cardiac Reprogramming

    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
  • Supplementary Table S5. Differentially Expressed Gene Lists of PD-1High CD39+ CD8 Tils According to 4-1BB Expression Compared to PD-1+ CD39- CD8 Tils

    Supplementary Table S5. Differentially Expressed Gene Lists of PD-1High CD39+ CD8 Tils According to 4-1BB Expression Compared to PD-1+ CD39- CD8 Tils

    BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Supplementary Table S5. Differentially expressed gene lists of PD-1high CD39+ CD8 TILs according to 4-1BB expression compared to PD-1+ CD39- CD8 TILs Up- or down- regulated genes in Up- or down- regulated genes Up- or down- regulated genes only PD-1high CD39+ CD8 TILs only in 4-1BBneg PD-1high CD39+ in 4-1BBpos PD-1high CD39+ CD8 compared to PD-1+ CD39- CD8 CD8 TILs compared to PD-1+ TILs compared to PD-1+ CD39- TILs CD39- CD8 TILs CD8 TILs IL7R KLRG1 TNFSF4 ENTPD1 DHRS3 LEF1 ITGA5 MKI67 PZP KLF3 RYR2 SIK1B ANK3 LYST PPP1R3B ETV1 ADAM28 H2AC13 CCR7 GFOD1 RASGRP2 ITGAX MAST4 RAD51AP1 MYO1E CLCF1 NEBL S1PR5 VCL MPP7 MS4A6A PHLDB1 GFPT2 TNF RPL3 SPRY4 VCAM1 B4GALT5 TIPARP TNS3 PDCD1 POLQ AKAP5 IL6ST LY9 PLXND1 PLEKHA1 NEU1 DGKH SPRY2 PLEKHG3 IKZF4 MTX3 PARK7 ATP8B4 SYT11 PTGER4 SORL1 RAB11FIP5 BRCA1 MAP4K3 NCR1 CCR4 S1PR1 PDE8A IFIT2 EPHA4 ARHGEF12 PAICS PELI2 LAT2 GPRASP1 TTN RPLP0 IL4I1 AUTS2 RPS3 CDCA3 NHS LONRF2 CDC42EP3 SLCO3A1 RRM2 ADAMTSL4 INPP5F ARHGAP31 ESCO2 ADRB2 CSF1 WDHD1 GOLIM4 CDK5RAP1 CD69 GLUL HJURP SHC4 GNLY TTC9 HELLS DPP4 IL23A PITPNC1 TOX ARHGEF9 EXO1 SLC4A4 CKAP4 CARMIL3 NHSL2 DZIP3 GINS1 FUT8 UBASH3B CDCA5 PDE7B SOGA1 CDC45 NR3C2 TRIB1 KIF14 TRAF5 LIMS1 PPP1R2C TNFRSF9 KLRC2 POLA1 CD80 ATP10D CDCA8 SETD7 IER2 PATL2 CCDC141 CD84 HSPA6 CYB561 MPHOSPH9 CLSPN KLRC1 PTMS SCML4 ZBTB10 CCL3 CA5B PIP5K1B WNT9A CCNH GEM IL18RAP GGH SARDH B3GNT7 C13orf46 SBF2 IKZF3 ZMAT1 TCF7 NECTIN1 H3C7 FOS PAG1 HECA SLC4A10 SLC35G2 PER1 P2RY1 NFKBIA WDR76 PLAUR KDM1A H1-5 TSHZ2 FAM102B HMMR GPR132 CCRL2 PARP8 A2M ST8SIA1 NUF2 IL5RA RBPMS UBE2T USP53 EEF1A1 PLAC8 LGR6 TMEM123 NEK2 SNAP47 PTGIS SH2B3 P2RY8 S100PBP PLEKHA7 CLNK CRIM1 MGAT5 YBX3 TP53INP1 DTL CFH FEZ1 MYB FRMD4B TSPAN5 STIL ITGA2 GOLGA6L10 MYBL2 AHI1 CAND2 GZMB RBPJ PELI1 HSPA1B KCNK5 GOLGA6L9 TICRR TPRG1 UBE2C AURKA Leem G, et al.
  • Genetic Variation of TBX21 Gene Increases Risk of Asthma and Its Severity in Indian Children

