DOCSLIB.ORG

Oakland Hosts DOE Genome Program Contractor-Grantee Meeting

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Oakland Hosts DOE Genome Program Contractor-Grantee Meeting LOGY P BIO H YS IC Y S R T S I E T M H E I H C C S E N S G IC IN T E A ER RM ING INFO ISSN: 1050–6101, Issue No. 45 Vol. 10, Nos. 3–4, October 1999 In This Issue HGP Leaders Confirm Accelerated DOE ’99 Oakland Highlights Timetable for Draft Sequence New Sequencing Resources Aid Effort DOE Genome Program Contractors and Grantees Present Progress at the Seventh n September, international leaders be closed and accuracy improved over Meeting, held in January 1999. Iof Human Genome Project (HGP) the following 3 years to achieve a com- Reported by Denise Casey, HGMIS sequencing confirmed a plan to com- plete, high-quality human DNA refer- Introduction ........................1 plete a rough draft of the human ence sequence by 2003 [see HGN Reports on Progress, Challenges .......3 genome by next spring, a year ahead 10(1–2), 1 (www.ornl.gov/hgmis/ Joint Genome Institute .............3 of schedule. This accelerated pace is Sequencing at Other Institutions ......4 publicat/hgn/v10n1/01goals.html)]. So Functional Genomics ..............6 made possible by the commercializa- far, about 13% of human sequence has Informatics.......................8 tion of a new generation of automated been finished, and another 12% is Education and Bioethics ............9 capillary DNA sequencing machines available in draft form (genome.ornl. Microbial Genome Explorations ......9 and by BAC mapping resources gener- gov/GCat; www.ncbi.nlm.nih.gov/ Genome Project ated from DOE-sponsored clone genome/seq). HGP Accelerated Timetable ...........1 projects. HGP Sequencing Progress .........2 Sequencing Allocation Refitting at JGI’s Sequencing Facility . 2 The rough draft will provide a scaffold DOE 2000 Santa Fe Meeting .........10 of sequence across about 90% of the About 60% of the draft sequence will human genome. Remaining gaps will be produced by six major NIH-funded Other Topics (see HGP Timetable, p. 2) In the News Chromosomes 21, 22 Sequence........7 Drosophila Sequence ...............10 Oakland Hosts DOE Genome Program DOE DOE Award Winners ...............11 Human MHC Sequence .............11 Contractor-Grantee Meeting ’99 99 New Mouse Probes .................11 nthusiasm ran high for the DOE sequencing, which remains the major Genetic Testing Advisory Committee ....11 Bioengineering at National Laboratories . .12 EHuman Genome Program (HGP) task facing the HGP today. An over- Public SNP Resource ...............13 in response to impressive gains view of JGI progress begins on p. 3. reported at the Seventh DOE SBIR 1999 Human Genome Awards....13 Investigators representing other HGP- HUGO: London Office, Editors .......15 Contractor-Grantee meeting in Janu- funded projects reported that exciting 1999 Hollaender Winners ............19 ary of this year. Convened every 12 to Protecting Privacy in Research .......19 improvements in mapping and 18 months, this workshop provides an sequencing technologies resulted in Microbial Genomics effective forum for all DOE HGP EcoCyc Database for E. coli ..........14 higher throughput. New approaches to investigators and invited guests to regulating gene expression are helping Microbial Genome News, Resources ...14 discuss their research, initiate col- ELSI News to assess whole-cell effects that are key laborations, and share new material to functional genomics. Attendees Education and Counseling Foundation . 16 resources and software ELSI Resourses ...................16 Meeting ’99 also discussed the applica- capabilities. tion of genome sequencing Informatics Although traditionally Highlights Begin Mouse Genome Informatics 2.2 .......16 information to real-life MRC’s Staden Package .............17 held in Santa Fe, New on p. 3 problems in medicine and Other Resources ..................17 Mexico, the 1999 meeting waste cleanup. DOE is con- was moved to Oakland, California, tinuing activities to educate the gen- Web, Other Resources ...........17,19 so attendees could visit the new Pro- eral public about the HGP and its Calendars .......................18 duction Sequencing Facility of DOE’s societal impact. Researchers in the Funding.........................19 Joint Genome Institute (JGI) in Microbial Genome Program, a spinoff Subscriptions, Acronyms ..........20 nearby Walnut Creek. Two years ago, of HGP, reported impressive gains in JGI began operations under the direc- whole-genome sequencing and analy- HGP Sequencing Progress: p. 2 tion of Elbert Branscomb to address sis, proteomics, and comparative February 2000 Santa Fe Meeting: p. 10 the challenge of high-throughput genomics. Human Genome News issues are placed on the Web soon after going to press. Archived issues are also online. 