Laboratory & Diagnosis
Official Journal of Iranian Association of Clinical Laboratory Doctors Supplement issue for IQC 15
Editorial Board Members:
Dr. Kamaledine Bagheri, DCLS Dr. Ali Sadeghitabar, DCLS
Dr. Mohammad Reza Bakhtiari, DCLS, PhD Dr. Mohammad Sahebalzamani, DCLS
Dr. S. Mahdi Boutorabi, DCLS, PhD Dr. Masomeh Salimi, DCLS
Dr. Mohammad Ghasem Eslami, DCLS Dr. Fariba Shaygan, DCLS
Dr. S. Mohammad Hasan Hashemimadani, DCLS Dr. Saeed Mahdavi, DCLS
Executive Board Members:
Ali Adibzadeh Sedigheh Jalili
Mina Moosa Nezhad Sara Tondro
Azam Jalili Mohammad Kazemi
Marzieh Moradi Maryam Fazli
Layout by: Navid Ghahremani
Circulation: 1000 copies
Address: No.29, Ardeshir Alley, Hashtbehesht St., Golha Square, Fatemi Ave, Tehran 1414734711 – Iran. Telefax: (+98 21) 88970700 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Message of Congress Chairman
Dr. S. M. Boutorabi DCLS, PhD In the name of God, the Compassionate, the Merciful Dear professors,colleagues, students and all associates in the field of laboratory sciences; With the help of God and on the behalf of the Iranian association of clinical laboratory doctors (IACLD), I am honored to invite you to attend the 10th International and 15th National Congress in Quality Improvement of Clinical Laboratory Services in Iran (IQC15). With the aim of promoting science and improving the clinical laboratory services, this congress will be held on April 20-23 2017 at Tehran Milad Tower International Conference Center. With the every year slogan of “The Quality Has No End”, the congress is a good opportunity to exchange knowledge and experience in all fields of laboratory science in order to improve the quality of diagnostic laboratory services. The laboratory system in Iran in particular, is currently facing many administrative and economic challenges. If there were no commitment to provide services, it would not be possible for the private sector to continue the path in the present circumstances. It is hoped that with the attendance of decision-makers and government administrators, who should appreciate all these efforts, and with the exchange of ideas and debate, practical solutions for overcoming challenges and obstacles are achieved to avoid harming the health of people in the society. My hard working collogues in scientific and executive committees of the congress, hope that holding this congress as the largest event of laboratory science in the region, can provide substrates to improve knowledge of the attendants by the presence of domestic and foreign professors and experts in the field, as well as holding workshops, and the exhibition of equipment and supplies. Your warm sympathy and active participation are appreciated and we look forward to seeing you in the great scientific event of IQC15.
2 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Message of Congress Secretaries
Dr. R. Mohammadi Dr. A. Sadeghitabar DCLS, PhD DCLS
Clinical diagnostic laboratories have a long history in providing medical services in our country. There have been huge developments in the delivery of services and the variety of different laboratory tests during these years. The steep slope of these developments’ graph in the past two decades in particular, the graduation of clinical laboratory science doctors and the Quality Improvement Congress represents the importance of these two significant events. Partners in this field, who are pure graduates in the specialized areas of clinical laboratory, initiated the important event of the quality improvement congress, which today after 15 years of establishment, is proud of laboratory community of the country and has become one of the biggest conferences in laboratory science in the Middle East and Emro. The congress of quality improvement is a meeting place to exchange views and ideas of different sections of the laboratory community and has been the origin of good events such as quality improvement, standardization and development of laboratory science in the country’s medical society.
Today we, as the laboratory community, are proud to be pioneer in the implementation of new developments in the medical field and owe this honor to the empathy and cooperation of all groups of educated and working people in this field. It is hoped that with active presence and participation in the fifteenth congress of quality improvement we can help to further development of laboratory science and improvement of the quality of services.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 3 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Congress Main Topics
Main Topics Coordinator Page
Accreditation of Clinical Laboratories ………………………………...... Dr. A. Shirin, DCLS 14
Antimicrobial Susceptibility and Resistance Inhibition Testing ...... Dr. N. Rahimifard, DCLS, PhD 18
Comparison of Laboratory Systems in Iran and Other Countries ...... Dr. F. Shaygan, DCLS 23
Information Technology Management in Laboratory ...... Dr. S. M. H. Hashemi Madani, DCLS 27
Laboratory and Clinic: Anemia ...... Dr. B. Poopak, DCLS, PhD 30
Laboratory and Clinic: Biomarkers in Neurology ...... Dr. M. R. Bakhtiari, DCLS, PhD 33
Laboratory and Clinic: Cardiovascular Disease Biomarkers ...... Dr. N. Almasi, DCLS 37
Laboratory and Clinic: Cancer Biomarkers ...... Dr. A. H. Zarnani, DCLS, PhD 43
Laboratory and Clinic: Diabetes and New Findings ...... Dr. M. Taghikhani, PhD 49
Laboratory and Clinic: Endocrine Disorders, Pituitary – Gonadal ...... Dr. A. Sadeghitabar, DCLS 52
Laboratory and Clinic: Hemoglobinopathies ...... Dr. M. Yavarian, DCLS, PhD 55
Laboratory and Clinic: Obesity ...... Dr. S. Mahdavi, DCLS 58
Law and Ethics in Laboratory ...... Dr. M. Gh. Eslami, DCLS 62
New Findings in Laboratory Diagnostics: Biochemistry ...... Dr. L. Hosseini Gohari, PhD 64
New Findings in Laboratory Diagnostics: Immunology and Serology ...... Dr. M. Mehdi Mohammadi, DCLS, PhD 70
New Findings in Laboratory Diagnostics: Microbiology ...... Dr. F. Azizmohseni, DCLS, PhD 75
Personalized Medicine ...... Dr. M. R. Mahdavi Amiri, DCLS 80
Prenatal Screening: New Methods and Challenges ...... Dr. S. M. Sezavar Kamali, DCLS 84
Scientific Management in Laboratory ...... Dr. H. Gholami, DCLS 88
Standardization and Harmonization of Clinical Laboratory Tests Results ...... Dr. S. M. Boutorabi, DCLS, PhD 91
The Main Challenges of Laboratory: Referral System, Laboratory Network, Mega Labs.. Dr. K. Bagheri, DCLS 95
The Role of Laboratory Science Education in Providing Sufficient Laboratory Director ... Dr. M. M. Mosallayi, DCLS 98
4 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Coordinators of Congress Main Topics (in Alphabetic Order)
Dr. N . Almasi Dr. F. Azizmohseni Dr. K. Bagheri Dr. M. R. Bakhtiari Dr. S. M. Boutorabi DCLS DCLS, PhD DCLS DCLS, PhD DCLS, PhD
Dr. M. Gh. Eslami Dr. H. Gholami Dr. M. H. Hashemi Madani Dr. L. Hosseni Gohari Dr. S. Mahdavi DCLS DCLS DCLS PhD DCLS
Dr. M. R. Mahdavi Amiri Dr. M. Mahdi Mohammadi Dr. M. M. Mosallayi Dr. B. Poopak Dr. N. Rahimi Fard DCLS DCLS, PhD DCLS DCLS, PhD DCLS, PhD
Dr. A. Sadeghitabar Dr. S. M. Sezavar Kamali Dr. F. Shaygan Dr. A. Shirin Dr. M. Taghikhani DCLS DCLS DCLS DCLS PhD
Dr. M. Yavarian Dr. A. H. Zarnani DCLS, PhD DCLS, PhD
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 5 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Key Speakers (in Alphabetic Order)
Prof. Khosrow Adeli Dr Majid HafezParast Prof. Ruprecht Keller (Canada) (England) (Germany) Chair of Publications and Communications Molecular Genetics at the School of Life Sciences, Head of Central Laboratory bei Municipal Division of IFCC, head and full professor of Clinical University of Sussex, and Brighton and Sussex Hospital Cologne, Deutschland- Biotechnologie Biochemistry, University of Toronto - Canada Medical School
Dr Sun Hoe Koo Dr. Gye Cheol Kwon Dr. Glenn E. Palomaki (South Korea) (South Korea) (USA) Department of Laboratory Medicine, College of Department of Pathology and Laboratory Vice president of KEQAS Director,, Professor Medicine, Chungnam National University Lab Medicine, Chungnam Nat l Univ. Hosp. Medicine Division of Medical Screening and South Korean Special Testing Women and Infants Hospital of Rhode Island
Dr. Mario Plebani Dr. Farzin Pourfarzad Prof. Dirk Roggenbuck (Italy) (Netherlands) (Germany) Laboratory specialist full Professor of Clinical Department of Cell Biology and Genetics, Biochemistry and Clinical Molecular Biology at the Managing Director Medipan School of Medicine, University of Padova, ITALY Erasmus Medical Centre, Rotterdam
Prof. Sverre Sandberg Dr. Praveen Sharma Prof. N. J. Wald (Norway) (India) (England) University of Bergen, Norway, Head of Department of Biochemistry, All India Professor of Environmental and Preventive EFLM president Institute of Medical Sciences, Jodhpur, India Medicine at the Wolfson Institute
6 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Company Guests (in Alphabetic Order)
Ahmed AbdulHuk Ahmed Ismail Ahmed Denis Andreu Lisa Anne Gannon (Egypt) Younes (France) (Ireland) Siemence (Egyptian) Vice-president,General Product Specialist Tcoag Manager Biomeruix
Andreas Busching Kenan Deniz Buyukakman Zhu Dong Abdelrahman Elgonaimy (Germany) (Turkey) (China) (Egypt) Business Area Manager Americas Medlic Co. Siemence & MEA Analyticon
Romain Fournials Dr. Myrna Germanos Haddad Suleyman Guceyu Wang Hao (Frence) (Libnan) (Turkey) (China) Siemence Customer Service Vircell Medlic Co. Guangzhou Hongqi Optical Instrument Technology Co., LTD.
Dr. Reinhold Hartwig Ehab Hassanen Zou Jiang Dong Li Jianzhang (Germany) (Egypt) (China) (China) Sales Manager,Middle Managing Director Medipan Siemence B&E Bio-Technology Co.,Ltd East Mindray
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 7 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Haiyan Liu Desiree Jill Vianney Leconier Ke Li (China) (Australia) (France) (China) Application Spplicialist Regional Business Manager Biomeruix
Wafa Manel Dejar Liao Maobin Mohamed Niyaz Can Orhan (France) (China) (India) (Turkey ) Regional Product Manager Guangzhou Hongqi Optical Siemence Middle East General Microbiology Biomeruix Instrument Technology Co., Manager Biomeruix
Gudrun Ingeborg Sahlmueller Dr. Glenn E. Palomaki Frederic Paquet Michele Premi (Germany) (USA) (Germany) (Spain) Head of International Sales General Manager Department Institut Sales Manager Linnnear EUROIMMUN LLC Dubai VirionSerion GmbH
Xavier sebastiao neto Antonio Serrano Wenhao. Shi Gauthier jean stinco (Brazil) (Spain) (China) (France) International Area Operational Product Siemence Manager Vircell Sales Manager Manager Tcoag
8 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Arshad Syed Prof. Nicholas Wald Elson Wang Freeman Wen (China) (Germany) (England) (China) Mindray International Sales Manager International Sales & Marketing Dep, IVD Institut Virion\Serion GmbH Division Regional Marketing Mindray
Jianhong Xi Yang Xu Zhong Yanhua Olivia Yin (China) (China) (China) (China) B&E Bio-Technology Co.,Ltd Company DYMIND
Quan Zhang Feng Zhao Liang Zhijian (China) (China) (China) Sales Director Customer Service Manager Zhongshan Chuangyi Biochemical Engineering CO. LTD.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 9 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Congress Scientific Board
Ms. E. Abbasi Dr. M. Bozorgi Dr. M. Hakemi Vala Dr. M. Abbasi Dr. A. Chegini Ms. Z. Hamzeloo Prof. M. R. Abbaszadegan Dr. M. S. Daneshpour Dr. Gh. Hamzeloo Ms. S. Abdollahi Dr. M. M. Danesi Kohan Dr. S. Hantooshzadeh Prof. Kh. Adeli Dr. H. Dargahi Dr. S. M. H. Hashemi Madani Dr. M. Afkhami Aghda Mr. H. Dehkordi Fazelian Dr.E. Hayati Dr. A. R. Afrasiabi Ms. E. Derakhshanfar Dr. M. Hedayati Dr. J. Ahmadi Ms. E. Didehvara Dr. S. M. Hooshmand Dr. A. R. Ahmadi Dr. M. E. Ebrahimzadeh Dr. H. Hosseini Dr. A. R. Ahmadian Dr. F. Ebrahim Pour Azar Dr. L. Hosseni Gohari Dr. M. T. Akbari Dr. G. H. Edrisian Dr. S. A. Hosseni Taghavi Mr. T. Akbarzadeh Khiavi Dr. H. Eftekhar Ardebili Dr. M. Izadi Dr. M. M. Akhondi Dr. S. Emamgholipour Mr. M. Jabbari Dr. S. M. Akrami Dr. A. H. Emami Dr. M. Jalilzadeh Khoei Mr. Sh. Al Lawati Dr. A. A. Enayati Prof. N. Jan Wald Dr. S. M. Alavian Mr. J. Ershad Dr. M. Javid Ahmadabadi Dr. M. Alebouyeh Dr. G. Eslami Dr. A. Kamyabi Prof. K. Ali Moghadam Dr. A. Etesanpour Dr. M. Karimi Dr. M. R. Aliakbarzadeh Saroukhani Eng. M. Falah Dr. A. Kariminejad Eng. H. A. All Taha Dr. Sh. Farsi Dr. P. Kavakeb Dr. N. Almasi Dr. M. Farhadi Langeroudi Dr. H. R. Kazerouni Dr. S. Amini Kafi Abadi Mr. E. Farzaneh Dokht Namini Dr. A. Kazemi Dr. H. R. Amir Moghadami Dr. A. Fatehi Prof. R. Keller Dr. H. Amir Rasouli Mr. S. M. Fatemi Dr. M. Keramatipour Mr. J. Amri Mr. M. Fathi Jozdani Dr. A. Khakifiroz Dr. Z. Ansari Eng. F. Feng Zhao Mr. M. A. Khames Ebrahim Dr. N. Asadi Dr. M. M. Feyzabadi Dr. S. M. Khosh Nit Niko Dr. M. R. Ashrafi Ms. H. Forouhash Tehrani Ms.A. Khosravi Mr. M. Azadi Dr. S. M. R. Fouladi Dr. I. Khosronia Dr. S. Azhdari Dr. M. Garshasbi Mr. M. Kohestani Dr. S. S. Azimi Dr. S. R. Ghafari Dr. S. H. Koo Dr. F. Aziz Mohseni Dr. S. H. Ghaffari Dr. A. Korourian Dr. F. Azizi Dr. M. Ghahremanlou Dr. G. C. Kwon Eng. H. Babaki Dr. M. Ghahri Dr. S. M. Tara Dr. H. Badali Dr. A. Gharehbaghian Dr. M. Maghsoudloo Dr. S. M. Baghbanian Dr. M. Gharibi Dr. S. Mahdavi Dr. K. Bagheri Dr. H. Ghazizadeh Dr. S. R. Mahdavi Dr. H. Bahreni Eng. I. Ghobeyti Dr. M. R. Mahdavi Amiri Dr. G. R. Bahoush Dr. R. Ghods Dr. S. Mahmoud Pour Dr. M. R. Bakhtiari Dr. H. Gholami Dr. M. R. Malek Dr. M. Bani Fazl Dr. M. Ghorbani Prof. SH. Maraghi Dr. H. Bayat Dr. H. Golafshan Dr. M. Mard-Soltani Dr. D. Behravan Dr. M. A .Gol Ara Dr. A. Mashhadi Abolghasem Dr. A. Beikmohamadi Dr. A. Golestani Dr. A. Mehrabi Tavana Ms. N. Bettache Dr. S. Gorgani Firozjaey Dr. A. Meimandi Dr. E. Bitaraf Dr. H. Gourabi Mr. R. Melis Dr. S. M. Boutorabi Dr. M. Hafezparast Dr. R. Meshkani
10 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Dr. D. Meyer Dr. F. Pourfarzad Dr. S. H. Shams Dr. M. Mikhak Dr. A. A. Pourfatollah Dr. A. A. Shams Borhan Dr. A. Mir Jalili Dr. Y. Pourkhoshbakht Dr. M. Shamsi Shahr Abadi Dr. H. Mirahmadi Dr. M. Rahbar Dr. M. Shanaki Dr. M. Moazeni Ms. M. Rahimi Mofrad Dr. S. Sharifzadeh Mr. M. Moghaddam Dr. N. Rahimifard Dr. P. Sharma Dr. S. H. Moghaddam Nia Dr. A. Rahimipour Dr. F. Shayegan Mr. P. Mohammadi Dr. A. Rajab Dr. M. Shekarabi Dr. R. Mohammadi Dr. H. Ravaghi Dr. R. Shervinbadv Dr. A. A. Mohammadi Dr. F. Razi Dr. Y. Shir Khani Dr. M. M. Mohammadi Dr. M. Razzaghi Azar Dr. A. Shirin Dr. M. Mohammadi Dr. I. Renji Jefroudi Dr. M. Shokr Abadi Dr. M. H. Mohammadi Eng. J. Rezaei Dr. D. Shokri Dr. A. Mohammadzadeh Prof. D. Roggenbuck Mr. J. Soltani Rezaee Dr. S. R. Mohebbi Mr. S. Akbari Dr. M. J. Soltanpour Mr. M. Mojtabaei Dr. M. Sabooni Dr. K. Soltanzadeh Dr. H. Moradzadegan Dr. H. Sabour Dr. M. Taghikhani Dr. M. M. Mossalaeie Ms. F. Sabzavi Dr. N. Taghinia Dr. S. G. Mostafavi Dr. A. Sadeghitabar Dr. M. Taghizadeh Dr. B. Motlagh Dr. A. Safaee Mr. M. Taheri Bonakdar Dr. A. Mouseli Dr. M. Sahebalzamani Ms. R. Tahmasian Dr. F. Moztarzadeh Dr. N. Saki Dr. A. R. Tavasoli Ms. A. Najafi Ms. M. Salahmand Dr. R. Todeh Zaeim Dr. M. Nakhjavani Dr. Sh. Salami Dr. B. Valizadeh Dr. M. H. Namvar Shushtari Dr. M. Salehi Dr. M. Vanaki Ms. L. Nasiri Goorabi Dr. H. Salehi Moghaddam Ms. J. Vartanosian Dr. M. Nematbakhsh Dr. M. Salimi Dr. Vazini Dr. H. Nemati Dr. R. Salman Yazdi Ms. Sh. Voghofi Dr. F. Nik Aeen Dr. S. H. Samdanifar M. Dr. Vojgani Dr. A. R. Nikbakht Nasr Abadi Dr. S. Samiee Dr. D. Yadegarinia Mr. M. Noori Dr. S. Z. Samsam Shariat Dr. M. Yaghmaei Dr. S. M. Nourazarian Dr. S. Sand Berg Dr. M. Yavarian Dr. M. Nourbakhsh Dr. E. Saneie Moghaddam Ms. Z. Yazdan Panah Dr. M. Nourbakhsh Dr. A. A. Sani Dr. M. R. Yzdan Panah Dr. B. Oboudi Dr. A. Saraf Nezhad Dr. M. R. Zali Mr. A. R. Palangi Dr. M. A. Saremi Dr. G. R. Zamani Dr. H. A. Panahi Broujeni Dr. S. R. Seyed javadin Ms. E. Zarei Dr. A. Pardakhti Dr. A. Sayah Dr. M. R. Zarei Dr. M. Parsania Dr. M. Sezavar Kamali Mr. S. M. Zarghami Dr. M. Pazhouhi Dr. M. Shabani Prof. A. H. Zarnani Dr. A. A. Peivandi Dr. S. Shabestari Khiabani Dr. S. Zeynali Prof. M. Plebani Dr. A. Shahi Dr. M. Ziaie Dr. B. Poopak Dr. E. Shahsavand Dr. B. Pourakbari Eng. N. Shaker Hosseini
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 11 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
ABSTRACTS
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratory
12 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Oral Presentations
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 13 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Accreditation of Clinical Laboratories O1 – O6
In the today’s modern world the variety and quality of healthcare services, as well as associated technologies and equipment are expanding and improving, day by day. However, this has not prevented even the highly developed and wealthy countries to worry about issues such as the model of service provision, security and safety of patient and his companions and also the costs of health and complications.However, today, the main problem of our health system is the quality and delivery of services, but unfortunately, this issue has been neglected Nevertheless, the issue has also been the center of focus for the most people, media and trade organizations and the major demands and complaints are connected to the field of treatment. To solve the problems mentioned above, the transformation of medical institutions from the old model to the gold model of accreditation has been an effective action, carried out. Accreditation is considered as one of the most reliable methods for evaluation of medical institutions in the world.Accreditation requirements are due to special needs, health system specification, characteristics of the human forces including special and other forces, as well as funding, etc.Accreditation as an external evaluation, examines all objective, measurable and scalable actions and its standards emphasizes on improving the quality.Accreditation is specifically designed to provide health care. Therefore, in comparison with ISO EFQM, its standards are more specific.It is the accreditation demand to be considered as a way to guide the government’s monitoring where there is a request decisively for commitment and clarity. Dr. A. Shirin, DCLS Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O1
Introducing International Laboratory Accreditation Cooperations a.(ILAC)
Rooshanak Tahmasian *
Laboratory accreditation is a process during which an accreditation body accredit a laboratory in accordance with recognised standards to ensure necessary competence to carry out specific activity is based on 4 factors :1- accreditation bodies 2-Auditors 3-Standards 4-laboratories The role of Accreditation bodies is provision and independent, impartial evaluation of Calibration and test Labratories (using Iso/IEC 17025), medical laboratories (using Iso/IEC 15189), inspection bodies(using Iso/IEC 17020) and accredit or suspend recognation based on evaluation results. There are international patterns and special standards for the accreditation bodies (Iso/IEC 17011) that determined requirments for their structures and evaluations.For developing Laboratory accreditation activities and processes International Laboratory Accreditation Cooperations (ILAC) became a formal Cooperation in 1996. This organization accredit accredation bodies of different economies membership. In fact ILAC provide peer evaluation for laboratory Accreditation that lead to international mutual arrengment that increase acceptance of laboratory data and results and will remove trade technical barriers. ILAC will assist and support developing countries in promoting accreditation systems. In this paper we effort to introduce ILAC and its roles in accreditation and developing accreditation systems.
O2
Challenges of Accreditation Body in Clinical Laboratory
Ali Shirin 1 *
1- Social Security [email protected]
There are 4 factors in medical laboratory accreditation:1- Accreditation body , 2 -Assesors, 3- Assessment Criteria (Standards), 4- Laboratory This paper presents challenges of accreditation body in medical laboratory and suggests for resolving them , evaluates suggestions and finally chooses the best for offering to decision-making body of medical laboratories.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 15 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O3
Introductio of National Accreditation Center of Iran
Alireza Khaki Firoz *
Based on the Country’s policy making, National Accreditation Center of Iran (NACI) As a sole Accreditation Body performs all Accreditation activities in Iran and abroad based on national and international rules and regulations. NACI is a member of International Accreditation forum (IAF), Pacific Accreditation Cooperation (PAC) and International Laboratory Accreditation Cooperation (ILAC). Based on peer evaluation process and signing Multilateral Recognition arrangement (MLA) with PAC & IAF , all certificates of certification bodies approved by NACI are internationally recognized in more than 70 countries.NACI performs accreditation activities according to international standards as follows: - Test and Calibration laboratories Accreditation based on ISO / IEC 17025 - Inspection Bodies Accreditation based on ISO / IEC 17020 - Certification Bodies Accreditation based on ISO / IEC 17021 - Product certification bodies Accreditation based on ISO / IEC 17065 -Proficiency Testing Laboratories Accreditation based on ISO / IEC 17043 - Medical laboratories Accreditation based on ISO / IEC 15189 ISO / IEC 15189 standard was formulated based on ISO / IEC 17025 and ISO / IEC 9001: 1388, and included specific requirements for quality and competence in medical laboratories.ISO/ IEC 15189 are used by medical laboratories in developing their quality management systems and assessing their own competence. It can also be used for confirming or recognizing the competence of medical laboratories by laboratory customers, regulatory authorities and accreditation bodies.
O4
Medical Lab Accreditation in Canada
Seyyed Mohammad Reza Fouladi 1 *
1- Social Security [email protected]
Canada with 35182000 total population and median age 40 years and life expectancy 80/84 years in M/F payed 4641 dollars as a total expenditure on health per capita (2014) and also allocated 10.4 percent of GDP on total expenditure on health sector. Ischemic heart disease, alzheimer’s and other dementia, trachea, bronchus and lung cancers were the top causes of death respectively. 14633 individuals work in medical laboratories. the majority of them are in Ontario province(4160) and 2408 of them are working in British Colombia. The standard council of Canada (SCC) offers an internationally recognized accreditation program for medical testing laboratory. The scope of accreditation is to define laboratories’ activities within disciplines ( teaching, controlling and rules) in many parts of the a laboratory including pathology, hematology, … While CAP-1562 gives specific requirements which are applicable to POCT (point of care testing), CAN-P-1569 which stands for accredited medical laboratory, is formally programmed to recognize the ability of laboratories in this background.
