An Ets-Related Gene, ERG, Is Rearranged in Human

Total Page:16

File Type:pdf, Size:1020Kb

An Ets-Related Gene, ERG, Is Rearranged in Human Proc. Natl. Acad. Sci. USA Vol. 90, pp. 10280-10284, November 1993 Medical Sciences An ets-related gene, ERG, is rearranged in human myeloid leukemia with t(16;21) chromosomal translocation KIMIKO SHIMIZU*t, HITOSHI ICHIKAWA*t, ARINOBU Tojo§, YASUHIKO KANEKO¶, NOBUO MASEKIII, YASUHIDE HAYASHI**, MIKI OHIRA*t, SHIGETAKA ASANO§tt, AND MISAO OHKI*t *Department of Immunology and Virology, Saitama Cancer Center Research Institute, and lDepartment of Laboratory Medicine and IlHematology Clinic, Saitama Cancer Center Hospital, Ina, Saitama 362, Japan; §Department of Hematology and Oncology, Institute of Medical Science, University of Tokyo, Minato-ku, Tokyo 108, Japan; and **Department of Pediatrics and ttFourth Department of Internal Medicine, Faculty of Medicine, University of Tokyo, Bunkyo-ku, Tokyo 113, Japan Communicated by Takashi Sugimura, July 19, 1993 ABSTRACT The t(16;21)(pll;q22) translocation is a non- MATERIALS AND METHODS random chromosomal abnormality found in several types of myeloid leukemia, which show variable cytomorphological Leukemia Samples, Cel Lines, and DNA Markers. Periph- features. We constructed rodent-human somatic cell eral blood or bone marrow cells were obtained from five hybrids patients with t(16;2l)(pll;q22) at diagnosis or in relapse. The containing the der(16) chromosome from leukemic cells of a patients were diagnosed as having AML, Ml subtype (patient patient with t(16;21). Using these hybrids, we mapped the 1); AML, M2 subtype (patient 2); AML, Ml or M7 subtype translocation breakpoint on the Not I restriction map of (patient 3); or MDS that had evolved to AML (patients 4 and chromosome 21 which we had previously constructed. The 5). result showed the proximity ofthe breakpoint to theERG gene, The adenine phosphoribosyltransferase (APRT)-deficient a member of the ets oncogene superfamily. Polymerase chain rodent cell lines used for construction of somatic cell hybrids reaction and Southern blot analyses of genomic DNA from the were a derivative ofthe mouse mammary carcinoma cell line hybrids and from peripheral blood cells and bone marrow cells FM3A (Cior5) (9) and a derivative of the Chinese hamster of patients with t(16;21) showed that the breakpoints were ovary cell line CHO (D118) and were obtained from H. clustered within a single intron in the coding region oftheERG Koyama (Kihara Institute, Yokohama, Japan). Three human gene. This finding and the results obtained by Northern blot hematopoietic cell lines, Namalwa (Burkitt lymphoma), Ka- analysis suggested the formation of a chimeric product(s) by sumi-1 (AML) (10), and MOLT-4 (T-cell leukemia), were fusion of the ERG gene and an unknown counterpart gene on used as controls. The human-mouse somatic cell hybrid chromosome 16. WAV17, which contains human chromosome 21, and its mouse parent cell line A9 were also used. Chromosomal translocations are implicated as important The chromosome 21-specific Not I linking clones have events in the pathogenesis ofhematopoietic malignancies. By been described (11). These clones were divided by Not I analysis of translocation breakpoints, many protooncogenes digestion into two half linking fragments. The DNA markers involved in neoplastic processes have been isolated (1, 2). pVK20B (D16S96) (12), pCJ52.196Ml (D16S160) (13), SF21 The translocation is a nonrandom chromo- (D21S41), and SF85 (D21S46) (14) were also used. t(16;21)(pll;q22) Construction ofSomatic Cell Hybrids. Bone marrow cells (5 somal abnormality found in human myeloid leukemia. This x 106) from patient 1 were fused with Cior5 or D118 cells (2 translocation was first identified in acute nonlymphocytic x 106) by the use of polyethylene glycol. Hybrids were leukemia (3-5), and its association with chronic myeloid selected as APRT+ cells growing in ES medium (Nissui leukemia