2 Human Genome News 10(3–4) October 1999 HGP Timetable (from p. 1) sequencing centers, including those Megabase previously established at Washington HGP Sequencing Pairs (Mbp) University, St. Louis; MIT-Whitehead Progress* Institute; and Baylor College of Medi- 3500 cine. In July, laboratories at the Uni- raph at right depicts versity of Washington, Seattle; Gprogress toward generat- 3150 ing a working draft of the Genome Therapeutics Corp.; and 2800 Stanford University joined the NIH human genome by spring 2000 and a complete, high- 2450 production sequencing effort. quality reference human The DOE-funded Joint Genome Insti- DNA sequence by 2003. 2100 tute (JGI) and the Sanger Center Sequences from roughly one- quarter of the human genome 1750 (United Kingdom) will generate about have been deposited into Gen- 10% and 30%, respectively, of the draft Bank (www.ncbi.nlm.nih.gov/ 1400 sequence. (See box, below right, for Genbank), and several indi- details on JGI sequencing.) France, vidual chromosomes are 1050 Germany, and Japan are contributing expected to be completed 700 significant amounts of human before the end of this year. sequence, and China recently joined For updates on HGP sequenc- 350 the worldwide project. To avoid dupli- ing, see Web site (www.ornl. cated work, each laboratory focuses gov/hgmis/project/progress. html). on particular genomic regions (see 379.7 Mbp 426.8 Mbp Human Genome Sequencing Index, *Totals as of September 17, 1999 www.ncbi.nlm.nih.gov/HUGO). Sequencing group members reaffirmed the policy of placing all sequence in JGI Refits Production publicly accessible databases within 24 hours of obtaining a continuous Sequencing Facility 1000- to 2000-base assembly. They ccelerated goals are challeng- also agreed that sequencing should Aing the major Human Genome continue to be based on a proven Project sequencing centers to strategy using BAC clones containing restructure and streamline their DNA from known genomic locations. processes. The Joint Genome Institute (JGI) Production BAC-End Sequences: Sequencing Facility is using 84 Prime Resource new high-throughput MegaBACE DNA sequencing machines acquired from Amersham Pharmacia Biotech. These machines use multiple thin Data from the DOE-funded BAC-end “capillary” tubes instead of large flat gels to separate and “read” the DNA sequencing projects at The Institute sequence. The technology was developed largely with funding from the for Genome Research (TIGR) and the DOE Human Genome Program and licensed to AP Biotech. University of Washington, Seattle (UWS), are critical for achieving the JGI’s current sequencing targets are human chromosomes 5, 16, and 19, new HGP goals. These projects are which together contain about 300 Mb of DNA or about 10% of the entire generating single-sequence reads human genome. Sequencing director Trevor Hawkins reports that as of Sep- from both ends of the human DNA tember 20, JGI had produced 31.2 Mb of finished sequence and about 41 Mb insert in 450,000 BAC clones [HGN of draft sequence (see “HGP Sequencing Progress” box, above). The Genome 10(1–2), 4 (www.ornl.gov/hgmis/ Annotation Consortium is joining with JGI for sequence analysis (see p. 8 publicat/hgn/v10n1/04bacend.html) for details), and Stanford University will be part of the finishing effort.◊ and BAC Web page (www.ornl.gov/ meetings/bacpac)]. valuable tools for eliminating redun- every 3000 to 4000 bases across the In March, DOE increased its support dant sequencing. They can direct entire human genome, a 100-fold of BAC-end sequencing projects to researchers to particular BAC clones improvement over other current accelerate their completion and useful- needed for extending a sequenced human genome maps. Detailed data on ness for guiding production sequenc- region along the chromosome and can BACs are available at TIGR ing. The BAC-end sequences, called identify clones representing genomic (www.tigr.org/tdb/humgen/bac_end_ sequence tag connectors (STCs), are regions still not sequenced. STCs also search/bac_end_intro.html) and UWS can provide quality checks on (www.htsc.washington.edu). The STC sequence assemblies and are useful data resource is complemented by sev- n DOE: $ 89.8M for spanning regions resisting stan- eral other types of mapping informa- FY 1999 HGP n NIH: $ 225.7M dard sequencing biochemistry. tion, including FISH mapping of BAC Budgets clones.◊ n Total: $315.5M STC data will furnish researchers with markers spaced on average October 1999 Human Genome News 10(3–4) 3 DOE DOE Genome Meeting Highlights 99 HGP Grantees Report Progress, Challenges ome 360 researchers, program managers, and invited guests gathered in SCalifornia on January 12–16 for the DOE Human Genome Program work- DOE Sets Next shop. Plenary presentations and posters described a wide spectrum of accom- Genome Meeting plishments and activities, highlights of which are reported below.
