Enhances Th1 Immunity in Male Mice Activity Selectively Α Activated Receptor − Antagonizing Peroxisome Proliferator

The Journal of Immunology

Antagonizing Peroxisome Proliferator–Activated Receptor a Activity Selectively Enhances Th1 Immunity in Male Mice

Monan Angela Zhang,* Jeeyoon Jennifer Ahn,* Fei Linda Zhao,* Thirumahal Selvanantham,* Thierry Mallevaey,* Nick Stock,† Lucia Correa,† Ryan Clark,† David Spaner,*,‡,x and Shannon E. Dunn*,{,‖

Females exhibit more robust Th1 responses than males. Our previous work suggested that this sex disparity is a consequence of higher activity of the androgen-induced gene peroxisome proliferator–activated receptor a (PPARa) in male CD4+ T cells. The objective of this study was to elucidate the cellular and molecular mechanism of how PPARa inhibits Th1 responses in male mice. In this study, we found that PPARa functions within CD4+ and CD8+ T lymphocytes and NKT cells to negatively regulate IFN-g responses in male mice and identified Ifng as the gene target of PPARa repression. Treatment of male CD4+ T cells with the PPARa agonist fenofibrate induced the recruitment of PPARa and the nuclear receptor-interacting protein, nuclear receptor corepressor 1, to specific cis-regulatory elements in the Ifng locus. This recruitment associated with reduced histone acetylation at these sites. Knockdown of nuclear receptor corepressor 1 in primary male T cells abolished the effect of fenofibrate in reducing IFN-g production. In contrast, treatment of male T cells with IS001, a novel antagonist of PPARa, increased Ifng gene expression and histone acetylation across the Ifng locus. Finally, we investigated the effects of IS001 on IFN-g responses in mice during infection with the Th1-associated pathogen Listeria monocytogenes and observed that IS001 enhanced IFN-g production by NKT, CD4+, and CD8+ T cells and improved the survival of male, but not female, mice. Our findings provide a novel mechanism of why IFN-g responses are more robust in females and introduce a small-molecule IS001 that can be used to enhance Th1 immunity in males. The Journal of Immunology, 2015, 195: 5189–5202.

helper cells are classified into distinct subsets based on the 1) directly transactivating Ifng; 2) mediating epigenetic changes expression of effector cytokines: IFN-g for Th1, IL-4 for that make chromatin more accessible at the Ifng locus; and 3) T Th2, and IL-17A for Th17 cells (1). Naive CD4+ T cells increasing CD4+ T cell responsiveness to IL-12 (1–3). In addition acquire these distinct Th cell fates to orchestrate the appropriate to being the major Th1 effector cytokine, IFN-g serves as an immune response against invading pathogens (1). Th1 cells are amplification signal in the Th1 pathway to further enhance T-bet specialized for the generation of cellular immunity against intra- expression (4). by guest on October 1, 2021. Copyright 2015 Pageant Media Ltd. cellular pathogens and are generated upon Ag receptor engage- One intriguing feature of Th1 immune responses is that they are ment in the presence of IL-12 (1). During Th1 differentiation, the more robust in females than in males (5–8). This sex difference is IFN-g receptor–STAT1 signaling pathway converges with the thought to underlie why women generate enhanced antiviral (9) TCR signaling pathway to induce expression of T-bet, the master and antitumor (10) immune responses, but also have a higher regulator of Th1 programming. T-bet promotes Th1 immunity by: propensity to develop certain autoimmune diseases (8). Past studies have suggested that sex differences in Th1 responses arise *Department of Immunology, University of Toronto, Toronto, Ontario M5S 1A8, because of suppressive effects of androgens at key nodes in the Canada; †Inception Sciences, San Diego, CA 92121; ‡Sunnybrook Health Sciences Th1 differentiation pathway including IL-12 production (11) and Centre, Toronto, Ontario M4N 3M5, Canada; xDepartment of Medical Biophysics, http://classic.jimmunol.org University of Toronto, Toronto, Ontario M5G 1L7, Canada; {Toronto General Re- signaling (12, 13) and IFN-g production downstream of Ag search Institute, University Health Network, Toronto, Ontario M5G 2M1, Canada; stimulation (6, 7). Until recently, the molecular players involved in ‖ and Women’s College Research Institute, Toronto, Ontario M5G 2M1, Canada this androgen-dependent regulation were not known. Received for publication February 23, 2015. Accepted for publication September 22, We previously identified that the nuclear receptor peroxisome 2015. proliferator–activated receptor a (PPARa) is expressed at higher This work was supported by a Canadian Institutes for Health Research grant (MOP- levels by male compared with female T cells both in humans and 97807) and the Arthritis Research Foundation through a generous donation from

Downloaded from Janice Wright (both to S.E.D.). M.A.Z., J.J.A., and F.L.Z. were supported by stu- in mice and acts to limit Th1 cytokine production exclusively in dentships and S.E.D. by a Don Paty award from the Multiple Sclerosis Society of the male sex (6, 7). We further showed that expression of PPARa Canada. M.A.Z. was also supported by an Ontario Health Scholar Award. is sensitive to androgen levels (6, 7) and that deﬁciency of this Address correspondence and reprint requests to Dr. Shannon E. Dunn, Toronto Gen- eral Research Institute, 67 College Street, Room 4-421, Toronto, ON M5G 2M1, gene leads to heightened Th1 responses and more severe acute Canada. E-mail address: [email protected] experimental autoimmune encephalomyelitis in male, but not fe- The online version of this article contains supplemental material. male mice (6). Despite these advances, the precise mechanism of Abbreviations used in this article: ChIP, chromatin immunoprecipitation; CNS, con- how PPARa limits Th1 immune responses is unknown. served noncoding sequence; Eomes, eomesdermin; H4-Ac, acetylated histone 4; Past studies have shown that PPAR family members (PPARa, HDAC, histone deacetylase; H3K27-Me, trimethylated histone 3 lysine 27; Inos, inducible NO synthase; MOG, myelin oligodendrocyte glycoprotein; NCOR, nuclear PPARd, and PPARg) function to activate or repress target genes receptor corepressor 1; PPARa, peroxisome proliferator–activated receptor a; ROR, by regulating gene transcription (14). Positive regulation of target retinoic acid receptor–related orphan receptor; RXR, retinoid X receptor; siRNA, genes occurs through the binding of PPARs and retinoid X re- small interfering RNA; Teff, effector T; Treg, regulatory T; WT, wild-type. ceptor (RXR) heterodimers to PPAR responsive elements in gene Copyright Ó 2015 by The American Association of Immunologists, Inc. 0022-1767/15/$25.00 promoter regions (14). The binding of lipid ligands activates

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1500449 5190 PPARa REGULATES SEX DIFFERENCES IN IFN-g PRODUCTION

PPARs by promoting an allosteric change in the ligand-binding In vitro T cell stimulations, cytokine measurements, and flow domain of the receptor that supports an increased association with cytometry coactivator proteins and a decreased association with corepressor CD4+ and CD8+ T cells were isolated from spleens and lymph nodes of proteins such as nuclear receptor corepressor 1 (NCOR) (14). In mice using magnetic beads (Miltenyi Biotec or Stemcell Technologies). contrast, the repressive activities of PPARs feature more in in- The purity of isolated cells was routinely monitored and ranged between flammation control and instead occur through the indirect 94 and 98%. Purified cells were resuspended in complete RPMI 1640 binding of PPARs to gene regulatory regions: a mechanism media or X-VIVO-20 media (Lonza) supplemented with 2 mmol/l L-glutamine and were cultured in 96-well flat-bottom plates (2 3 105/well) that that has been termed “transrepression” (14). The molecular de- were precoated with anti-CD3 (clone 145-2C11) and anti-CD28 (clone tails of this transrepression mechanism are less understood, but 37.51) (each at 0.5 mg/ml). Th polarizations were conducted as described have been resolved for certain gene targets of PPARg including previously (7) using the following cytokines and Abs from eBioscience: inducible NO synthase (Inos) and retinoic acid–related orphan 10 ng/ml IL-12 + 10 mg/ml anti–IL-4 (clone 11B11) for Th1-, 10 ng/ml IL-4 + 10 mg/ml anti–IFN-g (clone XMG1.2) for Th2-, or 3 ng/ml TGF-b + receptor (ROR) gt(Rorc) (15, 16). For example, it has been shown 30 ng/ml IL-6 + 10 mg/ml anti–IFN-g +10mg/ml anti–IL-4 (clone 11B11) that treatment of macrophages with the ligand rosiglitazone in- for Th17-polarizing conditions. Cytokine levels in culture supernatants duces the sumoylation and recruitment of PPARg to the Inos were measured using Ready-SET-Go! ELISA kits (eBioscience). PMA/ promoter, where it stabilizes the presence of the histone deacet- ionomycin stimulations and cell surface and intracellular cytokine stain- ings were performed as described previously (19, 20). Intranuclear staining ylase (HDAC) 3/NCOR-containing corepressor complex, thereby for transcription factors was performed using the Foxp3 Transcription inhibiting gene transcription (15). Whether PPARa works via a Factor Staining Buffer Set (eBioscience). The following Abs and tetramers similar mechanism to repress Th1 responses in males is not were used in this study and were purchased from eBioscience unless known. otherwise noted: CD4-PE–Cy5 (GK1.5), CD8-FITC (53-6.7), TCRb-PE– The aim of this study was to dissect the cellular and molecular Cy7 (H56-597), IFN-g–PE (XMG1.2), NKp46-allophycocyanin–eFluor780 (29A1.4), NKp46–Alexa Fluor 700 (29A1.4; BD Biosciences), GATA-3–PE mechanism of how PPARa inhibits Th1 immunity in male mice (TWAJ), T-bet–PE-Cy7 (4B10), RORgt-PE (B2D), and unloaded and and to explore the utility of a novel small-molecule antagonist of PBS57-loaded mCD1d tetramer–allophycocyanin (National Institutes of PPARa to enhance Th1 immune responses. Health Tetramer Core Facility). Data were acquired using an LSRII (BD Biosciences) (Sickkids Flow Cytometry facility) and analyzed using FlowJo Materials and Methods software (V9+) (Tree Star). Mice Measurement of mRNA levels SJL/J and C57BL/6J mice and breeder pairs of PPARa+/+ (129S1/SvIM/J) Levels of specific mRNAs were measured using real-time RT-PCR (Roche 2 2 and PPARa / mice (129S4/SVJae-Ppartm1Gonz/J) were from The LightCycler 480; Roche) as described previously (7) using FastStart 2 2 Jackson Laboratory. Breeder pairs of PPARa+/+ (model B6) and PPARa / Universal SYBR Green Master mix (Roche) and specific primer pairs (model ppara) on the B6 background were from Taconic Farms. The latter (Supplemental Table I). The following amplification parameters were used: 2 2 mice were also crossed onto the T-bet / background (The Jackson Lab- 95˚C for 15 min, followed by 50 cycles of 94˚C for 20 s, 55˚C for 30 s, and oratory). Work was conducted using 8–10-wk-old mice in accordance with 72˚C for 30 s. The relative abundance of each PCR product was deter- the guidelines of the Canadian Council on Animal Care under animal use mined using the standard curve method and normalized to b-actin mRNA protocols (AUP 1747 and AUP 3213) approved by the University Health levels. Network.