in the blast crisis was also reported (6). In addition, Seiyaku, Tokyo) containing 10 ,uM azaserine and 100 ,uM myelodysplastic syndrome (MDS) evolved to acute myeloid adenine and were cloned after 20 days of culture. Residual leukemia (AML) with the same translocation (Y.H., unpub- human chromosomes in these clones were examined by lished data). AML with t(16;21) has been classified into Southern blot analysis. various subtypes in the French-American-British classifica- Southern Blot Analysis. Genomic DNA was digested with tion because it shows diverse cytomorphological features. appropriate restriction enzymes, and the restriction frag- This diversity raises a possibility that the breakpoints in each ments were separated by electrophoresis and transferred to leukemia may be inconsistent. These breakpoints on chro- a nylon membrane (Hybond-N; Amersham) by standard mosome 21 are cytogenetically indistinguishable (3) from methods. For pulsed-field gel electrophoresis (PFGE), ge- those ofthe t(8;21)(q22;q22) translocation, which is one ofthe nomic DNA was prepared and digested in agarose and then most common abnormalities in AML. Previously, we isolated fractionated with a Bio-Rad apparatus (CHEF Mapper). a protooncogene, AMLI, which is located across the t(8;21) Hybridization and autoradiography were performed as de- breakpoint on chromosome 21 (7). However, the AMLI gene scribed (15). is not rearranged in the leukemic cells with t(16;21) (8). PCR Amplfication and Primers. PCR amplification from 1 To determine the exact location of the t(16;21) transloca- Mg of genomic DNA was carried out with 0.2 nmol of tion breakpoint and the gene(s) involved in the neoplastic oligonucleotide primers in 100 ,ul of the reaction mixture [10 process of the leukemia, we mapped and analyzed the mM Tris'HCl, pH 7.5/50 mM KCI/1.5 mM MgCl2/0.01% breakpoint region on chromosome 21. Here, we report that gelatine/0.2 mM 4 dNTPs containing 2 units of DNA poly- the ERG gene, a member ofthe ets oncogene superfamily, on chromosome 21, was rearranged by this translocation. Abbreviations: AML, acute myeloid leukemia; APRT, adenine phos- phoribosyltransferase; MDS, myelodysplastic syndrome; PFGE, pulsed-field gel electrophoresis. The publication costs ofthis article were defrayed in part by page charge tPresent address: Radiobiology Division, National Cancer Center payment. This article must therefore be hereby marked "advertisement" Research Institute, Chuo-ku, Tokyo 104, Japan. in accordance with 18 U.S.C. §1734 solely to indicate this fact. *To whom reprint requests should be sent at the present address. 10280 Downloaded by guest on October 2, 2021 Medical Sciences: Shimizu et al. Proc. Natl. Acad. Sci. USA 90 (1993) 10281 merase (AmpliTaq; Perkin-Elmer)] by 30 cycles of denatur- cell hybrids between rodent cells and leukemic cells. Mouse ation at 95°C for 1 min, annealing at 60°C for 2 min, and APRT- cells (FM3A CiorS) were fused with bone marrow extension at 72°C for 3 min with a Perkin-Elmer thermal cells of one patient (patient 1) and selected in medium cycler. For reverse transcription-PCR, cDNA was synthe- containing azaserine and adenine. This selection resulted in sized from 1 ug of poly(A)+ RNA in 20 Al of the reaction enrichment ofhybrid cells retaining a normal chromosome 16 mixture [10 mM Tris HCl, pH 8.3/75 mM KCl/3 mM or der(16) chromosome as APRT+ clones, since the human MgCl2/1 mM dithiothreitol/l mM each dNTP containing 10 APRT gene is located at 16q24. Residual human chromo- units of RNasin (Promega), 25 pmol of random hexamer somes in the resulting eight APRT+ clones were examined by (Pharmacia), and 200 units of reverse transcriptase (Super- Southern blot analysis using chromosome 16 or 21-specific Script RNase H-; GIBCO/BRL)] at room temperature for 10 probes for D16S160 (16pl3), D16S96 (16q21-q22), D21S46 min and then at 37°C for 1 hr. One-tenth ofthe cDNA product (21qll-q21), and D21S41 (21q22.3) loci. Two