16 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O5
Positive and Negative Predictive Values for Hepatitis C Virus Diagnosis Over more than 1000 Laboratories
Reza Nasiri 1, Ali Sadeghitabar 2 *
1- Avicenna Infertility Clinic, Avicenna Research Institute (ARI), ACECR, Tehran, Iran, 2- Reproductive Biotechnology Research Center, Avicenna Research Institute (ARI), ACECR, Tehran, Iran, Secretory of Iranian Scientific Association of Clinical Labolaroty Doctorat, Iranian Scientific Association of Clinical Labolaroty Doctorat, Tehran, Iran [email protected], [email protected]
Viral infection is one of the concerning problems around the world; and determination of the infected individuals is the first step to control them. The detection methods for HCV test are different in terms of protocol and sensitivity. The problem is that these methods can release false results and even several limitations. In this survey the state of quality and accuracy of more than 1000 laboratories in Iran are reported for anti HCV test. The results of HCV test from the laboratories participated inEQAP was analyzed 17000 times during nineteen series (three times annually) since 2008 until 2015. The analysis was based on the methods which the laboratories was applied to do the test and each methods was compared together; therefore the samples was negative or weakly positive for anti HCV antibody. The three routine and wide applicable methods was studied and compared to determine the rate of errors and sensitivity.The sensitivity and error percentage of each method was calculated according to the released results during nineteen periods of EQAP. Total error percentage of Immunochromatography, ELISA and CL/ECL was 11.57%, 9.2% and 7.95%, respectively over the periods and totally there was 8.71 percent false detection in average. The role of laboratories in the world health system in really significant and the released results can change the patient destination. As it is clear from the acquired results, the most error percentage was related to the method with lower sensitivity.
Keywords: Hepatitis C, Enzyme-Linked Immunosorbent Assay, Virus Diseases, Diagnosis, RNA Viruses
O6
Suggestive Executive Validation Process for Medical Diagnostic Laboratories of Iran
Hossein Babaki *
The benefits of accreditation and vision of Accreditation Committee Description of subject , Provide information to laboratory as their rights. How to implemen the accreditation process, How to select evaluation and auditors , How to cooperate Accreditation Committee with Laboratory.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 17 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Antimicrobial Susceptibility and Resistance Inhibition Testing O7 – O14
In this panel, we will focus on the study and comparing of antimicrobial Susceptibility test methods, Research and report of antimicrobial resistance, Microbial diseases and Anti Microbial Resistance (AMR) surveillance system, Source finding of pathogens and detection of specific reservoirs and Strategy for improvement of a regional/inter-country reference laboratory network for management and prevention of Microbial Diseases and antimicrobial resistance. Dr. N. Rahimifard, DCLS, PhD Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O7
For Improvement of a Regional/Inter-Country Reference Laboratory Network for Management and Prevention of Microbial Diseases and Antimicrobial Resistance
Nahid Rahimifard 1 *
1- Food and Drug Laboratory Research center (FDLRC), Food and Drug Control Laboratories (FDCLs), Ministry of Health (MOH), Pharmaceutical Sciences Branch, Islamic Azad University, Tehran, Iran [email protected]
Due to increasing antimicrobial resistance of pathogens and difficulties of infectious diseases treatment, many studies have focused on antimicrobial resistance features, determining of each bacterial resistant pattern, introducing new natural or synthetic products for microbial infections, production of more effective antimicrobial disinfections, providing new antimicrobial structures or even textile and cloths such as nano products, but Source finding of pathogens and detection of specific reservoirs and Strategy for improvement of a regional/inter-country reference laboratory network for management and prevention of microbial diseases and antimicrobial resistance play an important role for controlling this disaster. For this purpose we should think in global aspects and work together in all regions. Local working can not be succeeded; it’s needed to have a common strategy for management and prevention of microbial diseases, accompanied by epidemiological research Related governmental and private organizations should be collaborated to care the future of antimicrobial therapy situation.
Keywords: Strategy, Antimicrobial Resistance, Source Finding
O8
Esentation, Evaluation and Comparison of Standard Antimicrobial Susceptibility Tests
Mojdeh Hakemi Vala 1 *
1- Shahid Beheshti University of Medical Sciences [email protected]
Treatment of infectious diseases, especially blood infections (septicemia) must be done as quickly as possible to prevent dissemination. Prescribing a suitable antibiotic is usual challenge for clinician, because mutation or acquisition of resistant factors in most bacteria causes treatment failure. The antimicrobial susceptibility methods are divided to: agar / broth dilution methods (quantitative), agar disk diffusion (qualitative), E-test (quantitative), Automated methods (quantitative) and genotypic methods. Among the above methods, agar disk diffusion method is rapid, simple and cost effective vs. MIC determination by dilution methods with high error rate and difficulty. Automated methods are reliable, high reproducibility rate and fast, occasionally, results are ready less than an hour. However, they are costly and their routine use is not possible in clinical laboratories. The genotypic methods used to identify the responsible resistant gene and are not common in usual clinical laboratories. To confirm the accuracy and reproducibility of results, each of selected test must do based on a standard protocol such as: CLSI, EUCAST, OIE, BSAC, SFM, SRGA and CDS. Continuously, to monitor results’ accuracy doing temporary quality control tests in each clinical laboratory is mandatory based on the same selected standard protocols.
Keywords: Quality Control, Antibiogram, MIC, Disk Diffusion Method
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 19 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O9
Laboratory Diagnosis of Hetero Resistance Phenotype in a Bacterial Population from Clinical Samples
Masoud Alebouyeh 1 *
1-Research Institute for Gastroenterolgy and Liver Diseases- Shahid Beheshti University of Medical Sciences [email protected]
Hetero resistance refers to a phenomenon in which different resistance phenotypes are seen against an antibiotic among subpopulations of a seemingly isogenic bacteria.This phenomenon is very important in clinical conditions, since greater numbers of resistant subpopulations are probably selected during antibiotic therapy. Usage of more non-standard complex and expensive methods in detection of this phenotype has been diminished the attention to its importance for therapeutic decisions at clinical setings. Different criteia have been proposed for laboratory diagnosis of hetero resistance among different species of bacteria; these criteria are mainly rely on phenotype diversity at a cut off concentration which diagnosed by disk diffution, agar dilutuion, Etest methods. This could also be diagnosed at different antibiotic concentrations and growth temperatures. The hetero resistance term is also applied in molecular microbiolgy, which refers to a subpopulation of bacteria whithin a sample of organism that present mutations at specific antibiotic resistance genetic locus. Population analysis profiling (PAP) using MIC detection method, either broth dilution or agar dilution methods, is one of the best diagnostic method for diagnosis of hetero resistance phenotype. Existence of colonies presenting MICs >8 folds is a definitive criterion for diagnosis of hetero resistance, however MIC equal to 8- folds or <=4-folds are definitive for intermediate hetero resistance and homogenous bacterial populations, respectively.
Keywords: Hetero Resistant, Bacterial Infection, Laboratory Diagnosis
O10
Frequency of Isolation and Antimicrobial Susceptibility of Bacteria Isolated from Infected Patients at Children’s Medical Center, Tehran, Iran, 1996–2016
Babak Pourakbari 1 *, Setareh Mamishi 1, Shima Mahmoudi 1
1- Pediatrics Infectious Diseases Research Center, Tehran University of Medical Sciences, Tehran, Iran [email protected], [email protected], [email protected]
Frequency of isolation and antimicrobial susceptibility patterns of pathogens provide essential information regarding the selection of antibiotic therapy for patients with different infections living in Iran. Emerging antimicrobial drug resistance among pathogenic bacterial can limit therapeutic options and complicate patient management. To encourage the prudent use of appropriate antibiotics in our pediatric population at Children’s Medical Center Hospital, Tehran, Iran, we studied the frequency and antibiogram patterns of different bacteria isolated from infected patients in the last 20 years.There were notable differences in the antimicrobial susceptibility of isolates in different times, which can help set priorities for focused control efforts. Because resistance varies according to specific location, continuous local monitoring of resistance patterns is necessary for the appropriate selection of empirical antimicrobial therapy. Our findings highlight the importance of a nationwide surveillance programme to monitor the trends in isolation frequency of bacteria and their antimicrobial resistance patterns throughout Iran.
Keywords: Antimicrobial Susceptibility
20 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O11
Identification of Enterococcus from Urine Samples in Patients Hospitalized in Emam Khomeini Hospital (Tehran) and Determination of Antimicrobial Susceptibility Patterns
Seyedesomaye Jasemi 1 , Saeedeh Mahfouzi 2 , Alireza Abdullahi 3 , Mohammad Mehdi Feizabadi 3 *
1- Department of Microbiology, School of Medicine, Tehran University of Medical Science, Tehran, Iran, 2- Imam Khomeini Hospital Laboratory, Tehran University of Medical Sciences, Tehran, Iran, 3- Department of Microbiology, School of Medicine, Tehran University of Medical science, Imam Khomeini Hospital Laboratory, Tehran University of Medical Sciences, Tehran, Iran [email protected], [email protected], [email protected], [email protected]
Introduction: Enterococcus is a commensal gut bacteria in humans but under certain condition can cause a variety of infections in healthcare settings worldwide. This organism is considered as the second most common cause of urinary tract infections. The aim of this study was identification of Enterococcus from urine samples in patients hospitalized in Emam Khomeini hospital (Tehran) and determination of antimicrobial susceptibility patterns. Materials and methods: Enterococcus isolates were identified and confirmed by morphological and biochemical laboratory tests. Antimicrobial susceptibility test was performed using standard disk diffusion method. Results: Urine samples collected from 10776 hospitalized patient. Enterococcus was recovered from 124 (9.8 %) of 1256 culture positive urine. The most effective antimicrobial agents against Enterococcus was Nitrofurantoin (91.9 %) and linezolid (97.5 %) respectively. The most frequent resistance observed to erythromycin (90.3%), ceftazidime (87%), and ceftriaxone (84%). Resistance to vancomycin was 38 %.Conclusion: The increasing of resistance to antibiotic was observed. The prevalence of vancomycin resistant Enterococcus was high. Therefore a comprehensive infection control strategy and taking preventive measures should be given more consideration.
Keywords: Enterococcus, Antibiotic Susceptibility, Urinary Tract Infections
O12
Antimicrobial Susceptibility Testing (AST) Challenges in Clinical Microbiology Laboratories
Mohammad Rahbar 1 *
1-Department of Microbiology, Iranian Reference Health Laboratories- Ministry of Health and Medical Education [email protected]
Performance of susceptibility testing is the main tasks of microbiology laboratories. The aims of AST is detecting drug resistance in pathogens and to assure susceptibility to drug of choice for treatment of infections. There are many AST methods including phenotypic and genotypic methods. Phenotypic methods such as disk diffusion and minimum inhibitory concentration methods (MIC) are used widely in microbiology laboratories. Performance quality control of material such as culture media and antibiotic disks are essential for achieving satisfactory results for selection of appropriate antibiotics for treatment of patients. There are guideline such as CLSI that provide tables that list the antimicrobial agents appropriate for testing of common isolates of microorganism. Unfortunately some laboratories do not use these guidelines. The results of AST must be interpreted by the laboratory before reporting to physician. Optimal interpretation of MIC needs knowledge of the pharmaceutics of antibiotics and source of infection. Interpretation of AST results needs referring to expert sources such as CLSI. These sources are updated and revised every year. There are many new methods which are introduced by companies and investigators. For each new method accuracy, a representative of resistant and susceptible strains should be tested and the results must be compared with standard methods. Other changes in AST are lack of defined breakpoint for some newly introduced antibiotics and for certain organisms. In conclusion for performance of reliable AST performance of quality control and using of standard guidelines such as CLSI is mandatory.
Keywords: Antimicrobial Susceptibility Testing Challenges
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 21 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O13 Viral Resistance Study: Challenges, Progress, and Opportunities
Seyed Reza Mohebbi 1 * 1- Department of Medical Virology, Gastroenterology and Liver Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran [email protected]
Viral infections are one of the most important heath issues worldwide. Human immunodeficiency virus (HIV), Hepatitis C virus (HCV), Hepatitis B virus (HBV) and Influenza virus are the main aims for designing and development of antiviral treatments but drug resistance is a major threat to long term success of the antiviral therapy. The most important nucleoside reverse transcriptase inhibitors resistance mutations are M184V/I. Other common resistance mutations include K65R, K70E/G/Q and L74V/I. In Hepatitis C virus, the natural polymorphism Q80K reduces susceptibility to Simeprevir and the S282T mutation was the most common mutation against sofosbuvir and L31M is frequently observed among NS5A sequences against daclatasvir. Major resistance mutations for HBV have found in patients under lamivudine treatment and known as rtM204Q, rtM204V and rtL180M mutations. For influenza virus, development of resistance to zanamivir or oseltamivir has been identified during treatment of seasonal influenza. Viral drug resistance testing can be performed by phenotypic and genotypic methods. Each thechnique has its own benefits or downsides. However, the necessity of proper diagnostic techniques is undeniable and an increasing demand for antiviral mutation detection tests has been observed during recent years. Control of viral infections with antiviral agents is a requirement and researchers and clinicians together should work to achieve to this goal. Keywords: Drug Resistance Mutation, Human Immunodeficiency Virus, Hepatitis C Virus, Hepatitis B Virus, Influenza Virus
O14 Laboratory Techniques for Extended Spectrum Beta Lactamase, AmpC and Carbapenemase
Sun Hoe Koo 1 * 1- Department of Laboratory Medicine, Chungnam National University College of Medicine, Daejeon, Korea [email protected]
Extended spectrum beta lactamase (ESBL) is an enzyme that hydrolyzes extended-spectrum beta lactam antimicrobial agents such as penicillins, aztreonam, and all cephalosporins except cephamycin.AmpC beta lactamase hydrolyzes penicillins, beta lactamase inhibitors, aztreonam, and cephalosporins except 4th cephalosporin. Both ESBLs and AmpC beta lactamases are associated with broad multidrug resistance and therapeutic options for patients infected by ESBL or AmpC producing bacteria are limited. Recent increasing carbapenemase-producing enterobacteriaceae (CPE) are resistant to carbapenem, which is a drug susceptible to ESBL and AmpC beta lactamase. ESBL-, AmpC beta lactamase-producing organisms and CPE are main concerns, because their prevalence is increasing in South Korea. In E. coli and K. pneumoniae, 23-31% and 28-33% of isolates were resistant to extended-spectrum cephalosporins, in 2015 study. Resistance to cefotaxime of K. pneumonia is consistently increasing annually ( 34% in 2002, 34% in 2007, 37% in 2010, and 38% in 2014), suggesting dissemination of ESBL or plasmid mediated AmpC β-lactamase (PABL) producing isolates. The carbapenem resistant rate of Enterobacteriaceae is less than 1-5% yet, but KPC, NDM, OXA-232 producing Enterobacteriaceae have been reported and they are increasing every year. And Acinetobacter baumannii and pseudomonas aeruginosa show already high resistance to carbapenem in South Korea. Carbapenem-resistant A.baumannii and P.aeruginosa increased to 60-80% of A.baumannii and 30-40% of P.aeruginosa, respectively. Therefore, rapid and reliable detection methods for ESBL, AmpC, and CPE are crucial for effective patient management. The first step for detection of ESBL is a screening for reduced susceptibility to any of the recommended screening agents such as cefotaxime, ceftriaxone, ceftazidime, cefpodoxime, and aztreonam. As ESBL confirmatory test, double disk test, CLSI confirmatory test (Disk diffusion and broth microdilution), commercial tests using Vitek2 and Microscan, and E-test strips for cefotaxim, ceftazidime, and cefepime with clavulanate can be performed. Also, molecular tests such as PCR and DNA sequencing are used for detection of ESBL. To detect AmpC beta lactamase, cefoxitin susceptibility test is performed as screening test, and as confirmatory test, there are three dimensional extract test, cefoxitin Hodge test, AmpC (Tris-EDTA) disk test, and AmpC inhibitor (boronic acid) disk test. The primary screening tests for CPE infection are identification and antimicrobial susceptibility test through culture of clinical specimen. As confirmatory tests for carbapenemase production, Modified Hodge test, Carba NP test, and carbapenemase inhibition test which classifies carbapenemase type (class A, class B) are performed. And each genotypes (KPC, NDM, OXA-48) are detected by PCR. The prevalence of ESBL, AmpC beta lactamases, and CPE is increasing not only Korea but also worldwide. So, we should moniter their resistance, study their resistance mechanism and effective detection methods, for the future ahead.
22 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Comparison of Laboratory Systems in Iran and Other Countries O15 – O19
Nowadays different countries have different laboratory service systems that indeed differ in each country based on policies, plans and objectives of the country.
Meanwhile it is tried to make the laboratory systems of countries proportional to the transformations in economic, education and health care systems and advances in accordance to the twenty-first century and on the other hand to provide necessary coordination between the laboratory system and the labor market in the fields of services, education and research.
In this topic the structure of the laboratory system will be dealt as the beginning of studies on the other laboratory systems in the world.
Dr. F. Shaygan, DCLS Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O15
System of Turkey’s Medical Laboratory
Fariba Shayegan 1 *
1- Shahin Vila Laboratory [email protected]
Introduction: Turkey can be described as one of the successful countries in the field of health and care, which is indebted to the solidarity and the Coordination idatoralth and careessful countries coordination of the government house and the chairmen. Purpose: Getting to know the system of health and medical lab of neighboring countries that are more similar to Iran in various systems such as economic, education, and cultural helps to create and develop an appropriate medical lab system. For the cited reason Turkey which is being considered as one of the top 20 industrial countries by economists and politicians is chosen for this research. Research method: this research is of qualitative kind. Discussion: Turkey for being in the Europe continent is effected by European :union:’s technology, management, and systems in different areas of health and medical lab. University education of the field, medical lab, starts from undergraduate in Turkey and the educational planning is done without the interference of the health ministry. In Turkey, graduate students will be approved in scientific and skill competences before starting to work, which is mostly in governmental sectors. Technical assistants of laboratories in Turkey are PhD graduates of the fields: clinical biochemistry, microbiology, and immunology; also the place of each of these fields is specified in Turkey’s health system. Because the majority of people is sent to mega labs to be analyzed. Results: in order to establish an advanced medical lab system the cooperation of all areas with the world is needed.
Keywords: Lab System, Turkey, Health, Education
O16
Laboratory System of Iran
Seyedeh Robabeh Seyed Javadin *
Health and hygiene conditions in any country are of criteria of estimating the rate and the direction of sustainable development. Recently; Iran, as one of developing countries, has commenced its programs to improve the health indicators and reach an integrated and efficient program matching to its economic, aboriginal and social characteristics as well as the universal standards. This article is to study medical diagnostic laboratory systems in the area of health and hygiene in Iran. It attempts to determine the real place of medical diagnostic laboratory systems in health, hygiene and treatment systems in the country concerning human resource considerations, administrative-educational structures, technology, knowledge and current regulations. Having considered the above-mentioned factors, the study aims to provide necessary context to compare current laboratory systems in Iran with some in other countries in the world. It hopes that the result of this comparison could be used to improve these systems in the future.
24 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O17
Laboratory System in Germany and Austria
Seyed Ghasem Mostafavi
Development and expansion of different laboratory sciences and the important and vital role of laboratories in controlling disease and promoting public health in society necessities designing and coherent and advanced laboratory system, that has the task of coordinating laboratory activities in all diagnostic centers and essential standard codification for evaluation and monitoring on these centers.Therefore the study of laboratory system of developed countries can be an appropriate pattern for policy makers in the field of country health which with regard to economic and cultural situations in the country and after localization of them, present proper solutions in direction of establishing moderate and optimized system.European countries before the formation of the union pursued in the field of training laboratory medicine specialists, establishing laboratory centers, controlling and monitoring on their functions and needed standards codification for special and unique policy to the country.Subsequently, the formation of European Union and for facilitation in other union’s countries has created the gradual of the International Federation of Clinical Chemistry and Laboratory Medicine (IFCC), variant specialized commission which have the role of coordination in all activities, evaluation and needed audits.In this research it is tried to assess the instruction of institutes and described responsibility until maybe from this means a proper pattern for establishing laboratory system be provided in our country.
O18
United States Laws and Regulations and the Standing of Our Profession in USA
Zahra Sara Ansari *
The Center of Medicare and Medicaid Services (CMS) and Clinical Laboratory Improvement Amendments (CLIA) are the regulatory agency and laws that oversight the Laboratories in United States. Each state also has the authority for adding more regulations which if they are more stringent they will supersede the CLIA regulations. Therefore in order to practice as a CLS (Clinical laboratory Scientist) equal to a bachelors in IRAN there are different rules in every state. Hereby I will be giving more information to you about state of California that is under CLIA rules and is regulated and inspected by Laboratory Field services (LFS) under California Department of Public Health (CDPH). The Pricing negotiation with government agencies are mostly under CMS. The Status of our Profession in United States including the Associate, bachelors and Doctorate level (PhD) degrees. Almost all of the major states need a form of Certification for being a CLS either from ASCP (American Society of Clinical Pathologist) or ABB (American Board of Bioanalysts) under American association of Bioanalysts (AAB)) but definitely all states need certification for Lab Director in United States. In California Certificate of CLS and CLB (for directors) from LFS (CDPH) is a must. Technologists without the required Licenses can only work as a Lab-Aide. Comparison of getting the permits and licenses in different states in USA. In order to get to a director level in United States applicants needs a PhD of any biological sciences and at least have 4 years experience as a CLS including at least 2 years of supervisory level.(California different). Frequency of inspections for lab recertification and Condition level deficiencies that could end up to the closure of the laboratories. Comprehensive QA program in order to maintain quality and reliability of results and passing necessary inspection. Proficiency testing programs at least 3 times a year (agencies like AAB and ASCP and API, produce the material). Medicare, Medicaid and private insurance companies (like Anthem, Blue Shield) controlling the pricing and reimbursement levels. The fight in US healthcare system and Affordable Care Act (Obamacare). Different healthcare systems.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 25 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O19
Canada Laboratory System and Policies
Mohsen Ghahremanlou 1 *
1- Clinical & Research Project Manager Doctorate in Clinical Laboratory Medicine [email protected]
The Canadian Society for Medical Laboratory Science (CSMLS) is the national certifying body for medical laboratory technologists and medical laboratory assistants, and the national professional society for Canada’s medical laboratory professionals. The purpose of this organization is to: To promote and maintain a nationally accepted standard of medical laboratory technology, and. To promote, maintain and protect the professional identity and interests of the medical laboratory technologist and of the profession. Basically, all of the medical laboratories professionals, including technicians, technologists and lab directors must have passed either certification exam or clinical scientist fellowship to be eligible to be part of the medical laboratory and have permission to work in the lab. The Clinician Scientist Training Program is directed to the training of future clinician scientists. The program involves two to four years of research training under the supervision of a member of the Faculty of Medicine, University of Toronto. It is open to Canadian citizens or permanent residents currently training in one of the subspecialties of Laboratory Medicine at the University of Toronto who are considering pursuit of a research career in academic medicine. In general, to be a clinical/medical laboratory doctor or director, applicants with a PhD degree may enter a two-year research program as a postdoctoral fellow. There is a couple of universities that offer this fellowship such as University of Toronto and McMaster University.
26 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Information Technology Management in Laboratory O20 – O23
With the advancement of Information Technology and related systems, the quality and accuracy of activities will increase. Clinical laboratories are currently using Information Technology in their fields of activity including: - Patient reception - Results reporting - Reporting of insurances However, there are many areas in clinical laboratories that do not yet use information technology. Such as: - Integration of test results in a city and province of the country and data analysis in order to use for healthcare and research purposes. - Reporting diseases online to national health authorities - Reporting required reports to insurance organizations to analyze the diseases in order to optimal use of resources and provide better service to patients. Dr. S. M. H. Hashemi Madani, DCLS Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O20
The Place of Private-Sector Companies in Development of LIS Software
Naser Shaker Hosseini 1 *
1- Institute Medical Sciences, Tehran [email protected]
Whatever nowadays known as “Electronics Health File”, begins by the use of the first LIS in late 60s in laboratories, genuinely. The main activists of this zone were private sector in supplying and demanding in Iran. In early 80s, on prepared platform of hardware, software, and experiences of private sector, the main Iranian insurers setting up “diskette list” program. Now, the knowledge and experience of laboratories managers in the country is figuring out the number of supplying in LIS market. The adherence of exploited software in laboratories could lead to the expansion of ERP. In new great laboratories, it is impossible to manage the errors of pro-analytics and post-analytics without applying special software. Connection to clients (clienteles, sample consigners, and doctors) implies the use of online systems of Costumer Relation Management (CRM). Series of supportive and expansible services are necessary. The process of production, expansion, and support of LIS software via private sector, is organized in ICT Guild Organization.