by guest on October 1, 2021. Copyright 2015 Pageant Media Ltd. Determination of IC50 of IS001 for PPARa and other nuclear Experimental approach for in vitro studies hormone receptors For the majority of our in vitro studies (unless otherwise indicated), two or The IC50 values of IS001 for PPARa and other nuclear hormone receptors three independent experiments were conducted that each used immune cells were determined using the following commercial reporter assay kits from that were pooled from mice of one cage per genotype. This was done to Indigo Biosciences: human PPARa (catalog number IB00111), murine ensure that the dominant, high-testosterone males were included in our PPARa (catalog number M00111), human PPARd (catalog number assays. Cage-housed males develop social hierarchies such that one or two IB00121), human PPARg (catalog number IB00101), human estrogen re- males within a cage emerge to have high testosterone levels (17). We ceptor b (catalog number IB00411), human glucocorticoid receptor (cat- showed in our previous studies that the male mice with the highest tes- alog number IB00201), human thyroid hormone receptor b (catalog tosterone levels also exhibit the highest levels of PPARa mRNAs in number IB01101), and human RXRa (catalog number IB00801). In brief, T cells (6). http://classic.jimmunol.org reporter cells provided with the kit were resuspended in the provided Regulatory T cell suppression assay media and dispensed into 96-well assay plates with a positive control agonist (i.e., 20 nmol/l GW7647 for PPARa assays) and different quan- CD4+ T cells were enriched from spleens of mice using the mouse CD4+ tities of IS001. Following an overnight incubation, media was discarded isolation kit II (Miltenyi Biotec). Cells were stained with the follow- from wells and replaced with luciferase detection reagent provided with ing Abs: CD4-FITC (clone RM4-5), CD44-PE (clone 1M7), and CD25- the kit. Luminescence was measured using a Molecular Devices Flex- allophycocyanin (clone PC61.5). CD4+CD25high regulatory T (Treg) cell and Station (Molecular Devices). The luminescence intensity of light emission CD4+CD44lowCD252 effector T (Teff) cell populations were sorted using from the luciferase reaction was directly proportional to the relative level Downloaded from the FACSAria II FACS sorter (BD Biosciences, Sickkids Flow Cytometry of nuclear receptor activation in the reporter cells. Facility). CD4+CD44lowCD252 responding T cells (2.5 3 104/well) were cocultured together at the indicated ratio with CD4+CD25high Treg cells in Small interfering RNA knockdown of gene expression 96-well U-bottom plates with irradiated splenocytes (5 3 104/well) and Transfection of mouse CD4+ T cells was performed using the Mouse T Cell anti-CD3 as described previously (18). The proliferation of responding Nucleofector Kit and the Nucleofector device (X-001 program) accord- T cells was measured between 72 and 90 h of culture using a [3H]thymidine ing to kit directions (Amaxa). Cells were transfected with 2 mgON- incorporation assay. TARGETplus SMART pool small interfering RNAs (siRNAs; Thermo In vitro assay of APC function Scientific) designed against mouse PPARa (L-040740-01), mouse NCOR (L-058556-00-0005), or nontargeting siRNAs (ON-TARGETplus control 2D2 TCR-transgenic CD4+CD62L+ T cells that were isolated by magnetic pool D-001810-10-05; Thermo Scientific). A pmaxGFP expression vector bead selection (Miltenyi Biotec) were cocultured in 96-well U-bottom provided with the kit was also transfected at the same time as the siRNAs. plates (5 3 104/well) at a 1:2 ratio with irradiated splenocytes in com- After electroporation, mouse CD4+ T cells were recovered from the plete RPMI 1640 (RPMI 1640 supplemented with 2 mmol/l L-glutamine, electroporation cuvette and then were allowed to rest overnight in sup- 1 mmol/l sodium pyruvate, 0.1 mmol/l nonessential amino acids, 100 U/ml plemented Mouse T Cell Nucleofector Medium (Amaxa). The following penicillin, 0.1 mg/ml streptomycin, 50 mmol/l 2-ME, and 10% FCS) in the day, a portion of cells was used for flow cytometric analysis of GFP ex- presence of 5–20 mg/ml of myelin oligodendrocyte glycoprotein (MOG) pression and real-time RT-PCR measurement of PPARa mRNA or NCOR p35–55 (Stanford Pan facility, Stanford, CA). mRNAs, whereas remaining cells were stimulated with anti-CD3 and The Journal of Immunology 5191

anti-CD28 for measurement of cytokine levels in culture supernatants or methylcellulose in PBS) or vehicle by gavage, twice daily (9 to 10 h apart), acetylated histone 4 (H4-Ac) by chromatin immunoprecipitation (ChIP) starting 1 d prior to infection. (see details below). Serum was also collected from mice at 2 d postinfection with 100,000 CFU pathogen by cardiac puncture. Bacterial load was determined in the Phosphosignaling analysis spleen at 48 h postinfection. For this, spleens were weighed and dissociated through a 70-micron nylon cell strainer into a petri dish that contained 13 T cells were washed with ice-cold serum-free X-VIVO 20 (Lonza) and 6 PBS. A 10 fold-dilution series of homogenates was prepared and streaked resuspended at a concentration of 140 3 10 cells/ml. Cells were stimu- onto plates containing the brain–heart infusion agar. After 48 h, CFUs were lated with anti-CD3 and anti-CD28, and cell lysates were prepared as counted, and the CFU/mg was calculated as the CFU on the plate/dilution described previously (21). Protein concentrations were determined using factor/0.1 ml plated/mg tissue. the Quantit Kit (Molecular Probes), and proteins were separate by SDS- PAGE using NuPAGE 4–12% Bis-Tris Gel (Life Technologies) and Statistical approach NuPAGE MOPS 2D2 running buffer (Life Technologies). Proteins were transferred to polyvinylidene difluoride membranes overnight at 4˚C using Data are presented as means + SEM. When data were parametric (kurtosis the Mini Trans-Blot Cell (Bio-Rad). Western blotting was conducted as and skewness ,2) and group variances were homogenous (Bartlett ho- described previously (22) by first probing blots overnight at 4˚C using mogeneity test), a two-tailed t test (n = 2 groups) or a one-way ANOVA primary Abs (diluted 1:500) from Cell Signaling Technology: p-ZAP70 (n . 2 groups) was used to detect differences among groups. When data (2701), ZAP70 (3165), p-JNK (9251), JNK (9252), IkBa (9242), p-p38 were nonparametric, ranks were compared among groups using a Mann– (9215), p38 (9212), p-Erk1/2 (9101), and Erk1/2 (9102). Blots were then Whitney U test (n = 2 groups) or Kruskal-Wallis test (n . 2 groups). A probed with HRP-conjugated donkey anti-rabbit secondary Ab (1:5,000– difference in mouse survival between groups was determined using a log- 1:10,000 #NA934V (GE Healthcare Life Sciences) at room temperature rank test. A p value # 0.05 was considered significant. for 1 h and developed on Hyperfilm using the ECL Plus Western blotting detection reagent (GE Healthcare). Results + ChIP PPARa acts within effector CD4 T cells to limit Th1 cytokine production CD4+ and CD8+ T cells were stimulated with plate-bound anti-CD3 and anti-CD28 (5 mg/ml each) for 2 and 4 h, respectively, and ChIP was Previously, we reported that T cells from male, but not female, performed as previously described (7) using the SimpleChIP Enzymatic PPARa2/2 mice proliferate more robustly and produce higher Chromatin IP kit (Cell Signaling Technology). DNA was immunoprecip- levels of Th1 cytokines than PPARa+/+ (wild-type [WT]) counter- itated using specific Abs (acetyl-histone H4K8, 2594S, 1:50 [Cell Sig- naling]; di/trimethylated histone 3 lysine 27 [H3K27-Me], 9733S, 1:50 parts both in vivo during experimental autoimmune encephalo- [Cell Signaling]; PPARa, 101710, 1:50 [Cayman Chemical]; NCOR1, myelitis and in vitro after activation with anti-CD3 and anti-CD28 PAI-844A, 1:50 [Thermo Scientific]; and isotype control IgG from native (6). This hyper-Th1 response occurred exclusively in males, rabbit sera, 2729P, 1:500 [Cell Signaling]) and amplified using real-time suggesting a role for this nuclear receptor in the sex-dependent PCR. Primer sequences are listed in Supplemental Table I. regulation of Th1 immunity (6). To further explore the cellular 2 2 Pharmacokinetic studies for IS001 basis of the enhanced Th1 responses in PPARa / males, we first conducted conventional in vitro Treg suppression assays. Con- Two CD-1 mice were gavaged orally with IS001 (30 mg/kg) in 0.5% sistent with our previous observations, CD4+CD252CD44low Teff methylcellulose in PBS. Blood samples were taken from mice at various 2 2 time points, and plasma samples were prepared and frozen at 280˚C prior to cells isolated from spleens of PPARa / males proliferated more analysis. Standards were prepared by adding known amounts of IS001 to robustly than WT counterparts (two-tailed t test, p = 0.022) and