of the eight was used for PCR amplification by 30 cycles of denaturation APRT+ clones retained D16S96 and D21S41 loci but had lost at 95°C for 20 sec, annealing at 60°C for 30 sec, and extension D16S160 and D21S46 loci, indicating that they harbored the at 72°C for 1 min. The amplified products were analyzed by der(16) chromosome but not normal chromosome 16, normal electrophoresis in 3% NuSieve 3:1 agarose (FMC Bioprod- chromosome 21, or der(21) chromosome. These two clones ucts) gel. For use as hybridization probes, the PCR products (NSC532 and NSC533) were used for subsequent analyses. were purified from the agarose gel. By using Chinese hamster APRT- cells (CHO D118), two The primers for the D2JS55 locus (pPW518-1R) were more somatic cell hybrids (NSD122 and NSD130), which also described by Tanzi et al. (16). The sequences of the primers harbored only the der(16) chromosome among the four rel- for the ETS2 and ERG genes were designed according to the evant chromosomes, were constructed similarly. known sequences (17, 18) as follows: ETS2F, 5'-TTCT- Mapping of the t(16;21) Translocation Breakpoint on Chro- CAGGGCTGTGCAAGTA-3'; ETS2R, 5'-CATGGTGAC- mosome 21. We have constructed a complete Not I restriction TCTAGGTCTAG-3'; ERGa, 5'-GGCCAAAGGCGGGAA- map of the long arm of human chromosome 21 by using Not GATGG-3'; ERGb, 5'-AGCGTAGGATCTGCTGGCAC-3'; I linking clones (11). Use of these Not I linking clones ERGc, 5'-CATGCATTAACCGTGGAGAG-3'; ERGd, 5'- together with the somatic cell hybrids provides a simple CCATCAGCGTGCATTCACCA-3'; ERGe, 5'-GCAT- system for mapping the t(16;21) translocation breakpoint. It GAACCCTCGAGTCTCC-3'; ERGf, 5'-CTGCAGTTA- can be mapped on the Not I restriction map by Southern blot GAGGCTCACTG-3'; ERGg, 5'-CAGCTCCTGAGCTG- analysis using the Not I linking clones as probes to examine TAGCCA-3'. the presence or absence of Not I sites in genomic DNA from Northern Blot Analysis. Total RNA of cultured cells and these hybrids. This analysis showed that the Not I sites of peripheral blood cells was isolated by the acid guanidinium linking clones LL46LP, LJ105, and LL42SP were present on thiocyanate/phenol/chloroform method (19).
Recommended publications
  • GCAT|Panel, a Comprehensive Structural Variant Haplotype Map of the Iberian Population from High-Coverage Whole-Genome Sequencing
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.20.453041; this version posted July 21, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. GCAT|Panel, a comprehensive structural variant haplotype map of the Iberian population from high-coverage whole-genome sequencing Jordi Valls-Margarit1,#, Iván Galván-Femenía2,3,#, Daniel Matías-Sánchez1,#, Natalia Blay2, Montserrat Puiggròs1, Anna Carreras2, Cecilia Salvoro1, Beatriz Cortés2, Ramon Amela1, Xavier Farre2, Jon Lerga- Jaso4, Marta Puig4, Jose Francisco Sánchez-Herrero5, Victor Moreno6,7,8,9, Manuel Perucho10,11, Lauro Sumoy5, Lluís Armengol12, Olivier Delaneau13,14, Mario Cáceres4,15, Rafael de Cid2,*,† & David Torrents1,15,* 1. Life sciences dept, Barcelona Supercomputing Center (BSC), Barcelona, 08034, Spain. 2. Genomes for Life-GCAT lab Group, Institute for Health Science Research Germans Trias i Pujol (IGTP), Badalona, 08916, Spain. 3. Institute for Research in Biomedicine (IRB Barcelona), The Barcelona Institute of Science and Technology, 08028, Barcelona, Spain (current affiliation). 4. Institut de Biotecnologia i de Biomedicina, Universitat Autònoma de Barcelona, Bellaterra, Barcelona, 08193, Spain. 5. High Content Genomics and Bioinformatics Unit, Institute for Health Science Research Germans Trias i Pujol (IGTP), 08916, Badalona, Spain. 6. Catalan Institute of Oncology, Hospitalet del Llobregat, 08908, Spain. 7. Bellvitge Biomedical Research Institute (IDIBELL), Hospitalet del Llobregat, 08908, Spain. 8. CIBER Epidemiología y Salud Pública (CIBERESP), Madrid, 28029, Spain. 9. Universitat de Barcelona (UB), Barcelona, 08007, Spain.