O21
Interoperability and Health Care Standards in Med Lab
Ilia Ghobeiti *
With ever increasing number of software systems , functionality and need for new systems and also with flourishing of new environments, smart systems, diagnostic systems and technologies, the need for interoperability of different software and operating systems in the medical and for our emphasized purpose medical laboratory is indispensible .For one example consider a laboratory wanting to simply send a patient test result to a doctor or a colleague . The results may be from different software or analyzers each using different output formats , making it impossible to interoperate and integrate in different systems .There are different international standards for medical and laboratory interoperability. Here a quick review of the internationally accepted standardsworthy of mentioning . Let’s not forget , these standards are often huge in size of documents , technicalities , and information and syntax. More overly, to implement HL7 all software parties must abide . Given the current circumstances and development time line . The best that can happen right now is for the governmental and Organizational communications follow internationally accepted protocols. It is imperative that the standards should be looked upon in the view of “what’s first basis”. Of course the march toward international standards has already began. The challenge is to find ways to persuade everyone to join in.It is important to realize that implementation of the standards should not mean to be the best tool to examine software systems that are operating in the field. However , step by step implementation of correct set of standards with precise pick and choose in the design and features is the key in encouraging private sector software systems to follow suit. In this understanding, attaching grading to software ratings and approval seems quite appropriate and encouraging .In general we should consider how rapid advancements in the development of e-health standards must accompany three trends in electronic healthcare in the coming decade: 1. Advancements in healthcare delivery via mobile and wireless e-health technologies; 2. Personalized medicine, including personal health records, medical diagnostic devices, and biometric records; and 3. Interactive healthcare via social media and Web 2.0 applications. The report should also provide an introduction to some of the institutions working to develop standards in the capacious area of e-health, including CEN/TC 251, DICOM, HL7, ISO/TC 215, ISO/IEEE 11073 and, in particular, the work ITU-T is doing in e-health standards areas such as telecommunications and mobile infrastructure, multimedia e-health applications, and emergency and disaster response.
28 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O22
Future Role of Laboratory Information Systems LIS in Health Care & Medical Laboratories Ehsan Bitaraf*, Seyyed Mahmoud Tara
In recent decades, there have been remarkable developments in several aspects including social, cultural, educational, economical, etc; most of which happened due to Information Technology (IT) development. One of the most important areas of this progress is medical science that health, treatment and patient care are considered as its subsets. Patient encounters to health care facilities and filing their info on hard copies on patient records has brought its own problems and it was not possible to easily predict, prevent or control disease.The progress in information and communication technology has provided the possibility of electronic communication among patient, healthcare provider and healthcare facilities, so that it is possible to capture and process the physical and mental status of a patient as well as the one’s vital signs. This makes the health system to respond in proper time in case any warning arises. Besides, establishment of Electronic Health Record Systems (EHRS) have made it possible to store the information regarding health status of an individual permanently.The results of these findings, determine the necessity of implementation and organization of eHealth Systems and Electronic Health Record Systems, presenting a coherent format to provide information to health professionals and empower patients. It is noteworthy that using IT facilities in health domain leads to more health information accessibility for the society and eliminating spatial distances among cities and countries. It also improves the relationship between the patient and the healthcare provider and causes better health information communication. All of which mentioned above, can play an important role in patient empowerment and thus national action is required. Medical diagnostic tests are of the most important information resource regarding the health status of individuals. Establishment of a standardized information system to register, report and communicate laboratory results is the most crucial step for eHealth development in the country. Establishment of Hospital Information Systems (HIS) in Iran was a good practice that encouraged the IT office of Ministry of Health and Medical Education as the national coordinator for eHealth to extend this experience to the laboratories all over the country. The office is planning to develop a global standard so that Laboratory Information Systems could conform according to it.We hope that these efforts could come to fruitful results in near future and all individuals could benefit from it and proceed to an electronic and reliable society.
O23
Online Analysis of Medical Laboratory Data, Causes Improvement of Health Care
Seyed Mohammad Hasan Hashemimadani, Hesamaldin Alltaha [email protected]
The value of permanently saving an electronic image of clinical laboratory data, and others have illustrated the valuable clinical, operational, and management information that can be derived from these data is well established. It is important to recognize the distinction between a data warehouse and a clinical repository (or electronic medical record). The data warehouse is constituted primarily for retrospective data analysis and contains sophisticated analytic tools, and a response time of 1 to 2 minutes is quite acceptable. The data repository might contain data of an equal volume, variety, and longevity, but it is organized and optimized for pulling together all clinical observations on a patient. Because the data repository is constituted to support patient care, subsecond response time is required. Despite the clinical benefits already obvious a decade ago, health care institutions have been slow to implement repositories .We are trying to emphasize and illustrate the importance of saving and using the data generated from the laboratory database. Regrettably, far too few laboratorians have taken this pioneering work to heart. How do we create laboratory “spare” resources to perform hundreds of nonreimbursed assays to establish (or validate) a new reference range.In our research , we established reference ranges for our test chemistry panels in laboratory all over the country during our test using the “warehouse” patient data accumulated from 10 laboratories during last year. Every laboratory was designated with demographic information of its location. So the patients information was conducted for different states and provinces. And a comparison of results was conducted . Detailed quantitative data on many tightly focused age groups have enabled discernment of important age- and sex related trends (eg, that young males have typically “high” alanine aminotransferase levels and that a “normal” bilirubin level in a woman actually might be pathologically elevated) , which could be lost in reference range studies that studies a total of only a few hundred people . The bottom line:All laboratories should ensure that records of all patient testing are preserved in a permanent, machine-readable form—preferably online on an analysis engine. it will be necessary to copy all data to a more modern computer (such as a PC) where it can be stored long-term and analyzed. If you have not saved your data, you cannot mine it for outcome studies or for clinical and management applications. Also every well-established outpatient-oriented laboratory should pursue the population-based method approach for defining its reference ranges for common chemistry analysis.In Data Warehousing of Clinical Laboratory, Different Kind of Analysis is Possible, Which is Important for Hygiene Systems.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 29 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Laboratory and Clinic: Anemia O24 – O27
To address existing problems and to improve the quality of hematology Lab. services regarding anemia in clinical in Iran, according to national and international standards - guidelines Anemia is one of the main problems of public health system in many countries which affects health with adverse effects on social & economic issues. According to the latest report of WHO, 43% of children, 38% of pregnant women, 29% of non-pregnant women and finally 29% of all women of reproductive age have anemia globally. Clinical Labs have important role & responsibilities in diagnosis, classification, determination of etiology and monitoring therapy of many types of hereditary and acquired anemia, so notice to challenges and improving the quality in this field is very important. In this session we decide to review the latest criteria for diagnosis regarding clinical & Lab. finding, classification, epidemiology, problems in diagnosis regarding point of view of pediatric & adult hemato-oncologist colleagues, new useful lab. parameters for anemia, harmonization & standardization of nomenclature & report of abnormal erythrocyte morphology, specific hemolytic anemias and advanced technology in this field. Dr. B. Poopak, DCLS, PhD Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O24 Detection & Treatment of Hereditary Anemias in the Era of NGS Mohammad Taghi Akbari 1 *
1- Department of Medical Genetics, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran [email protected]
The response to drug treatment, as well as the occurrence of adverse events, is complex, involving multiple genetic and environmental factors and their interactions. Precision medicine is based on the understanding of genomic, epigenomic, environmental and pathophysiological factors as well as on drug interactions. In the past years, genome-wide association studies (GWAS) have identified a lot of common genetic variants underlying susceptibility.The availability of genetic and genomic data is considered an important advance towards characterizing and explaining the variability in treatment response. Since the drug response is complex, no single molecular event is expected to fully unravel the mechanism of its variability among individuals. In this context, the development of high-throughput technologies to detect genetic variation and gene expression certainly marked the opening of a new era for genetic and clinical research. Massively parallel DNA sequencing technologies, termed next generation sequencing (NGS), have rendered the whole-genome resequencing of each individual more and more practical. The increased knowledge of genetic and genomic differences among individuals has enhanced the attention given to the individual response, leading to a transition from population-based dosing and prescriptions to patient individualization both in drug development and in clinical practice. Anemia affects vast numbers of the world population, mainly due to iron deficiency. However, secondary anemia, i.e. the anemia of chronic disease or anemia due to surgical blood loss, is the most common form of anemia in hospitalized patients and the second most prevalent worldwide after iron deficiency. Moreover, anemia is the most common side effect of a wide range of pharmacological treatments for very different conditions. A paradigmatic example of this concept is represented by glucose-6-phosphate dehydrogenase (G6PD) deficiency, which is associated with development of acute hemolytic anemia (AHA) induced by a number of drugs, the best known of which is the antimalarial primaquine. Hereditary anemias represent a substantial and heterogeneous group of anemias in which the identification of genetic variants is crucial for appropriate treatment. Examples of studies of pharmacogenetics in hereditary anemias have been conducted on sickle cell disease (SCD) and thalassemia major. Hydroxyurea therapy has been shown to improve signs and symptoms of SCD, primarily by increasing the level of fetal hemoglobin (HbF). Pharmacogenetics analysis highlighted the role of several SNPs influencing either the baseline %HbF (including 4 SNPs within BCL11A, one in Hb Epsilon and one in XmnIGamma-globin promoter region) or the variation of %HbF between baseline and maximum tolerated dose (MTD); this is the case of the 2 SNPs located in ARG1 and ARG2 genes. In b-thalassemia, to overcome iron overload, oral iron chelators like deferoxamine, deferiprone and deferasirox have been introduced into clinical practice. UGT1A6 is responsible for glucuronidation of deferiprone. In the study by Gunaseeliet al., serum ferritin levels were estimated periodically in b-thalassemia patients to evaluate iron overload and the patients were grouped into responders and non-responders depending on the ferritin levels. A significant difference in the genotypic distribution and allelic frequencies of UGT1A6*2 Thr181Ala (rs2070959) between responders and non-responders was observed. In this presentation, application of NGS in the form of selected panels of genes involved in anemia and their use in detection and treatment is reviewed.
O25 Anemia-Clinical Approach Seyyd Amir Hossein Emami 1 *
1- Imam Khomeini Hospital Complex [email protected]
Anemia is one of the most common problems encountered in daily clinical practice. Diagnosis of anemia begins with clinical suspicion. Attention to symptoms such as weakness, tiredness &easy fatigability, loss of concentration & irritability, hair loss, palpitation & dyspnea during history taking should prompt physician،s attention. Pallor is the most important finding in physical examination which depending on expertise & attention to anemia in clinical setting has 70-100% sensitivity. Apart from morphologic classification of anemia, attention to family history, personal & social history, alcohol and opium use, nutritional habits &other findings such as fever & bleedin would be helpful. In physical exam apart from pallor, findings such as premature graying of hair, lymphadenopathy & splenomegaly, fever and ptechia can lead to specific diagnosis.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 31 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O26
Challenges in the Laboratory Diagnosis of Anemia Behzad Poopak 1 * 1- Associate Professor of Islamic Azad University, Tehran Medical Branch [email protected]
Considering the high prevalence of anemia in the world and also in Iran, the role of diagnostic laboratories in the diagnosis, treatment monitoring and screening of hereditary and acquired disorders is very important.Today, despite the establishment of national standards and presence of laboratories that are equipped with automated cell counters and necessary equipment for testing from simple to complex, we are facing numerous problems in investigation of anemia in the country’s hematology laboratories. Remarkable diversity of automated cell counters, lack of sufficient access constantly to calibrators and blood controls at three levels, different internal quality control procedures and many other factors, have led to discrepancies in the primary test results. Currently, there is a great deal of diversity in reporting of red blood cell morphology among different laboratories in the country. Unfortunately, this has caused that little consideration is spent in cases such as detection and quantitative reporting of schistocytes and has led to creation of many problems in the early diagnosis of patients suffering from thrombocytopenic thrombotic Purpura (TTP), hemolytic uremic syndrome and other similar cases.In spite of new, calibrated and automated cell counters which are able to report the number of red blood cell parameters such as MCV and MCH as well as the morphological flags is there a need to report microscopic morphology, too? Additionally, at present, reticulocyte count is less common in classification of types of anemia due to various reasons, including the lack of sufficient numbers of reticulocyte count, lack of identical detection criteria, and limitations in automated counting and related parameters. Assessment of hemoglobin hereditary diseases is still performed using cellulose acetate and measurement of hemoglobin A2 by chromatography in many centres. These techniques have considerable fluctuation and no capability in detection of all variants. On the other hand, hemoglobinopathies and thalassemia referral diagnostic centres that are capable of detecting all aspects of the diseases have not yet been defined and unnecessary referral of cases for molecular analysis occur more than before because of the weakness in the initial diagnosis. Moreover, there are serious weakness in the field of hereditary and acquired hemolytic diseases of red blood cell membranes in the application of new technologies such as flow cytometry analysis of membrane proteins and molecular diagnostic tests, suggesting severe need for scientific and operational promotion planning.In addition to the above mentioned, the evaluation of enzyme defects which is currently restricted to one or two enzymes in our country requires extensive investigation. Keywords: Clinical Laboratory, Anemia
O27 Controversies in Laboratory Medicine with Special Views to Clinical Hematology Gholam Reza Bahoush 1 * 1- Associate Professor in Pediatric Hematology and Oncology, Onco-Pathology Research Center, Ali-Asghar Children Hospital, Iran University of Medical Sciences, Tehran, Iran [email protected]
The appropriate ordering and interpreting of laboratory tests is an essential element of a physician’s clinical skills. Along with history taking, physical examination, and the thoughtful use of imaging techniques, the clinical laboratory is a major tool in the physician’s armamentarium. The introduction of sophisticated quality improvement techniques into the clinical arena has evolved substantially in the past decade. It makes sense to integrate the changes that we make in our daily practice of medicine with quality improvement changes in the clinical laboratory in order to maximize the functionality of both areas for the safety and quality of care for our patients. For that reason, I was delighted to be asked to contribute to this controversial topic as an opportunity to improve communication between the disciplines of the practice of clinical medicine and clinical laboratory medicine. Having said that, improvement is always possible, so I will discuss below some issues that my clinician colleagues and I believe have some room for improvement. 1-Failure to Provide Useful Information to Help Interpret a Test Result. 2- Standardization of Reference Ranges and Units of Measurement. 3- Laboratory Policies That Interfere With Patient Care. 4- Performance of the Wrong Test. 5- Miscellaneous. Keywords: Controversies, Laboratory Medicine, Clinical Hematology
32 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Laboratory and Clinic: Biomarkers in Neurology O28 – O32
Neurological diseases are disorders of the central and peripheral nervous systems and mainly include encephalitides, epilepsies, strokes, MS, parkinson’s, headaches, etc. Undoubtedly, Neurology in addition to clinical skills required for diagnosis, prognosis and treatment of many diseases of the nervous system, also depends on para-clinic and clinical diagnostic laboratory, in particular. Today, with impressive advances in several fields of science such as proteomics, various biomarkers have been introduced to help disease diagnoses. Moreover, the science of genomics and advances in related technologies such as NGS have drawn attention in the molecular diagnosis of many diseases that can particularly benefit neurologists. In this meeting, after familiarizing the audiences with the latest standards in classification of pediatric neurological disorders, the most important of these disorders will be dealt with including encephalitides, neurometabolic disorders and epilepsies. The role of diagnostic laboratory in the diagnosis, prognosis, treatment and monitoring of diseases will also be addressed. Prominent professors of pediatric neurology, as speakers on the above mentioned topics, will express their expectations from diagnostic laboratories, in particular. Laboratory medicine specialists are also expected to contribute the topics by participating in the panel. Dr. M. R. Bakhtiari, DCLS, PhD Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O28
Cellular and Molecular Mechanisms of Autosomal Dominant Spinal Muscular Atrophy
Majid Hafez Parast 1 *
1- School of Life Sciences, University of Sussex, Brighton, UK [email protected]
Spinal muscular atrophy (SMA) is a common childhood neurological disorder characterised by degeneration of spinal motor neurons, affecting 1 in 6,000 to 1 in 10,000 people. Mutations in DYNC1H1 are the main genetic cause of autosomal dominant form of SMA, known as spinal muscular atrophy, lower extremity predominant (SMA-LED). SMA-LED is often associated with malformation of cortical development (MCD) and learning disability. There are considerable pathological overlaps between autosomal recessive SMN-associated SMA and DYNC1H1-associated SMA-LED at the clinical, cellular and molecular levels. DYNC1H1 is a component of cytoplasmic dynein 1 protein complex, which has crucial roles in axonal retrograde transport, maintenance of the Golgi apparatus, autophagy and the endocytic trafficking pathway. Here I present data that show mutations in DYNC1H1 result in defective trafficking of signalling endosomes and consequently impaired MAP kinase signalling, aberrant post-translational modification of the microtubule cytoskeleton, and that they compromise the structural integrity of the Golgi apparatus. Collectively, these data suggest a set of molecular and cellular mechanisms that provide a platform for further discoveries in understanding the neurodegenerative and defective neurodevelopmental processes in SMA-LED.
O29
The Role of Laboratory Diagnostic Tools in Diagnosis of Pediatric Neurometabolic Disorders
Ali Reza Tavasoli 1 *
1- Children’s Medical Center, Tehran University of Medical Sciences, Tehran, Iran [email protected]
Inborn Error of Metabolism (IEM) and neurodegenerative disorders form a diverse group of brain disorders in children. The brain at birth is the most immature organ in the body and therefore is more often the target of hereditary IEM than any other organ system in initial months of life. IEM affect only approximately 1 in 5000 live births and are therefore relatively uncommon. Neurometabolic Disorders is applied to the group of more than 1000 IEM associated with neurologic abnormalities. Subgroups of neurometabolic disorders are as follow: 1-Disorders involving subcellular organelles (lysosomes, Golgi, peroxisomes). 2- Disorders of intermediary metabolism (aminoacid and organic acid). 3- Disorders of lipid metabolism. 4- Disorders of neurotransmitter metabolism (NKH, serine deficiency, GABA metabolism defect). 5- Disorders of metal (copper). 6- Miscellaneous diseases. Clinical Features suggestive of neurometabolic disorders are: Encephalopathy (CP, coma, MR ), Seizures, Abnormal movement and tone, Ataxia, Microcephaly and macrocephaly, Speech problem, Skin /Hair / Eye Problems, Abnormal odor, Systemic problems ( liver-heart- muscle-kidney- ... ). Many symptoms prominent in patients with IEM are not very specific and can be caused by more frequently occurring conditions, such as infections, or other neurologic diseases. These conditions are usually easier to be diagnosed; therefore, this differential diagnosis should be always being considered first. An easier classification of neurometabolic disorders is based on these four criteria: Anatomic location, Symptoms, Metabolites that are concentrated in the body fluids and neurologic manifestations. Hereditary metabolic and degenerative diseases are transmitted according to different models: Autosomal recessive (AR), Autosomal dominant (AD), X-linked disorders, and mitochondrial inheritance. The majority of IEM are inherited as AR trait. Most individuals with AR inherited metabolic diseases have no family history of the disorder. Initial routine laboratory studies are include: Blood tests (CBC, BS, Ca, Electrolytes, Amonia, lactate and pyruvate, LFT, uric acid, Peripheral blood smear for vacuolated lymphocytes) and Urine tests (ketone, PH, Sulfite granules, Reducing substance, Ferric chloride, DNPH, Nitroprusside). More specific laboratory tests are: EEG, CT or MRI Scan, Leukocyte enzyme assay, Suction rectal biopsy, Bone marrow puncture, skeletal survey and electrodiagnostic studies. Depending on the case the practicing physician selects one or more of these laboratory tests to reach the diagnosis and then after genetic studies help to confirm the diagnosis and also to prenatal diagnosis (PND).
34 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O30
Autoimmune Encephalitis and the Diagnostic Aid of Medical Laboratory
Mahmoud Reza Ashrafi 1 *
1- Professor of Pediatric Neurology, Departement of Pediatric Neurology, Children’s Medical Center Pediatric Center of Excellence, Growth and Development Research Center, Tehran University of Medical sciences [email protected]
Autoimmune encephalitis (AE) is a difficult clinical diagnosis due to its similarities in the clinical, and paraclinical (imaging and laboratory findings) findings with many of autoimmune and infectious encephalitis . Encephalitis is a broad term consisting any inflammatory disease process of the brain that manifests clinically with seizures , alterations of consciousness and/or behavioral changes. Autoimmune conditions are not a common cause of encephalitis and despite a growing knowledge of AE , diagnosis is often considered late or not at all, resulting in poor outcomes . Encephalitis by way of autoimmunity should be considered in the differential diagnosis of any pediatric patient presenting with unexplained encephalopathy of acute or subacute onset. AE is a treatable cause of sub-acute onset of loss of consciousness, cognitive disorder, movement disorders, memory loss and seizure disorders.Several features that may support suspicion of an AE include :Evidence of central nervous system (CNS) inflammation , MRI findings and Clinical response to immunotherapy .Evidence of CNS inflammation including inflammatory findings in the CSF ,consisted of the presence of oligoclonal bands, lymphocytic pleocytosis, and elevated protein, but are relatively nonspecific. In addition, the presence of elevated CSF neopterin may serve as a useful marker of inflammation and may be a more sensitive marker of inflammation than CSF pleocytosis.However, in many conditions, these changes are not present. A comprehensive investigation to exclude an underlying neoplasm should be considered in all cases. An ovarian teratoma is the most commonly associated tumor and is reported to be present in over half of adult female cases of Anti-NMDAR encephalitis .Extraovarian tumors can occur but are much more common in older adults . In childhood, nonparaneoplastic, antibody-associated encephalitis is more commonly diagnosed. In pediatric anti-NMDAR encephalitis, a unilateral or bilateral ovarian teratoma is discovered in approximately 30% of girls aged 18 years or younger and < 10% in girls less than 14 years . Serum and CSF analysis for antibodies targeting neuronal cell surface antigens including :Anti-NMDAR, Voltage-gated potassium channel complex ,Anti-glycine receptor ,Anti-gamma-aminobutyric acid type A receptor,Anti-gamma- aminobutyric acid type B receptor, Anti-dopamine D2 receptor and Ophelia syndrome and autoantibodies targeting intracellular antigens including:Anti-Hu encephalitis , Anti-Ma2 encephalitis and Anti-GAD associated encephalitis is essential for confirmation of AE diagnosis .Imaging especially brain MRI , electrodiagnostic tools especially EEG are part of diagnostic evaluation of AE. Clinical response to immunotherapy is the last evidence of AE diagnosis.
O31
Common Lab Tests in Pediatric Patients with Seizure
Mahmoud Mohammadi 1 *
1- MD, Professor, Pediatric Neurology and Epileptology Head, Epilepsy Monitoring Unit, Children’s Medical Center, Tehran University of Medical Sciences [email protected]
Seizure is not rare in children, occurring in about 0.5-10 percent of pediatric population. Taking a thorough history and doing a complete physical and neurological exam has the key role in reaching the exact diagnosis. Some of the lab exams are essential in the workup of a child with seizure. I can summarize the generic lab test for evaluation of these children; Complete blood count (CBC) and sedimentation rate to screen for infection, and other inflammatory conditions. Blood chemistry tests to check for abnormal electrolyte levels (such as magnesium, sodium, and calcium), signs of kidney or liver malfunction, and other common problems. Lumbar puncture (sometimes called a spinal tap), which is an analysis of spinal fluid evaluated to rule out infections, such as meningitis and encephalitis, especially in patients affected by fever and seizure. Toxicology screen, which examines blood, urine, or hair to look for poisons, illegal drugs, or other toxins. In my talk, I will address some real clinical scenarios in everyday practice.
Keywords: Epilepsy, Childhood, Seizures, Lab Exams, Routine Lab Exam
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 35 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O32
The Importance of Effective Relationship between Laboratory and Clinics in Neurological Diseases
Mohammad Reza Bakhtiari 1 *
1- Biotechnology Dept., Iranian Research Organization for Science & Technology (IROST) [email protected]
Neurology is a branch of medicine dealing with disorders of the central and peripheral nervous systems. Neurologic disorders are wide ranging having various causes, complications and outcomes. Several neurologic diseases are congenital, meaning that they were present at birth. But some others are acquired, which implies that they developed after birth. Meanwhile, those with an unidentified cause are termed idiopathic. Many syndromes are due to gene or chromosome abnormalities, some with congenital malformations and some present as metabolic disorders. Acquired causes of neurological diseases are also significant. They may include neurologic conditions with a background of autoimmunity and/or inflammation, or post infection pathologies. Traumatic injuries to the brain or spinal cord are also considered as acquired causes. Neoplasms and toxins may also damage the nervous system. Most of the diagnoses of neurological disorders have been based on thorough clinical investigations including history taking and medical examinations. Hence, until recently clinical laboratories had minor contributions to such diagnoses. Fortunately, with current advances in technologies such as next generation sequencing (NGS), tandem mass spectrometry and methodologies for detecting inflammatory / immune biomarkers, clinical laboratories have nowadays powerful and stat-of-the art tools, very beneficial and efficient, to assist in complete and absolute neurological diagnoses. So, it seems that the close relationship between neurologists and clinical laboratories could lead to better management of neurological disorders, in comparison with the past.