by guest on October 1, 2021. Copyright 2015 Pageant Media Ltd. thawed mouse plasma to yield a concentration range from 0.8 to 4000 ng/ml. produced higher levels of IFN-g (two-tailed t test, p = 0.042) (Teff Plasma samples were precipitated using acetonitrile (1:4, v:v) containing the only, open circles, left versus right panels, Fig. 1A). In contrast, internal standard buspirone and 1.5% acetic acid. The levels of IS001 and 2/2 + + buspirone were analyzed using a quadrupole mass spectrometer system WT and PPARa CD4 CD25 Treg cells did not exhibit any that consisted of the mass spectrometer (Sciex API-3200; Sciex) that was differences in their capacity to suppress the expansion or IFN-g interfaced to an HPLC system containing two LC10Avp pumps, a static- production by either WT (Fig. 1A, left panel)orPPARa2/2 bed mixer (Shimadzu), and a LEAP PAL autoinjector (Leap Technologies, (Fig. 1A, right panel) Teff cells. Further supporting a role for Carrboro, NC). The analyte mixture (10 ml) was then injected on the + column, and the samples were analyzed in positive ion mode by multiple- PPARa in male CD4 Teff cells, PPARa mRNAs were also more reaction monitoring. The liquid chromatography-tandem mass spectrom- highly expressed in male versus female T cells, particularly within etry mobile phase contained 10 mmol/l ammonium acetate in water with the Teff cell compartment (Fig. 1B). http://classic.jimmunol.org 0.05% formic acid (solvent A) and 10 mmol/l ammonium acetate in 50% We also explored a role for PPARa in the APC compartment by acetonitrile/50% methanol with 0.05% formic acid (solvent B). The flow 2 2 culturing irradiated PPARa / and WT splenocytes (as a source rate was maintained at 1 ml/min, and the total run time was 2.5 min. + Analytes were separated using a linear gradient as follows: 1) the mobile of APC) with purified naive MOG p35–55 TCR-transgenic CD4 phase was held for 30 s at 5% solvent; 2) solvent B was increased from 5 to T cells and peptide Ag. However, varying the genotype of APC in 95% over the next 0.2 min; 3) solvent B was then held constant for 1.3 min these assays did not influence the proliferation or IFN-g produc- at 95%; and 4) solvent B was then returned to the initial gradient condition by responding CD4+ T cells (Fig. 1C). These results confirm tions. The pharmacokinetic test parameters of the compound were calcu- + Downloaded from lated by a noncompartmental analysis using WinNonlin (Pharsight). that PPARa functions within effector CD4 T cells to negatively Maximal plasma concentrations and their time of occurrence were both regulate Th1 responses in male mice. obtained directly from the measured data. The calibration curves were constructed by plotting the peak-area ratio of the analyzed peaks against PPARa represses Th1 responses the corresponding nominal concentrations of test compound in the plasma We observed that PPARa deficiency was associated with enhanced samples. Th1 cytokine production by male T cells; however, it has also Experimental infection with L. monocytogenes been reported that certain ligand activators of PPARa enhance IL- 4 production (24). To distinguish which Th pathway is the target L. monocytogenes (EGD strain) were grown in brain–heart infusion media as previously described (23). For survival studies, C57BL6/J mice were of PPARa-dependent regulation, we compared cytokine produc- 2/2 + infected i.p. with the LD50 dose of the pathogen. For immune studies, a tion by male PPARa and WT CD4 T cells that were stimu- dose of 100,000 CFU was used to elicit optimal NK and NKT IFN-g related under Th0-, Th1-, Th17-, or Th2-polarizing conditions. sponses (19), whereas a sublethal dose of 20,000 CFU was used for ex- Regardless of the type of skewing condition, male PPARa2/2 CD4+ periments that assessed CD4+ and CD8+ T lymphocyte responses to avoid T cells produced IFN-g at higher levels than WT counterparts mouse lethality prior to the time of the peak T cell response. Endpoints for 2/2 survival studies consisted of a 20% loss in body weight. For IS001 treat- (Fig. 2A). This increased IFN-g production by male PPARa ment studies, mice were administered the drug (30 mg/kg in 150 ml 0.5% CD4+ T cells was accompanied by decreases in the production of 5192 PPARa REGULATES SEX DIFFERENCES IN IFN-g PRODUCTION

FIGURE 1. PPARa functions within effector CD4+ T cells to negatively regulate Th1 responses. (A) Spleens were isolated from WT and PPARa2/2 male mice (n = 5 mice/group) on the SV.129 background, pooled within groups, and then dissociated into single-cell suspensions. CD4+CD252CD44low naive Teff cells and CD4+ CD25+ Treg cells were then FACS sorted from these splenocyte preparations. (A) shows the proliferation of (sampled between 72 and 90 h, top panels) and IFN-g production by (sampled at 96 h, bottom panels)PPARa+/+ (left panel)orPPARa2/2 (right panel) Teff cells after coculture with PPARa+/+ (open circles) or PPARa2/2 (closed circles) CD4+CD25+ Treg cells in the presence of irradiated splenocytes and 5 mg/ml anti-CD3. (B) shows the PPARa mRNA expression levels (relative to b-actin mRNAs) in CD4+CD252 (Teff) and CD4+CD25+ (Treg) cells in male and female mice as measured using real-time RT-PCR. *p , 0.05, difference from the male Teff group as determined using a one-way ANOVA and Tukey post hoc test. No other comparisons were signiﬁcant. (C) Splenic mononuclear cells isolated from WT or PPARa2/2 mice (n = 5/group) were pooled together, irradiated, and then cocultured at a 2:1 ratio with naive MOG p35–55 TCR-transgenic (2D2) CD4+ T cells in the presence of MOG p35–55. At 48 h, cultures were pulsed with [3H]thymidine, and cells were harvested 18 h later for measurement of incorporated radioactivity in CPM. IFN-g was measured in culture supernatants after 72 h of culture by ELISA assay. In (A)–(C), values are means 6 SEM of values obtained in triplicate cultures (A and C) or triplicate PCR reactions (B)

IL-4 under Th17-skewing conditions and decreases in the produc- address the involvement of PPARa in the regulation of the Th fate, tion of IL-17 under most conditions examined (Fig. 2A). These we investigated the effects of the well-known PPARa agonist changes in Th cytokine production were accompanied by increases fenoﬁbrate and a novel antagonist of PPARa IS001 on Th cyto- in the intranuclear staining of T-bet and decreases in the intra- kine production by WT CD4+ T cells. IS001 was designed to be a nuclear staining of GATA-3 and RORgt (Fig. 2B). competitive antagonist of PPARa and would act to displace en- We also stimulated naive WT and PPARa2/2 CD4+ T cells with dogenous fatty acid ligands (i.e., unsaturated fatty acids such as http://classic.jimmunol.org anti-CD3 and anti-CD28 under Th0 conditions and examined the linoleic acid) that are constitutively bound to PPARa in vivo or time course of expression of various Th-associated genes. We in vitro when cells are cultured in media that contains serum or observed that PPARa2/2 CD4+ T cells displayed a striking en- fatty acid-bound albumin. Preliminary experiments using nuclear + hancement in Ifng gene expression relative to WT CD4 T cells at hormone reporter assays determined that the IC50 of IS001 for all time points examined (Fig. 2C). In addition, Il4 gene expres- mouse and human PPARa is in the nanomolar range and further sion was lowered in PPARa2/2 CD4+ T cells at 4 and 16 h showed that this drug exhibits a 50–200-fold selectivity for mouse

Downloaded from poststimulation (Fig. 2C). This Th1 skewing in the cytokine gene and human PPARa compared with other nuclear receptors signature in PPARa2/2 CD4+ T cells was evident at the earliest (Fig. 3A). time point examined (4 h) and was accompanied by increases in Upon treatment of CD4+ T cells with IS001, we observed that the expressions of a number of Th1-associated genes including the drug had the effect of enhancing IFN-g production by acti- Stat1 (at 4 h), Tbx21 (at 16 h), and eomesdermin (Eomes) (at 16 h) vated CD4+ T cells relative to vehicle control treatment (Fig. 3B), and decreases in the peak expressions of Gata3 (at 4 h) and Rorc but did not decrease IL-4 or IL-17 production (Fig. 3B). In fact, (at 8 h) mRNAs (Fig. 2C). IS001 had the effect of slightly enhancing the production of IL-4 It has been previously reported that male PPARa2/2 mice de- (Fig. 3B), which appeared to relate to a stimulatory effect of this velop a fatty liver with age due to defects in lipid metabolism (25). drug on T cell proliferation (Supplemental Fig. 1A). In contrast, Though we used young (8-wk-old) adult mice in our experiments treatment with fenofibrate selectively reduced the production of to avoid this possible confounder, it remained possible that the IFN-g by CD4+ T cells (Fig. 3C). These effects of IS001 and Th1 bias we observed in PPARa2/2 T cells related to other fenofibrate on IFN-g production were not observed in cultures metabolic abnormalities (25) or developmental defects (26) in the of PPARa2/2 CD4+ T cells (Supplemental Fig. 1B for IS001) PPARa2/2 mouse or to the compensatory upregulation of other (see Ref. 7 for fenofibrate), indicating that they were PPARa nuclear receptors such as PPARg and PPARd (6). Thus, to further dependent. The Journal of Immunology 5193 by guest on October 1, 2021. Copyright 2015 Pageant Media Ltd.

FIGURE 2. PPARa2/2 CD4+ T cells are skewed toward Th1. (A and B) Lymph nodes were isolated from WT or PPARa2/2 male SV.129 mice (n =5 http://classic.jimmunol.org mice/group), pooled within groups, and dissociated into a single-cell suspension. Cells were then stimulated in complete RPMI 1640 with anti-CD3 and anti-CD28 under Th0- (no added cytokines), Th1- (IL-12 + anti–IL-4), Th2- (IL-4 + anti–IFN-g), or Th17-polarizing (TGF-b + IL-6 + anti–IFN-g + anti– IL-4) conditions. (A) Cytokine levels in supernatants at 60 h in one experiment of three. Values are means + SEM readings in triplicate cultures. (B) Intranuclear staining of T-bet, GATA-3, and RORgt in Th0 cells in the CD4+ T cell live gate after 60 h of stimulation. These plots are representative of two independent experiments. (C) Naive CD4+ T cells were isolated from spleen and lymph nodes of PPARa+/+ or PPARa2/2 male mice (n = 5 mice/group), pooled within groups, and stimulated with anti-CD3 and anti-CD28 for various times (0, 4, 8, 16, or 24 h). After the indicated times, cells were harvested for isolation of total RNA. Transcript levels for the indicated genes were measured by real-time PCR and are expressed relative to b-actin mRNAs. Values Downloaded from are means + SEM of triplicate PCR reactions in one representative experiment of two that were performed. *Signiﬁcantly different (p , 0.05) from PPARa+/+ by t test (two-tailed). FMO, ﬂuorescence-minus-one.

To further verify that PPARa is uniquely regulating the Th1 pathway directly as opposed to an indirect mechanism involving pathway, we also conducted siRNA knockdown studies in primary promotion of Th2 or Th17 pathways. male WT CD4+ T cells. For these studies, we used male T cells from SJL mice, for which we can achieve reasonable transfection Ifng is the gene repressed by PPARa efficiencies and PPARa mRNA knockdown (Fig. 3D, Fig. 3 leg- To determine which gene in the Th1 pathway is the target of end). Similar to findings using the antagonist, transfection with PPARa-dependent regulation, we focused on the three Th1- PPARa siRNAs resulted in a heightened production of IFN-g by associated genes (Tbx21, Eomes, and Ifng) that are known to act CD4+ T cells upon stimulation with anti-CD3 and anti-CD28 early in the Th1 pathway downstream of early TCR and CD28 2 2 stimulation, but did not influence the productions of IL-17 or stimulation (1) and were expressed at higher levels in PPARa / IL-4 (Fig. 3E). Together with our pharmacologic data, these re- compared with WT CD4+ T cells (Fig. 2C). IFN-g and T-bet act in sults support a mechanism by which PPARa inhibits the Th1 a feed-forward loop to enhance each other’s expression during 5194 PPARa REGULATES SEX DIFFERENCES IN IFN-g PRODUCTION