Load more

Recommended publications
  • University of Maryland Establishes Center for Health Related Informatics and Bioimaging
    University of Maryland Establishes Center for Health Related Informatics and Bioimaging News & Events UNIVERSITY OF MARYLAND ESTABLISHES CENTER FOR HEALTH CONTACT RELATED INFORMATICS AND BIOIMAGING Monday, June 10, 2013 Karen Robinson, Media Relations New Center, Led By Distinguished Bioinformatics Scientist Owen White, (410) 706-7590 Ph.D., Unites Scientists Across Disciplines to Integrate Genomics and Personalized Medicine into Research and Clinical Care [email protected] University of Maryland, Baltimore campus President Jay A. Perman, M.D., and Media Relations Team University of Maryland School of Medicine Dean E. Albert Reece, M.D., Ph.D., M.B.A., wish to announce the establishment of a new center to unite research scientists and physicians across disciplines. The center will employ these SEARCH ARTICLES interdisciplinary connections to enhance the use of cutting edge medical science such as genomics and personalized medicine to accelerate research discoveries and improve health care outcomes. Participants in the new News Archives University of Maryland Center for Health-Related Informatics and Bioimaging (CHIB) will collaborate with computer scientists, engineers, life scientists and others at a similar center at the University of Maryland, College Park campus, CHIB Co-Director Owen White, Ph.D. together forming a joint center supported by the M-Power Maryland initiative. LEARN MORE University of Maryland School of Medicine Dean E. Albert Reece, M.D., Ph.D., M.B.A., with the concurrence of President Perman, has appointed as co-director of the new center Owen White, Ph.D., Professor of Epidemiology and Public Health and Director of Bioinformatics at the University of Maryland School of Medicine Institute for Genome Sciences.
    [Show full text]
  • Functional Annotation of Exon Skipping Event in Human Pora Kim1,*,†, Mengyuan Yang1,†,Keyiya2, Weiling Zhao1 and Xiaobo Zhou1,3,4,*
    D896–D907 Nucleic Acids Research, 2020, Vol. 48, Database issue Published online 23 October 2019 doi: 10.1093/nar/gkz917 ExonSkipDB: functional annotation of exon skipping event in human Pora Kim1,*,†, Mengyuan Yang1,†,KeYiya2, Weiling Zhao1 and Xiaobo Zhou1,3,4,* 1School of Biomedical Informatics, The University of Texas Health Science Center at Houston, Houston, TX 77030, USA, 2College of Electronics and Information Engineering, Tongji University, Shanghai, China, 3McGovern Medical School, The University of Texas Health Science Center at Houston, Houston, TX 77030, USA and 4School of Dentistry, The University of Texas Health Science Center at Houston, Houston, TX 77030, USA Received August 13, 2019; Revised September 21, 2019; Editorial Decision October 03, 2019; Accepted October 03, 2019 ABSTRACT been used as therapeutic targets (3–8). For example, MET has lost the binding site of E3 ubiquitin ligase CBL through Exon skipping (ES) is reported to be the most com- exon 14 skipping event (9), resulting in an enhanced expres- mon alternative splicing event due to loss of func- sion level of MET. MET amplification drives the prolifera- tional domains/sites or shifting of the open read- tion of tumor cells. Multiple tyrosine kinase inhibitors, such ing frame (ORF), leading to a variety of human dis- as crizotinib, cabozantinib and capmatinib, have been used eases and considered therapeutic targets. To date, to treat patients with MET exon 14 skipping (10). Another systematic and intensive annotations of ES events example is the dystrophin gene (DMD) in Duchenne mus- based on the skipped exon units in cancer and cular dystrophy (DMD), a progressive neuromuscular dis- normal tissues are not available.