Keywords: Neurological Disorders, Clinical Laboratory
36 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Laboratory and Clinic: Cardiovascular Disease Biomarkers O33 – O41
Definition & Efficacy, Cardiac Troponins, Point of care Assay, Prognostic Value of troponin, Creatine Kinase-MB, CK-MB isoform, Myeglobin, Homocysteine, High sensitive CRP, B-type natriuretic peptide, Troponin in non ischmic heart discare, Troponin T in Ambulatory patient with heart failure, Other tests, Testing strategy. Dr. N . Almasi, DCLS Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O33
Serum Levels of Secreted Frizzled-Related Protein 4 (SFRP4) in Patients with Coronary Artery Disease
Shahriar Akbari 1 *
1- Forensic Medicine [email protected]
Introduction: The SFRP4 protein have essential role in the promotion of atherosclerosis and coronary artery disease (CAD). In this study, serum levels of the biomarker in relation other traditional cardiovascular risk factors in patients with coronary artery disease (CAD) Materials and Methods: The patients subjects were selected based on clinical criteria and angiography by cardiologist based on parameters angiography and ECG. Serum, proteins SFRP4 in 40 patients and 40 controls was measured using ELISA kits ELISA immunoassay. Lipid profile (LDL, HDL, total cholesterol and triglycerides) was determined by enzymatic methods. Other cardiovascular risk factors were also assigned through medical history and questionary. Serum levels SFRP4 in patients with control subjects were determined to be assessed relationship between serum levels of this protein SFRP4 phase of myocardial infarction with other risk factors was value. Results: SFRP4 serum protein in patients with coronary artery was significantly higher than that in normal control. (P <0.05). In the group of patients, protein SFRP4 had a significant relationship with ox LDL and also showed the incidence of coronary artery CAD (p <0.05). Conclusion: Considering the role of SFRP4 in progress of coronary artery disease CAD due to its association with clinic pathologic factors, it can be used as a new diagnostic marker and as a noninvasive method for early diagnosis, introduced in patients of coronary artery disease CAD.
Keywords: Atherosclerosis, Protein SFRP4, CAD
O34
Relationship between Serum Glutathione Peroxidase-1 Activity with Endothelial Dysfunction Level in Patients with Coronary Artery Diseases
Ziyae Aldin Samsam Shariat 1, Fariba Sakhaei 1, Faezeh Morovvat1 *
1- Dep. of Clinical Biochemistry, School of Pharmacy, Isfahan University of Medical Sciences, Isfahan, Iran [email protected], [email protected], [email protected]
Background and aim: Glutathione peroxidases (GP Xs) are a large enzymatic family with peroxidase activity and several isoform in human body. Among these peroxidase enzymes, glutathione peroxidase-1 (GPX-1) is the most abundant isoenzyme in human serum. This enzyme isoform is found in the cytoplasm of nearly all mammalian cells that enzymatically reduces hydrogen peroxide to water to limit its adverse effects. Deficiencies in GPXs have been associated with progression of cardiovascular diseases, however the relationship between serum GPX- 1 activity and endothelial dysfunction level remains controversial. This study examined the relationship between serum GPX-1 activity and endothelial dysfunction level in subjects with coronary artery diseases. Methods: In this case-control study, samples from 38 subjects with coronary artery diseases and 38 healthy subjects of similar age and sex were used. Serum GPX-1 activity and lipid profile measured using a colorimetric assay. Endothelial dysfunction was assessed with FMD technique.Results: Data from the study revealed that in patients with coronary artery diseases, serum GPX-1 activity and FMD was significantly lower than healthy individuals.Total cholesterol ,triglyceride and LDL-c were significantly higher in subjects with coronary artery diseases than in control. HDL was higher in healthy subjects than subjects with coronary artery diseases individuals. Conclusion: It is thought that there is a relationship between serum GPX-1 activity and endothelial dysfunction. It is suggested that decreasing serum GPX-1 activity may cause endothelial dysfunction.
Keywords: Glutathione Peroxidase, Endothelial Dysfunction, Enzyme Activity
38 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O35 Cardiac Biomarkers: State-of-the Art
Mario Plebani 1 * 1- Department of Laboratory Medicine, University-Hospital of Padova, Italy [email protected]
Mortality associated with Coronary heart Diseases (CHD) has fallen steeply in the last decades reflecting, at least in part, the shift in the pattern of acute coronary syndrome (ACS), with the rise in non-ST segment elevation ACS (NSTE-ACS) and a decline in ST-segment elevation myocardial infarction (STEMI), the latter accounting for approximately one-third of all ACS events. This shift in the last decade is basically due to a paradigmatic change in diagnostic testing with a widespread use of cardiac troponin assays, as well as to the change in the risk factor profile of patients with ACS. Cardiac troponin [both troponin I (cTnI) and T (cTnT)] assay] has become globally recognized as the preferred biomarkers for diagnosing ACS, replacing all other laboratory tests including creatine kinase (CK), CK MB, and myoglobin for its “absolute” myocardial tissue specificity. In addition, particularly when measured with recent-generation assays, cardiac troponin assures a diagnostic sensitivity superior to all other biomarkers and much higher than previously developed conventional methods. As for all laboratory tests, but particularly for tests that strongly influences the clinical decision-making process, three critical elements are needed for optimal use of troponin testing in clinical care: a) the analytical performance of the assay; b) the clinical sensitivity and specificity (diagnostic accuracy) of the test results, and c) the clinical reasoning for ordering and interpreting the test result. This is particularly important as cTn values may increase in circulation for many cardiac diseases other than ACS and AMI but still reflecting myocardial damage. In the last decades, we experienced a dramatic improvement of the methods available for troponin assay: not only the clinical sensitivity and specificity have changed as the assays have evolved over time, but its pathophysiology, kinetics and value in clinical decision making have been significantly modified. For example, while the algorithms based on conventional cTn assays adopted a protocol with serial testing at admission (0), and after three and six hours, current hs-assays allows to reduce the timing to 0 and 3 hours, and possibly to only 1 or 2 hours after the first measurement.
O36 Biomarker Detection of Myocardial Injury with Necrosis
Fariborz Nik Aeen *
Cardiac troponin I and T are components of the contractile apparatus of myocardial cells and are expressed almost exclusively in the heart. Although elevations of these biomarkers in the blood reflect injury leading to necrosis of myocardial cells, they do not indicate the underlying mechanism.[5]Regardless of the pathobiology, myocardial necrosis due to myocardial ischemia is designated as MI.Also, histological evidence of myocardial injury with necrosis may be detectable in clinical conditions associated with predominantly non-ischemic myocardial injury. Small amounts of myocardial injury with necrosis may be detected, which are associated with heart failure (HF), renal failure, myocarditis, arrhythmias, pulmonary embolism or otherwise uneventful percutaneous or surgical coronary procedures. These should not be labeled as MI or a complication of the procedures, but rather as myocardial injury. It is recognized that the complexity of clinical circumstances may sometimes difficult to determine the cause of elevation. In this setting, it is important to distinguish acute causes of cTn elevation, which require a rise and/or fall of cTn values, from chronic elevations that tend not to change acutely. Elevations of cardiac troponin values may be due to myocardial injury and related to primary myocardial ischaemia such as Plaque rupture and Intraluminal coronary artery thrombus formation or secondary to supply/demand imbalance of myocardial ischemia (such as Tachy-/brady-arrhythmias, Aortic dissection or severe aortic valve disease, Hypertrophic cardiomyopathy, Cardiogenic, hypovolemic, or septic shock Severe respiratory failure or anemia, Hypertension with or without LVH, Coronary spasm, Coronary embolism or vasculitis, Coronary endothelial dysfunction without significant CAD.Also Injury may not be related to myocardial ischemia such as Cardiac contusion, surgery, ablation, pacing, or defibrillator shocks, Rhabdomyolysis with cardiac involvement, Myocarditis, Cardiotoxic agents, (e.g. anthracyclines, herceptin) Myocardial injury may be Multifactorial or indeterminate mechanism in Heart failure, Stress (Takotsubo) cardiomyopathy, Severe pulmonary embolism or pulmonary hypertension, Sepsis and critically ill patients, Renal failure, Severe acute neurological diseases (e.g. stroke, subarachnoid hemorrhage), Infiltrative diseases(e.g. amyloidosis, sarcoidosis) and Strenuous exercise.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 39 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O37
Cardiac Markers in Atherosclerosis
Najma Asadi *
Atherosclerosis has been regarded as a form of chronic vascular inflammation. It is a condition in which plaque builds up inside the arteries. Plaque is made of cholesterol, fatty substances, cellular waste products, calcium and fibrin (a clotting material in the blood). Numerous biomarkers associated with inflammation have been identified as novel targets to monitor atherosclerosis and cardiovascular risk. It is very important to know the risk factors of coronary artery disease and the role of inflammatory markers. One of these markers is C-reactive protein (hs-CRP) that has been indicated to increase in patients with coronary artery atherosclerosis and it is one of the most actively studied and established inflammatory biomarkers for cardiovascular events. However, hs-CRP response is triggered by many disorders unrelated to cardiovascular disease, which interferes with the clinical application. This inflammatory biomarker has several characteristics that render it particularly attractive. It is an acute phase protein that has been shown to be a marker of systemic inflammation, elevated in response to injury, infection, and other inflammatory stimuli. Recent studies suggest that, besides hs-CRP, other inflammatory biomarkers such as cytokines [interleukin (IL)-1, IL-6, IL- 8, monocyte chemoattractant protein-1 (MCP-1)], soluble CD40 ligand, serum amyloid A (SAA), selectins (E-selectin, P-selectin), myeloperoxidase (MPO), matrix metalloproteinases (MMPs), cellular adhesion molecules [intercellular adhesion molecule 1 (ICAM-1), vascular adhesion molecule 1 (VCAM-1)], placental growth factor (PlGF) and A2 phospholipases may have a potential role for the prediction of risk for developing coronary artery disease (CAD) and may correlate with severity of CAD.
O38
The Effective Management of Coronary Heart Disease 2
Ali Etesanpour *
The effective management of coronary heart disease (CHD) and heart failure (HF) is a challenge to clinicians as a consequence of their prevalence; the rapid evolution of therapies to improve outcomes; and patient, practitioner, and system obstacles to the delivery of care. As a result, clinicians often rely on professional societies for guidance in treating their patients with these illnesses. Coronary artery atherosclerosis is the single largest killer of men and women in the United States. It is the principal cause of coronary artery disease (CAD), in which atherosclerotic changes are present within the walls of the coronary arteries. Atherosclerosis, or hardening of the arteries, is a condition in which plaque builds up inside the arteries and which may require 10-15 years for full development. Plaque is made of cholesterol, fatty substances, cellular waste products, calcium and fibrin (a clotting material in the blood). Angina pectoris is the result of myocardial ischemia caused by an imbalance between myocardial blood supply and oxygen demand. It is a common presenting symptom (typically, chest pain) among patients with coronary artery disease (CAD). Approximately 9.8 million Americans are estimated to experience angina annually, with 500,000 new cases of angina occurring every year. Heart failure develops when the heart, via an abnormality of cardiac function (detectable or not), fails to pump blood at a rate commensurate with the requirements of the metabolizing tissues or is able to do so only with an elevated diastolic filling pressure.
40 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O39
Non-Coding RNAs as Biomarkers for Disease Diagnostics and Prognostics
Majid Hafez Parast 1 *
1- School of Life Sciences, University of Sussex, Brighton, UK [email protected]
Protein biomarkers are of pivotal importance in diagnosis of cardiovascular diseases (CVDs). Their availability and clinical relevance to this group of diseases are, however, limited as they are influenced by the heterogeneity of CVDs, life style, and the populations genetic/proteomics background. Non-coding RNA (ncRNA) species provide an alternative and complementary group of biomarkers for CVDs. MicroRNAs (miRNAs) and long non-coding RNAs (lncRNAs) are two groups of such ncRNAs. miRNAs are distinguished from other small RNAs by the presence of a predicted hairpin fold-back precursor structure in their primary transcript and an approximately 22 nucleotide long mature sequence. miRNAs predominantly regulate the transcriptome/ proteome of the cell. lncRNAs are non-coding transcripts of more than 200 nucleotides in length and they are the most abundant group of ncRNAs in the mammalian transcriptome. lncRNAs have important regulatory functions in gene transcription and epigenetic modifications of DNA. Dysregulation of miRNAs and lncRNA species as regulators of transcriptome and translation plasticity is gaining significant weight in the pathophysiology of CVDs. This paper will discuss the current understanding of ncRNA dysregulation in CVDs and their potential as diagnostics and prognostic biomarkers of CVDs.
O40
Cardiac Natriuretic Peptides
Mahin Mikhak 1 *
1- Dr. Shariati Hospital, Social security, Isfahan, Iran [email protected]
Coronary heart disease (CHD) and other heart diseases can impair the heart`s ability to pump blood, causing the clinical syndrome of heart failure (HF). Clinical chemistry has become important in detection of HF. PreproBNP (134 amino acids) is synthesized in the cardiac myocytes and is processed to a proBNP (108 amino acids) precursor molecule. The proBNP is subsequently cleaved into physiologically active BNP (32 amino acids), and a degradation fragment NT-proBNP (76 amino acids). BNP and NT-proBNP reflects the presence and severity of HF. The symptoms and signs of HF are nonspecific, so an objective test for HF would be extremely useful. Unlike cardiac troponins, which are intracellular proteins that escape from heart muscle cells only because the cells are dead or seriously injured, BNP is a hormone that is secreted into the blood. The secretion of BNP is stimulated by the stretch of the heart wall that occurs in HF. BNP levels decline when effective therapy for HF is instituted, so the test maybe used to monitor the course of treatment. Other proposed applications include risk stratification of patients with acute coronary syndrome (ACS), monitoring disease severity in patients with stable CHD, screening for ventricular dysfunction in selected populations, and testing for drug cardiotoxicity. Similar to cardiac troponins, both BNP and proBNP are measured by sensitive immunoassays methods. A clear advantage of one biomarker over the other for any particular application has not been established. IFCC recommended analytical and pre-analytical quality specification for NP assays.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 41 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O41
QC & Reference Interval in Heart Biomarkers
Naser Almasi *1
1-Management of the Social Security Organization of [email protected]
Reference intervals for some analytes have been replaced by decision limits, established by national (or international) consensus. But for the other , in practice, very few laboratories perform their own reference interval studies. the best means to establish a reference interval is to collect samples from a sufficient number of qualified reference individuals to yield a minimum of 120 samples for analysis, by nonparametric means, for each partition (eg, sex, age range).The fact is that few laboratories, or even manufacturers, do such studies. Often, if any study is done, far fewer individuals are used, with assumptions made about the underlying distributions and about the comparability among partitions. For these reasons, CLSI believes strongly that individual laboratories should focus more on verifying reference intervals established elsewhere, a much less formidable task and this can be done in at least two practical ways:(1) If a laboratory has previously established a reference interval for its own population, then it can verify that reference interval by transference. A major advantage of this option is there is no need to collect samples from reference individuals. One can use existing patient samples, even from subjects not known to be healthy, thus overcoming one of the major obstacles in reference interval studies.(2) As an alternative, a laboratory can verify a reference interval, established by more stringent techniques elsewhere, by collecting as few as 20 samples from qualified reference individuals. Whichever method one chooses, though, the important point is, with as few as 20 samples from reference individuals, a laboratory can verify reasonably well the applicability of a reference interval to its own population and methodology.
42 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Laboratory and Clinic: Cancer Biomarkers O42 – O51
According to the National Cancer Institute (NCI) , a biomarker is “a biological molecule found in blood, other body fluids, or tissues that is a sign of a normal or abnormal process, or of a condition or disease,” such as cancer. Biomarkers typically differentiate an affected patient from a person without the disease. With the steadily growing knowledge about the biology of cancer and the rapid progress in molecular technologies, studies on cancer biomarkers are published almost daily. The cancer biomarkers encompass a vast array of genomic, epigenomic, proteomics, cellular and morphologic, and genetic factors predisposing to the cancer or indicating the occurrence of the disease. Besides screening, cancer biomarkers have also other potential applications in medical oncology including monitoring of cancer progression, differential diagnosis, prediction of recurrence and prognosis, monitoring treatment response and risk assessment. Cancer biomarkers are also useful in cancer research settings for development of target drugs and providing a valid platform as surrogate endpoint for new cancer drugs utility. In this context, it is mandatory for laboratory specialist and clinicians to have an in-depth knowledge of cancer biomarkers in order to know how, whether or not and in what setting a cancer biomarker could potentially be used for disease interpretation and patient care. Dr. A. H. Zarnani, DCLS, PhD Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O42
A Pilot Study of CK19, CK20 and GCC mRNA in the Peripheral Blood as a Colorectal Cancer Biomarker Panel
Pouria Mohammadi 1 *
1- Research Center for Molecular Medicine, Hamadan University of Medical Sciences, Hamadan, Iran [email protected]
Colorectal cancer remains one of the major cancer- related deaths despite progress in the treatment during past decades. Detection of disease at earlier stages reduces its mortality. The aim of current study was to investigate expression of Cytokeratin 19 (CK19), Cytokeratin 20 (CK20) and Guanylyl Cyclase C (GCC) mRNA in peripheral blood of non- metastatic colorectal cancer patients which may result into introducing of an early detection test. 25 patients with colorectal cancer and 25 healthy controls were recruited. Blood was obtained from all individuals. Expression of CK19 and CK20 and GCC mRNA and 18SrRNA (as reference gene) were determined based on real- time RT-PCR on total RNA from blood. CK19, CK20 and GCC expression had been detected in 68%, 76% & 52% of patient group, respectively, which was higher than healthy group, with 8%, 32% and 0% expression, respectively (p<0.05). CK20 was over-expressed 8- fold more in patients compared to controls. Similar result was found for CK19 with 4- fold over- expression. Sensitivity and specificity of combination of markers were 88% and 68%, respectively. Current data suggest that the detection of CK20 & CK19 as relative sensitive markers may become a valuable tool for primary diagnosis of colorectal cancer in early stages. GCC could be considered as a specific tumor marker for detection of colorectal cancer. Higher expression of these markers in patients may be considered as a relative good tool for the diagnosis of disease in non- metastatic stages.
Keywords: Colorectal Cancer, Cytokeratin 19, Cytokeratin 20, Guanylyl Cyclase C, Biomarker
O43
Determination of SFRP1 and SFRP2 Genes Promoter Methylation Status in Patients with Chronicmyelogenous Leukemia with the Method MSP
Elahe Derakhshanfar 1 *, Masoud Karimi 1, Shaban Alizadeh 2, Hasan Rafie Mehr1
1- Hamedan University of Medical Sciences, Faculty Paramedical, 2- Hematology-Oncology and Stem Cell Transplantation Research Center, Tehran University of Medical Sciences, Tehran, Iran [email protected], [email protected], [email protected], [email protected]
Background and Aim: Chronic myeloid leukemia (CML) is myeloprolifrative neoplasm that characterized by an expansion of myeloid, erythroid cells and platelets in peripheral blood and myeloid hyperplasia in the bone marrow. Secreted frizzled-related protein family is a negative regulator of the Wnt signaling pathway that suppress this signaling pathway in healthy individuals. Aberrant regulation of the Wnt signaling pathway is a prevalent theme in cancer biology, and methylation in promoter of SFRP family has been shown to cause uncontrolled cell proliferation in cancer. Chronic myeloid leukemia was the first malignancy in which the important role of Wnt signaling pathway has been described. In the present study, we examined the methylation status of SFRP1 and SFRP2 genes in patients with CML.Materials and Methods: Blood samples were obtained from 25 healthy individuals and 33 patients whit chronic myloied leukemia (23 male, 10 female) Then Isolated DNA was treated with sodium bisulfite and analyzed by methylation-specific polymerase chain reaction (MSP) with primers specific for methylated and unmethylated promoter sequences of the SFRP1 & -2 genes. We used Mann-Whitney u-tests to investigate the correlation between SFRP-1 and SFRP-2 genes hypermethylation and clinical parameters. Results: In CML patient hypermethyleation frequency of SFRP-1 and SFRP-2 genes were 16.1 ℅ and 27.2%. in control group, methylation of SFRP-1 and SFRP-2 genes were negative. Conclusion: The present study showed that, methylation of SFRP genes also occurs in CML. Therefore, the methylation of these genes may play a role in the initiation of leukmogenesis.
Keywords: Chronic Myelogenous Leukemia, DNA Methylation, SFRP Gene
44 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O44
Exosomes in Tumor Microenvironment as Novel Cancer Biomarkers
Roya Ghods 1 *
1- Department of Molecular Medicine, Faculty of Advanced Technologies in Medicine, Oncopathology Research Center, Iran University of Medical Sciences, Tehran, Iran [email protected]
Tumor microenvironment (TME) plays a pivotal role in the formation and maintenance of cancer, participating in tumor initiation, progression, metastasis and drug resistance. Tumors develop in complex environment; in fact, tumours are “malignant organs”. This microenvironment composed of non-cancer cells and components such as cytokines, extracellular matrix and exosomes. Exosomes are small (30-100 nm) extracellular membrane-enclosed vesicles, secreted by various cell types including tumor cells and enter the circulation. Exosomes are enriched with a distinct set of nucleic acids (such as miRNA, mRNA and long non-coding RNAs), proteins, and lipids; therefore, represent different biological functions, according to cell origin. Although the cargo composition of exosomes is dissimilar to that of cytoplasmic content of producer cells, indicating that loading and sorting of exosomes is complex and sophisticated process. They play an important role in cell signaling in both normal states and cancer. Exosomes can reprogram their microenvironment and also communicate with cells distance from site of its origin. Tumor-derived exosomes promote pre- metastatic niche formation and support tumor growth, invasion, angiogenesis, chemoresistance and extracellular remodeling. Due to selective cargo loading, that contain tumor specific proteins and RNAs, tumor exosomes are valuable tool in identifying cancer biomarker especially for clinical diagnosis, for example it has been shown that glypican-1, a cell surface proteoglycan, enriched on tumor exosomes. Monitoring circulating glypican-1-enriched exosomes, demonstrated sensitivity and specificity in distinguishing between healthy subjects and benign pancreatic cancer patients from early/late stage patients. There is growing evidence supporting the use of exosomes in the context of diagnosis application. In addition, excellent stability and biofluids source of exosomes such as saliva and urine, make it very suitable for clinical application.
Keywords: Cancer Biomarkers, Exosomes, Tumor Microenvironment, Body Fluids
O45
High Platelet Count and High Probability of CALR Detection in Myeloproliferative Neoplasms Najmaldin Saki 1 *, Reza Shirzad 1
1- Thalassemia and Hemoglobinopathy Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran [email protected], [email protected]
Background: Calreticulin (CALR) has been recently detected in BCR-ABL1 and JAK2V617F negative myeloproliferative neoplasms (MPNs). Methods: In this study, we used PCR-PAGE and DNA sequencing methods for detection of CALR mutations and analysis of laboratory findings in MPN patients. BCR-ABL1, JAK2V617F, and MPL515 were assessed using RT-PCR and ARMS-PCR methods in 103 suspected MPN patients. CALR was assessed in patients negative for BCR-ABL1 and JAK2V617Fpatients as well as six cell lines (Jurkat, U937, NB4, KCL22, THP1, and K562) using PCR-PAGE and DNA sequencing. Finally, laboratory data of patients were obtained. Results: BCR-ABL1 and JAK2V617F were detected in 39 (37.86 %) and 34 (33 %) MPN patients, respectively. Two patients had combined BCR-ABL1/JAK2V617F mutation. MPL 515 was negative in all the patients. CALR mutation was found in six male JAK2V617F-negative MPN patients (28.6 %, p = 0.07). Platelet count was 1049.5 × 109/L (p = 0.01) in these patients. All patients with type 1 and 2 CALR mutations had platelet counts lower and higher than 1000 × 109/L, respectively. CALR- positive patients had lower WBC count versus JAK2V617F-positive patients. Finally, CALR mutations were negative in all the cell lines. Conclusions: CALR is useful for molecular diagnosis of JAK2V617F- and MPL-negative MPN patients. PCR-PAGE may be a rapid, cost-effective, and simple method, especially in developing countries. CALR mutations are detected in male patients, suggesting different incidences of CALR mutations in male/female populations in different nations and races.
Keywords: CalreticulinJAK2v617fBCR, ABL1MPLMyeloproliferative Neoplasms
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 45 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O46
Cancer Biomarkers and Clinical Applications
Kamran Ali Moghadam 1 *
1- Hematology, Oncology and Stem Cell Transplantation Research Center, Tehran University of Medical Sciences, Tehran, Iran [email protected]
Tumor biomarkers denote to any laboratory data that has a diagnostic, preventive, prognostic or predicative role in cancer diagnosis, prevention or treatment decision making. These markers are biochemical, genetic and genomic, immunologic or pathologic. Some current available markers in laboratory has role in current practice and many of them are investigational or historical significance and are not useful in today practice. So discrimination between useful tests and other tests is important and unwise use of these tests may increase stress of patients and increase cost of patient care without any benefit for patient of health system. Below, I will discuss some important tests in common cancers. Breast cancer: in this common cancer list of useful markers are:Immunohistochemistry for ER, PR, Her2 neu and Ki67 for classification of tumor, Degree of lymphocytic infiltration of tumor, BRCA1 and BRCA2 for suspected familial cancer,Oncotype Dx or equivalent tests, Possibly circulating tumor cells CTC ( investigational yet but may be applicable soon) for monitoring of response, PET CT scan Lung cancer:EGFR mutation, ALK, PD-L1, d- PET CT scan Colorectal cancer:K-RAS , N-RAS and BRAF mutation, Microsatellite instability( MSI), PD-L1, CEA, PET CT scan, May be CTC Gastric cancer, Her2 neu by IHC or FISH, MSI, PD-L1, May be CTC, May be presence of tumor cells in ascites or peritoneal washing, PET CT scan This list expanding rapidly and may be a way toward personalizing medicine.