Th1 differentiation, whereas Eomes is important for optimal expression of IFN-g in CD4+ T cells and the major inducer of IFN-g expression in the absence of T-bet (1). To investigate whether it was the higher T-bet expression in PPARa2/2 CD4+ T cells that was driving the enhanced IFN-g mRNAs, we generated PPARa+/+ and PPARa2/2 mice on the T-bet2/2 background, isolated naive CD4+ T cells from these mice and stimulated these cells with anti-CD3 and anti-CD28. IL-12 was also added to media to help amplify the low-level IFN-g mRNA expression in T-bet2/2 T cells. We observed that PPARa2/2 T-bet2/2 CD4+ T cells still exhibited higher IFN-g mRNA levels and cytokine production than PPARa+/+T-bet2/2 CD4+ Tcells (Fig. 4A), suggesting that T-bet is not required for the PPARa- dependent regulation of IFN-g production. Interestingly, in the absence of T-bet, there was an early compensatory increase in Eomes mRNA expression in the PPARa2/2 CD4+ T cells (Fig. 3A) that corresponded with the timing of the early peak in T-bet expression that is observed in WT T cells postactivation (Fig. 2C). Because T-bet and Eomes are both induced downstream of IFN-g receptor–STAT1 signaling (4, 27), it remained possible that the higher expressions of these transcription factors in PPARa2/2 CD4+ T cells was related to the higher IFN-g production by PPARa2/2 CD4+ T cells during the early stages of activation. Thus, we repeated T cell stimulations in the presence of an IFN-g neutralizing Ab, which functioned to bind any secreted IFN-g. We found that under these conditions, the differences in the early expressions of T-bet and Eomes mRNAs between WT and PPARa2/2 CD4+ T cells disappeared, whereas the levels of IFN-g mRNAs in PPARa2/2 CD4+ T cells remained elevated above WT (Fig. 3B). Together, these data strongly suggest that Ifng is the gene repressed by PPARa in male CD4+ T cells. Deﬁciency in PPARa is associated with enhanced histone acetylation at the Ifng locus

by guest on October 1, 2021. Copyright 2015 Pageant Media Ltd. We had observed that the effect of PPARa in limiting Ifng gene expression in male CD4+ T cells occurred even under Th0 conditions, suggesting that this transcription factor may be acting as a rheostat, modulating the strength of TCR or CD28 signals that FIGURE 3. PPARa specifically inhibits the Th1 pathway. (A)TheIC 50 lead to Ifng transcription. Although previous reports have sug- of the IS001 antagonist for human and mouse PPARa as well as for thyroid hormone receptor b (TRb), RXRa, glucocorticoid receptor gested a role for PPARa in the negative regulation of the phos- (GR), and estrogen receptor b (ERb) as determined using nuclear- phorylation of p38 (28) or the abundance of IkB (29), we did not hormone based luciferase reporter assays. WT CD4+ T cells isolated observe any aberrations in the expression or phosphorylation of from SV.129 male mice (n = 5 mice/group) were pooled together and key signaling intermediates downstream of the TCR and CD28 2/2 + http://classic.jimmunol.org preincubated in X-VIVO-20 media with 100 nmol/l IS001 (B)or2.5 in male PPARa CD4 T cells (Supplemental Fig. 2). Thus, mmol/l fenofibrate (C)orDMSO(0.1%)vehiclefor4hpriortostim- PPARa must operate more distally in this pathway, possibly at the ulation with anti-CD3 and anti-CD28. Shown are the cytokine levels Ifng locus itself to control Ifng expression. detected in culture supernatants after 48 h. Values are means + SEM of Transcription of Ifng is regulated by both TCR and cytokine- triplicate cultures, and data are representative of three independent dependent signals and downstream transcription factors that bind experiments. *Significantly different (p , 0.05) from WT by t test (two- to cis elements at the promoter, but also at a number of highly tailed). (D and E)TotalmouseCD4+ T cells were isolated from male Downloaded from SJL mice (n = 5 mice/group), pooled, and electroporated with a vector conserved noncoding sequences (CNS) located far upstream and encoding GFP (to monitor for transfection efficiency) plus mouse downstream of Ifng (Fig. 5A) (1–3). The binding of transcription PPARa siRNAs or nontargeting control siRNAs. After an overnight rest, factors to CNS sites is supported by epigenetic modifications such an aliquot of cells was frozen for real-time measurement of PPARa as histone acetylation that make chromatin at the Ifng locus more mRNA expression and remaining cells were transferred to anti-CD3– accessible (2, 3). H4-Ac is one epigenetic mark that accumulates and anti-CD28–coated plates. (D) The frequency of CD4+ T cells that at CNS sites at the Ifng locus during Th1 differentiation (30). This expressed the GFP vector. Transfection with PPARa mRNAs resulted acetylation event occurs as a result of the T-bet–dependent re- in an efficient knockdown of the PPARa transcript (PPARa threshold moval of the NCOR/Sin3A/HDAC-containing corepressor com- cycle = 34.7 + 0.38 in nontargeting group and transcript was not detectable plex at the Ifng locus (30). in PPARa siRNA group; b-actin threshold cycles were 14.3 + 0.06 in To investigate whether PPARa may be regulating histone acety- nontargeting group and 14.5+ 0.24 in the PPARa siRNA group). (E) Cytokine levels in culture supernatants at 48 h of stimulation. Values lation, we started by comparing the abundance of H4-Ac at CNS are means + SEM of triplicate cultures, and data presented are repre- sites and at the promoter region of Ifng in activated male WT and 2/2 + sentative of two independent experiments. *Significantly different PPARa CD4 T cells using a ChIP assay. Consistent with pre- (p , 0.05) from nontargeting control by t test (two-tailed). n.d., not vious reports (3), we observed a more notable induction in H4-Ac detectable. in WT CD4+ T cells under Th1 compared with Th0 polarization The Journal of Immunology 5195

FIGURE 4. IFN-g is the gene target of PPARa-dependent suppression. WT or PPARa2/2 naive CD4+ T cells were isolated from mice on the T-bet+/+ or T-bet2/2 background (cells pooled from n = 5 mice/group). These cells were stimulated in complete RPMI 1640 with anti-CD3 and anti-CD28 for 24 h in the absence (A) or presence (B) of anti–IFN-g (10 mg/ml). For the experiment using T-bet2/2 CD4+ T cells (in A), media was also supplemented with mouse rIL-12. Transcript levels were measured using real-time PCR and normalized to b-actin mRNAs. IFN-g levels in culture supernatants were measured at 24 h of culture using ELISA. Values are means 6 SEM of triplicate reactions (left three panels) or triplicate cultures (right panel) and representative of two independent experiments. *Signiﬁcantly different (p , 0.05) from PPARa+/+ group by t test (two-tailed).

conditions (Fig. 5B). However, when comparing the levels of H4- mechanism of how the related nuclear receptor PPARg represses Ac between WT and PPARa2/2 CD4+ T cells, it was apparent that the transcription of Inos in macrophages. It was found that the PPARa2/2 CD4+ T cells showed a higher abundance of H4-Ac at ligand agonist rosiglitazone promotes the sumoylation and re- the Ifng promoter and at most CNS sites examined under both Th0 cruitment of PPARg to the Inos promoter, where it stabilizes the

by guest on October 1, 2021. Copyright 2015 Pageant Media Ltd. and Th1 conditions (Fig. 5C, 5D). However, no differences in the presence of an NCOR-containing corepressor complex, rendering abundance of H4-Ac were observed between quiescent WT and the gene refractory to LPS stimulation (15). NCOR mediates the PPARa2/2 CD4+ T cells (Fig. 5E), indicating that PPARa only repressive effects of PPARs and other nuclear receptors by influences H4-Ac at the Ifng locus in activated T cells. recruiting HDACs to gene-regulatory regions (32). Given that We also compared the abundance of H3K27-Me, a repressive PPARa is also reported to be sumoylated upon ligand treatment mark that accumulates at CNS sites in the Ifng locus upon Th2 (33), we hypothesized that PPARa may operate by a similar differentiation (31). Though naive CD4+ T cells show only limited mechanism to repress Ifng. H3K27-Me at certain CNS sites in the Ifng locus, we noted that We therefore tested whether treatment of male CD4+ T cells with this abundance was lowered in PPARa2/2 compared with WT cells the PPARa ligand fenofibrate would enhance the recruitment of http://classic.jimmunol.org after stimulation (Fig. 5F), further consistent with the notion that PPARa to regulatory elements at the Ifng gene and whether this male PPARa2/2 CD4+ T cells are not only more poised to become recruitment would be associated with reduced H4-Ac and en- Th1 but may be less poised to become Th2 cells. hanced NCOR at these sites. For these studies, we used Th1- Next, we investigated whether the small-molecule PPARa antag- polarized CD4+ T cells that exhibited a higher basal level of onist IS001 could evoke a similar increase in H4-Ac across the Ifng H4-Ac (Fig. 5B). We observed that treatment with fenofibrate locus as seen in PPARa2/2 CD4+ T cells. For these experiments, we reduced IFN-g mRNAs and the abundance of H4-Ac at two CNS +

Downloaded from stimulated both male and female CD4 T cells with anti-CD3 and sites (CNS-22 and CNS-34) and at the Ifng promoter relative to anti-CD28 for 4 h in the presence of either IS001 or vehicle control. levels in the vehicle control group (Fig. 6A). These changes were Similar to findings of male PPARa2/2 CD4+ T cells, treatment of independent of T-bet, because fenofibrate treatment did not lower male WT CD4+ T cells with the antagonist increased H4-Ac at the T-bet expression within the 4-h time frame of the experiment Ifng promoter and at most CNS sites (Fig. 5G, left panel)aswellas (Fig. 6B). In addition, the three cis-regulatory elements that increased the levels of IFN-g mRNAs (Fig. 5H). Consistent with the showed reduced H4-Ac also displayed an increased abundance of broad-scale nature of these changes, IS001 treatment also enhanced NCOR and PPARa as detected by ChIP (Fig. 6C, 6D). T-bet mRNA levels in male T cells (Fig. 5H). This effect of the Though the increased presence of PPARa at the Ifng promoter antagonist in increasing H4-Ac was not observed in assays conducted and CNS-22 and CNS-34 enhancer regions correlated with the using female CD4+ T cells (Fig. 5G, right panel), confirming a sex- accumulation of NCOR, it remained unclear whether NCOR was specific modulation of the Ifng gene by PPARa. required for the repressive activities of PPARa on IFN-g production. Therefore, we investigated whether siRNA-mediated Ligand-dependent transrepression of Ifng by PPARa knockdown of NCOR expression in primary T cells would How PPARa represses the expression of Ifng is not presently abrogate the effects of fenofibrate in decreasing IFN-g pro- known. Previously, Pascual et al. (15) resolved the molecular duction. For these studies, we used SJL male T cells, which are 5196 PPARa REGULATES SEX DIFFERENCES IN IFN-g PRODUCTION by guest on October 1, 2021. Copyright 2015 Pageant Media Ltd.