    [Show full text]
  • Computational Analysis and Predictive Cheminformatics Modeling of Small Molecule Inhibitors of Epigenetic Modifiers
    RESEARCH ARTICLE Computational Analysis and Predictive Cheminformatics Modeling of Small Molecule Inhibitors of Epigenetic Modifiers Salma Jamal1☯‡, Sonam Arora2☯‡, Vinod Scaria3* 1 CSIR Open Source Drug Discovery Unit (CSIR-OSDD), Anusandhan Bhawan, Delhi, India, 2 Delhi Technological University, Delhi, India, 3 GN Ramachandran Knowledge Center for Genome Informatics, CSIR Institute of Genomics and Integrative Biology (CSIR-IGIB), Delhi, India ☯ These authors contributed equally to this work. ‡ These authors are joint first authors on this work. * [email protected] a11111 Abstract Background The dynamic and differential regulation and expression of genes is majorly governed by the OPEN ACCESS complex interactions of a subset of biomolecules in the cell operating at multiple levels start- Citation: Jamal S, Arora S, Scaria V (2016) ing from genome organisation to protein post-translational regulation. The regulatory layer Computational Analysis and Predictive contributed by the epigenetic layer has been one of the favourite areas of interest recently. Cheminformatics Modeling of Small Molecule Inhibitors of Epigenetic Modifiers. PLoS ONE 11(9): This layer of regulation as we know today largely comprises of DNA modifications, histone e0083032. doi:10.1371/journal.pone.0083032 modifications and noncoding RNA regulation and the interplay between each of these major Editor: Wei Yan, University of Nevada School of components. Epigenetic regulation has been recently shown to be central to development Medicine, UNITED STATES of a number of disease processes. The availability of datasets of high-throughput screens Received: June 10, 2013 for molecules for biological properties offer a new opportunity to develop computational methodologies which would enable in-silico screening of large molecular libraries.
    [Show full text]
  • A Database Integrating Genomic Indel Polymorphisms That Distinguish Mouse Strains Keiko Akagi1,2, Robert M
    D600–D606 Nucleic Acids Research, 2010, Vol. 38, Database issue Published online 20 November 2009 doi:10.1093/nar/gkp1046 MouseIndelDB: a database integrating genomic indel polymorphisms that distinguish mouse strains Keiko Akagi1,2, Robert M. Stephens3, Jingfeng Li2,4, Evgenji Evdokimov5, Michael R. Kuehn5, Natalia Volfovsky3 and David E. Symer2,4,6,7,8,9,* 1Mouse Cancer Genetics Program, Center for Cancer Research, National Cancer Institute, Frederick, MD 21702, 2Department of Molecular Virology, Immunology and Medical Genetics, The Ohio State University Comprehensive Cancer Center, Columbus, OH 43210, 3Advanced Biomedical Computing Center, Information Systems Program, SAIC-Frederick, Inc., NCI-Frederick, Frederick, MD 21702, 4Basic Research Laboratory, 5Laboratory of Protein Dynamics and Signaling, 6Laboratory of Biochemistry and Molecular Biology, Center for Cancer Research, National Cancer Institute, Frederick, MD 21702, 7Human Cancer Genetics Program, 8Departments of Internal Medicine and 9Biomedical Informatics, The Ohio State University Comprehensive Cancer Center, Columbus, OH 43210, USA Received August 5, 2009; Revised October 23, 2009; Accepted October 27, 2009 ABSTRACT wide-ranging functional differences. This extensive phenotypic variation has helped to make the mouse a MouseIndelDB is an integrated database resource premier model organism, mimicking many aspects of containing thousands of previously unreported human diversity and diseases. Understanding the mouse genomic indel (insertion and deletion) genomic differences that
    [Show full text]