    [Show full text]
  • GCAT (NM 014291) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG204870 GCAT (NM_014291) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: GCAT (NM_014291) Human Tagged ORF Clone Tag: TurboGFP Symbol: GCAT Synonyms: KBL Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG204870 representing NM_014291 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGGCCTGGGAACGCCTGGCGCGCCGCACTCTTCTGGGTGCCCCGCGGCCGCCGCGCACAGTCAGCGC TGGCCCAGCTGCGTGGCATTCTGGAGGGGGAGCTGGAAGGCATCTGCGGAGCTGGCACTTGGAAGAGTGA GCGGGTCATCACGTCCCGTCAGGGGCCGCACATCCGCGTGGACGGCGTCTCCGGAGGAATCCTTAACTTC TGTGCCAACAACTACCTGGGCCTGAGCAGCCACCCTGAGGTGATCCAGGCAGGTCTGCAGGCTCTGGAGG AGTTTGGAGCTGGCCTCAGCTCTGTCCGCTTTATCTGTGGAACCCAGAGCATCCACAAGAATCTAGAAGC AAAAATAGCCCGCTTCCACCAGCGGGAGGATGCCATCCTCTATCCCAGCTGTTATGACGCCAACGCCGGC CTCTTTGAGGCCCTGCTGACCCCAGAGGACGCAGTCCTGTCGGACGAGCTGAACCATGCCTCCATCATCG ACGGCATCCGGCTGTGCAAGGCCCACAAGTACCGCTATCGCCACCTGGACATGGCCGACCTAGAAGCCAA GCTGCAGGAGGCCCAGAAGCATCGGCTGCGCCTGGTGGCCACTGATGGGGCCTTTTCCATGGATGGCGAC ATCGCACCCCTGCAGGAGATCTGCTGCCTCGCCTCTAGATATGGTGCCCTGGTCTTCATGGATGAATGCC ATGCCACTGGCTTCCTGGGGCCCACAGGACGGGGCACAGATGAGCTGCTGGGTGTGATGGACCAGGTCAC CATCATCAACTCCACCCTGGGGAAGGCCCTGGGTGGAGCATCAGGGGGCTACACGACAGGGCCTGGGCCC CTGGTGTCCCTGCTGCGGCAGCGCGCCCGGCCATACCTCTTCTCCAACAGTCTGCCACCTGCTGTCGTTG
    [Show full text]
  • Epigenetic Regulation of the Nuclear-Coded GCAT and SHMT2
    www.nature.com/scientificreports OPEN Epigenetic regulation of the nuclear-coded GCAT and SHMT2 genes confers human Received: 29 October 2014 Accepted: 14 April 2015 age-associated mitochondrial Published: 22 May 2015 respiration defects Osamu Hashizume1,*, Sakiko Ohnishi1,*, Takayuki Mito1,*, Akinori Shimizu1, Kaori Ishikawa1, Kazuto Nakada1,2, Manabu Soda3, Hiroyuki Mano3, Sumie Togayachi4, Hiroyuki Miyoshi4,5, Keisuke Okita6 & Jun-Ichi Hayashi1,2,7 Age-associated accumulation of somatic mutations in mitochondrial DNA (mtDNA) has been proposed to be responsible for the age-associated mitochondrial respiration defects found in elderly human subjects. We carried out reprogramming of human fibroblast lines derived from elderly subjects by generating their induced pluripotent stem cells (iPSCs), and examined another possibility, namely that these aging phenotypes are controlled not by mutations but by epigenetic regulation. Here, we show that reprogramming of elderly fibroblasts restores age-associated mitochondrial respiration defects, indicating that these aging phenotypes are reversible and are similar to differentiation phenotypes in that both are controlled by epigenetic regulation, not by mutations in either the nuclear or the mitochondrial genome. Microarray screening revealed that epigenetic downregulation of the nuclear-coded GCAT gene, which is involved in glycine production in mitochondria, is partly responsible for these aging phenotypes. Treatment of elderly fibroblasts with glycine effectively prevented the expression of these
    [Show full text]
  • AKB Ligase / GCAT (22-419, His-Tag) Human Protein – AR50906PU-S