    Genetic Variation of TBX21 Gene Increases Risk of Asthma and Its Severity in Indian Children

    Journal of Human Genetics (2014) 59, 437–443 & 2014 The Japan Society of Human Genetics All rights reserved 1434-5161/14 www.nature.com/jhg ORIGINAL ARTICLE Genetic variation of TBX21 gene increases risk of asthma and its severity in Indian children Neeraj Sharma1, Indu Jaiswal2,5, Raju K Mandal3,5, Shubha R Phadke4 and Shally Awasthi1 T-box transcription factor protein (TBX21) is encoded by the TBX21 gene in human. It is crucial for naive T lymphocyte development, interferon-c production, airway hyperresponsiveness and regulation of corticosteroid response in asthmatics. Polymorphisms rs4794067 and rs16947078 of TBX21 were found to be associated with acetylsalicylic acid-induced and allergic asthma, respectively. We examined whether sequence variants of TBX21 gene are associated with asthma and its severity in Indian population. In a hospital-based case–control study, 240 asthmatic children and 240 healthy controls were investigated for the association of TBX21 rs4794067 (C4T) and rs16947078 (G4A) polymorphisms with asthma and its severity using PCR-restriction fragment length polymorphism method. Heterozygous (CT) (odds ratio (OR) ¼ 2.33; P ¼ 0.001) and variant (TT) (OR ¼ 6.25; P ¼ 0.001) genotypes of rs4794067 were demonstrated significant risk of asthma. However, in asthma severity variant (TT) genotype revealed significant increase risk (intermittent: OR ¼ 5.9, P ¼ 0.001; mild: OR ¼ 8.0, P ¼ 0.001; moderate: OR ¼ 3.2, P ¼ 0.041; and severe: OR ¼ 43.6, P ¼ 0.001) in all subgroups. Furthermore, haplotypes TG (OR ¼ 2.83; P ¼ 0.001) and TA (OR ¼ 2.54; P ¼ 0.001) of TBX21 were associated with an increased risk of asthma.
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K

    Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K

    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
  • UNIVERSITY of CALIFORNIA, SAN DIEGO Towards an Understanding of Inflammation in Macrophages a Dissertation Submitted in Partial

    UNIVERSITY of CALIFORNIA, SAN DIEGO Towards an Understanding of Inflammation in Macrophages a Dissertation Submitted in Partial

    UNIVERSITY OF CALIFORNIA, SAN DIEGO Towards an Understanding of Inflammation in Macrophages A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biomedical Sciences by Dawn Xiaobin Zhang Committee in charge: Professor Christopher L. Glass, Chair Professor Jack Bui Professor Ronald M. Evans Professor Richard L. Gallo Professor Joseph L. Witztum 2014 Copyright Dawn Xiaobin Zhang, 2014 All rights reserved. This Dissertation of Dawn Xiaobin Zhang is approved, and it is acceptable in quality and form for publication on microfilm and electronically: Chair University of California, San Diego 2014 iii DEDICATION To my family and the love of my life, Matthew. iv EPIGRAPH How often have I said to you that when you have eliminated the impossible, whatever remains, however improbable, must be the truth? -Sherlock Holmes, From The Sign of the Four, Sir Arthur Conan Doyle v TABLE OF CONTENTS Signature Page ……………………………………………………………….. iii Dedication ……………………………………………………….…………….. iv Epigraph ……………………………………………………………………….. v Table of Contents ………………………………………………………….….. vi List of Figures ………………………………………………………….………. viii List of Tables ………………………………………………………….…….…. x Acknowledgements …………………………………….…………………..…. xi Vita …………………………………….……………………………………..…. xiii Abstract of the Dissertation ………………………………..…………………. xv Chapter I: Introduction: Towards an Understanding of Cell-Specific Function of Signal-Dependent Transcription Factors ……....…....…... 1 A. Abstract ……....…....………………………………...…………….. 2 B. Introduction
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
  • Enhances Th1 Immunity in Male Mice Activity Selectively Α Activated Receptor − Antagonizing Peroxisome Proliferator