  • GCAT|Panel, a Comprehensive Structural Variant Haplotype Map of the Iberian Population from High-Coverage Whole-Genome Sequencing
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.20.453041; this version posted July 21, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. GCAT|Panel, a comprehensive structural variant haplotype map of the Iberian population from high-coverage whole-genome sequencing Jordi Valls-Margarit1,#, Iván Galván-Femenía2,3,#, Daniel Matías-Sánchez1,#, Natalia Blay2, Montserrat Puiggròs1, Anna Carreras2, Cecilia Salvoro1, Beatriz Cortés2, Ramon Amela1, Xavier Farre2, Jon Lerga- Jaso4, Marta Puig4, Jose Francisco Sánchez-Herrero5, Victor Moreno6,7,8,9, Manuel Perucho10,11, Lauro Sumoy5, Lluís Armengol12, Olivier Delaneau13,14, Mario Cáceres4,15, Rafael de Cid2,*,† & David Torrents1,15,* 1. Life sciences dept, Barcelona Supercomputing Center (BSC), Barcelona, 08034, Spain. 2. Genomes for Life-GCAT lab Group, Institute for Health Science Research Germans Trias i Pujol (IGTP), Badalona, 08916, Spain. 3. Institute for Research in Biomedicine (IRB Barcelona), The Barcelona Institute of Science and Technology, 08028, Barcelona, Spain (current affiliation). 4. Institut de Biotecnologia i de Biomedicina, Universitat Autònoma de Barcelona, Bellaterra, Barcelona, 08193, Spain. 5. High Content Genomics and Bioinformatics Unit, Institute for Health Science Research Germans Trias i Pujol (IGTP), 08916, Badalona, Spain. 6. Catalan Institute of Oncology, Hospitalet del Llobregat, 08908, Spain. 7. Bellvitge Biomedical Research Institute (IDIBELL), Hospitalet del Llobregat, 08908, Spain. 8. CIBER Epidemiología y Salud Pública (CIBERESP), Madrid, 28029, Spain. 9. Universitat de Barcelona (UB), Barcelona, 08007, Spain.
    [Show full text]
  • Genome Informatics 2016 Davide Chicco1 and Michael M
    Chicco and Hoffman Genome Biology (2017) 18:5 DOI 10.1186/s13059-016-1135-5 MEETINGREPORT Open Access Genome Informatics 2016 Davide Chicco1 and Michael M. Hoffman1,2,3* Abstract of sequence variants. Konrad Karczewski (Massachusetts General Hospital, USA) presented the Loss Of Func- A report on the Genome Informatics conference, held tion Transcript Effect Estimator (LOFTEE, https://github. at the Wellcome Genome Campus Conference Centre, com/konradjk/loftee). LOFTEE uses a support vector Hinxton, United Kingdom, 19–22 September 2016. machine to identify sequence variants that significantly disrupt a gene and potentially affect biological processes. We report a sampling of the advances in computational Martin Kircher (University of Washington, USA) dis- genomics presented at the most recent Genome Informat- cussed a massively parallel reporter assay (MPRA) that ics conference. As in Genome Informatics 2014 [1], speak- uses a lentivirus for genomic integration, called lentiM- ers presented research on personal and medical genomics, PRA [3]. He used lentiMPRA to predict enhancer activity, transcriptomics, epigenomics, and metagenomics, new and to more generally measure the functional effect of sequencing techniques, and new computational algo- non-coding variants. William McLaren (European Bioin- rithms to crunch ever-larger genomic datasets. Two formatics Institute, UK) presented Haplosaurus, a variant changes were notable. First, there was a marked increase effect predictor that uses haplotype-phased data (https:// in the number of projects involving single-cell analy- github.com/willmclaren/ensembl-vep). ses, especially single-cell RNA-seq (scRNA-seq). Second, Two presenters discussed genome informatics while participants continued the practice of present- approaches to the analysis of cancer immunotherapy ing unpublished results, a large number of the presen- response.