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for AR50906PU-S AKB ligase / GCAT (22-419, His-tag) Human Protein Product data: Product Type: Recombinant Proteins Description: AKB ligase / GCAT (22-419, His-tag) human recombinant protein, 0.1 mg Species: Human Expression Host: E. coli Tag: His-tag Predicted MW: 45.0 kDa Concentration: lot specific Purity: >85% by SDS - PAGE Buffer: Presentation State: Purified State: Liquid purified protein Buffer System: 20 mM Tris-HCl buffer (pH 8.0) containing 0.4M urea, 10% glycerol Preparation: Liquid purified protein Protein Description: Recombinant human GCAT protein, fused to His-tag at N-terminus, was expressed in E.coli. Storage: Store undiluted at 2-8°C for one week or (in aliquots) at -20°C to -80°C for longer. Avoid repeated freezing and thawing. Stability: Shelf life: one year from despatch. RefSeq: NP_001165161 Locus ID: 23464 UniProt ID: O75600 Cytogenetics: 22q13.1 Synonyms: KBL This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 AKB ligase / GCAT (22-419, His-tag) Human Protein – AR50906PU-S Summary: The degradation of L-threonine to glycine consists of a two-step biochemical pathway involving the enzymes L-threonine dehydrogenase and 2-amino-3-ketobutyrate coenzyme A ligase. L-Threonine is first converted into 2-amino-3-ketobutyrate by L-threonine dehydrogenase.
    [Show full text]
  • Annotate’ April 4, 2014
    Package ‘annotate’ April 4, 2014 Title Annotation for microarrays Version 1.40.1 Author R. Gentleman Description Using R enviroments for annotation. Maintainer Bioconductor Package Maintainer <[email protected]> Depends R (>= 2.10), AnnotationDbi (>= 0.1.15) Imports Biobase, AnnotationDbi, DBI, xtable, graphics, utils, stats,methods, XML (>= 0.92- 2), BiocGenerics (>= 0.1.13) Suggests Biobase, hgu95av2.db, genefilter, Biostrings (>= 2.25.10),rae230a.db, rae230aprobe, tkWid- gets, GO.db, org.Hs.eg.db, XML (>= 0.92-2), org.Mm.eg.db, hom.Hs.inp.db, humanCHRLOC,Rgraphviz, RUnit, License Artistic-2.0 LazyLoad yes Collate AllGenerics.R ACCNUMStats.R Amat.R AnnMaps.R chromLocation.R compatipleVersions.R findNeighbors.R getData.R getPMInfo.R getSeq4ACC.R GOhelpers.R homoData.R html.R isValidKey.R LL2homology.R pmid2MIAME.R probesByLL.R pubMedAbst.R query.R readGEOAnn.R serializeEnv.R blastSequences.R zzz.R test_annotate_package.R biocViews Annotation, Pathways, GO R topics documented: accessionToUID . .3 ACCNUMStats . .4 annotate-defunct . .5 annPkgName . .5 aqListGOIDs . .6 blastSequences . .7 1 2 R topics documented: buildChromLocation . .8 buildPubMedAbst . .9 chrCats . 10 chromLocation-class . 12 compatibleVersions . 13 dropECode . 14 entrezGeneByID . 15 entrezGeneQuery . 16 filterGOByOntology . 17 findNeighbors . 18 genbank . 20 getAnnMap . 21 getEvidence . 22 getGOTerm . 23 getOntology . 24 getPMInfo . 25 getQueryLink . 26 getSEQ . 27 getSYMBOL . 28 GO2heatmap . 30 GOmnplot . 31 hasGOannote . 32 hgByChroms . 33 hgCLengths . 33 hgu95Achroloc . 34 hgu95Achrom . 34 hgu95All . 35 hgu95AProbLocs . 36 hgu95Asym . 36 homoData-class . 37 htmlpage . 38 HTMLPage-class . 40 isValidKey . 41 LL2homology . 42 makeAnchor . 44 mapOrgs . 44 organism . 45 p2LL ............................................ 46 pm.abstGrep . 47 pm.getabst . 48 pm.titles . 49 pmAbst2HTML . 50 pmid2MIAME .