FIGURE 5. Reducing PPARa activity enhances H4-Ac at the Ifng locus. (A) Schematic of the Ifng.(B and C) Naive CD4+ T cells or Th1-polarized cells grown from spleens of male WT or PPARa2/2 mice (n = 5/group) were stimulated in complete RPMI 1640 with anti-CD3 and anti-CD28 for 4 h. ChIP was http://classic.jimmunol.org performed using anti–H4-Ac and primers that spanned CNS sites and the Ifng promoter. (B) Mean + SEM fold increase of H4-Ac in stimulated versus nonstimulated CD4+ T cells in one experiment. The relative abundance of H4-Ac in the WT and PPARa2/2 CD4+ T cells is shown under Th0 (C) and Th1 conditions (D). (E) Mean + SEM relative abundance of H4-Ac at the various CNS sites and the Ifng promoter in naive quiescent WT and PPARa2/2 CD4+ T cells. (F) Naive PPARa+/+ and PPARa2/2 CD4+ T cells were activated for 4 h with anti-CD3 and anti-CD28 (8 mg/ml each), and ChIP was performed using a di/trimethylated histone H3K27 Ab. Shown is the relative abundance of H3K27-Me at the various CNS sites and the Ifng promoter. *Signiﬁcantly different (p , 0.05) by two-tailed t test. (G and H) Naive CD4+ T cells were isolated from male or female WT mice and were stimulated in X-VIVO-20 G

Downloaded from media with anti-CD3 and anti-CD28 in the presence of 100 nmol/l IS001 or DMSO vehicle. ChIP was performed as described above for H4-Ac ( ), and T-bet and IFN-g mRNAs were measured using real-time PCR (male cells only) (in H). All of these studies were conducted using samples from mice (n =5 mice pooled/group). The values are means + SEM of triplicate PCR measurements from one experiment, and data shown are representative of two to three independent experiments. All ChIP data except for that in (B) reﬂects the abundance of immunoprecipitated DNA normalized to input DNA less the minimal signal generated from the IgG control. *Signiﬁcantly different (p , 0.05) from PPARa+/+ (C–F) or vehicle (G and H)byt test (two-tailed).

amenable to transfection and gene knockdown (Fig. 6E, 6F). and associated HDACs to important regulatory elements in the Similar to our previous ﬁndings in SV.129 CD4+ T cells Ifng locus.

(Fig. 3C), fenofibrate treatment reduced IFN-g production by + CD4+ T cells transfected with nontargeting siRNAs (Fig. 6G) PPARa also limits IFN-g production by male NKT and CD8 and reduced H4-Ac at CNS-34, CNS-22, and the Ifng promoter T cells sites (Fig. 6H). Knockdown of NCOR reversed these effects of IFN-g is not only produced by CD4+ T cells, but also in large fenofibrate (Fig. 6G, 6H), confirming that PPARa requires amounts by cytotoxic CD8+ T lymphocytes, NK, and NKT cells NCOR for the repression of Ifng. Together, these data suggest (34). It has also been reported that these cell types exhibit a higher that PPARa represses Ifng gene expression by recruiting NCOR production of IFN-g in females than in males (35–37). To gain The Journal of Immunology 5197 by guest on October 1, 2021. Copyright 2015 Pageant Media Ltd. http://classic.jimmunol.org

FIGURE 6. Fenofibrate induces PPARa recruitment to specific regulatory elements in the ifng locus to repress H4-Ac. (A–D) Th1-polarized CD4+ T cells grown from male WT mice (n = 5/group) were stimulated for 4 h with anti-CD3 and anti-CD28 in X-VIVO-20 media in the presence of the PPARa ligand (fenofibrate) or DMSO vehicle. (B) Total RNA was isolated from T cells, and T-bet and IFN-g mRNAs were measured using real-time RT-PCR mea-

Downloaded from surement and expressed relative to b-actin mRNAs. ChIP was performed as described in Fig. 5 legend using anti–H4-Ac (A), anti-NCOR (C), and anti- PPARa (D) Abs. For ChIP studies in (A) and (C), the data are the relative abundance of immunoprecipitated DNA normalized to total input DNA less the minimal signal generated from the IgG control, whereas (D) shows the fold change of the relative abundance of PPARa in the fenofibrate- versus DMSO- treated samples. Values in (A)–(C) are means + SEM of triplicate PCR reactions and representative of two independent experiments, whereas values in (D) are means + SEM of fold-change values obtained in two independent experiments. In (A)–(D), an asterisk denotes a significant difference (p , 0.05) from vehicle counterpart by two-tailed t test. (E–H) CD4+ T cells were isolated from male SJL/J mice and transfected with either nontargeting or NCOR-specific siRNAs along with a GFP reporter plasmid. After a 12-h overnight rest, cells were treated 4 h with fenofibrate and then stimulated with anti-CD3 and anti- CD28 for either 4 h (ChIP and mRNA measurement) or 48 h (cytokine measurement). (E) Efficiency of transfection as determined by flow cytometry measurement of GFP expression. (F) Abundance of NCOR mRNAs (relative to b-actin mRNAs) in CD4+ T cells stimulated with NCOR or nontargeting siRNAs. (G) IFN-g production by CD4+ T cells, and (H) H4-Ac at CNS-34, CNS-22, and Ifng promoter sites using ChIP. Values in (F)–(H) are means + SEM of triplicate PCR reactions or cultures in one experiment done of two that were performed. In (G) and (H), an asterisk indicates a significant difference (p , 0.05) from nontargeting siRNA vehicle as determined using a one-way ANOVA and Tukey post hoc test. 5198 PPARa REGULATES SEX DIFFERENCES IN IFN-g PRODUCTION

insights into the breadth of regulation of IFN-g production by tal infection of mice with L. monocytogenes has been an instru- PPARa, we stimulated splenocytes from male and female WT and mental model for deciphering the importance of IFN-g in innate PPARa2/2 mice with PMA/ionomycin and examined IFN-g re- and cellular immunity (19, 38–41). We therefore were interested sponses by NK and NKT cells by intracellular cytokine staining. in whether treatment with the PPARa antagonist IS001 would We observed that the frequencies of IFN-g–producing NK cells enhance IFN-g production by innate and adaptive immune cells in did not differ between WT and PPARa2/2 groups in either sex, male mice and improve resistance against experimental infection though there was a tendency for a higher frequency of IFN-g+ with this pathogen. For these studies, mice were infected with cells in the male PPARa2/2 versus the male WT group (Fig. 7A). L. monocytogenes (i.p.) and treated twice daily via oral gavage In contrast, IFN-g responses to PMA/ionomycin were higher in with either vehicle (0.5% methylcellulose) or IS001 (30 mg/kg), the NKT cell compartment in male PPARa2/2 as compared with starting1dpriortoinfection.Preliminary,pharmacokinetic WT mice (Fig. 7B). studies established that a 30-mg/kg oral dose of IS001 resulted in Next, we investigated whether PPARa is involved in regulating plasma concentrations of IS001 (Supplemental Fig. 3) that would + the sex difference in IFN-g production by CD8 T cells. Consis- specifically antagonize PPARa based on the determined IC50 tent with our findings for CD4+ T cells, CD8+ T cells isolated from values (Fig. 3A). spleens of male, but not female, PPARa2/2 mice produced higher During experimental infection with L. monocytogenes, early levels of IFN-g than WT counterparts in response to anti-CD3 and IFN-g production by NK and NKT cells in the spleen and liver is anti-CD28 stimulation (Fig. 8A). Similarly, treatment with IS001 important for the initial control of the pathogen (39, 40). To in- increased IFN-g production by male, but not female, CD8+ T cells vestigate whether there was a sex-dependent effect of IS001 on relative to levels in the vehicle control group (Fig. 8B). The in- NK and NKT cell IFN-g production, we infected male and female creased IFN-g production by male CD8+ T cells in response to mice i.p. with 100,000 CFU of L. monocytogenes and treated mice IS001 treatment correlated with a higher abundance of H4-Ac at twice daily with IS001 or vehicle starting 1 d prior to infection. most CNS sites examined (Fig. 8C, top panel). In contrast, the We then examined IFN-g production by innate cells in the spleen abundance of H4-Ac was not changed or was lowered at CNS sites at 24 h postinfection, the time of the peak IFN-g response. We in female CD8+ T cells treated with IS001 (Fig. 8C, bottom found that significant differences in IFN-g responses were ap- panel). These results indicate that PPARa controls sex differences parent between the sexes and between treatment groups within the in IFN-g production by conventional CD4+ and CD8+ T cells as NKT cell compartment, but not in the NK cell compartment well as NKT cells. (Fig. 9A, 9B). Specifically, we observed that a higher frequency of female NKT cells produced IFN-g compared with male NKT cells IS001 treatment enhances IFN-g responses in male mice upon infection (comparing vehicle-treated male and female groups during L. monocytogenes infection in Fig. 9B; p = 0.048, t test), and this was associated with a higher IFN-g signaling has been shown to be crucial for mounting cel- level of IFN-g in the serum of female mice (Fig. 9C). Oral dosing lular immune responses against intracellular pathogens including of IS001 had the effect of enhancing IFN-g responses by the Gram-positive bacterium L. monocytogenes (38). Experimen- NKT cells and increasing serum IFN-g in male, but not female by guest on October 1, 2021. Copyright 2015 Pageant Media Ltd. http://classic.jimmunol.org Downloaded from

FIGURE 7. PPARa negatively regulates IFN-g production by male NKT cells. Splenocytes isolated from male and female WT and PPARa2/2 mice were stimulated in complete RPMI 1640 with 10 ng/ml PMA and 750 nmol/l ionomycin in the presence of GolgiStop for 5 h and processed for cell-surface and intracellular cytokine staining. Left panels show the frequency of cells in the NK cell gate (CD82TCRb2tetramer2NKp46+)(A) or NKT cell gate (CD82TCRb+tetramer+)(B) that showed positive IFN-g staining. Values are means + SEM frequencies of measures obtained in individual mice (n = 5/group). Right panels show representative intracellular staining after PMA and ionomycin stimulation. Gates were set using ﬂuorescence-minus-one controls. Data in panels are representative of two independent experiments. *Signiﬁcantly different (p , 0.05) from WT male as determined by one-way ANOVA followed by a Tukey post hoc test. FSC, forward light scatter. The Journal of Immunology 5199