    [Show full text]
  • Maternally Inherited Pirnas Direct Transient Heterochromatin Formation
    RESEARCH ARTICLE Maternally inherited piRNAs direct transient heterochromatin formation at active transposons during early Drosophila embryogenesis Martin H Fabry, Federica A Falconio, Fadwa Joud, Emily K Lythgoe, Benjamin Czech*, Gregory J Hannon* CRUK Cambridge Institute, University of Cambridge, Li Ka Shing Centre, Cambridge, United Kingdom Abstract The PIWI-interacting RNA (piRNA) pathway controls transposon expression in animal germ cells, thereby ensuring genome stability over generations. In Drosophila, piRNAs are intergenerationally inherited through the maternal lineage, and this has demonstrated importance in the specification of piRNA source loci and in silencing of I- and P-elements in the germ cells of daughters. Maternally inherited Piwi protein enters somatic nuclei in early embryos prior to zygotic genome activation and persists therein for roughly half of the time required to complete embryonic development. To investigate the role of the piRNA pathway in the embryonic soma, we created a conditionally unstable Piwi protein. This enabled maternally deposited Piwi to be cleared from newly laid embryos within 30 min and well ahead of the activation of zygotic transcription. Examination of RNA and protein profiles over time, and correlation with patterns of H3K9me3 deposition, suggests a role for maternally deposited Piwi in attenuating zygotic transposon expression in somatic cells of the developing embryo. In particular, robust deposition of piRNAs targeting roo, an element whose expression is mainly restricted to embryonic development, results in the deposition of transient heterochromatic marks at active roo insertions. We hypothesize that *For correspondence: roo, an extremely successful mobile element, may have adopted a lifestyle of expression in the [email protected] embryonic soma to evade silencing in germ cells.
    [Show full text]
  • Evidence of Selection at the Ramosa1 Locus During Maize Domestication
    Molecular Ecology (2010) 19, 1296–1311 doi: 10.1111/j.1365-294X.2010.04562.x Evidence of selection at the ramosa1 locus during maize domestication BRANDI SIGMON and ERIK VOLLBRECHT Department of Genetics, Development, and Cell Biology, Iowa State University, Ames, IA 50011, USA Abstract Modern maize was domesticated from Zea mays parviglumis, a teosinte, about 9000 years ago in Mexico. Genes thought to have been selected upon during the domestication of crops are commonly known as domestication loci. The ramosa1 (ra1) gene encodes a putative transcription factor that controls branching architecture in the maize tassel and ear. Previous work demonstrated reduced nucleotide diversity in a segment of the ra1 gene in a survey of modern maize inbreds, indicating that positive selection occurred at some point in time since maize diverged from its common ancestor with the sister species Tripsacum dactyloides and prompting the hypothesis that ra1 may be a domestication gene. To investigate this hypothesis, we examined ear phenotypes resulting from minor changes in ra1 activity and sampled nucleotide diversity of ra1 across the phylogenetic spectrum between tripsacum and maize, including a broad panel of teosintes and unimproved maize landraces. Weak mutant alleles of ra1 showed subtle effects in the ear, including crooked rows of kernels due to the occasional formation of extra spikelets, correlating a plausible, selected trait with subtle variations in gene activity. Nucleotide diversity was significantly reduced for maize landraces but not for teosintes, and statistical tests implied directional selection on ra1 consistent with the hypothesis that ra1 is a domestication locus. In maize landraces, a noncoding 3¢-segment contained almost no genetic diversity and 5¢-flanking diversity was greatly reduced, suggesting that a regulatory element may have been a target of selection.