    [Show full text]
  • Saccharomyces Cerevisiae LIF1: a Function Involved in DNA Double-Strand Break Repair Related to Mammalian XRCC4
    The EMBO Journal Vol.17 No.14 pp.4188–4198, 1998 Saccharomyces cerevisiae LIF1: a function involved in DNA double-strand break repair related to mammalian XRCC4 Gernot Herrmann, Tomas Lindahl1 and Human XRCC4 was identified by its ability to comple- Primo Scha¨ r2 ment radiation sensitivity and a deficiency in V(D)J recombination of hamster XR-1 cells, which have been Imperial Cancer Research Fund, Clare Hall Laboratories, South shown to lack both alleles of the XRCC4 gene (Stamato 2 Mimms, Hertfordshire EN6 3LD, UK and Institute of Medical et al., 1983; Li et al., 1995). The XRCC4 gene encodes a Radiobiology, University of Zu¨rich, CH-8029 Zu¨rich, Switzerland polypeptide with a predicted molecular mass of 38 kDa 1 Corresponding author which occurs as a phosphoprotein and migrates at ~55 kDa e-mail: [email protected] on SDS–PAGE (Critchlow et al., 1997; Grawunder et al., 1997; Mizuta et al., 1997). XRCC4 appears to be conserved Saccharomyces cerevisiae DNA ligase IV (LIG4) has in mammals, with human and mouse sequences sharing been shown previously to be involved in non-homo- ~75% identity, but homologues have not been detected in logous DNA end joining and meiosis. The homologous other eukaryotes. Recently, XRCC4 was shown to interact mammalian DNA ligase IV interacts with XRCC4, a with the C-terminal region of human DNA ligase IV and protein implicated in V(D)J recombination and double- strand break repair. Here, we report the discovery of to stimulate double-strand break joining efficiency of this LIF1, a S.cerevisiae protein that strongly interacts with enzyme in vitro (Critchlow et al., 1997; Grawunder et al., the C-terminal BRCT domain of yeast LIG4.
    [Show full text]
  • Oakland Hosts DOE Genome Program Contractor-Grantee Meeting
    LOGY P BIO H YS IC Y S R T S I E T M H E I H C C S E N S G IC IN T E A ER RM ING INFO ISSN: 1050–6101, Issue No. 45 Vol. 10, Nos. 3–4, October 1999 In This Issue HGP Leaders Confirm Accelerated DOE ’99 Oakland Highlights Timetable for Draft Sequence New Sequencing Resources Aid Effort DOE Genome Program Contractors and Grantees Present Progress at the Seventh n September, international leaders be closed and accuracy improved over Meeting, held in January 1999. Iof Human Genome Project (HGP) the following 3 years to achieve a com- Reported by Denise Casey, HGMIS sequencing confirmed a plan to com- plete, high-quality human DNA refer- Introduction ........................1 plete a rough draft of the human ence sequence by 2003 [see HGN Reports on Progress, Challenges .......3 genome by next spring, a year ahead 10(1–2), 1 (www.ornl.gov/hgmis/ Joint Genome Institute .............3 of schedule. This accelerated pace is Sequencing at Other Institutions ......4 publicat/hgn/v10n1/01goals.html)]. So Functional Genomics ..............6 made possible by the commercializa- far, about 13% of human sequence has Informatics.......................8 tion of a new generation of automated been finished, and another 12% is Education and Bioethics ............9 capillary DNA sequencing machines available in draft form (genome.ornl. Microbial Genome Explorations ......9 and by BAC mapping resources gener- gov/GCat; www.ncbi.nlm.nih.gov/ Genome Project ated from DOE-sponsored clone genome/seq). HGP Accelerated Timetable ...........1 projects. HGP Sequencing Progress .........2 Sequencing Allocation Refitting at JGI’s Sequencing Facility .