Keywords: Cancer Biomarkers, Breast Cancer, Lung Cancer, Colorectal Cancer, Gastric Cancer, Clinical Applications
O47
Technical Points Recommended for Accurate Human Epidermal Growth Factor Receptor 2 Testing in Breast Cancer
Mahdi Shabani 1 *
1- Department of Immunology, School of Medicine, Shahid Beheshti University of Medical Sciences [email protected]
The human epidermal growth factor receptor-2 (HER2) HER2 protein is overexpressed in approximately 20-25 percent of breast cancer cases. HER2 overexpression is associated with poor prognosis. However, survival of HER2-positive breast cancer has been improved by advent of new HER2 specific therapeutic monoclonal antibodies such as trastuzumab. In this context, patient’s HER2 status is critical for treatment and other patient management decisions in several ways. Immunohistochemistry and in-situ hybridization are two most commonly used techniques to establish a breast cancer’s HER2 status. In 2007, ASCO/CAP announced that approximately 20% of HER2 testing may be inaccurate that significantly influences the therapy outcomes. Due to HER2 testing importance, in this presentation, the importance of HER2 scoring, available algorithm on HER2 testing, technical points, source of HER2 testing variation in pre-analytical, analytical and post analytical steps and current guidelines in HER2 testing will be discussed.
Keywords: HER2, IHC, FISH, Breast Cancer, Monoclonal Antibody
46 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O48
Micrometastasis Prediction in Breast Cancer by Molecular Biomarkers of Circulating Tumor Cells
Seyed Hamidollah Ghaffari 1 *, Parisa Ghaffari 1, Marjan Yaghmaei 1, Kamran Alimoghaddam 1, Ardeshir Ghavamzadeh 1
1- Hematology, Oncology and Stem Cell Transplantation Research Hematology, Oncology and Stem Cell Transplantation Research Center, Shariati Hospital, School of Medicine, Tehran University of Medical Sciencesenter [email protected], [email protected]
Breast cancer remains the most frequently diagnosed cancer and the foremost cause of death from cancer amongst women. Metastasis is known to be one of the major causes for tumor associated mortality. The treatment of primary breast cancer is aimed at the prevention of distant metastasis. However, when metastasis occurs, treatment becomes primarily palliative rather than curative. Circulating tumor cells (CTCs) have recently evoked much interest in cancer research, representing potential prognostic biomarkers and a reliable mean to predict metastasis development. CTCs enumeration has been used as biomarker not only in the prognostic stratification in early stage of disease, but also in identification of patients requiring adjuvant therapy, evaluation, managing and monitoring patient`s response during therapy, prediction of disease recurrence. We have established an efficient enrichment techniques and sensitive approach for the detection of CTCs in the PB, both before and after adjuvant therapy; and investigated their relationship with the clinical outcome. Our study shows that presence of CTCs play significant association with the process of metastasis and with the disease free survival of breast cancer patients. Thus, the detection of cancer cells in PB of patients diagnosed with primary breast cancer can serve as a prospective predictor of disease recurrence and, hence, signify a patient who may be at risk for a new metastasis.
Keywords: Circulating Tumor Cells, Micrometastasis, Breast Cancer, Biomarkers
O49
New Generation of Molecular Biomarkers in Breast Cancer
Ali Korourian 1 *
1- Hematology, Oncology and Stem Cell Transplantation Research Center, Shariati Hospital [email protected]
Various genetic, epigenetic and genomic changes have been associated with breast cancer. Traditional criteria like St Galen have been used for many years to stratify patients but could not predict tumor behavior of indeterminate category, so new tests for this group is needed. About 60% of breast cancer patients are estrogen receptor positive and Decision about chemotherapy in addition to conventional hormone therapy is a challenging issue. These patients also need prognostic and predictive tests. New generation tests like PAM50, mammaprint and Oncotype will be beneficial for correct decision of chemotherapy and will avoid many Unnecessary treatment and its adverse effects.
Keywords: Breast Cancer, Biomarker, Mammaprint, Oncotype
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 47 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O50
Prognostic and Predictive Biomarkers in Lung, Gastric and Breast Cancers
Marjan Yaghmaei 1 *
1- Hematology, Oncology and Stem Cell Transplantation Research Center, Tehran University of Medical Sciences, Tehran, Iran [email protected]
Molecular alterations are important targets for use in the early detection of lung cancer and for use as surrogate biomarkers in following the efficacy of lung cancer chemoprevention, The challenge is to identify not only the prevalence and temporal sequence of molecular lesions in lung preneoplasia, but also to determine which are rate limiting and indispensable and thus represent potential candidates for intermediate biomarker monitoring and therapeutic efforts. Many genes are involved in tumorigenesis of both small cell lung cancer (SCLC) and non- small-cell lung cancer (NSCLC) but there are also unique genetic aberrations associated with each tumor type. The identification of the nature and frequency of these molecular abnormalities is necessary to determine their clinical implications (e.g., associations with histologic type, stage, survival, response to therapy), and define their clinical utility for the prevention and early diagnosis of lung cancer, and the development of therapeutic targets. Identification of prognostic and predictive biomarkers, such as the EGFR mutation and ALK-EML4 fusion previously described that are both direct targets and predict the response and outcomes to specific therapies. They are biomarkers that may also help as predictive markers and also early assessment of response in gastric and gastroesophageal tumors such as testing for HER2 that identifies patients who could benefit from trastuzumab and molecular markers that might indicate resistance or sensitivity to CF. Amplification of cMyc, Mdm2, Met and deletion of TP53 are other prognostic marker in gastric cancer. In breast cancer HER2 is also a marker that has been widely studied as a predictor of benefit from adjuvant chemotherapy. HER2 overexpression is associated with a relative benefit from anthracycline-based chemotherapy. The 21-gene recurrence score (Oncotype DX) predicts outcome for ER+, node- negative breast cancers treated with tamoxifen 1% or tamoxifen plus chemotherapy in node-negative and node-positive patients. In conclusion, the predictive markers such as EGFR mutation and ALK-EML4, ROSI, and RET fusion in lung cancer and Her2 amplification in breast and gastric cancer play an increasingly important role in selecting optimal treatment strategies as the number of molecularly targeted therapies expands and amplification of protoncogenes of cMyc, Mdm2 and Met and deletion of TP53 play an important prognostic role in gastric cancers. Molecular assays that integrate larger numbers of biomarkers can clarify the role of chemotherapeutic agents in adjuvant treatment in these patients.
Keywords: Prognostic Biomarkers, Predictive Biomarkers, Breast Cancer, Gastric Cancer, Lung Cancer
O51
Tumor Heterogeneity Makes Cancer Biomarkers a Blind View at an Elephant in the Dark
Amir Hassan Zarnani 1 *
1- Department of Immunology, School of Public Health, Tehran University of Medical Sciences [email protected]
Despite absolute need, there is still a paucity of reliable cancer biomarkers for early diagnosis, monitoring of progression, differential diagnosis, prediction of recurrence and prognosis and monitoring of treatment response. Although, with the emergence of high throughput technologies, the list of cancer biomarkers is steadily growing, most of the introduced markers never reach beyond research communities. One main obstacle includes a tremendous heterogeneity which is commonplace in all cancer types. Such diversity in character of cancer cells takes place at several levels- genetic, epigenetic, stage-dependent, positional and at the population level. Meticulously, behavior of each individual cancer cell is profoundly affected by the surrounding different subpopulations of tumor mass. Such complicated nature of the cancer limits our understanding of how cancers behave and place a big obstacle for introduction of valid cancer biomarkers.
Keywords: Tumor Heterogeneity, Genetic, Epigenetic, Stage-Dependent, Cancer Biomarkers, Diagnosis
48 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Laboratory and Clinic: Diabetes and New Findings O52 – O55
Diabetes is one of the most common diseases in the world. In Iran, despite the identification of a large number of patients, there are yet many people who are not aware of their disease, in particular, type 2 diabetes, which is becoming more significant day by day due to the lifestyle changes and unhealthy eating habits. Therefore, making people aware of the importance of diabetes and developing more accurate and rapid techniques for diagnosis and treatment of the disease, should definitely be a priority for the public health programs. In this topic it will be tried to focus on different aspects of diabetes and new approaches for diagnosis and treatment of the disease will be discussed. Dr. M. Taghikhani, PhD Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O52
HbA1c Measurement Challenges in Iran
Farideh Razi 1 *
1- Diabetes Research Center, Tehran University of Medical Science [email protected]
Regular measurement of HbA1c is usually requested by clinicians for management of diabetic patients and also diagnosis of diabetes. Measurement of HbA1c is convenient (does not require fasting), has increased preanalytical stability and is less likely to differ in different days due to stress or illness. Various methods are used for measurement of blood HbA1c levels such as HPLC, electrophoresis, boronate affinity chromatography, enzymatic and immunoassay. In 1993 Diabetes Control and Complications Trial (DCCT) results showed significant differences between Hba1c results obtained from laboratories and consequently HbA1c assays standardization was proposed. The National Glycohemoglobin Standardization Program (NGSP) began in 1996 to implement harmonization and standardization of HbA1c Assays. Also International Federation of Clinical Chemistry (IFCC) Working Group on HbA1c Standardization developed reference methods for HbA1c analysis, including mass spectroscopy and capillary electrophoresis. But although the IFCC/NGSP correlation is brilliant, IFCC results are constantly 1.5-2% HbA1c lower throughout the range of values which may be due to specificity of IFCC methods.HbA1c represents a high-volume request in the medical laboratory in Iran which leads to use of different method in laboratories, some of them are not NGSP certified. Thus, to minimize the variation between methods, reinforcement of nationally standardization and harmonization of HbA1c assays is required.
Keywords: Diabetes, HbA1c, NGSP
O53
Are Circulating miRNAs a Potential Biomarker for Diabetes?
Reza Meshkani 1 *
1- Department of Biochemistry, Faculty of Medicine, Tehran University of Medical Sciences [email protected]
Diabetes is a complex disease characterized by chronic hyperglycaemia due to pancreatic beta-cell dysfunction and insulin resistance. As the worldwide prevalence of type 2 diabetes mellitus increases, it is important to develop cost-effective methods to predict and diagnose the onset of diabetes, monitor progression, and risk stratify patients in terms of subsequent cardiovascular and diabetes complications. Recently, a new class of endogenous non-coding small RNAs, namely microRNAs, have been indicated as putative biomarkers, being released by cells and tissues and found in a cell-free circulating form in many biological fluids, including serum and/or plasma. MicroRNAs have been initially identified as promising biomarkers in cancer, and nowadays their application has been extended to other diseases, including diabetes. Although an increasing number of studies focused on the evaluation of circulating microRNAs in diabetes, few reproducibly identified microRNAs as biomarkers for disease prediction or follow-up. Technological problems as well as the need to obtain highly standardized operating procedures and methods are still an issue in such research field.
50 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O54 Chronic Hyperglycemia and Complications of Diabetes Mellitus Manoucher Nakhjavani 1 * 1- Endocrine and Metabolism Ward, Vali-Asr Hospital, Imam Khomeini Medical Center, Tehran University of Medical Sciences, Tehran, Iran [email protected]
All forms of diabetes, both inherited and acquired, are characterized by hyperglycemia, a relative or absolute lack of insulin, and the development of diabetic-specific microvascular disease in the retina, renal glomerulus, and peripheral nerve. Microvascular complications of diabetes are caused by chronic hyperglycemia, whereas macrovascular complications are caused by both chronic hyperglycemia and the consequences of insulin resistance. The effects of former high HbA1c levels can persist for years after HbA1c values have been lowered (hyperglycemic memory). Diabetes is the leading cause of blindness in people 20 to 74 years old and the fastest growing cause of renal dialysis and transplant recipients. More than 60% are affected by neuropathy and it is the cause of 50% of non-traumatic amputations. Risk factors for diabetic foot ulcers are sensory neuropathic loss of proprioception, and motor neuropathic foot deformity. The rate of cardiovascular complications is increased by twofold to six fold. Tissue damaging effects of hyperglycemia are expressed in capillary endothelial cells, mesangial cells in the renal glomerulus, and neurons and Schwann sells in the peripheral nerves. Diabetes Control and Complications Trial (DCCT) study showed efforts to control blood glucose impact the development or progression of the long-term complications of diabetes. For every 10% reduction in HbA1c the risk of retinopathy progression was reduced by 44%, microalbuminuria or worse by 25%, macroalbuminuria or worse by 44% and clinical neuropathy by 30%. Overview of the Diabetes Control and Complications Trial (DCCT)/Epidemiology of Diabetes Interventions and Complications (EDIC) study at 30 years was published in Diabetes Care in January 2014. EDIC showed a durable effect of initial assigned therapies despite a loss of the glycemic separation (metabolic memory) and demonstrated that the reduction in early-stage complications during the DCCT translated into substantial reductions in severe complications and CVD. In the retina of diabetic rats with poor glycemic control for 2 months, subsequent normalization of HbA1c for 7 months lowered elevated retinal lipid peroxides by only about 50% and had no beneficial effects on levels of oxidative marker 3-nitrotyrosine. Patients with a long-term exposure to a higher level of hyperglycemia became more susceptible to damage from subsequent lower levels of hyperglycemia than they were when they first started trial. Mechanisms of Hyperglycemia-induced damage include increased flux through the polyol pathway, intracellular production of AGE precursors, Protein Kinase C activation, and increased hexosamine pathway activity. Pathophysiologic features of microvascular complications include: intracellular hyperglycemia, abnormal endothelial cell function, increased vessel wall protein accumulation, microvascular cell loss and vessel obstruction, development of microvascular complications during posthyperglycemic euglycemia (Metabolic memory), and genetic susceptibility to microvascular complications. For microvascular disease end points, there is an almost 10-fold increase in risk as HbA1c increases from 5.5% to 9.5%, whereas over the same HbA1c range, macrovascular risk increases only about twofold. Insulin resistance increases cardiovascular risk by 2.5 fold, after adjustment for 11 known cardiovascular risk factors. Hyperglycemia and insulin resistance interact with hypertension and dyslipidemia. Hyperglycemia-induced ROS overproduction reduces eNOS activity in diabetic aorta by 65%. Hyperglycemia-induced ROS overproduction reduces prostacyclin synthase activity in diabetic aorta by 95%. Optimal treatment includes intensive lowering of low-density lipoprotein cholesterol and blood pressure, and control of hyperglycemia.
O55 Principles of Diabetes Treatment
Assadullah Rajab 1* 1- Iranian Diabetes Society
Diabetes is a disease which caused by the effect of decrease or the lack of insulin production or increasing in environmental resistance to insulin. It is worth noting that at the present 480 million people in world are suffered from diabetes which this statistics will be reached to 642 million up to 2040. This number is estimated about 10% of population in Iran and also, about 14% population of more than 20 reported in Tehran. Apart from this issue, more than 90% of them suffered from diabetes type 2. While, according to stated statistics over 40% of them do not aware of their illness.The research results confirm that slight percent of diabetes population have got proper control. Concerning results of some researches showed that improper control is more than 90%. From another side, estimations confirmed that costs will be manifold in case of diabetes side effects that causes from the lack of proper control.The purpose of diabetes treatment is the effect prevention of access in short and long period beside self-preservation and promotion of life quality. According to chronic quiddity of diabetes that affects all aspects of diabetic life and also, the necessity of patient-centered diabetes treatment. So, a diabetic patient must participate in his treatment by all means. It is not possible except acquiring applied training and performing them simultaneously. Diabetes treatment must include below cases respectively:1- Training patient to self-care and empowerment,2- Social-psychological supports, 3- Daily metabolism control beside glycemic periodical status evaluation ,4- Proper nutrition, 5- Appropriate physical activity, 6- Medicine (Oral therapy, Insulin therapy)Therefore, in modern world that witnesses the production of new medicines in diabetes treatment. The main question is patient empowerment and selection of proper medicine and proportion to patient’s status, not the necessity of employing new medicine. In other words, diabetes treatment is a dynamic phenomenon not static.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 51 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Laboratory and Clinic: Endocrine Disorders, Pituitary – Gonadal O56 – O59
Many human diseases are dependent on the function of endocrine glands in the brain or other organs of the body. The pituitary gland is a small and important gland in the human body that controls the function of some other glands, including the gonads. Any dysfunction of this gland can lead to a disorder in the target gland’s activity and primary occurrence of a certain condition. On the other hand the occurrence of some diseases and conditions in target glands such as the ovaries and testis can predispose them for imbalanced activity. “Endocrine disorders of the pituitary – gonadal axis” is a topic of the 15th Congress on quality improvement in clinical laboratories. During the time of this panel it will be tried to discuss the laboratory variations of different analytes by presenting the latest findings in endocrine disorders and their effects on the target tissue’s function with an emphasis on female diseases. The meeting will provide a suitable environment for the exchange of views and ideas beetween laboratory and clinical professionals in the field of women’s diseases. The participants will contribute the meeting by asking their questions or sharing their experiences. Dr. A. Sadeghitabar, DCLS Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O56
Quality Assurance in Hypothalamic –Pituitary – Gonadal Axis Tests
Ali Sadeghi Tabar *1 1- Avicenna Research Center, Iranian Association of Clinical Laboratory Doctors [email protected]
The HPG axis plays a critical part in the development and regulation of a number of the body’s systems, such as the reproductive and immune systems. Fluctuations in this axis cause changes in the hormones produced by each gland and have various local and systemic effects on the body.The anterior pituitary (adenohypophysis) is a lobe of the gland that regulates several physiological processes (including stress, growth, reproduction, and lactation). The intermediate lobe synthesizes and secretes melanocyte-stimulating hormone. The posterior pituitary (or neurohypophysis) is a lobe of the gland that is functionally connected to the hypothalamus by the median eminence via a small tube called the pituitary stalk (also called the infundibular stalk or the infundibulum).Hormones secreted from the pituitary gland help control: gowth (GH),blood pressure (ADH), certain functions of the sex organs (LH , FSH), thyroid glands and metabolism (TSH) as well as some aspects of pregnancy( LH, FSH), childbirth (oxytosin), nursing (LTH), water/salt concentration at the kidneys(ADH), temperature regulation(TSH) and pain relief(ACTH).The pituitary controls the function of most other endocrine glands and is therefore sometimes called the master gland. In turn, the pituitary is controlled in large part by the hypothalamus, a region of the brain that lies just above the pituitary. By detecting the levels of hormones produced by glands under the pituitary’s control (target glands), the hypothalamus or the pituitary can determine how much stimulation the target glands need.
Keywords: Pituitary, Gland, Axis , Hormones, Hypothalamus
O57
The Evaluation of LAP in Women with Polycystic Ovarian Syndrome
Elham Zarei 1 *, Hassan Mohajeri Shahrebabaki 1, Fatemeh Aliakbari 1, Fatemeh Mohammadzadeh 2, Sepideh Bakhshandehnosrat 3, Azadreza Mansourian 4
1- Metabolic Disorders Research Center, Student Research Committee, Golestan University of Medical Sciences, Gorgan, Iran, 2-Department of Internal Medicine- Golestan University of Medical Sciences, Gorgan, IRAN,3- Department of Gynecology Golestan University of Medical Sciences, Gorgan , IRAN, 4- Metabolic Disorders Research Center Golestan University of Medical Sciences, Gorgan, Iran [email protected], [email protected], [email protected], [email protected], [email protected]
Background and Objective: Noting that hyperinsulinemic-euglycemic Calmap gold standard method is complex and is not cost benefit and regarding that fasting insulin levels has not any reference intervals and is determined incorrectly, it has been necessary to use some insulin resistance indexes that are facile to detect, such as WC, BMI and LAP.The accurate evaluation of (LAP), HOMA-IR, WHR, WC are considered among biomarker of insulin resistance .The aim of this study is to assess the above indices in women with PCOS.Methods: In this case control study ,Antropometrics, biochemical parameters, LAP, and insulin resistance in 43 women suffering from PCOS as case and 40 healthy women as control were measured. Statistical analysis was used to compare the WHR, WC, LAP, BMI. ROS curve was used to assess the insulin resistance.Results: The mean age,BMI, WHR among PCOS women were 24.06±5.86, 26.61±4.34 and 0.81±0.061. LAP index was 47.13±4.13.There was a direct significant correlation among HOMA-IR with WC, BMI, and LAP among women with PCOS.Conclusion:WC, BMI, LAP are among accurate and key indices in diagnosing insulin resistance among PCOS women respectively. Although good relationship between HOMA-IR and Calamp gold standard method in present study, it is possible that this relationship is not significant among people with PCOS. We concluded that WC, BMI and LAP are indexes with facile detection and high accuracy that may be useful to monitor insulin resistance among women with PCOS.
Keywords: Polycystic Ovarian Syndrome, HOMA-IR, LAP, WHR,BMI ,WC
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 53 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O58
Disorder of Hypothalamus Pituitary Gonad Axis in Male Infertility
Kaveh Soltanzadeh 1 *
1- Urologist [email protected]
Approximately 20% of men undergoing an infertility evaluation will be diagnosed with an underlying endocrine abnormality. Therefore, an evaluation of the reproductive endocrine status is an essential component in the investigation of all male partners with either an abnormal physical examination suggestive of a disorder intestosterone production and action, an abnormal semen examination, or evidence of impaired sexual function. The important hormones of the male reproductive system are gonadotropin- releasing hormone (GnRH), produced in the hypothalamus; the pituitary gonadotropins, luteinizing hormone (LH) and follicle- stimulating hormone (FSH); the testicular steroids, testosterone and estradiol; the testicularpeptide, inhibin; and the peripherally produced dihydrotestosterone (DHT).The differential diagnosis and treatment of endocrine-dependent male-factor infertility is based on the history, physical examination, and reproductive hormone levels. Based on these data, patients can be placed in four major diagnostic categories: (1)hypogonadotropic hypogonadism (secondary hypogonadism),(2)hypergonadotropic hypogonadism or testicular failure (primary hypogonadism), (3) defective androgen synthesis or response, and (4)combined primary and secondary hypogonadism. The endocrine evaluation of the male partner is an essential part of the workup of the infertile couple. A careful history, physical examination, and laboratory assessment, guided by an understanding of the physiology of the hypothalamic– pituitary–testicular axis, will allow the clinician to ascertain a diagnosis and an appropriate treatment plan.
O59
Functional of Panel Hypothalamus-Pituitary-Ovarian
Afsaneh Mohammadzadeh *
Normal menstrual function requires normal function of Hypothalamus– Hypophyeses – ovary axis. The hypothalamus stimulates the pituitary gland to produce and secrete Follicular stimulating hormone (FSH) and luteinizing hormone (LH). FSH stimulates granulose cells in ovarian follicles to proliferate and produce Estrogen hormone as well. Theca cells produce androgens that are initial substrate for Estrogen synthesis. Follicular growth ends to ovulate and conception.2 ovarian hormones Estrogen and progesterone induce endometrial growth for embryo implantation. Any irregularity and disturbances in this axis leads to defect in eggs’ and endometrial growth and finally reduces women ability to get pregnant.