    [Show full text]
  • Mom Identifies a Receptor for the Drosophila JAK/STAT Signal Transduction Pathway and Encodes a Protein Distantly Related to the Mammalian Cytokine Receptor Family
    Downloaded from genesdev.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press mom identifies a receptor for the Drosophila JAK/STAT signal transduction pathway and encodes a protein distantly related to the mammalian cytokine receptor family Hua-Wei Chen,1,3 Xiu Chen,1,3 Su-Wan Oh,1 Maria J. Marinissen,2 J. Silvio Gutkind,2 and Steven X. Hou1,4 1The Laboratory of Immunobiology, National Institutes of Health, National Cancer Institute at Frederick, Frederick, Maryland 21702, USA; 2Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, Maryland 20892, USA The JAK/STAT signal transduction pathway controls numerous events in Drosophila melanogaster development. Receptors for the pathway have yet to be identified. Here we have identified a Drosophila gene that shows embryonic mutant phenotypes identical to those in the hopscotch (hop)/JAK kinase and marelle (mrl)/Stat92e mutations. We named this gene master of marelle (mom). Genetic analyses place mom’s function between upd (the ligand) and hop. We further show that cultured cells transfected with the mom gene bind UPD and activate the HOP/STAT92E signal transduction pathway. mom encodes a protein distantly related to the mammalian cytokine receptor family. These data show that mom functions as a receptor of the Drosophila JAK/STAT signal transduction pathway. [Key Words: Drosophila; JAK/STAT; signal transduction; cytokine receptor] Received October 19, 2001; revised version accepted December 6, 2001. The JAK/STAT signal transduction pathway was identi- (upd) secreted glycoprotein identifies an in vivo ligand fied through studies of the transcriptional activation re- activating the HOP/STAT92E pathway (Harrison et al.
    [Show full text]
  • GCAT (NM 014291) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG204870 GCAT (NM_014291) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: GCAT (NM_014291) Human Tagged ORF Clone Tag: TurboGFP Symbol: GCAT Synonyms: KBL Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG204870 representing NM_014291 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGGCCTGGGAACGCCTGGCGCGCCGCACTCTTCTGGGTGCCCCGCGGCCGCCGCGCACAGTCAGCGC TGGCCCAGCTGCGTGGCATTCTGGAGGGGGAGCTGGAAGGCATCTGCGGAGCTGGCACTTGGAAGAGTGA GCGGGTCATCACGTCCCGTCAGGGGCCGCACATCCGCGTGGACGGCGTCTCCGGAGGAATCCTTAACTTC TGTGCCAACAACTACCTGGGCCTGAGCAGCCACCCTGAGGTGATCCAGGCAGGTCTGCAGGCTCTGGAGG AGTTTGGAGCTGGCCTCAGCTCTGTCCGCTTTATCTGTGGAACCCAGAGCATCCACAAGAATCTAGAAGC AAAAATAGCCCGCTTCCACCAGCGGGAGGATGCCATCCTCTATCCCAGCTGTTATGACGCCAACGCCGGC CTCTTTGAGGCCCTGCTGACCCCAGAGGACGCAGTCCTGTCGGACGAGCTGAACCATGCCTCCATCATCG ACGGCATCCGGCTGTGCAAGGCCCACAAGTACCGCTATCGCCACCTGGACATGGCCGACCTAGAAGCCAA GCTGCAGGAGGCCCAGAAGCATCGGCTGCGCCTGGTGGCCACTGATGGGGCCTTTTCCATGGATGGCGAC ATCGCACCCCTGCAGGAGATCTGCTGCCTCGCCTCTAGATATGGTGCCCTGGTCTTCATGGATGAATGCC ATGCCACTGGCTTCCTGGGGCCCACAGGACGGGGCACAGATGAGCTGCTGGGTGTGATGGACCAGGTCAC CATCATCAACTCCACCCTGGGGAAGGCCCTGGGTGGAGCATCAGGGGGCTACACGACAGGGCCTGGGCCC CTGGTGTCCCTGCTGCGGCAGCGCGCCCGGCCATACCTCTTCTCCAACAGTCTGCCACCTGCTGTCGTTG
    [Show full text]
  • DNA Sequencing