    [Show full text]
  • Human AKB Ligase / GCAT (22-419, His-Tag) - Purified
    OriGene Technologies, Inc. OriGene Technologies GmbH 9620 Medical Center Drive, Ste 200 Schillerstr. 5 Rockville, MD 20850 32052 Herford UNITED STATES GERMANY Phone: +1-888-267-4436 Phone: +49-5221-34606-0 Fax: +1-301-340-8606 Fax: +49-5221-34606-11 [email protected] [email protected] AR50906PU-N Human AKB ligase / GCAT (22-419, His-tag) - Purified Alternate names: 2-amino-3-ketobutyrate coenzyme A ligase, Aminoacetone synthetase, Glycine acetyltransferase, KBL Quantity: 0.5 mg Concentration: 1 mg/ml (determined by Bradford assay) Background: The degradation of L-threonine to glycine consists of a two-step biochemical pathway involving the enzymes L-threonine dehydrogenase and 2-amino-3-ketobutyrate coenzyme A ligase. L-Threonine is first converted into 2-amino-3-ketobutyrate by L- threonine dehydrogenase. GCAT is the second enzyme in this pathway, which then catalyzes the reaction between 2-amino-3-ketobutyrate and coenzyme A to form glycine and acetyl-CoA. The enzyme is considered a class II pyridoxal-phosphate- dependent aminotransferase. Uniprot ID: O75600 NCBI: NP_055106 GeneID: 23464 Species: Human Source: E. coli Format: State: Liquid purified protein Purity: >85% by SDS - PAGE Buffer System: 20 mM Tris-HCl buffer (pH 8.0) containing 0.4M urea, 10% glycerol Description: Recombinant human GCAT protein, fused to His-tag at N-terminus, was expressed in E.coli. AA Sequence: MGSSHHHHHH SSGLVPRGSH MSALAQLRGI LEGELEGIRG AGTWKSERVI TSRQGPHIRV DGVSGGILNF CANNYLGLSS HPEVIQAGLQ ALEEFGAGLS SVRFICGTQS IHKNLEAKIA RFHQREDAIL YPSCYDANAG LFEALLTPED AVLSDELNHA SIIDGIRLCK AHKYRYRHLD MADLEAKLQE AQKHRLRLVA TDGAFSMDGD IAPLQEICCL ASRYGALVFM DECHATGFLG PTGRGTDELL GVMDQVTIIN STLGKALGGA SGGYTTGPGP LVSLLRQRAR PYLFSNSLPP AVVGCASKAL DLLMGSNTIV QSMAAKTQRF RSKMEAAGFT ISGASHPICP VMLGDARLAS RMADDMLKRG IFVIGFSYPV VPKGKARIRV QISAVHSEED IDRCVEAFVE VGRLHGALP Molecular weight: 45.0 kDa (419aa) Storage: Store undiluted at 2-8°C for one week or (in aliquots) at -20°C to -80°C for longer.
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • (Sinipercidae) Genomes Provide Insights Into Innate Predatory Feeding
    ARTICLE https://doi.org/10.1038/s42003-020-1094-y OPEN Mandarin fish (Sinipercidae) genomes provide insights into innate predatory feeding Shan He1,2,6, Ling Li1,2,3,6, Li-Yuan Lv1,2,6, Wen-Jing Cai1,2, Ya-Qi Dou1,2, Jiao Li1,2, Shu-Lin Tang1,2, Xu Chen1,2, ✉ Zhen Zhang1,2, Jing Xu1,2, Yan-Peng Zhang1,2, Zhan Yin4, Sven Wuertz3, Ya-Xiong Tao5, Heiner Kuhl3 & ✉ Xu-Fang Liang1,2 1234567890():,; Mandarin fishes (Sinipercidae) are piscivores that feed solely on live fry. Unlike higher ver- tebrates, teleosts exhibit feeding behavior driven mainly by genetic responses, with no modification by learning from parents. Mandarin fishes could serve as excellent model organisms for studying feeding behavior. We report a long-read, chromosomal-scale genome assembly for Siniperca chuatsi and genome assemblies for Siniperca kneri, Siniperca scherzeri and Coreoperca whiteheadi. Positive selection analysis revealed rapid adaptive evolution of genes related to predatory feeding/aggression, growth, pyloric caeca and euryhalinity. Very few gill rakers are observed in mandarin fishes; analogously, we found that zebrafish deficient in edar had a gill raker loss phenotype and a more predatory habit, with reduced intake of zooplankton but increased intake of prey fish. Higher expression of bmp4, which could inhibit edar expression and gill raker development through binding of a Xvent-1 site upstream of edar, may cause predatory feeding in Siniperca. 1 College of Fisheries, Chinese Perch Research Center, Huazhong Agricultural University, Wuhan, China. 2 Innovation Base for Chinese Perch Breeding, Key Laboratory of Freshwater Animal Breeding, Ministry of Agriculture, Wuhan, China.