Keywords: GnRH, FSH, LH, Follicular Growth
54 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Laboratory and Clinic: Hemoglobinopathies O60 – O63
Hemoglobinopathies are a group of genetic blood disorders that include sickle cell disease (SCD), thalassemia, and other structural or functional disorders of hemoglobin (HB). For decades, laboratory diagnosis of hemoglobinopathy has been mainly based on hemoglobin dissociation techniques (eg, electrophoresis and chromatography) and sometimes functional assays of hemoglobin (eg, solubility, instability, affinity for oxygen). Such protein-based techniques are unable to detect or completely differentiate a number of hemoglobinopathies. Nevertheless, many clinicians still rely on protein-based diagnostic techniques in suspected clinical cases. This could be because of their concerns about the costs of genetic testing or lack of proper understanding of the tests.To determine the clinical application of genetic tests in diagnosis of hemoglobinopathies and improve the quality of a suspected clinical diagnosis, the molecular understanding of the disease is strategic. In addition, summing up the results of many years of prevention measures implemented during the previous years will be light for the way of the future. Dr. M. Yavarian, DCLS, PhD Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O60
Success of Iran Beta Thalassemia Prevention Program: Substantial Regressive Trend of the Incidence Rate Ashraf Samavat 1, Sara Azimi 2 * 1- MD, PhD. Genetics Office, Health Deputy, Ministry of Health and Medical Education, 2- Msc in Epidemiology. Genetics Office, Health Deputy, Ministry of Health and Medical Education [email protected] Background: Thalassemia is one of the most common genetic diseases in Iran with expected annual incidence of 1000 beta major thalassemia in absence of any kind of intervention. Given the burden of thalassemia, a national prevention program was planned and implemented by genetics office in 1997. The main strategies of this program have been screening of carrier couples, genetic counselling and offering prenatal diagnosis. Materials and Methods: this study aimed to analyze incidence rate trend of major beta thalassemia by applying joinpoint regression on the 17 years incidence data (1997-2012) of thalassemia national prevention program. Results: national beta thalassemia incidence rate fell from 4.6 in 1998 to 1 per 10,000 live birth in 2012. The regressive trend of the incidence rate, separated by 1 joinpoint in 2005 with -7.1 and -12.9 annual percent changes (APC) (Pvalue<0.05). In average 57% of the incidence cases were from four provinces with different health and epidemiologic statues. This percentage has changed from 36% to 80% from 1997 to in 2012. Trends of incidence rate in these provinces and other provinces did not differ significantly, with APCs equal to -4.3 (95%CI: -6.1, -2.5).Conclusion: the national beta thalassemia prevention program of Iran has been successful in achieving the goal of the program. Management of the residual incidence cases in the special provinces need fine-tuning and taken special measures with compliance with the special health and epidemiologic situation of the special provinces. Keywords: Iran, Prevention Program, Beta Thalassemia, Incidence Rate, Trend Analysis, Joinpoint Regression, Genetics Office, Iran
O61 Current Challenges in Diagnosis of Alpha Thalassemia Sirus Zeinali *1 1- Molecular Medicine Section, Pasteur Institute of Iran Thalassemia is the most widespread genetic disease in the world. In Iran and most of other countries the prevalence of alpha thalassemia is more than beta thalassemia. Beta thalassemia screening has been in process since 1997 in the country. In this program beta thalassemia transmitters and suspicious people are referred to hematologist and/or medical genetic laboratories.In regard to an alpha thalassemia transmitter has similarity with a beta thalassemia transmitter in some hematological parameters or in some cases a beta thalassemia transmitter can have similar hematological parameters of an alpha thalassemia transmitter. These cases challenge in diagnosis. The similarities of a beta and alpha thalassemia transmitter are: both of them have MCV and MCH lower than normal. RBC has risen in both of subjects. In both of them hemoglobin partly has been decreased. In some rare cases A2 in the beta thalassemia transmitter is normal. In acute alpha thalassemia except for the amount of A2, other parameters in both of them are very alike. In the cases of a person be a beta and alpha thalassemia transmitter (from point mutation) parameters of two types might be the same (in some cases HbF increases). So it is seen that a person with condition like alpha thalassemia cannot be known as alpha thalassemia transmitter without examination.Base on state instructions of the diagnosis before birth in our country, whenever one person was certainly beta thalassemia transmitter (based on hematology results), the laboratory must determine first the opposite side (who seemingly is an alpha thalassemia transmitter) beta globin gene sequence and if the sequencing was normal, it must confirm that the subject is not qualified for removal of beta globin gene by RFLD and SNP around the beta globin gene, shows sequence is not deleted.If the person was not a beta thalassemia transmitter, it must be checked that whether the person is subject to acute alpha thalassemia or not. If MCV and MCH parameters were low (for instance MCH was less than 25 and MCV less than 75) in this case it must be confirmed that if the person is subject to acute alpha thalassemia or not and whether inherits genes as CIS or Trans. If it was CIS, the opposite side who was beta thalassemia transmitter must be checked for alpha thalassemia. If it was Trans it is not necessary for more check of alpha thalassemia.In cases which a person has acute alpha thalassemia with the help of parents blood test can detect whether the person is transmitter as CIS or Trans. If it was CIS, the status of the opposite side must be specified. If both of them were acute beta thalassemia transmitters, the molecular status must be determined. If both of them were acute alpha thalassemia transmitters of CIS type, it would be probable that the birth of child be with 25% of hydrops fetalis. If one side was acute alpha thalassemia of CIS type and the other side of Trans or weak alpha thalassemia, the next step must be determination of mutation type of Trans or trait, alpha thalassemia person.The experience has shown that in some cases if one side was an acute alpha thalassemia transmitter and the other side was of Trans type or weak removal of gene type, this possible for born of it trait child. In these cases the family must be warned, but reported that these people are not dependent on blood. If one side is strongly SYS and the other has dot mutation, we can not verify that their child will have H disease.
56 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O62
Beta Thalassemia Technical Problems in Assessment and HBA2 Interpretation
Abdul Reza Afrasiabi 1 *
1- Genetic Technician of Pathobiology and Genetic Implantation Laboratory [email protected]
Microcytic anemia commonly can be originated due to iron deficiency anemia or alpha and beta thalassemia transmitters.The increase amount of HBA2 more than 3.5% is propounded as one of the parameters in screening of beta thalassemia transmitters. But contradictory reports occasionally as a definite parameter of beta transmitters in cases with iron deficiency anemia are questioned.It has shown that transmitters of β+ mutations than to β0 transmitters have less amount of HBA2.Moreover, β thalassemia transmitters whose gamma globulin gene production is normal and can have normal HBA2. Many studies have shown that the amount of HBA2 in iron deficiency anemia possessors do not show significant decrease.The reason for HBA2 increase in β thalassemia transmitters is due to decline in chain of beta that as a result additional beta chain is produced and HBA2 (α, γ2) increased, because β+ transmitters have some composed β gene, the rise of composed gene is not considerable, so the amount of HBA2 is less.In delta beta thalassemia transmitters the amount of HBA2 is low or in normal range. In concurrent alpha and beta thalassemia transmitters, there is no significant alterations in HBA2 and HBF which makes feasible the studies of parents for diagnosis of alpha and beta transmitters simultaneously.Folate deficiency and vitamin B-12, the amount of HBA2 is increased and can be between 3.5%-8% and HBF between 1%-5%. In HIV carriers, the amount of HBA2 is more than normal range.All in all, HBA2 is spite of changes in conditions and special diseases is one of the best and the most reliable parameters in diagnostic of beta thalassemia transmitters even with the concurrent iron deficiency anemia.
O63
(/ ,/ ,/) β0/β،β+/β+،β0/β+) Beta Thalassemia Intermedia)
Majid Yavarian 1 *
1-Genetic Ph.D of Laboratory Sciences
All three heredity patterns, homozygote, doubly heterozygote and heterozygote, can generate – β thalassemia intermedia. In homozygote and doubly heterozygote variants there are mutation in both alleles which cause normal degree of synthesis decline in β chain. Occasionally patients who inherit removal of a natural β gene have extreme clinical symptoms which in classification is known – β thalassemia intermedia than – β thalassemia.δ β thalassemia: In this thalassemia production of both β and δ chain has disorder. δβ mutation can be classified in two genotypes: and .design with lack of synthesis in both and β chain and genotype expresses a decline in synthesis of and β synthesis. Lack of δ and β synthesis is usually because of structural remove of δ and β complex gene. One or both remaining γ gene can generate 100% FHb. In spite of increase in γ production chain full compensation of production lack in β chain practically will not happen. It looks that in – δβ thalassemia, γ compensating synthesis is less than HPFH, but more than – β homozygote thalassemia. Thalassemia intermedia disease rarely needs blood transfusion except for cases of physiological pressure like pregnancy or infection. Therefore, most of – δβ thalassemia patients have mild microcytic hypochromic anemia. Presumably hemolysis has a role in anemia because reticulocyte and bilirubin will increase.Specific clinical finding in heterozygote form of – δβ thalassemia (/β) is not recognizable. Anemia and splenomegaly do not exist, but hematology image of it, is like minor – β thalassemia with erythrocytes microcyte and hypochromia. HbA2 has a natural or a little decline, while HbF is increased to 20%-5%.γδβ thalassemia: It is a rare type of thalassemia which has several variety and observes with removal or inactivity of the whole β gene complex. Removal of γδ and β causes lack of all natural Hemoglobins. So it is just observed in heterozygote condition. It is dare to say that heterozygote condition is incompatible with life. Although infants have acute hemolytic anemia, but in case of development the infant shows alike mild – β thalassemia.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 57 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Laboratory and Clinic: Obesity O64 – O68
How is obesity diagnosed? What was the obesity indicator in the past? What is it, now? What is the role of the laboratory in the diagnosis of obesity and its consequences? Is obesity associated with diseases that are recognizable by the laboratory? Does the adipose tissue secrete the analyte that is recognizable in the laboratory? What is the role of genetics in obesity? Is obesity related to other diseases such as diabetes, skin diseases or cancer? The questions mentioned above and also many other obesity related questions which have engaged our mind on the one hand, and the role of laboratory in the diagnosis of obesity on the other hand have led the Quality Improvement Congress to allocate one of the topics for this important subject. In current century due to the change in the pattern of food consumption as well as the level of stress and reduced amount of physical activity and also having appropriate genetic background, have caused people to develop obesity. On the other hand the attitude towards the adipose tissue has been completely changed and this tissue is now introduced as an endocrine gland with more than a dozen hormones. Dr. S. Mahdavi, DCLS Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O64
The Mutual Relationship between Thyroid Disorders and Obesity
Mohammad Reza Bakhtiari 1 *
1- Director General, University Entrepreneurship, IROST, Ministry of Science, Research and Technology [email protected]
Thyroid gland has very essential roles in regulating metabolism, body weight and composition, body temperature and energy expenditure. There is a complex relationship between thyroid disease, body weight and metabolism. One side of the picture is well-known, i.e. hypothyroidism (subclinical and overt) is commonly considered as a cause to weight gain, reduced thermogenesis, and metabolic rate. Hyperthyroidism usually causes intensified basic metabolism rate (BMR), and consequently weight loss. Since hyperthyroidism also amplifies appetite, some patients may actually gain weight. On the other side, various studies show that obesity, central obesity in particular, is linked to many endocrine abnormalities, as well as thyroid dysfunction as a primary trigger. In obese patients there is a peripheral resistance to the action of thyroid hormones due to diminished expression of related receptors in adipose tissues. This leads to further secretion of TSH form pituitary gland. These situations can be reversed with weight loss, and decreases in both number and size of adipose cells. There is strong evidences suggesting that high body mass index (BMI) is positively correlated with both serum leptin and TSH levels. Also it has been shown that serum T4 and free T4 has an inverse correlation with obesity. It is interesting that a slight to moderate increase of serum T3 and Free T3 has been reported in obese patients. This discovery suggests a high conversion of T4 to T3 in obesity, most probably due to leptin-mediated augmented deiodinase activity as a compensatory mechanism against fat accumulation for improving the energy expenditure.
Keywords: Thyroid Disorders, Obesity, Serum Leptin and TSH
O65
Genome Wide Association Study in Tehran Cardio-Metabolic Genetic Study Could Promotes Genetic of Obesity in Iran
Maryam Daneshpour 1 *
1- Cellular and Molecular Endocrine Research Center, Research Institute for Endocrine Sciences Shahid Beheshti University of Medical Sciences [email protected]
In recent decades trying to identify the role of genetic changes and their effect on the prevention and disease is one of the most fundamental goals of medicine. Some of these diseases are common, so the scientists have to find the best solution to manage prevent the disease. Obesity is one of the most important problem in developed country and need to assessed for all aspects. Genetic variations play critical role in weight management. Since the physicians’ instructions are based on the specification set is an average that cannot be completely effective for wide range of patient. Therefore, precision medicine or personal medicine have used of certain genetic characteristics, genomics and clinical information for each individual. By the end of the genome-wide project, planning for more recognition of genetic pattern was done. The original version of the genome as a book is not edited and non- readable and lots of researchers around the world had tried to extract and categorize information. Also, developing large scale of genomic data banks like HapMap and 1000 Genomes Project would help make more accurate readings do this great book. Genome- wide study on participant of Tehran Lipid and Glucose Study as the oldest and largest prospective study has been conducted to by Iranian researchers removed a small step toward understanding the genome of the Iranian population. The prospective of this lecture is reviewing the findings from genome-wide studies in whole of the word in recent years then introduce the genome-wide study on the Iranian population.
Keywords: Genome Wide Association Study, Obesity, Tehran Lipid and Glucose Study
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 59 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O66 Hormonal and Biochemical Alterations in Childhood Obesity Mitra Nourbakhsh 1 *, Maryam Razaghi Azar 2 1- Department of Biochemistry, Faculty of Medicine, Iran University of Medical Sciences, Tehran, Iran, 2- H. Aliasghar Children’s Hospital, Iran University of Medical Sciences, Tehran, Iran [email protected], [email protected]
Childhood obesity is one of the most serious public health challenges of the 21st century. The problem is global its prevalence has increased at an alarming rate. Globally, in 2015 the number of overweight children under the age of five, is estimated to be over 42 million. Obesity is associated with many short- and long term consequences. Metabolic disturbances and insulin resistance occur early in obesity and these abnormalities are observed frequently in obese children and adolescnets. Type 2 diabetes and cardiovascular disorders are long-term consequences of obesity which are associated with reduced longevity and higher morbidity.Adipose tissue not only stores fat but also is responsible for secretion of many different bioactive molecules. Therefore obesity is accompanied by many biochemical alterations including increased secretion of leptin, visfatin, resistin and inflammatory cytokines. The elevation of these factors are observed in obese children and adolescents and most of them are associated with insulin resistance. Angiopoietin-like proteins (ANGPTL) are also among the factors that are deranged in childhood obesity. ANGPTLs belong to a superfamily of angiogenic regulating, secreted proteins that function in an endocrine manner in vivo. Some ANGPTLs possess other pleiotropic activities such as inhibition of lipoprotein lipase and endothelial lipase, augmentation of energy expenditure, and induction of inflammation. ANGPTL2 is a key adipocyte-derived inflammatory mediator that links obesity to systemic insulin resistance. ANGPTL3, -4 and ANGPTL6/angiopoietin-related growth factor (AGF) directly regulate lipid, glucose and energy metabolism. Both ANGPTL2 and ANGPTL3 are increased while ANGPTL4 is decreased in obese children and adolescents. These changes are associated with insulin resistance and other altered metabolic parameters collectively known as metabolic syndrome. Reduced PPARγ gene expression which is observed in obese children is also related to ANGPTL4. These molecules can serve as suitable targets for the early prevention and treatment of childhood obesity and its associated complications.
O67 Molecular and Physiological Mechanisms of Obesity: The Critical Role of the Gut-Brain Axis Khosrow Adeli 1 *
1- Professor, Department of Biochemistry, University of Toronto Head, Clinical Biochemistry & Senior Scientist, Molecular Medicine, Research Institute, The Hospital for Sick Children, Toronto, Canada [email protected]
Over the past few decades, there has been an alarming rise in incidence of both pediatric and adult obesity and their metabolic complications worldwide leading to much higher rates of type 2 diabetes in children and adults. Insulin resistance (or “prediabetes) is a central pathophysiological feature of type 2 diabetes and abdominal obesity, and is commonly associated with metabolic dyslipidemia. The current consensus is that obesity and insulin resistance may be part of a common pathologic state termed the “metabolic syndrome”. The metabolic syndrome, is characterized by a constellation of pathologies that include glucose intolerance, insulin resistance, obesity, dyslipidemia, and hypertension. Insulin resistance generally develops as the first indicator of type 2 diabetes and manifests as a decreased biological response to normal levels of circulating plasma insulin. Emerging evidence indicates that the intestine plays a key sensing and signaling role in the physiology of energy homeostasis by controlling satiety, energy intake, and energy expenditure. Upon nutrient ingestion, an intestine-brain axis is triggered involving signals from the upper intestine by vagal afferents that communicate with the nucleus of the solitary tract (NTS) in the brain. Satiety signals from the gastrointestinal tract such as small lipids in the upper intestine control food intake by afferent sensory neurons that signal to the NTS to regulate nutrient consumption. Besides this neuronal pathway, many hormones (leptin, insulin, ghrelin, and peptides like cholecystokinin (CCK) and glucagon-like peptide-1 (GLP-1) contribute to the regulation of food intake by modulating the responses of the brain to the intestinal signals. Lipid ingestion can also regulate glucose homeostasis involving a gut-brain-liver axis. As part of the brain-liver axis, the hypothalamus plays a major role in this process as experimental lipid infusion in this area blocks hepatic glucose production, an effect that is reverted after hepatic vagotomy. Moreover, blocking the sensitivity of the hypothalamus to lipids promotes overfeeding resulting in obesity and insulin resistance. During the transition from fasting-to-fed states (immediately following meal ingestion), entroendocrine cells (L- and K-cells) in the proximal and distal small intestine are stimulated, possibly through a combination of neuro-hormonal pathways and direct nutrient stimulation, to secrete incretins, GLP-1 and gastric inhibitory polypeptide (GIP). GLP-1 together with postprandial hyperglycemia stimulates the pancreatic beta-cells to secrete insulin, thereby increasing circulating insulin levels. Postprandial hyperinsulinemia acutely suppresses lipoprotein assembly and secretion in the liver, and increased GLP-1 secretion may also have a similar function, reducing hepatic lipid export postprandially. There is further evidence in animals that a gut-brain-liver axis is operative and thus the accumulation of certain lipids (such as long-chain fatty acids) in the upper intestine suppresses liver glucose production through action of the gut-peptide hormone CCK.In this presentation, I will review the current evidence for the central role of the intestine and the gut-brain axis in mediating nutrient sensing to control energy balance and body weight. Molecular and physiological mechanisms will be discussed focusing on the key role of gut peptides, particularly GLP-1 and GLP-2.
60 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O68
Obesity, Endocrine Function, and Their Laboratory Tests
Mehdi Hedayati 1 *
1- Associate Professor of Biochemistry Head of Cellular & Molecular Research Center and Academic Faculty Member Research Institute of Endocrine Sciences, Shahid Beheshti University of Medical Sciences [email protected]
Adipose tissue is the most important and primary storage site for excess energy deposit as Triglyceride, but recently it is also recognized as an active endocrine organ. Adipocytes are now generally accepted to be a complex cell type involved in generating a number of messengers which include cytokines, hormones and growth factors that not only affect the neighboring cells which is called paracrine action, but also impact target tissues involved in energy metabolism and influencing biochemical and physiologic and pathologic processes which is considered as endocrine function. The most research in the field of Adipokines area has focused on Leptin and adiponectin, the two important adipokines, which show beneficial effects on insulin action and lipid metabolism too. Obesity is characterized by increased in adipocytes cell number, fat cell size, or a combination of the two. More recently, there is evidence that low-grade inflammation within the adipose tissue results in the dysregulation of adipocytokine production, thereby contributing to the pathophysiology of metabolic syndrome. In the obesity state, the adipose tissue is infiltrated by inflamed macrophages that release cytokines such as TNF-α and IL-6, thus linking obesity, inflammation and insulin resistance. It is increasingly important to understand the signaling pathways by which adipokines control metabolism and to try to discover new therapies for diseases related to adipose tissue increasing mass and dysregulating of function.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 61 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Law and Ethics in Laboratory O69
Observing etiquette and knowing law and regulations presently are the factors that could be a resolution for lots of predicaments and troubles in medical and diagnostic laboratories. Observing legal contentions in signing contracts with personnel and insurer institutions and supplying companies in providing medical materials and equipment and proper interaction with organizations and governmental ones. In this approach, with accompanying of experts, these matters will be discussed. Dr. M. Gh. Eslami, DCLS Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O69
Ethics in Laboratory Based on ISO-15189
Parveen Sharma 1 *
1- Professor and Head, Department of Biochemistry, All India Institute of Medical Sciences, Jodhpur, India [email protected]
Laboratory medicine plays a crucial role in patient care as over 70% of medical diagnoses now rely on laboratory analyses. Essentiality of maintaining high ethical standards in laboratory practise is well known, but till today ethics does not receive the attention it deserves. The importance of ethics has been further acknowledged by ISO 15189, one of the fastest growing international quality standards in the world. Ethical practice is a new addition to this standard, whereby laboratory should foremost work in the best interest of the patient and not consider the same as customer. Several ethical issues exist in laboratory practice like confidentiality of patient medical information, allocation of resources, codes of conduct, publishing issues, conflicts of interest etc. Moreover, ethical issues prevails in each of the phases of laboratory testing (pre-analytical, analytical, and post-analytical). Human errors are 100% preventable and patient safety can be achieved through confidence only when ethics are part of laboratory’s primary agenda. Accreditation system cannot evaluate basic ethics in any diagnostic division. Accreditation of medical laboratories, to ISO 15189, is an indicator of quality and reliability of services provided by the laboratory. Medical laboratory’s aim should not be limited only to provide accurate results, but doing the right thing in the right patient, within a meaningful timeframe, and as regards clinical management, using appropriate laboratory procedures and with a respect for ethics, confidentiality and the safety of the patient.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 63 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
New Findings in Laboratory Diagnostics: Biochemistry O70 – O79
Although in the past 50 years with the advent of automatic analysers and immunochemical reagents a lot of progress has been made in routine and biochemistry testing, a new subset entitled Molecular Clinical Biochemistry raised in recent years with the use of automated DNA sequencing systems, mass spectroscopy and optimized PCR, has created a great development in clinical biochemistry. Nowadays using molecular techniques such as proteomics, genomics and bioinformatics there has been remarkable progress in the identification of protein and genetic biomarkers in bio fluids for the prognosis, diagnosis and treatment of diseases, including cancer. Dr. L. Hosseini Gohari, PhD Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O70
Compare of SLC30A8 Gene Expression and Its Association to Diabetes
Seyd Manucheh Nourazarian 1 *, Alireza Nourazarian 1, Majid Tozihi 1, F.Soghra Hamzavi 1 Behroz Pourasghari 1 Babak Bayaz 1
1- Tabriz University of Medical Sciences [email protected], [email protected], [email protected], [email protected], [email protected], [email protected]
Background: Type 1 diabetes Mellitus (T1DM) is an autoimmune disease and Type 2 diabetes Mellitus (T2DM) is multifactorial disease affects people of all age. The purpose: According the role of zinc in insulin function and studies on how the SLC30A8 gene expression as a risk factor for type T2DM. The expression of this gene and IAA, C-pepdite, Anti GAP in Diabetics 1 and 2 were conducted.Method: 60 patients withT1DM divided as follows: group of 30 people aged less than 20 years and 30 people aged upper 20 years at the time of diagnosis. 45 patients with type 2 diabetes and 45 healthy persons were selected as control group. To measure the parameters of the IAA and Anti GAD and C-Peptide ELISA kit was used. For SLC30A8 gene expression PCR-RFLP method was used.Results: Serum levels of IAA and Anti GAD in patients less than 20 years have increased significantly compared to the other groups. Also in patients with type 1 diabetes ratio type 2 was significantly lower than the amount of C- peptide. Although the SLC30A8 gene expression was reduced in type 1 diabetes than type 2 diabetes. But this difference was not significant among the three groups.Conclusion: The findings of this study and comparing it with previous studies indicating reduced gene expression as SLC30A8 polymorphisms in (T1DM) is ZnT8. To prove definitive role of this gene in the pathogenesis of diabetes, repeat the study with a large sample sizes and in different locations is recommended.
Keywords: Diabetes, SLC30A8, IAA, C-Peptide, Anti GAD
O71
A Preliminary Study of Circulating CTRP1 / CTRP5 Ratio in Non-Alcoholic Fatty Liver Disease: a Novel Biomarker for Diagnosis?
Solaleh Emamgholipour 1 *, Parisa Shabani 1, Mahmood Mahmood Doosti 1, Hossein Poustchi 2
1- Department of Biochemistry, Faculty of Medicine, Tehran University of Medical Sciences, Tehran, Iran. 2- Liver and Pancreatobiliary Diseases Research Center, Digestive Diseases Research Institute, Tehran University of Medical Sciences, Tehran, Iran [email protected], [email protected], [email protected], [email protected]
Background: Recently, the clinical relevance of members of the C1q/TNF-related protein (CTRP) family in pathogenesis of insulin resistance –related diseases is beginning to emerge from several studies. Hence, we aimed at investigating the association of circulating CTRP1 / CTRP5 ratio with several parameters related to liver fibrosis in Nonalcoholic fatty liver disease (NAFLD) patients.Methods: A total of 65 patients categorized into three subgroups, patients with NAFLD (n=22), NAFLD with T2DM (NAFLD+T2DM) (n=22) and healthy subjects (n=21) were recruited in this study. Patients and controls were all men and were matched in term of age. Liver stiffness (LS) measurement was undertaken in all participants.The APRI was calculated as AST (IU/l)/(upper limit of normal)/platelet count (x109/liter)x100. The FIB-4 score was calculated: age x AST (IU/l)/platelet count (x109/liter) x√(ALT(IU/L))Plasma levels of CTRP5 and CTRP1 were measured by ELISA.Results: In whole population, we found a significant correlation between CTRP1 / CTRP5 ratio with LS (r= 0.711; p>0.001), APRI (r= 0.268; p=0.044). We also found a significant association between circulating CTRP1 /CTRP5 ratio and risk of NAFLD and NAFLD+T2DM. The ROC curves of circulating CTRP1 / CTRP5 ratio in predicting NAFLD and NAFLD+ T2DM demonstrated an area under the curve (AUC) of 0.519 in NAFLD, and 0.994 in NAFLD + T2DM. A cut-off value of 3.14 presented a sensitivity of 100% and a specificity of 90% for evaluating NAFLD+T2DM.Conclusions: It seems that circulating CTRP1/CTRP5 ratio can be considered as a potential biomarker with high diagnostic power to differentiated NAFLD+T2DM.