    Contig Assembly ATCGATGCGTAGCAGACTACCGTTACGATGCCTT… TAGCTACGCATCGTCTGATGGCAATGCTACGGAA.. C T AG AGCAGA TAGCTACGCATCGT GT CTACCG GC TT AT CG GTTACGATGCCTT AT David Wishart, Ath 3-41 [email protected] DNA Sequencing 1 Principles of DNA Sequencing Primer DNA fragment Amp PBR322 Tet Ori Denature with Klenow + ddNTP heat to produce + dNTP + primers ssDNA The Secret to Sanger Sequencing 2 Principles of DNA Sequencing 5’ G C A T G C 3’ Template 5’ Primer dATP dATP dATP dATP dCTP dCTP dCTP dCTP dGTP dGTP dGTP dGTP dTTP dTTP dTTP dTTP ddCTP ddATP ddTTP ddGTP GddC GCddA GCAddT ddG GCATGddC GCATddG Principles of DNA Sequencing G T _ _ short C A G C A T G C + + long 3 Capillary Electrophoresis Separation by Electro-osmotic Flow Multiplexed CE with Fluorescent detection ABI 3700 96x700 bases 4 High Throughput DNA Sequencing Large Scale Sequencing • Goal is to determine the nucleic acid sequence of molecules ranging in size from a few hundred bp to >109 bp • The methodology requires an extensive computational analysis of raw data to yield the final sequence result 5 Shotgun Sequencing • High throughput sequencing method that employs automated sequencing of random DNA fragments • Automated DNA sequencing yields sequences of 500 to 1000 bp in length • To determine longer sequences you obtain fragmentary sequences and then join them together by overlapping • Overlapping is an alignment problem, but different from those we have discussed up to now Shotgun Sequencing Isolate ShearDNA Clone into Chromosome into Fragments Seq. Vectors Sequence 6 Shotgun Sequencing Sequence Send to Computer Assembled Chromatogram Sequence Analogy • You have 10 copies of a movie • The film has been cut into short pieces with about 240 frames per piece (10 seconds of film), at random • Reconstruct the film 7 Multi-alignment & Contig Assembly ATCGATGCGTAGCAGACTACCGTTACGATGCCTT… TAGCTACGCATCGTCTGATGGCAATGCTACGGAA.
    [Show full text]
  • The Biogrid Interaction Database
    D470–D478 Nucleic Acids Research, 2015, Vol. 43, Database issue Published online 26 November 2014 doi: 10.1093/nar/gku1204 The BioGRID interaction database: 2015 update Andrew Chatr-aryamontri1, Bobby-Joe Breitkreutz2, Rose Oughtred3, Lorrie Boucher2, Sven Heinicke3, Daici Chen1, Chris Stark2, Ashton Breitkreutz2, Nadine Kolas2, Lara O’Donnell2, Teresa Reguly2, Julie Nixon4, Lindsay Ramage4, Andrew Winter4, Adnane Sellam5, Christie Chang3, Jodi Hirschman3, Chandra Theesfeld3, Jennifer Rust3, Michael S. Livstone3, Kara Dolinski3 and Mike Tyers1,2,4,* 1Institute for Research in Immunology and Cancer, Universite´ de Montreal,´ Montreal,´ Quebec H3C 3J7, Canada, 2The Lunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital, Toronto, Ontario M5G 1X5, Canada, 3Lewis-Sigler Institute for Integrative Genomics, Princeton University, Princeton, NJ 08544, USA, 4School of Biological Sciences, University of Edinburgh, Edinburgh EH9 3JR, UK and 5Centre Hospitalier de l’UniversiteLaval´ (CHUL), Quebec,´ Quebec´ G1V 4G2, Canada Received September 26, 2014; Revised November 4, 2014; Accepted November 5, 2014 ABSTRACT semi-automated text-mining approaches, and to en- hance curation quality control. The Biological General Repository for Interaction Datasets (BioGRID: http://thebiogrid.org) is an open access database that houses genetic and protein in- INTRODUCTION teractions curated from the primary biomedical lit- Massive increases in high-throughput DNA sequencing erature for all major model organism species and technologies (1) have enabled an unprecedented level of humans. As of September 2014, the BioGRID con- genome annotation for many hundreds of species (2–6), tains 749 912 interactions as drawn from 43 149 pub- which has led to tremendous progress in the understand- lications that represent 30 model organisms.
    [Show full text]