mice (Fig. 9B, 9C). This higher early production of IFN-g in IS001-treated mice also was associated with lower bacterial loads in the spleen in male mice (Fig. 9D). Next, to investigate the sex-dependent effect of IS001 on adaptive lymphocyte responses, we infected mice with a sublethal dose of 20,000 CFU L. monocytogenes and measured IFN-g production by splenic CD4+ and CD8+ T cells ex vivo (7 d postinfection) after restimulation with heat-killed pathogen. Similar to findings for NKT cells, IFN-g responses tended to be higher in the CD8+ T cell (p = 0.02, two-tailed t test) and CD4+ T cell (p = 0.051, two-tailed t test) compartments in female compared with male mice (left versus right panels, Fig. 9E, 9F). Treatment with IS001 enhanced IFN-g responses exclusively in male mice (Fig. 9E–G). In dose-escalation studies, we had observed that females were more resistant to death in response to infection with the same dose of 100,000 CFU pathogen by log-rank test (p = 0.0079) (compare LD50 curve for male vehicle in the top panel to the LD10 curve for female vehicle in the bottom panel of Fig. 9H). To explore whether IS001 would differentially impact mouse survival in males and females during L. monocytogenes infection, we repeated studies except infected with the LD50 dose of the pathogen (100,000 CFU for males and 150,000 CFU for females, Fig. 9H). When chal- lenged with these doses, IS001 increased the percentage survival of male but not female mice (Fig. 9H, LD50 curves). In fact, treatment with the antagonist essentially abrogated the sex- difference in mouse survival upon infection with the same dose of 100,000 CFU of the pathogen (compare male LD50 vehicle survival curve in top panel versus the female LD10 survival curve in the bottom panel in Fig. 9H). Altogether, these results further implicate PPARa as the major factor controlling sex differences in IFN-g responses and support the application of IS001 as an adjuvant to boost innate and cellular immune responses in males. by guest on October 1, 2021. Copyright 2015 Pageant Media Ltd. Discussion It has been suggested that sex differences in Th1 responses arise because of the higher IL-12 production by APC and enhanced T cell responsiveness to this cytokine in females (11, 12). We previously observed that even in the absence of IL-12, male CD4+ T cells have a lower intrinsic ability than female CD4+ T cells to produce IFN-g, which associated with higher expression of PPARa (6, 7). The present study identifies Ifng as the gene re- http://classic.jimmunol.org pressed by PPARa and provides evidence that PPARa inhibits Ifng by recruiting NCOR to key regulatory elements of the Ifng locus. Furthermore, we observed that treatment of mice with a a g + small-molecule PPAR antagonist IS001 enhanced IFN- pro- FIGURE 8. PPARa negatively regulates IFN-g production by male CD8 duction by NKT, CD4+, and CD8+ T cells selectively in male T cells. Total CD8+ T cells isolated from spleens of male or female WT and 2 2 mice, further implicating PPARa as a major factor controlling sex PPARa / mice (n = 5/group) were stimulated with anti-CD3 and anti-CD28 Downloaded from (A) or treated with 100 nmol/l IS001 or vehicle prior to stimulation (B and C). differences in IFN-g responses in vivo. (A) Shown are the mean + SEM cytokine levels in culture supernatants of The finding that fenofibrate treatment, IS001 treatment, and male and female cells after 24 h in one of two independent experiments that siRNA-mediated knockdown of PPARa mRNAs modulated IFN-g + were done. Male and female data were collected from independent experi- production by male CD4 T cells without effecting opposite ments and were thus not displayed in the same panel. *Significantly different changes in the productions of IL-4 or IL-17A, indicated that from the WT group by two-tailed t test. (B) Shown are the mean + SEM PPARa represses Th1 cytokine production directly as opposed to + cytokine levels in culture supernatants of male and female CD8 T cell an indirect mechanism involving transactivation of Th2 or Th17 cultures in one of two representative experiments that were done. *Significantly pathways. Notably, this finding does contrast with results of pre- , † , different (p 0.05) from the vehicle counterpart, significantly different (p vious studies that reported certain PPARa ligands (WY 14643, 0.05) from sex-matched counterpart. Data were compared using a one-way gemfibrozil, and ciprofibrate, but not GW7462) to enhance Th2 ANOVA and Tukey post hoc test. (C) ChIP for H4-Ac was performed as described in Fig. 3 legend. Values are means + SEM of triplicate cultures or cytokine production (24, 42). The study by Cunard et al. (24) PCR reactions of one representative experiment of two that were done. Data reported that treatment of splenocytes with high concentrations of are expressed as the relative abundance of immunoprecipitated DNA nor- gemfibrozil, WY 14643, and ciprofibrate increased IL-4 produc- malized to total input DNA less the minimal signal generated from the IgG tion by T cells. However, the effect of fibrates in increasing IL-4 2 2 control. *Significant difference (p , 0.05) from vehicle by two-tailed t test. was still evident when splenocytes were sourced from PPARa / 5200 PPARa REGULATES SEX DIFFERENCES IN IFN-g PRODUCTION by guest on October 1, 2021. Copyright 2015 Pageant Media Ltd.

FIGURE 9. IS001 treatment enhances IFN-g responses selectively in males during L. monocytogenes infection. (A–D) Female and male C57BL/6 mice http://classic.jimmunol.org (n = 3–5/group) were infected with 100,000 CFU L. monocytogenes and treated twice daily by gavage with 30 mg/kg IS001 or vehicle, starting 1 d prior to infection. Spleens were harvested after 24 h and immediately processed for intracellular cytokine staining. Shown are the frequencies of IFN-g+ cells in the NK (CD82TCRb2tetramer2NKp46+)(A) and NKT cell (CD82TCRb+tetramer+)(B) gates. (C) IFN-g levels in the serum, and (D) bacterial load in the spleen after 48 h. (E–G) Female and male C57BL/6 (n = 8/group for the infected mice and n = 3/group for the control mice) were infected with 20,000 CFU L. monocytogenes and treated as described. After 7 d, spleens were harvested and cultured with heat-killed pathogen (1:1 ratio of bacterium/cell) for 24 h with GolgiStop added in the last 4 h of culture. Shown are the frequencies of live CD4+ (E) and CD8+ (F) cells that produced IFN-g and the levels of IFN-g

in culture supernatants (G). (H) Male and female mice (n = 18/group) were infected i.p. with the LD50 dose of the pathogen (100,000 CFU for males and Downloaded from 150,000 CFU for females). In addition, for comparison purposes, a group of female mice (n = 8/group) were infected with 100,000 CFU (LD10 dose) of the pathogen. Mice were then followed for survival to end points for 21 d. In (A)–(G), data are from one representative experiment of two to three individual experiments that were performed, and values are means 6 SEM of values obtained from individual mice (A–F) or triplicate cultures (G). *Signiﬁcantly different (p , 0.05) from vehicle by t test (two-tailed) (A, B, and E–G) or log-rank test (H).

mice (24), suggesting that the effect occurred through a PPARa- In addition to elucidating the Th1 pathway as the prime target of independent mechanism. In contrast, the study by Gocke et al. PPARa-dependent regulation, our studies identified the Ifng to be (42) reported that the induction of IL-4 in T cells by gemfibrozil the gene target of suppression. There were three key pieces of was PPARa dependent and associated with the direct recruitment evidence that supported this conclusion. First, in examining the of PPARa to the IL-4 promoter (42). Taken together, the cur- profile of Th-related genes in activated CD4+ T cells, it was ap- rent evidence suggests that PPARa functions primarily to inhibit parent that Ifng was the gene that showed a striking and sustained IFN-g production by T cells; however, at high doses, certain difference in expression between WT and PPARa2/2 CD4+ fibrate drugs may have the added effect of inducing Th2 cytokine T cells. Secondly, when we neutralized extracellular IFN-g, the production, which may or may not be PPARa dependent. differences in T-bet and Eomes mRNA expression between WT The Journal of Immunology 5201

and PPARa2/2 CD4+ T cells disappeared, whereas the expression Stimulation of naive CD4+ T cells over 4 h in the presence of the of Ifng remained persistently elevated in PPARa2/2 CD4+ T cells. antagonist had the effect of enhancing T-bet expression, a neces- Finally, in our ChIP studies that investigated the effect of fenofi- sary prerequisite for inducing broad-scale changes in H4-Ac at the brate on H4-Ac, we observed the drug to inhibit IFN-g but not Ifng locus (30). In contrast, ChIP experiments using fenofibrate T-bet mRNAs. Notably, our finding that PPARa targets IFN-g were conducted using Th1-polarized cells that already exhibited rather than T-bet, does contrast with the mechanism elucidated for high T-bet mRNA expression, which was not impacted in the the PPARg-dependent control of the Th17 lineage, in which it was short-term by ligand treatment; hence no broad-scale changes in found that PPARg directly represses RORgt expression (16). Why H4-Ac were apparent and T-bet–independent effects of PPARa evolution favored Ifng rather than Tbx21 as a target of PPARa in could be revealed. the control of Th1 immunity is not known, but may relate to the The finding that PPARa regulates IFN-g expression through the key importance of early production of IFN-g in the amplification CNS-34 site may also explain why NK cell IFN-g production was of T-bet expression during early Th1 programming (4). not significantly impacted by PPARa deficiency. Although CNS- Our experiments also resolved a potential mechanism for how 22 is involved in the establishment of H4-Ac marks and for in- PPARa represses Ifng. We observed that treatment with fenofi- duction of Ifng transcription in both NK cells and adaptive brate induced the corecruitment of PPARa and NCOR to the Ifng lymphocytes, the human homolog of CNS-34 has been shown to promoter as well as CNS-22 and CNS-34 sites, which are distal be important in the regulation of IFN-g in CD4+ T cells and elements in the Ifng locus that are required for Th1 lineage- NKT cells, but not in NK cells (2, 45). Thus, it is possible that the specific expression (2). The enhanced abundance of NCOR was PPARa-dependent control of Ifng may be diluted in NK cells due also associated with reduced histone acetylation at these regula- to the decreased importance of CNS-34 in this regulation. Con- tory elements, which is consistent with the role of NCOR in sistent with this notion, we did observe a trend for a higher IFN-g tethering HDACs to gene control regions (32). Furthermore, our response by PPARa2/2 NK cells and by WT NK cells treated with finding that knockdown of NCOR abrogated the effects of feno- the PPARa antagonist. fibrate in reducing H4-Ac and IFN-g production, proved that Our in vivo studies using IS001 also provided the proof of NCOR is required for the effect of PPARa on IFN-g expression. concept that antagonizing PPARa activity with a small molecule These findings thus mirror the mechanism elucidated for the can be used as an approach to boost IFN-g production in males to PPARg-dependent inhibition of Inos, where it was found that aid in the clearance of intracellular pathogens. In addition to its PPARg inhibited expression of this gene by recruiting and stabi- role in combating bacterial infection, IFN-g production is crucial lizing the presence of NCOR and HDAC3 at the promoter region for antitumor immune responses, and rIFN-g or IL-12 have been of this gene. In addition to the effects of PPARa on histone used with some success in clinical trials to treat various malig- acetylation, our studies provided limited evidence that PPARa nancies (46–48). Because systemic administration of these cyto- may also regulate the accumulation of the repressive histone mark kines is associated with side effects and dose-related toxicities H3K27-Me, because the levels of H3K27-Me were higher at (47, 48), alternative approaches are being pursued to enhance various CNS sites in PPARa2/2 versus WT CD4+ cells. Future IFN-g signaling including injection of tumors with adenovirus studies will investigate whether PPARa is directly responsible for encoding IFN-g (47) and administration of small-molecule acti-

by guest on October 1, 2021. Copyright 2015 Pageant Media Ltd. the altered methylation status at the Ifng promoter, by examining vators of STAT1 signaling (49). We propose that treatment with whether H3K27-Me or Enhancer of Zeste Homolog 2, the enzyme IS001 may serve as yet another approach to boost IFN-g responses that catalyzes this histone methylation event, accumulate differ- in males to treat chronic infection or malignancy. ently at the Ifng locus in fenoﬁbrate- or IS001-treated T cells. In conclusion, our studies in PPARa provide a molecular Why PPARa was recruited to CNS-22 and CNS-34 and not mechanism for why IFN-g responses are more robust in females other CNS sites is not clear, but could relate to the fact that these and introduce a novel small molecule that can be used to augment two regulatory elements are considered to be pioneering elements the production of this cytokine in males. within the Ifng locus (2, 43). In particular, CNS-22 is thought to serve as a primary node for the recruitment of trans factors that Acknowledgments http://classic.jimmunol.org initiate the remodeling of the locus during Th1, Tc1, and NK cell We thank Dr. Peppi Prasit and the scientiﬁc team from Inception Sciences differentiation (2, 43). CNS-22 and CNS-34 along with the Ifng for providing IS001, Dr. Dana Philpott from the University of Toronto for promoter also contain binding sites for NF-kB, a transcription providing L. monocytogenes, and the National Institutes of Health Tetra- factor that acts downstream of TCR and CD28 signals to induce mer Core Facility for the CD1d tetramers. Ifng gene expression (2, 44). Though our study did not reveal a role for PPARa in regulating the kinetics of IkB degradation, in 2/2 Disclosures