Keywords: Nonalcoholic Fatty Liver Disease, Nonalcoholic Fatty Liver Disease, CTRP-1,CTRP-5
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 65 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O72 The Circulating CTRP13 in Type 2 Diabetes and Non-Alcoholic Fatty Liver Patients Mehrnoosh Shanaki 1 *, Hossein Poustchi 2, Solaleh Emamgholipour 3, Reza Fadaei 3, Nariman Moradi 4
1- Department of Laboratory Science, School of Allied Medical Science, Shahid Beheshti University of Medical Sciences, 2- Liver and Pancreatobiliary Diseases Research Center, Digestive Diseases Research Institute, Tehran University of Medical Sciences, Tehran, Iran, 3- Department of Biochemistry, Faculty of Medicine, Tehran University of Medical Sciences, Tehran, Iran, 4- Department of Biochemistry, Faculty of Medicine, Iran University of Medical Sciences, Tehran, Iran [email protected], [email protected], [email protected], [email protected], [email protected]
Numerous studies have shown that C1q/TNF-related proteins (CTRPs) are involved in the pathophysiology of Non-alcoholic fatty liver disease (NAFLD) and Type 2 Diabetes (T2DM). There is a little information concerning CTRP13 in the context of NAFLD and T2DM. We evaluated the plasma levels of CTRP13 in healthy control and patients with NAFLD, T2DM and NAFLD+T2DM, and also correlations between CTRP13 plasma levels and clinical and subclinical features. Circulating CTRP13 was examined in 88 male (20 healthy control, 22 T2DM patients, 22 NAFLD patients and 22 NAFLD+T2DM patients). CTRP13 and adiponectin plasma levels were measured by ELISA method. CTRP13 serum levels were higher in the control group than the other groups (all p <0.001). CTRP13 had a significant inverse correlation with cIMT (r = -0.345) and liver stiffness (LS) (r = -0.372) (both, p <0.001). Also, the multiple stepwise linear regression has shown that visceral fat is a significant predictor of CTRP13 serum levels (p <0.001). Multiple stepwise linear regression with LS as the dependent variable showed that ALT (p < 0.001) and SBP (p = 0.010) were two predictor factors for LS. Strikingly, multiple stepwise linear regression showed that CTRP13 (p = 0.006) and SBP (p = 0.007) were two independent predictors for cIMT. Lower CTRP13 in patients with T2DM, NAFLD and NAFLD + T2DM was associated with increased risk of the diseases. CTRP13 is a negative predictor of cIMT. Our results suggested that CTRP13 could be an associated factor with NAFLD in patients with and without T2DM. Keywords: Type 2 Diabetes Mellitus, Non Alcoholic Fatty Liver Disease , CTRP13
O73
Allelic Frequency of a 24-bp Duplication in Exon 10 of the CHIT1 Gene in the General Iranian Population by HRM Analysis
Behrooz Motlagh 1 *, Mohammad Taghikhani 2
1- Zanjan University of Medical Sciences, 2- Tarbiat Modares University [email protected], [email protected]
Background:The human chitinase chitotriosidase enzyme, which is encoded by the CHIT1 gene, is produced by macrophages and may be important in immune responses to chitin-containing organisms, such as fungi. Plasma chitotriosidase activity is used to diagnose and monitor some forms of lysosomal storage disorders, such as Gaucher disease. This metabolic disorder is an autosomal recessive lysosomal storage disease. Clinical manifestations of the disease include hematological and skeletal complications including pathological fractures. However, homozygous duplication of a 24-bp region in exon 10 of the CHIT1 gene eliminates enzyme activity and may complicate disease monitoring. The high prevalence of this mutation highlights the need to determine its frequency in different populations and screen patients for this mutation in order to verify whether chitotriosidase activity is a reliable marker of lysosomal storage disease. Methods: To identify the 24-bp duplication in exon 10 of the CHIT1 gene, genotyping of DNA extracted from peripheral blood leukocytes of 577 healthy Iranians was performed using PCR amplification and High Resolution Melting (HRM) PCR techniques. Results: In this study, heterozygous and homozygous duplications were detected in 183 (31.7%) and 35 (6.1%) subjects, respectively. In addition, the allelic frequency was 21.9% (95% confidence interval). Conclusion: Our study indicates that genotype analysis by HRM-PCR is a fast, reliable, and highly accurate screening approach for identifying the 24-bp duplication in CHIT1 exon 10. Due to the wide range of duplication frequencies among different ethnic groups, new biomarkers are necessary for assessing genetic characteristics of lysosomal storage disorders in different populations.
Keywords: Chitotriosidase, Biomarker, Gaucher Disease, PCR-HRM
66 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O74 Serum Anti-HSP27 Levels in Patients with Hypertriglyceridemia and Healthy Subjects in Iranian Population
Mahdi Taheri Bonakdar 1 *, Mahdieh Khazaei 1, Maryam Saberi-Karimianb 2, Maryam Tayefi 3 , Amirhosein Sahebkar 4, Mohsen Mohebati 5, Hanieh Gazizadeh 3, Gordon A. Ferns 6, Majid Ghayour-Mobarhana 1, Seyed Mohammad Reza Parizadeh 1 1-Biochemistry of Nutrition Research Center, School of Medicine, Mashhad University of Medical Science (MUMS), 2-Student Research Committee, Department of Modern Sciences and Technologies, School of Medicine, Mashhad University of Medical Science (MUMS), Iran, 3-Department of Modern Sciences and Technologies, School of Medicine, Mashhad University of Medical Science (MUMS), Iran, 4-Biotechnology Research Center, Mashhad University of Medical Science (MUMS), Iran, 5-Cardiovascular Research Center, School of Medicine, Mashhad University of Medical Science (MUMS), Iran, 6-Brighton & Sussex Medical School, Division of Medical Education, Falmer, Brighton, Sussex BN1 9PH [email protected], [email protected], [email protected], [email protected], [email protected], mohsen- [email protected], hanieh [email protected], [email protected], [email protected], [email protected]
Background:There are little data on isolated hypertriglyceridemia and CVD risk. Heat shock protein 27 (Hsp27) is a member of the small molecular weight heat shock protein (Hsp) family. There are higher concentrations of auto-antibodies to Hsps in atherosclerosis patients. Objective: We aimed to investigate the association between isolated hypertriglyceridemia, blood pressure, serum Hs-CRP levels and anti-Hsp27 titres in an Iranian adult population. Methods: The population sample was obtained using a stratified-cluster method and derived from MASHAD STUDY. A total of 1688 participants (aged 35-65 years old) who were not previously aware of their increased lipid profiles and had not taken any lipid lowering drugs were recruited into the study. Demographic data including age, gender and smoking were collected using a questionnaire. The subjects were initially separated into 2 groups: individuals with hypertriglyceridemia (HTG), and healthy subjects without hypertriglyceridemia. The patients with hypertriglyceridemia were further classified into isolated hypertriglyceridemia (IHTG) and those who had combined dyslipidemia using NCEP ATPIII criteria. The serum anti-HSP27 antibody titers were measured by ELISA. Results: There were significant differences in waist and hip circumferences, level of fasting blood glucose, Hs-CRP, systolic and diastolic blood pressure (p< 0.001 for all variables), between IHTG patients, combined dyslipidemia and control groups. Serum Hsp27 antibody titers were higher in the IHTG group compared with the combined dyslipidemia group and healthy subjects (p< 0.05). Conclusion: We found that serum Hsp27 antibody titers were significantly higher in the IHTG group compared with individuals with combined dyslipidemia or health individuals. Keywords: Heat-Shock Proteins, Hypertriglyceridemia
O75
Correlation between Salivary and Serum Melatonin and Creatine kinase-BB in Prostate Cancer and Benign Prostatic Hyperplasia
Jamal Amri 1 *, Hyder Farahani 1
1- Department of Biochemistry and Genetic, Biochemist, Faculty of Medicine, Arak University of Medical Sciences, Arak, IR. Iran [email protected], [email protected] Introduction: The tumor marker Melatonin and CK-BB are of the import reliable for Prostate cancer monitoring. In recent years, the use of saliva as a specimens, due to its non-invasive and easy access increased. However, so far there are few studies about its diagnostic value for cancer. Therefore, we conducted a study to investigate the relationship between salivary and serum Melatonin and CK-BB. Materials and Methods: A case-control study was conducted with 40 men: 20 Prostate cancer patients (PCa) and 20 benign prostatic hyperplasia (BPH) from the Hospital Ayatollah khansari in Arak, Iran. The Melatonin and CK-BB concentrations in saliva and serum samples were assessed using an enzyme immune assay (ELISA). We used Spearman correlation coefficients to assess and compare Melatonin and CK-BB concentrations between two groups. Results: We observed that the serum Melatonin concentration in PCa and BPH groups was positive and no statistically significant correlated with salivary Melatonin concentration (r= 0.132, P<0.05), (r=0.254, P<0.05) respectively. While the correlation between salivary and serum CK-BB concentration in PCa group and BPH group was positive and significant (r= 0.358, P<0.05), (r=0.259, P<0.05) respectively.Conclusion: According to the results of the present study, the sample of saliva can substitute for serum in the diagnosis and monitoring of prostate cancer. However, further studies are recommended. Keywords: Melatonin, Creatine Kinase-BB (CK-BB), Prostate Cancer (PCa), Benign Prostatic Hyperplasia (BPH)
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 67 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O76 The Level of Epidermal Growth Factor in Psoriastic Patients before and after Treatment Houshang Nemati 1 *, Mohammad Hosin Gharemani 2, Gholamreza Tavosidana 2, Reza Faridi 3, Babak Eizadi 1, Narges Nemati 1 1- Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah, Iran, 2- Molecular Medicine Department, School of Advanced Medical Technologies, Tehran University of Medical Sciences, Tehran, Iran, 3- Medical Nanotechnology Department, School of Advanced Medical Technologies, Tehran University of Medical Sciences, Tehran, Iran [email protected], [email protected], [email protected], [email protected], [email protected], [email protected] Epidermal growth factor (EGF) stimulates epidermal cells division.In this study we undertake to clarify correlation between serum EGF and disease activity during local therapy with calcipotriol- betamethasone in psoriatic patients. We measured serum EGF concentrations in 33 psoriatic patients before and after topical treatment with calcipotriol- betamethasone. A control group consisted of 22 healthy volunteers. Level of serum EGF was performed using Immunoassay methods. Data were Assessed by Mann-Whitney and t-test. The mean serum level of EGF in patients with psoriasis before treatment was 415.5 pg/mL, which was higher (P = 0.55) than patients with psoriasis after treatment( 344.5pg/ml). Mean EGF level in healthy controls, it was 307.6 pg/mL.Conclusion: EGF levels were higher in patients before treatment than patients after treatment and healthy control, however, this increase was not statistically significant. But probably it effective in disease severity from patients. Keywords: EGF, Psoriasis,Treatment
O77 ELISA Based hTSH Assessment Using two Sensitive and Specific anti-TSH Polyclonal Antibodies Maysam Mard-Soltani 1 * , Mohamad Javad Rasaee 2 , Saeed Khalili 2 , Abdol Karim Sheikhi 3 , Mehdi Hedayati 4 1-Department of Clinical Laboratory Sciences, Dezful University of Medical Sciences, Dezful, Iran, 2-Department of Medical Biotechnology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran,3-Cellular and Molecular Immunology Research Laboratory, Immunology Department, Dezful University of Medical Sciences, Dezful, Iran, 4-Cellular and Molecular Endocrine Research Center, Institute for Endocrine Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran [email protected], [email protected], [email protected], [email protected], [email protected] Introduction: Production of specific antibody responses against hTSH is a cumbersome process duo to the high identity between the hTSH and the other members of the glycoprotein hormone family (FSH, LH and HCG) and the high identity between the human TSH and antibody production host animals. Therefore, two polyclonalantibodies were purified against two recombinant proteins. Four possible ELISA tests were designed based on these antibodies.Methods: After the immunogen region selection of hTSH protein, c terminal of B TSH was selected and applied. Two recombinant genes, with this cut pieces (first: two repeat of C terminal of B TSH, second: tetanoustoxin+B TSH C terminal), were designed and sub-cloned into the pET32a expression vector. Standard methods were used for protein expression, purification and verification. Thereafter, immunizations of the white New Zealand rabbits were performed and the serums of them were used for antibody titration, purification and characterization (specificity, sensitivity and cross reactivity). Then, four ELISA tests based on two antibodies were employed.Results: The obtained results indicated the raised antibodies were capable of specific and sensitive hTSH detection, while the cross reactivity with the other members of the glycoprotein hormone family was minimum. Among the 4 designed tests, the test in which the antibody against first protein was used as capture antibody and the antibody against second protein was used as detector antibody did not show any hook effect up to 50 mIU/L. Keywords: hTSH, Bioinformatics, Protein Expression, Cross Reactivity
68 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O78
Glycoprotein 2 Isoform Alpha – a New Diagnostic and Prognostic Biomarker for Acute Pancreatitis
Dirk Roggenbuck 1 *
1- Germany-Medipan GMbH [email protected]
Glycoprotein 2 (GP2), the pancreatic major zymogen granule membrane glycoprotein, was reported to be elevated in acute pancreatitis in animal models. Enzyme-linked immunosorbent assays (ELISAs) were developed to evaluate human glycoprotein 2 isoform alpha (GP2a) and total GP2 (GP2t) as specific markers for acute pancreatitis in sera of 153 patients with acute pancreatitis, 26 with chronic pancreatitis, 125 with pancreatic neoplasms, 324 with non-pancreatic neoplasms, 109 patients with liver/biliary disease, 67 with gastrointestinal disease, and 101 healthy subjects. GP2a and GP2t levels were correlated with procalcitonin and C-reactive protein in 152 and 146 follow-up samples of acute pancreatitis patients, respectively. The GP2a ELISA revealed a significantly higher assay accuracy in contrast to the GP2t assay (sensitivity <=3 disease days: 91.7%, specificity: 96.7%, positive likelihood ratio [LR+]: 24.6, LR-: 0.09). GP2a and GP2t levels as well as prevalences were significantly elevated in early acute pancreatitis (<=3 disease days) compared to all control cohorts (p<0.05, respectively). GP2a and GP2t levels were significantly higher in patients with severe acute pancreatitis at admission compared with mild cases (p<0.05, respectively). Odds ratio for GP2a regarding mild versus severe acute pancreatitis with lethal outcome was 7.8 on admission (p = 0.0222). GP2a and GP2t levels were significantly correlated with procalcitonin (rho=0.21, 0.26; p=0.0110, 0.0012; respectively) and C-reactive protein (rho=0.37, 0.40; p<0.0001; respectively) Serum GP2a is a specific marker of acute pancreatitis and analysis of GP2a can aid in the differential diagnosis of acute abdominal pain and prognosis of severe acute pancreatitis.
Keywords: Glycoprotein 2 Isoform Alpha, A New Diagnostic and Prognostic Biomarker, For Acute Pancreatitis
O79
How to Diagnose Porphyria
Sverre Sandberg 1*
1-The Norwegian Porphyria Centre (NAPOS),Haukeland University Hospital, NO-5021 Bergen Norway [email protected]
To Be able to diagnose Prophyrias in an effective way, it is essential to establish standardized routines for how this can be done. In practice, a Porphyria specialist centre should be able to, - Give advice on what samples to send for Porphyria diagnosing and monitoring, - Select the correct constituents for analysis given the clinical history, - Perform the analyses with high analytical quality, - Diagnose the different types of Porphyria ,- Dive expert comments on the results, - Give Advice on the futher follow up and monitoring of the patient,The European Porphyria Network (EPNET) is working towards making the laboratories participating in EPNET be able to fulfill the goals stated above. The present lecture will give an overview on how to diagnose the different types of Porphyria and also initiate a discussion on how this can be done in Iran.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 69 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
New Findings in Laboratory Diagnostics: Immunology and Serology O80 – O86
In a wide area such as immunology- that nowadays is introduced as the intersection of science and is also laid in a joint route of different branches of medical biology science, the implementation of purposive and functional researches plays an important role in promoting laboratory techniques and innovating methods and different laboratory kits especially in the field of laboratory. In this way presenting results of researches conducted by Iranian researchers and young scientists, has an important role in better interpretation of experimental phenomenon and more accurate conclusions from hypotheses and theories related to this scope and improving the scientific level of staffs in clinical diagnostic laboratories as well as the quality of related services. Hopefully, researchers will contribute to the 15th congress on Quality Improvement of Clinical laboratories in Iran and take a step forward towards the quality improvement of clinical laboratories in Iran by presentation of results in different fields of immunology especially laboratory immune-serology. In this regard scientific works from clinical and basic researches by MSc and PhD students and graduates in the field of immunology, are appreciated. We hope that the 15th congress will be held this year, more effectively and efficiently with the participation of young and enthusiastic Immunologists from all over the country and academics from other countries in the field of Immunology. Dr. M. Mehdi Mohammadi, DCLS, PhD Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O80 Molecular Evaluation of Human Neutrophil Antigen (HNA-4) in Blood Donors of Eastern Azerbaijan –Iran Atieh Khosravi 1 *, Mojgan Shaiegan 2, Karim Shams Asanjan 1, Shahram Samiei 2, Zahra Atai Kachuai 2, Frank Showkati3, Batool Kiani 3, Soheila Omid 3 1- Tabriz University of Medical Sciences, 2- Iran Blood Transfusion Organization, 3- East Azarbaijan Blood Transfusion Building [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected] Background and Objectives Neutrophil alloantigens are involved in several blood transfusion reactions including transfusion related acute lung injury (TRALI), refractoriness to granulocyte transfusions and febrile transfusion reactions (FNHTRs). Due to lack of reports on neutrophil antigens, we aimed to detect the frequency rates of HNA-4a and HNA-4b antigens in some blood donors living in Eastern Azerbaijan.Materials and Methods Blood samples were collected from 204 Turkish unrelated blood donors where referred to Eastern Azerbaijan Blood Center. DNA was extracted by Pars-Tous kit. PCR-SSP was used for evaluation of HNA-4a, HNA-4b.After PCR-SSP method, the gene frequency rates of HNA 4a and HNA-4b antigenes were calculated by Hardy Weinberg equilibrium. ResultsThe gene frequencies of HNA-4a, HNA-4b were 0.91 and 0.09, respectively showing consistency with the Hardy-Weinberg equilibrium. Phenotypic frequency was found in 168 (82.35%) with HNA-4 (a,a), 1 (0.49%) with HNA- 4(b,b) and 35 (17.15%) with HNA-4(a,b) .Conclusions The results observed in this study is shown the highest frequency for gene HNA-4a (91.1%), that In a similar study in Fars that this gene frequency was 100%.The frequencies of HNA-4a and -4b were similar to those found in the previous study conducted on German populations. Keywords: HNA-4 Antigen, Blood Donors of Eastern Azerbaijan, PCR-SSP, TRALI
O81 A Novel Recombinant Multi-Epitop Antigen of Helicobacter Pylori: Desigh, Construction and Its Preliminary Evaluation as a Marker for Diagnosis of H.Pylori Infection Zeinab Hamzehloo 1*, Ghasem Mosayebi 2, Behzad Khansarinejad 3, Mina Zolfaghari 4, Hamid Abtahi 5 1- MSc Student In Medical Biotechnology, Dept. of Biotechnology and Microbiology, Arak University of Medical Sciences, Arak, Iran, 2- Professor of Medical Immunology, Dept. of Microbiology and Immunology, Arak University of Medical Sciences, Arak, Iran, 3- Assistant Professor of Medical Virology, Dept. of Microbiology and Immunology, Arak University of Medical Sciences, Arak, Iran, 4- MSc Student In Medical Microbiology, Dept. of Microbiology and Immunology, Arak University of Medical Sciences, Arak, Iran, 5- Associate Professor of Medical Microbiology, Molecular and Medical Research Center, Arak University of Medical Sciences, Arak, Iran [email protected] Intruduction: Helicobacter pylori (H. pylori) is the main cause of gastric cancer. Some diagnostic tests are available for detection of H.pylori. Invasive tests are performed by biopsy specimens include histology,culture,rapid urease test and molecular methods. Urea breathing test,stool antigen test and serology are non-invasive tests. Detection of H.pylori infection via serological methods is the easiest approach to diagnose the infection.Several virulence genes have been identified in H. pylori and the proteins expressed by some of them, like UreB, VacA, HpaA, CagA, HspB, FlaA, FlaB have been investigated as diagnostic indicators of H.pylori infection.In some commercial diagnostic kits,a mixture of critical antigens is used because it provides higher specificity and sensitivity in comparison with using a single antigen.This study aimed to construct a gene that encodes multi-immuno- dominant epitops of FlaA and UreB of H.pylori,expression, purification and antigenisity evaluation of recombinant multi epitope protein(rFlaA-UreB) as a promising diagnostic marker.Materials and Methods: The antigenic regions of FlaA and UreB genes was detected by bioinformatics methods,amplified and join together by PCR by special primers contain linker sequence and cloned into the pET-32a. After expression and purification,the diagnostic performance of rFlaA-UreB was evaluated by IgG enzyme-linked immunosorbent assay(ELISA) and Western Blot using human sera infected with H.pylori.Results: The data indicated that rflaA- UreB was recognized by all patients sera and its sensitivity and specificity was high.Conclusion: This recombinant protein has close antigenic properties to the natural forms of these antigens so it seems to be a promising antigen for serologic diagnosis of H.pylori. Keywords: FlaA, Helicobacter Pylori, UreB
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 71 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O82
Preparation of Genetically Fused Protein A-luciferase for use in Bioluminescent Immunoassays
Mohammad Azadi 1 *, Hossein Abdul Tehrani 1
1- Department of Medical Biotechnology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran [email protected], [email protected]
Protein A is a cell wall component in the most strains of Staphylococcus aureus. The protein is usually linked covalently to the peptidoglycan, but some mutants have been found which are able to secrete protein A into the growth medium. Protein A is a single polypeptide chain consisting of five IgG binding domains. The other protein, Luciferase, which has obtained from firefly, have become extremely popular in recent years for the bioluminescence measurements. It is often used to determine the amount of a specific unknown present in a sample. In this study the genes encoding staphylococcal protein A and firefly luciferase were genetically fused to obtain a dual functional marker for immunoassays using bioluminescent activity. The genomic DNA of Staphylococcus aureus, strain ATCC6538, was extracted and the gene of protein A containing IgG binding domains (914bp) was amplified by PCR reaction. Then the PCR fragment was cloned into pET-22b (+) vector and an amplified fragment of luciferase containing (1653 bp) was inserted downstream of the protein A gene. The resulted construct was transformed into Ecoli BL21 and the transformed cells were cultured in LB broth medium. After reaching to acceptable OD, the expression of fused protein was induced by IPTG and after 4 hours the cells were harvested. Finally the fused protein was isolated from the cell extract and purified by Nickle affinity chromatography. The results of immunodiffusion and bioluminescence assay were confirmed by binding capability of protein A to IgG and the enzyme activity of luciferase respectively.
Keywords: Staphylococcus Aureus, Protein A, Luciferase, IgG, Immunodiffusion and Bioluminescence Assay
O83
Comparison of Native ELISA Test (Prepared in Khuzestan) and Commercial ELISA Kit in Diagnosis of Human Hydatidosis
Sharif Maraghi 1 *, Abdollah Rafiei 1, Maryam Fasihi 1, Seyed Mahmoud Latifi 1
1- Ahvaz Jundishapur University of Medical Sciences [email protected], [email protected], [email protected], [email protected]
Aim:Cystic echinococcosis (CE) is a zoonotic disease caused by the larval stage of small metacestod worm called Echinococcus granulosus. Canines are the definitive and herbivorous animals and humans act as intermediate hosts who are infected accidentally. Eggs are passed in the feces of an infected dog and may subsequently be ingested by grazing herbivorous or by ingestion of vegetables or via the direct contact with dogs and cause cystic echinococcosis. Ultrasonographic appearance of echinococcal cysts is seen in the image below.Cystic echinococcosis is diagnosed via the imaging or serological methods. Commercial serological kits commonly are expensive and hard to be accessed.The aim of this study is comparison of sensitivity and specificity ofnativeand commercial kits in diagnosis of human hydatidosis. If Methods: Serum sample of 90 individuals, including 50 confirmed post- operation hydatidosis, 20 with heterologus diseases such as cancer, icterus, kala azar, HIV+, hepatitis and giardiosis, and 20 healthy subjects as control group were tested as single blind for anti- hydatidosis Ig G using native and commercial ELISA kits. Results: From 90 serum samples 52 were positive for hydatidosis by native ELISA and 22 (44.5%) were positive by commercial kit. The sensitivity for native kit was 100% and for commercial kit was 44% in comparison with surgery. Conclusion: The results of this study indicated that application of Elisa test with native antigen is more sensitive and specific than commercial kit in diagnosis of hydatidasis.