    [Show full text]
  • Mice Deficient in the Shmt2 Gene Have Mitochondrial Respiration Defects
    www.nature.com/scientificreports OPEN Mice defcient in the Shmt2 gene have mitochondrial respiration defects and are embryonic lethal Received: 15 August 2017 Haruna Tani1, Sakiko Ohnishi1, Hiroshi Shitara1,2, Takayuki Mito3, Midori Yamaguchi2, Accepted: 12 December 2017 Hiromichi Yonekawa2, Osamu Hashizume3, Kaori Ishikawa1,3, Kazuto Nakada1,3 & Published: xx xx xxxx Jun-Ichi Hayashi4 Accumulation of somatic mutations in mitochondrial DNA (mtDNA) has been proposed to be responsible for human aging and age-associated mitochondrial respiration defects. However, our previous fndings suggested an alternative hypothesis of human aging—that epigenetic changes but not mutations regulate age-associated mitochondrial respiration defects, and that epigenetic downregulation of nuclear-coded genes responsible for mitochondrial translation [e.g., glycine C-acetyltransferase (GCAT), serine hydroxymethyltransferase 2 (SHMT2)] is related to age-associated respiration defects. To examine our hypothesis, here we generated mice defcient in Gcat or Shmt2 and investigated whether they have respiration defects and premature aging phenotypes. Gcat-defcient mice showed no macroscopic abnormalities including premature aging phenotypes for up to 9 months after birth. In contrast, Shmt2-defcient mice showed embryonic lethality after 13.5 days post coitum (dpc), and fbroblasts obtained from 12.5-dpc Shmt2-defcient embryos had respiration defects and retardation of cell growth. Because Shmt2 substantially controls production of N-formylmethionine- tRNA (fMet-tRNA) in mitochondria, its suppression would reduce mitochondrial translation, resulting in expression of the respiration defects in fbroblasts from Shmt2-defcient embryos. These fndings support our hypothesis that age-associated respiration defects in fbroblasts of elderly humans are caused not by mtDNA mutations but by epigenetic regulation of nuclear genes including SHMT2.
    [Show full text]
  • Physiological Functions of Threonine in Animals: Beyond Nutrition Metabolism
    nutrients Review Physiological Functions of Threonine in Animals: Beyond Nutrition Metabolism Qi Tang, Peng Tan, Ning Ma and Xi Ma * State Key Laboratory of Animal Nutrition, College of Animal Science and Technology, China Agricultural University, Beijing 100193, China; [email protected] (Q.T.); [email protected] (P.T.); [email protected] (N.M.) * Correspondence: [email protected] Abstract: Threonine (Thr), an essential amino acid for animals and the limiting amino acid in swine and poultry diets, which plays a vital role in the modulation of nutritional metabolism, macromolec- ular biosynthesis, and gut homeostasis. Current evidence supports that the supplementation of Thr leads to benefits in terms of energy metabolism. Threonine is not only an important component of gastrointestinal mucin, but also acts as a nutritional modulator that influences the intestinal immune system via complex signaling networks, particularly mitogen-activated protein kinase (MAPK) and the target of the rapamycin (TOR) signal pathway. Threonine is also recognized as an indispensable nutrient for cell growth and proliferation. Hence, optimization of Thr requirement may exert a favorable impact on the factors linked to health and diseases in animals. This review focuses on the latest reports of Thr in metabolic pathways and nutritional regulation, as well as the relationship between Thr and relevant physiological functions. Keywords: threonine; metabolism; physiological effects; nutrition; intestinal health Citation: Tang, Q.; Tan, P.; Ma, N.; Ma, X. Physiological Functions of Threonine in Animals: Beyond 1. Introduction Nutrition Metabolism. Nutrients 2021, Threonine (Thr), otherwise known as α-amino-β-hydroxybutyric acid, is an indispens- 13, 2592. https://doi.org/10.3390/ able amino acid in animals that must be obtained from the diet [1].
    [Show full text]