Downloaded from past work, we showed that nuclear extracts from male PPARa N.S., L.C., and R.C. are employees of Inception Sciences who developed CD4+ T cells exhibit higher NF-kB p65 DNA binding activity than the IS001 antagonist. N.S. is also the director of Inception Sciences and WT nuclear extracts using an oligo-based DNA-binding assay (6). holds equity in the company. The other authors have no financial conflicts This result indicated that in addition to regulating chromatin remod- of interest. eling, PPARa may regulate the expression of Ifng by impacting distal events in NF-kB signaling that influence the DNA binding of this transcription factor (such as phosphorylation of NF-kB). References One inconsistency that we observed between the effects feno- 1. Zhu, J., H. Yamane, and W. E. Paul. 2010. Differentiation of effector CD4 T cell populations (*). Annu. Rev. Immunol. 28: 445–489. fibrate and IS001 on H4-Ac and was that IS001 influenced H4-Ac at 2. Balasubramani, A., R. Mukasa, R. D. Hatton, and C. T. Weaver. 2010. Regu- all CNS sites, whereas fenofibrate influenced H4-Ac only at CNS- lation of the Ifng locus in the context of T-lineage specification and plasticity. 22 and CNS-34. This inconsistency most likely relates to differ- Immunol. Rev. 238: 216–232. 3. Aune, T. M., P. L. Collins, S. P. Collier, M. A. Henderson, and S. Chang. 2013. ences in the types of Th cells that were used in ChIP studies and the Epigenetic activation and silencing of the gene that encodes IFN-g. Front. effects of these short-term drug treatments on T-bet expression. In Immunol. 4: 112. + 4. Afkarian, M., J. R. Sedy, J. Yang, N. G. Jacobson, N. Cereb, S. Y. Yang, the ChIP experiments using IS001, naive CD4 T cells were used T. L. Murphy, and K. M. Murphy. 2002. T-bet is a STAT1-induced regulator of that exhibited low baseline T-bet mRNA expression and H4-Ac. IL-12R expression in naı¨ve CD4+ T cells. Nat. Immunol. 3: 549–557. 5202 PPARa REGULATES SEX DIFFERENCES IN IFN-g PRODUCTION

5. Cua, D. J., D. R. Hinton, and S. A. Stohlman. 1995. Self-antigen-induced 28. Jones, D. C., X. Ding, T. Y. Zhang, and R. A. Daynes. 2003. Peroxisome Th2 responses in experimental allergic encephalomyelitis (EAE)-resistant proliferator-activated receptor alpha negatively regulates T-bet transcription mice. Th2-mediated suppression of autoimmune disease. J. Immunol. 155: through suppression of p38 mitogen-activated protein kinase activation. J. 4052–4059. Immunol. 171: 196–203. 6. Dunn, S. E., S. S. Ousman, R. A. Sobel, L. Zuniga, S. E. Baranzini, S. Youssef, 29. Kleemann, R., P. P. Gervois, L. Verschuren, B. Staels, H. M. G. Princen, and A. Crowell, J. Loh, J. Oksenberg, and L. Steinman. 2007. Peroxisome T. Kooistra. 2003. Fibrates down-regulate IL-1-stimulated C-reactive protein proliferator-activated receptor (PPAR)alpha expression in T cells mediates gene expression in hepatocytes by reducing nuclear p50-NFkappa B-C/EBP-beta gender differences in development of T cell-mediated autoimmunity. J. Exp. complex formation. Blood 101: 545–551. Med. 204: 321–330. 30. Chang, S., P. L. Collins, and T. M. Aune. 2008. T-bet dependent removal of 7. Zhang, M. A., D. Rego, M. Moshkova, H. Kebir, A. Chruscinski, H. Nguyen, Sin3A-histone deacetylase complexes at the Ifng locus drives Th1 differentia- R. Akkermann, F. Z. Stanczyk, A. Prat, L. Steinman, and S. E. Dunn. 2012. tion. J. Immunol. 181: 8372–8381. Peroxisome proliferator-activated receptor (PPAR)a and -g regulate IFNg and 31. Chang, S., and T. M. Aune. 2007. Dynamic changes in histone-methylation IL-17A production by human T cells in a sex-specific way. Proc. Natl. Acad. Sci. ‘marks’ across the locus encoding interferon-gamma during the differentiation USA 109: 9505–9510. of T helper type 2 cells. Nat. Immunol. 8: 723–731. 8. Whitacre, C. C., S. C. Reingold, and P. A. O’Looney. 1999. A gender gap in 32. Sun, Z., D. Feng, B. Fang, S. E. Mullican, S. H. You, H. W. Lim, L. J. Everett, autoimmunity. Science 283: 1277–1278. C. S. Nabel, Y. Li, V. Selvakumaran, et al. 2013. Deacetylase-independent 9. Klein, S. L. 2012. Sex influences immune responses to viruses, and efficacy of function of HDAC3 in transcription and metabolism requires nuclear receptor prophylaxis and treatments for viral diseases. BioEssays 34: 1050–1059. corepressor. Mol. Cell 52: 769–782. 10. Dorak, M. T., and E. Karpuzoglu. 2012. Gender differences in cancer suscep- 33. Leuenberger, N., S. Pradervand, and W. Wahli. 2009. Sumoylated PPARalpha tibility: an inadequately addressed issue. Front. Genet. 3: 268. mediates sex-specific gene repression and protects the liver from estrogen- 11. Wilcoxen, S. C., E. Kirkman, K. C. Dowdell, and S. A. Stohlman. 2000. induced toxicity in mice. J. Clin. Invest. 119: 3138–3148. Gender-dependent IL-12 secretion by APC is regulated by IL-10. J. Immunol. 34. Schoenborn, J. R., and C. B. Wilson. 2007. Regulation of interferon-gamma 164: 6237–6243. during innate and adaptive immune responses. Adv. Immunol. 96: 41–101. 12. Kissick, H. T., M. G. Sanda, L. K. Dunn, K. L. Pellegrini, S. T. On, J. K. Noel, 35. Curiel, R. E., M. H. Miller, R. Ishikawa, D. C. Thomas, and N. J. Bigley. 1993. and M. S. Arredouani. 2014. Androgens alter T-cell immunity by inhibiting T- Does the gender difference in interferon production seen in picornavirus-infected helper 1 differentiation. Proc. Natl. Acad. Sci. USA 111: 9887–9892. spleen cell cultures from ICR Swiss mice have any in vivo significance? J. In- 13. Bao, M., Y. Yang, H. S. Jun, and J. W. Yoon. 2002. Molecular mechanisms for terferon Res. 13: 387–395. gender differences in susceptibility to T cell-mediated autoimmune diabetes in 36. Gourdy, P., L. M. Araujo, R. Zhu, B. Garmy-Susini, S. Diem, H. Laurell, nonobese diabetic mice. J. Immunol. 168: 5369–5375. M. Leite-de-Moraes, M. Dy, J. F. Arnal, F. Bayard, and A. Herbelin. 2005. 14. Glass, C. K., and K. Saijo. 2010. Nuclear receptor transrepression pathways that Relevance of sexual dimorphism to regulatory T cells: estradiol promotes IFN- regulate inflammation in macrophages and T cells. Nat. Rev. Immunol. 10: 365– gamma production by invariant natural killer T cells. Blood 105: 2415–2420. 376. 37. Okuyama, K., T. Kashimura, T. Kawano, Y. Ohkawara, M. Takayanagi, 15. Pascual, G., A. L. Fong, S. Ogawa, A. Gamliel, A. C. Li, V. Perissi, D. W. Rose, T. Kikuchi, and I. Ohno. 2012. Higher sensitivity of male CD4+ T cells to T. M. Willson, M. G. Rosenfeld, and C. K. Glass. 2005. A SUMOylation- suppressive effects of CD8+ T cells on IL-5 production compared to female CD4 dependent pathway mediates transrepression of inflammatory response genes + T cells. Int. Arch. Allergy Immunol. 158(Suppl 1): 35–41. by PPAR-gamma. Nature 437: 759–763. 38. Huang, S., W. Hendriks, A. Althage, S. Hemmi, H. Bluethmann, R. Kamijo, 16. Klotz, L., S. Burgdorf, I. Dani, K. Saijo, J. Flossdorf, S. Hucke, J. Alferink, J. Vilcek, R. M. Zinkernagel, and M. Aguet. 1993. Immune response in mice that N. Nowak, M. Beyer, G. Mayer, et al. 2009. The nuclear receptor PPAR gamma lack the interferon-gamma receptor. Science 259: 1742–1745. selectively inhibits Th17 differentiation in a T cell-intrinsic fashion and sup- 39. Tripp, C. S., S. F. Wolf, and E. R. Unanue. 1993. Interleukin 12 and tumor presses CNS autoimmunity. J. Exp. Med. 206: 2079–2089. necrosis factor alpha are costimulators of interferon gamma production by nat- 17. Barnard, C. J., J. M. Behnke, and J. Sewell. 1994. Social behaviour and sus- ural killer cells in severe combined immunodeficiency mice with listeriosis, and ceptibility to infection in house mice (Mus musculus): effects of group size, interleukin 10 is a physiologic antagonist. Proc. Natl. Acad. Sci. USA 90: 3725– aggressive behaviour and status-related hormonal responses prior to infection on 3729. resistance to Babesia microti. Parasitology 108: 487–496. 40. Ranson, T., S. Bregenholt, A. Lehuen, O. Gaillot, M. C. Leite-de-Moraes, 18. Collison, L. W., and D. A. A. Vignali. 2011. In vitro Treg suppression assays. A. Herbelin, P. Berche, and J. P. Di Santo. 2005. Invariant V alpha 14+ NKT cells Methods Mol. Biol. 707: 21–37. participate in the early response to enteric Listeria monocytogenes infection. J. 19. Selvanantham, T., N. K. Escalante, M. Cruz Tleugabulova, S. Fie´ve´, Immunol. 175: 1137–1144.