    Enhances Th1 Immunity in Male Mice Activity Selectively Α Activated Receptor − Antagonizing Peroxisome Proliferator

    The Journal of Immunology Antagonizing Peroxisome Proliferator–Activated Receptor a Activity Selectively Enhances Th1 Immunity in Male Mice Monan Angela Zhang,* Jeeyoon Jennifer Ahn,* Fei Linda Zhao,* Thirumahal Selvanantham,* Thierry Mallevaey,* Nick Stock,† Lucia Correa,† Ryan Clark,† David Spaner,*,‡,x and Shannon E. Dunn*,{,‖ Females exhibit more robust Th1 responses than males. Our previous work suggested that this sex disparity is a consequence of higher activity of the androgen-induced gene peroxisome proliferator–activated receptor a (PPARa) in male CD4+ T cells. The objective of this study was to elucidate the cellular and molecular mechanism of how PPARa inhibits Th1 responses in male mice. In this study, we found that PPARa functions within CD4+ and CD8+ T lymphocytes and NKT cells to negatively regulate IFN-g responses in male mice and identified Ifng as the gene target of PPARa repression. Treatment of male CD4+ T cells with the PPARa agonist fenofibrate induced the recruitment of PPARa and the nuclear receptor-interacting protein, nuclear receptor corepressor 1, to specific cis-regulatory elements in the Ifng locus. This recruitment associated with reduced histone acetylation at these sites. Knockdown of nuclear receptor corepressor 1 in primary male T cells abolished the effect of fenofibrate in reducing IFN-g production. In contrast, treatment of male T cells with IS001, a novel antagonist of PPARa, increased Ifng gene expression and histone acetylation across the Ifng locus. Finally, we investigated the effects of IS001 on IFN-g responses in mice during infection with the Th1-associated pathogen Listeria monocytogenes and observed that IS001 enhanced IFN-g production by NKT, CD4+, and CD8+ T cells and improved the survival of male, but not female, mice.
  • Liver X-Receptors Alpha, Beta (Lxrs Α , Β) Level in Psoriasis

    Liver X-Receptors Alpha, Beta (Lxrs Α , Β) Level in Psoriasis

    Liver X-receptors alpha, beta (LXRs α , β) level in psoriasis Thesis Submitted for the fulfillment of Master Degree in Dermatology and Venereology BY Mohammad AbdAllah Ibrahim Awad (M.B., B.Ch., Faculty of Medicine, Cairo University) Supervisors Prof. Randa Mohammad Ahmad Youssef Professor of Dermatology, Faculty of Medicine Cairo University Prof. Laila Ahmed Rashed Professor of Biochemistry, Faculty of Medicine Cairo University Dr. Ghada Mohamed EL-hanafi Lecturer of Dermatology, Faculty of Medicine Cairo University Faculty of Medicine Cairo University 2011 ﺑﺴﻢ اﷲ اﻟﺮﺣﻤﻦ اﻟﺮﺣﻴﻢ "وﻣﺎ ﺗﻮﻓﻴﻘﻲ إﻻ ﺑﺎﷲ ﻋﻠﻴﻪ ﺗﻮآﻠﺖ وإﻟﻴﻪ أﻧﻴﺐ" (هﻮد، ٨٨) Acknowledgement Acknowledgement First and foremost, I am thankful to God, for without his grace, this work would never have been accomplished. I am honored to have Prof.Dr. Randa Mohammad Ahmad Youssef, Professor of Dermatology, Faculty of Medicine, Cairo University, as a supervisor of this work. I am so grateful and most appreciative to her efforts. No words can express what I owe her for hers endless patience and continuous advice and support. My sincere appreciation goes to Dr. Ghada Mohamed EL-hanafi, Lecturer of Dermatology, Faculty of Medicine, Cairo University, for her advice, support and supervision during the course of this study. I am deeply thankful to Dr. Laila Ahmed Rashed, Assistant professor of biochemistry, Faculty of Medicine, Cairo University, for her immense help, continuous support and encouragement. Furthermore, I wish to express my thanks to all my professors, my senior staff members, my wonderful friends and colleagues for their guidance and cooperation throughout the conduction of this work. Finally, I would like to thank my father who was very supportive and encouraging.