by guest on October 1, 2021. Copyright 2015 Pageant Media Ltd. S. E. Girardin, D. J. Philpott, and T. Mallevaey. 2013. Nod1 and Nod2 enhance 41. Daugelat, S., C. H. Ladel, B. Schoel, and S. H. Kaufmann. 1994. Antigen- TLR-mediated invariant NKT cell activation during bacterial infection. J. speciﬁc T-cell responses during primary and secondary Listeria mono- Immunol. 191: 5646–5654. cytogenes infection. Infect. Immun. 62: 1881–1888. 20. Dunn, S. E., R. Bhat, D. S. Straus, R. A. Sobel, R. Axtell, A. Johnson, 42. Gocke, A. R. R. Z., R. Z. Hussain, Y. Yang, H. Peng, J. Weiner, L. H. Ben, K. Nguyen, L. Mukundan, M. Moshkova, J. C. Dugas, et al. 2010. Peroxisome P. D. Drew, O. Stuve, A. E. Lovett-Racke, and M. K. Racke. 2009. Transcrip- proliferator-activated receptor delta limits the expansion of pathogenic Th cells tional modulation of the immune response by peroxisome proliferator-activated during central nervous system autoimmunity. J. Exp. Med. 207: 1599–1608. receptor-alpha agonists in autoimmune disease. J. Immunol. 182: 4479–4487. 21. Chan, S. M., J. Ermann, L. Su, C. G. Fathman, and P. J. Utz. 2004. Protein 43. Balasubramani, A., C. J. Winstead, H. Turner, K. M. Janowski, S. N. Harbour, microarrays for multiplex analysis of signal transduction pathways. Nat. Med. Y. Shibata, G. E. Crawford, R. D. Hatton, and C. T. Weaver. 2014. Deletion of a 10: 1390–1396. conserved cis-element in the Ifng locus highlights the role of acute histone 22. Dunn, S. E., S. Youssef, M. J. Goldstein, T. Prod’homme, M. S. Weber, acetylation in modulating inducible gene transcription. PLoS Genet. 10: S. S. Zamvil, and L. Steinman. 2006. Isoprenoids determine Th1/Th2 fate in e1003969.

http://classic.jimmunol.org pathogenic T cells, providing a mechanism of modulation of autoimmunity by 44. Balasubramani, A., Y. Shibata, G. E. Crawford, A. S. Baldwin, R. D. Hatton, and atorvastatin. J. Exp. Med. 203: 401–412. C. T. Weaver. 2010. Modular utilization of distal cis-regulatory elements controls 23. Boneca, I. G., O. Dussurget, D. Cabanes, M.-A. Nahori, S. Sousa, M. Lecuit, Ifng gene expression in T cells activated by distinct stimuli. Immunity 33: 35–47. E. Psylinakis, V. Bouriotis, J.-P. Hugot, M. Giovannini, et al. 2007. A critical role 45. Collins, P. L., S. Chang, M. Henderson, M. Soutto, G. M. Davis, A. G. McLoed, for peptidoglycan N-deacetylation in Listeria evasion from the host innate im- M. J. Townsend, L. H. Glimcher, D. P. Mortlock, and T. M. Aune. 2010. Distal mune system. Proc. Natl. Acad. Sci. USA 104: 997–1002. regions of the human IFNG locus direct cell type-speciﬁc expression. J. 24. Cunard, R., M. Ricote, D. DiCampli, D. C. Archer, D. A. Kahn, C. K. Glass, and Immunol. 185: 1492–1501. C. J. Kelly. 2002. Regulation of cytokine expression by ligands of peroxisome 46. Ikeda, H., L. J. Old, and R. D. Schreiber. 2002. The roles of IFN gamma in proliferator activated receptors. J. Immunol. 168: 2795–2802. protection against tumor development and cancer immunoediting. Cytokine Downloaded from 25. Costet, P., C. Legendre, J. More´, A. Edgar, P. Galtier, and T. Pineau. 1998. Growth Factor Rev. 13: 95–109. Peroxisome proliferator-activated receptor alpha-isoform deﬁciency leads to 47. Miller, C. H. T., S. G. Maher, and H. A. Young. 2009. Clinical use of interferon-g. progressive dyslipidemia with sexually dimorphic obesity and steatosis. J. Biol. Ann. N. Y. Acad. Sci. 1182: 69–79. Chem. 273: 29577–29585. 48. Leonard, J. P., M. L. Sherman, G. L. Fisher, L. J. Buchanan, G. Larsen, 26. Yang, Q., Y. Xie, S. E. Alexson, B. D. Nelson, and J. W. DePierre. 2002. In- M. B. Atkins, J. A. Sosman, J. P. Dutcher, N. J. Vogelzang, and J. L. Ryan. 1997. volvement of the peroxisome proliferator-activated receptor alpha in the Effects of single-dose interleukin-12 exposure on interleukin-12-associated immunomodulation caused by peroxisome proliferators in mice. Biochem. toxicity and interferon-gamma production. Blood 90: 2541–2548. Pharmacol. 63: 1893–1900. 49. Lynch, R. A., J. Etchin, T. E. Battle, and D. A. Frank. 2007. A small-molecule 27. Suto, A., A. L. Wurster, S. L. Reiner, and M. J. Grusby. 2006. IL-21 inhibits IFN- enhancer of signal transducer and activator of transcription 1 transcriptional gamma production in developing Th1 cells through the repression of Eomeso- activity accentuates the antiproliferative effects of IFN-gamma in human cancer dermin expression. J. Immunol. 177: 3721–3727. cells. Cancer Res. 67: 1254–1261. SUPPLEMENTARY DATA

Supplemental Fig. 1. Titration of IS001 and the effect of this compound on CD4+ T cell proliferation and IFN-γ production. Total CD4+ T cells were isolated from male PPARα+/+ and PPARα-/- mice (N=5/group) and were pre-incubated with various concentrations of IS001 or DMSO vehicle (0.1% volume) prior to stimulation with anti-CD3 and anti-CD28. (A) The proliferation of T cells was measured between 72-90 h by [3H]-thymidine incorporation assay and is expressed in counts per minute (CPM). (B) IFNγ production was measured after 48 hours using an ELISA kit. Values represented are means +/- SEM of triplicate cultures and data are representative of 2-3 independent experiments. * indicates a significant difference from the vehicle-treated counterpart by two-tailed T- test (level of significance, P<0.05).

1 012 51030 Min. +/+ -/- +/+ -/- +/+ -/- +/+ -/- +/+ -/- +/+ -/-

Phospho-ZAP70

ZAP70

Phospho-ERK

ERK

Phospho-JNK

JNK

Phospho-p38

p38

IκBα

β-actin

Supplemental Fig. 2. PPARα-/- male CD4+ T cells do not exhibit a differential phosphorylation or abundance of key signaling intermediates downstream of TCR/CD28. Total CD4+ T cells isolated from male WT and PPARα-/- mice (N=6-8 mice/group) and were stimulated with anti-CD3 and anti- CD28. At the indicated times after stimulation, cells were lysed with 2 x lysis buffer and were boiled. Proteins were separated by SDS-PAGE and western blotting was performed using the indicated antibodies. β-actin was used as a loading control. These blots are representative of 2 independent experiments.

2.0

1.5

1.0

0.5

[IS001 in blood] (µM)

0.0 02468 15 20 25 Time post-gavage

Supplemental Fig. 3. Blood concentrations of IS001 after a single oral dose of IS001. IS001 was prepared as a 30 mg/kg suspension in 0.5% methylcellulose and was provided orally to two CD-1 mice. Blood was collected after 1, 2, 4, 6 and 24 h after gavage and the levels of IS001 were measured via mass spectrometry. The levels in the blood were below the level of detection (0.01 µM) by 24 h. Values are means + SEM of levels observed in the two mice.

Supplemental Table I: Primer sequences used for real-time RT-PCR and ChIP studies

Primer Names Sequences (5’-3’)

IFNγ FWD TGGCTCTGCAGGATTTTCATG

IFNγ REV TCAAGTGGCATAGATGTGGAAGAA

tbx21 FWD TGCCTGCAGTGCTTCTAACA

tbx21 REV TGCCCCGCTTCCTCTCCAACCAA

Eomes FWD TACGGCCAGGGTTCTCCGCTCTAC

Eomes REV GGGCCGGTTGCACAGGTAGACGTG

IL-4 FWD GAAGCCCTACAGACGAGCTCA

IL-4 REV ACAGGAGAAGGGACGCCAT

GATA-3 FWD AGGCAAGATGAGAAAGAGTGCCTC

GATA-3 REV CTCGACTTACATCCGAACCCGGTA

IL-17A FWD CTCCAGAAGGCCCTCAGACTA

IL-17A REV AGCTTTCCCTCCGCATTGACA

RORγT FWD ACCTCTTTTCACGGGAGGA

RORγT REV TCCCACATCTCCCACATTG

IL-12Rβ FWD TTGGACGGCATCAGTGTC

IL-12Rβ REV AGCAACCCAGTGCCACATAG

STAT-4 FWD TCTGCTCAAAGATAAAATGCCTG

STAT-4 REV TCCATTTTCAGATTGGTCCAC

STAT-1 FWD GGAGGTGAACCTGACTTCCA

STAT-1 REV TCTGGTGCTTCCTTTGGTCT

β-actin FWD GAACCCTAAGGCCAACCGT

β-actin REV CACGCACGATTTCCCTCTC

CNS-55 FWD GGCTTCCTGTCATTGTTTCCA

CNS-55 REV CAGAGCCATGGGATGACTGA

CNS-34 FWD GGTATGCATCATCCCGGG

CNS-34 REV TGGCCTGTCTTCAGAAGTTTGC

CNS-22 FWD CCAGGACAGAGGTGTTAAGCCA

CNS-22 REV GCAACTTCTTTCTTCTCAGGGTG

CNS-5 FWD TCTGAACGGGTGGAGGAGGT

CNS-5 REV GGTTGCGCTTTTCCCCTA

CNS-1 FWD CTAAGATGGTTCCCTGCCCA

CNS-1 REV CACTTGACATCTATCTATTCCTGCAGA

Ifng promoter FWD CGAGGAGCCTTCGATCAGGT

Ifng promoter FWD GGTCAGCCGATGGCAGCTA

CNS+17 FWD AGGATGCCCCGTGAGTCAC

CNS+17 REV CACTGGTTGAAAGTCACAGGAACT

PPARα FWD GAGAAGTTGCAGGAGGGGATTGTG

PPARα REV CCCATTTCGGTAGCAGGTAGTCTT

NCOR FWD TTCAGCCACCATTGCTAGGA

NCOR REV TCCTCCATCAGCCCATTCAT

The primer sequences used to amplify the ifng promoter and CNS sites were provided by Dr. Robin Hatton and Dr. Casey Weaver (University of Alabama Birmingham).