Keywords: Hydatid Cyst, Echinococcus Granulosus, Commercial Kit, Native Antigen
72 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O84
The Effect of Platelet Lysate from Umbilical Cord Blood and Peripheral Blood on Mesenchymal stem Cells Proliferation
Mohadeseh Rahimi Mofrad 1 *, Afsaneh Aghaei 2, Fatemeh Yari 2, Mahin Niko Goftar 2
1-Kashan Shahid Beheshti Hospital, Kashan University of Medical Sciences, Kashan, Iran, 2- Tehran.Blood Trasfusion Center [email protected]
The role of platelets in hemostasis, innate and adaptive immunity has been demonstrated before; howeverplatelet growth factors are able to improve the growth of different cell lines.Fetal bovine serum (FBS) is common used to supplement the culture medium. In this study, platelet lysate from umbilical cord blood (UCB) or peripheral blood (PB) was used to differentiation and proliferationof mesenchymal stem cells (MSC).Materials and Methods:TheMSCfrom placenta was cultured in DMEM-LG with 10% FBS,and confirmedfor CD44, CD90, CD73, CD105, CD166, CD45 and CD34 markers.Then these cellswere cultured in 2%, 5% and 10% FBS, 10% UCB serum, 10% PB serum and platelets lysate from UCB or PBseparately, the mixture of serum and platelets lysate was used too.These cells were cultured in adipogenesismedium or osteogenesismedium containing platelet lysate ofUCBorPB. The amount of growth factor TGF-β was measured.Result:The morphology of MSC cultured in both platelets lysate was similar to medium containing FBS. The proliferation of mesenchymal stem cells in both platelet lysate were similar to medium containing 5% FBS.The proliferation in UCB platelets lysate plus cord blood serum was similar to medium containing 10% FBS. MSCcultured in UCB or PBplatelet lysate maintain their differentiation ability to adipocyte and osteocyte. No differences were observed in the amount of growth factor TGF-β.Conclusion:In general platelets lysate of UCB or PB could be a good substitute instead of animal supplementary culture medium.
Keywords: Platelet Lysate, Umbilical Cord Blood, Peripheral Blood, Mesenchymal Stem Cell
O85
Cloning and Production of the Monomer form of Recombinant Streptavidin and Appraisal of it`s Binding Affinity to biotin
Elham Didevara 1* , Abdorrahim Sadeghi 2 , Niloofar Moradi 1 , Malihe Hallaji 1 , Shabnam Sadoogh 3 , Hamid Abtahi 3
1- Department of Biotechnology and Molecular Medicine, Arak University of Medical Sciences, Arak, Iran, 2-Department of Biochemistry and Genetics, Arak University of Medical Sciences, Arak, Iran,3- Department of Microbiology and Immunology, Arak University of Medical Sciences, Arak, Iran [email protected], [email protected], [email protected], [email protected], [email protected], [email protected]
Background: Homotetramer streptavidin protein, which has high binding affinity to biotin has widely used in biotechnological processes and cell studies. but, it`s tetramer form makes disturbance with some assays. So in this study produced monomer streptavidin by a deletion mutation .Materials and methods: First, the nucleotide sequence of the streptavidin mature form was taken from the NCBI site after making a Mutation in the gene sequence in order to expression in E.Coli bacteria,the sequence was optimized and synthesized. To clone and expression the streptavidin gene used from E.coli DH5α strain and E.coli BL21 (DE3) pLysS strain , Respectively. Protein purification was performed by Ni-NTA kit and binding affinity to biotin-streptavidin was measured by HABA dye.Results: Streptavidin monomer form in E.coli BL21 (DE3) pLysS expression host was produced and purified. Recombinant Monomer streptavidin binded to biotin with a suitable binding affinity.Conclusion: By creating mutation in the streptavidin peptide sequences can be achieved to monomer form of streptavidin that has binding affinity to biotin.
Keywords: Streptavidin, Cloning, Monomer Form
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 73 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O86
Use of Whole Exome Sequencing for Differentiation of Primary/Secondary Immunodeficiency and Identification of New Mutations
Majid Fathi 1 *, Arshad Hosseini 2
1- Student Research Committee, Department of Medical Biotechnology, Faculty of Allied Medicine, Iran University of Medical Sciences, Tehran, Iran, 2- Department of Medical Biotechnology, Faculty of Allied Medicine, Iran University of Medical Sciences, Tehran, Iran [email protected], [email protected]
Immunodeficiencies are the defects in immune system, which cause different kinds of infections by pathogens. They are divided in to primary and secondary, that are congenital and acquired respectively. Because more than 300 genes are known as the reasons of Primary Immunodeficiency (PID) and these two kinds may have the same clinical manifestations so their differentiation is complicated.One of the ways to understand the exact reason of patient manifestations is to use Whole Exome Sequencing (WES), as if we reach to a mutation we can conclude that patient’s symptoms is because of PID and vice versa.In this study, we outlined a practical framework to discover the variants cause a primary immunodeficiency. Two patients suspected as Familial Hemophagocyic Lymphohistiocytosis with signs of recurrent infections and prolonged fever were choose. After WES of patient genomes, their data were analyzed Linux NGS soft wares then Sanger sequencing assessed their results. WES analysis selected two missense mutations in ITCH and UNC13D genes in one patient and a no significant mutation in the second one. After Sanger sequencing of both gene mutations and comparing with their families sequence, UNC13D has been choose as the main mutation for the first patient.We showed that utilizing appropriate analysis tools could reach us to the exact deleterious mutations. In addition, if we did not detect any mutation in PID patients by exome sequencing we can confer, there might be a secondary form of PID case or maybe the mutant is somewhere out of exons in promoters.
Keywords: Whole Exome Sequencing, Primary Immunodeficiency, Secondary Immunodeficiency, Sanger Sequencing, Familial Hemophagocyic Lymphohistiocytosis
74 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
New Findings in Laboratory Diagnostics: Microbiology O87 – O94
Identification of the causative agents of infectious diseases is fundamental element in diagnostic microbiology. regarding of broad spectrum of infectious agents including viruses, bacteria, fungi, and parasite, there isn’t a unique method for isolation and identification of these pathogen agents. In recent years, by developing information and recognition of structures and physiological features of pathogenic elements, has been established great improvements in identification of microbes. In the other hand, beside the new technology (methods based on proteomics and genomics), conventional methods (based on immunology and phenotype) recommend for quick identification, medical approaches, and proper validity in diagnostic bacteriology. Indeed, isolation and identification of pathogenic agents from different anatomic sites of human body, epidemiology studies and using new technologies in diagnostic infectious diseases, especially, Point of care testing (POCT) are always considerable subjects in medical microbiology researches. Therefore, different articles for different diseases selected in this topic for presentation. Dr. F. Azizmohseni, DCLS, PhD Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O87
Detection of S.entritidis in Poultry Product Using Conventional and PCR Molecular Methods
Zeinab Yazdanpanah 1 * , Mohsen Zargar Rahmana 2 , Mohammad Taghi Zahraee 3 , Somayeh Allahkarami 4
1- Department of Biology, Qum Islamic Azad University,Qom, Iran- Laboratory Technical Officer, 2- Department of Biology, Qum Islamic Azad University,Qom, Iran- Doctor, 3- Departement of Veterinary Medicine, Tehran university,Tehran, Iran, 4- Department of Biology, Science and Research Branch, Islamic Azad University,Tehran, Iran- Ph.D. Student [email protected], [email protected], [email protected], [email protected]
Salmonella infections cause disease in many hosts such as domestic, wild animals and human. Salmonella enteritidis is one of the most important serotype was isolated after cleaning and disinfection of poultry houses. Chiken meat and its product are the most important protein foods in the diet that plays an important role in the transmission of zoonotic bacteria to human. In this study, the prevalence detection of S.enteritidis in poultry products analyzed by PCR and culture. In this cross study, 400 samples including 250 Chicken meat specimens, 75 eggshell and 75 chicken feed samples from five regions in Tehran within six months were applied to biochemical tests. After that, the samples were tested by PCR using specific primers of S.entritidis to detect the fimbrial genes of SEF14 and SEF17. Moreover, the sensitivity and resistance of bacteria to antibiotics were determined using the disk diffusion method. Of 400 samples studied, 35 were detected using biochemical tests. DNA of the 35 samples was tested by PCR that 20 samples including 14 (70%) chicken meat, 4 (20%) eggshells, 2 (10%) chicken feed belong to S.entritidis using dedicated fimbrial primers. Of the antibiotics studied, the most antibiotic resistance belongs to Doxycycline and Co-trimoxazole. The results showed a strong control should be applied to the destruction process and supply of chicken, eggs and livestock feeds. Also, due to the difficulties of in vitro isolation, PCR method can be used as a sensitive and rapid method for the detection of S.entritidis in contaminated food samples.
Keywords: Salmonella Enteritidis, Poultry, Fimbrial Genes, PCR
O88
The Relationship between the Virulence Factors and New Phylogenetic Groups of Escherichia Coli Strains in Iran
Akram Najafi 1 * , Mojtaba Hassanpour 2 , Masoud Aziemzadeh 3
1- The Persian Gulf Marine Biotechnology Medicine Research Center, Bushehr University of Medical Sciences, Bushehr, Iran, 2- Bushehr University of Medical Sciences, Bushehr, Iran, 3- Department of Microbiology and Parasitology, Faculty of Medicine, Bushehr University of Medical Sciences, Bushehr, Iran [email protected], [email protected], [email protected]
Background: Uropathogenic E. coli are among major pathogens causing urinary tract infections. VF are mainly responsible for the severity of these emerging infections. In 2013 Clermont classified E. coli into eight new phylogenetic groups.Objectives: This study was aimed to compare the distribution of virulence genes in the new phylogenetic groups of E. coli isolated from patients with UTI in Iran.Materials and Methods: In this cross-sectional study, all positive E. coli isolates were subjected to phylogenetic groups typing by a quadruplex PCR method. Also, 10 virulence genes of the isolates were detected using multiplex- PCR.Results: Among 140 E. coli isolates majority belonged to phylogenetic group B2 (39.3%), followed by unknown (27.1%), E (9.3%), C and Clade I (each 6.4%), B1 (5%), F and D (each 2.9%) and A (0.7%). The most prevalent virulence genes were fimH (85%), The most predominant virulence gene was fimH (85%), and followed by iucC (61.4%), papC (38.6%), hlyA (22.1%), cnf-1 (18.6%), afa (10.7%), papG and neuC (each 9.3%), ibeA (3.6%) and sfa/foc (0.7%), respectively. The highest presence of virulence genes was detected in phylogenetic group B2 and unknown.Conclusion: About 25% of E. coli isolates belong to the newly described phylo-groups C, E, F and clade I. However, group B2 isolates were the most versatile as all were equipped with virulence genes. Such studies need to be done in various geographical regions of the country to know about the frequency of virulence genes and phylo-typing of E. coli strains correctly.
Keywords: Escherichia Coli, Phylogenetic Groups, UTI, Virulence Factors
76 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O89
Detection of Beta-Lactamase Resistance among Campylobacters Isolated from Diarrhea Patients in Markazi Province - 2015
Elnaz Abbasi 1 * , Ehsanollah Ghaznavi Rad 1
1- Department of Microbiology & Immunology, Faculty of Medicine, Arak University of Medical Sciences, Arak, Iran [email protected], [email protected]
Introduction:Campylobacter species, especially C. jejuni and C. coli, are the most common bacterial causes of gastroenteritis in humans (1).In recent years, beta-Lactamase resistance has emerged among many pathogenic and nonpathogenic species of bacteria. The occurrence of this resistance is due to obtaining different beta-Lactamase resistance (oxa61) genes(2).In Iran, limited studies have been determined antibiotic resistance of these bacteria, so investigating beta-Lactamase resistance in them is necessary. Therefore, this study aimed to determine the frequency of beta-Lactamase resistance and to investigate genotypic determinant of beta-Lactamase resistance in campylobacters isolated from the stools of the dysenteric patients admitted to educational and medical centers in Arak, Iran Materials and Methods:In this descriptive cross-sectional study, diarrheal stool specimens of the patients admitted to educational and medical centers in Arak in the period from May 2015 to Sep. 2015 were collected and after phenotypic and genotypic investigation of campylobacter, resistance to beta-Lactamase was assessed using disk diffusion method. In addition, oxa61 genes contributing to beta-Lactamase resistance in campylobacter were also investigated Result:Out of 108 dysenteric stool specimens, 28 (25.92%) campylobacter were isolated of which 26 (24.07%) were C. jejuni and 2 (1.85%) were C. coli. Phenotypic resistance prevalence in C. jejuni was obtained as 18 (64.28%) and in C. coli as 2 (7.1%).Frequency of, oxa61 beta-Lactamase resistance gene was found as 7 (26.92%) and 1(50%) in C. jejuni and C. coli, respectively Discussion:This study showed beta- Lactamase resistance in campylobacter isolates.This is very useful data for empirical therapy.
Keywords: Campylobacter, Beta-Lactamase, Drug Resistance, Bacterial, Iran
O90
Genotyping of Giardia Duodenalis by Multilocus Genoyping (MLG) in Inhabitance of Baharestan City
Leyla Nasiri Goorabi 1 *, Majid Pirestani 1
1- Tarbiat Modares University,Tehran, Iran [email protected], [email protected]
Background and Target : Giardiasis is an infection of the digestive system caused by tiny parasites called Giardia duodenalis (also known Giardia lamblia or Giardiaintestinalis). Interference of parasite in absorption of fat-soluble vitamins and fats, in seriouse infections were observed steatorrhea ,anemia, weakness and weight loss but most patients are asymptomatic and most infections are self-limited. The study to evaluate Giardia deodenalis isolates of Baharestan city (Tehran Province) using glutamate dehydrogenase (GDH), triosephosphate isomerase (TPI) and Beta- giardin genes by PCR-RFLP and sequencing.Material and procedure: in this study, 320 stool samples of health cards applicants collected and examined with wet mount method. 25 out these fecal samples were positive. Positive samples were stored in ptassium dichromate 5% and 4ºC. DNA extraction and amplification of genes GDH, TPI and Beta giardin by PCR were performed.Conclusion: Totally, these results showed that genetic diversity of Giardia deodenalis seen in asymptomatic pateints in this city. There is no correlation between genetic diversity and clinical symptoms.Findings :The result of PCR were positive in all samples. The MLG result revealed that12 (48%) out 25 isolates belonged to assemblage A, 9 isolate (36%) in assemblage B and 4 isolate (16%) were co-infection A and B, respectively. The result of sequencing confirmed RFLP results.
Keywords: Giardia Deodenalis, Triose Phosphate Isomerase Gene, Glutamate Dehydrogenase, BetaGiardin, MLG
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 77 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O91
Cytochrome b and Molecular Typing of Leishmania in Cutaneous Leishmaniasis Species in Sistan and Baluchestan Province of Iran Hadi Mirahmadi 1 *, Gholamreza Motalleb 2, Ahmad Zare Zadeh 2, Ahmad Mehravaran 1 1- Department of Parasitology and Mycology, Faculty of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran 2- Department of Molecular Biology, Faculty of Science, University of Zabol, Zabol, Islamic Republic of Iran [email protected], [email protected], [email protected], [email protected] Background: Leishmaniasis is a common zoonotic disease and according to the World Health Organization’s report has an annual incidence of 900000-1300000 new cases and 20000-30000 mortality rate. Despite the high prevalence and drug resistance of disease in Sistan and Baluchestan province, the species of cutaneous Leishmania has not been identified. Methods: After sampling from the wound of patients suspected of cutaneous Leishmaniasis (700 slides), 345 samples were positive. The total collected samples were assessed by direct microscopy. After DNA extraction, positive samples were used for cytochrome b detection by PCR-RFLP to determine the parasite species. Among positive samples, 20% were sequenced. To compare the results of sequences, molecular evolutionary genetic analysis (MEGA6) was used.Results: 53 samples (53%) were identified as Leishmania major and 47 samples (47%) Leishmania tropica. The results showed that cytochrome b in L. major converted to 400 and 480bp pieces and in L. tropica to 130, 215 and 535bp pieces. Comparison of sequences of common and new haplotypes of cytochrome b of Leishmania major with haplotypes recorded in Genebank and Leishmania major isolated from patients of Zahedan identified 4 different nucleotides in places 11, 283, 419 and 642.Conclusion: According to the results of this research, infection was more related to Leishmania major. PCR-RFLP method has a high sensitivity and is appropriate for diagnosis of Leishmaniasis and fast determination of parasite species causing disease. Keywords: Leishmania Major, Leishmania Tropica, Cytochrome b, PCR, DNA Sequencing
O92 Diagnostic Value of Serological and Molecular Methods for Screening and Detecting Chlamydia Trachomatis Infection in Semen Samples of Infertile Men Referring to Royan Institute Amin Khoshakhlagh 1, Reza Salman Yazdi 2 *, Farah Taj Navab-Akbar 3, Azadeh Ghaheri 4, Shaghayegh Sadeghinia 5 Farid Dadkhah 2 1- Department of Microbiology, Islamic Azad University, Naein Branch, Isfahan, Iran, 2- Department of Andrology, Reproductive Biomedicine Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran, 3- Department of Microbiology and Virology, Isfahan University of Medical Sciences, Isfahan, Iran, 4- Department of Epidemiology and Reproductive Health, Reproductive Epidemiology Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran, 5- Department of Biomolecular & Biomedical Science, School of Health Life & Science, Glasgow Caledonian University, Glasgow, UK [email protected], [email protected], [email protected], [email protected], [email protected], [email protected] Objective:Chlamydia trachomatis(CT) with damaging effects on sperm quality parameters can often cause infertility in men. The main objective of this study was to determine the Diagnostic Value of serological and molecular methods in screening and detecting CT infection in semen samples of infertile men referring to Royan Institute.Materials and Methods:In this cross-sectional study, 465 patients referring to the clinical laboratory of Royan Institute were randomly chosen for primary screening and detection of the presence of CT. 93 samples were normozoospermia (Asymptomatic) and other 372 had abnormal parameters (Symptomatic) in semen analysis. ELISA test was performed as the screening test. Samples with OD>0.200 were selected as the case group and asymptomatic samples with OD<0.200 were selected as the control group for confirmatory test. PCR assay was used to confirm the serological results.Results:In the case groups (n=62), 4 out of 32 symptomatic samples (12.5%), and 1 out of 30 asymptomatic samples (3.3%) revealed positive results in the PCR. No PCR positive sample was observed in the control group (n=34). The final results revealed that considering OD>0.400 as the ELISA Positive, the Diagnostic Value of CT-ELISA Positive in symptomatic and asymptomatic infertile patients were 0.019(7 of 372) and 0.021(2 of 93), respectively.Conclusion:Screening of infertile men who do not show any clinical symptoms look unavoidable and can be considered as a part of the program of sexually transmitted disease control. In conclusion the anti-CT IgA ELISA test could be introduced as an appropriate tool for screening purpose in the seminal plasma. Keywords: Chlamydia Trachomatis, Infertile Men, ELISA, PCR, Screening
78 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O93
The Prevalence and Frequencies of Adhesion Genes in Streptococcus Pneumoniae Isolated from Carrier Children in Tehran
Sara Abdollahi 1,2 *, Seyed Fazlollah Mousavi 1, Seyed Davar Siadat 1, Reza Shapoury 2
1- Department of Microbiology, Pasteur Institute of Iran, Tehran, Iran, 2- Department of Microbiology, Islamic Azad University, Zanjan Branch, Zanjan [email protected], [email protected]
Background: Most strains of Streptococcus pneumoniae are natural flora of the natural membrane and cause diseases in certain circumstances. Pharyngeal carriers are the source and transitional vectors of invasive .Attachment is the first step of the pathogenicity. Adhesin proteins of these bacteria play an important role in attachment and colonization. In the absence of these proteins attachment does not occur. Some of these factors are candidate antigens for protein based vaccines. Objective: In this study, 5 key virulence genes lytA, pspC, phtD,phtE and rrgA, which encoded surface proteins, were evaluated among S. pneumoniae isolates. Materials and Methods: A total of 308 nasopharyngeal swabs were collected from children under 6 years old of the Tehran children medical center and child care centers covered by Tehran welfare organization. Isolates of S. pneumoniae were confirmed by optochin susceptibility and colony appearance and also by PCR for gene. The presence phtD,phtE, pspC, lytA, rrgA genes were also detected by PCR. Results: From 308 nasopharyngeal swabs, 102 isolates of Streptococcus pneumoniae were identified after identification tests. Among these isolates, 87 (85.2%) 54(%52.9), 51(%50), 43(%42.1) and 31 (30.3%) were positive for lytA, rrgA,phtE, pspC and phtD genes respectively. Conclusion: cpsA gene was specific for detection of S. pneumoniae isolates which were colonized in nasopharynx. Among five adhesin genes, lytA was the most frequent gene and combination of rrgA, lytA was the most observed pattern.These findings could be very useful for design of further studies about vaccine against S. pneumonia in our country.
Keywords: Treptococcus Pneumoniae, Nasopharynx, Adhesin, Genes, Children, PCR
O94 Novel Molecular Tools for Detection of Triazole-Resistance Gene Mutations in Pathogenic Fungi
Hamid Badali 1 *, Sedighe Khodavasi 2
1- Department of Medical Mycology and Parasitology, Invasive Fungi Research Center, School of Medicine, Mazandaran University of Medical Sciences, Sari, Iran, 2- Department of Medical Parasitology and Mycology, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran [email protected]
Fungal pathogens such as Candida and Aspergillus species are the causal agents of infections with high mortality among immunocompromised patients. Treatment options are limited due to the low efficacies of some antifungal drugs against pathogenic fungi. Management of these diseases is dependent on the early and efficient antifungal drug therapy, as well as drug resistance monitoring. Clinical failures are now reported frequently, and the frequency of isolation of triazole-resistant clinical A. fumigatus and Candida species isolates has increased in several countries. Remarkably, the occurrence of triazole-resistant A. fumigatus strains has been documented in environmental samples from some countries, with isolation frequencies ranging from 5% to 12%. Although emerging azole resistance contributes to treatment failures is unknown, triazole fungicide use in agriculture has been linked to this phenomenon in Europe Therefore, regarding to the decreased sensitivity of these pathogenic fungi to antifungal drugs during recent decades, rapid detection/identification of drug resistance associated mutations is crucially important. Generally, a study for identification of drug resistance associated mutations requires complicated and expensive methods such as PCR or DNA sequencing. However, nowadays application of accurate, fast and highly sensitive techniques, i.e., Rolling Circle Amplification (RCA), simple PCR, PCR restriction fragment length polymorphism (RFLP), Real-Time PCR and ARMS-PCR, provides the possibility for detection of target sequence contains nucleotide polymorphisms even at the one base pair (SNP) level. Herein we aimed to discuss the usage, advantages and disadvantages of these techniques in order to identify the mutations of the azole-resistant strains.
Keywords: Triazole Resistance, Mutation, Molecular Tools
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 79 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Personalized Medicine O95 - O100
In conventional standard therapy protocols, treatment is based on trial and error in many cases. For example, there are some drugs for each patient and ordered by physician them based on existing instructions. If the first drug has not effective, so, then physician ordered second and may be more drugs. In a valid report, it has shown that more than 75% of cancers eventually will not respond to the identical treatment regime. This failure to treatment occur is 50% of arthritis, 70% in Alzheimer’s disease, 52% osteoporosis, 48% migraine, and 43% diabetes. Additionally, the percentage of unsuccessfull treatments occur in 40% asthma, 38% depression. These data clarify the essential personalize medicine approach base on personal characteristics, genetic, physiological, life style, and dedicated variables for each individual more than ever. Dr. M. R. Mahdavi Amiri, DCLS Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O95
The Oncotype Diagnosis Assay in the Management of Invasive Early Stage Breast Cancer
Ariana Kariminejad 1 *
1-Kariminejad-Najmabadi Pathology & Genetics Center 2 [email protected]
Background: The oncotype diagnosis assay determines a recurrence score in women with early stage breast cancer with no lymph node involvement and estrogen positive involvement.Methods: Based on 21 genes selected in paraffin-embedded tumor tissue a recurrence score is determined which determines the 10 year recurrence rate. Patients with high recurrence score (RS) More or equal to 31 had a large benefit from chemotherapy (relative risk; 27.6%; SE 8.0%). Patients with low RS (less than 18) had a minimal, if any benefit from chemotherapy treatment (relative risk, Patients with intermediate RS did not appear to have a large benefit from chemotherapy. Conclusion: Before starting chemotherapy for all breast cancer patients, performing oncotype diagnosis assay can prevent the unnecessary side effects and costs of chemotherapy in cancer patients.
Keywords: Oncotype Diagnosis, Breast Cancer
O96
Organoids: A Novel Patient Derived Platform for Personalized Medicine and Drug Discovery
Farzin Pourfarzad 1 *
1- Hubrecht Organoid Technology [email protected]
Hubrecht Organoid Technology (HUB) has developed 3D cultures system to establish and expand human and animal epithelial tissue from a variety of organs both healthy and diseased, such as cancer. The Organoid technology is based on work of Hans Clevers that identified adult’s stem cells in many human tissues such as intestine, liver, pancreas, breast, and lung. Organoid cultures are virtually unlimited, genetically and phenotypically stable and retain biological and functional properties of the original tissue (Barker et al., Nature 2007; Sato et al., Nature 2009, 2011; Gastroenterology 2011; Huch et al., Nature 2013; Karthaus et al., Cell 2014; Cell 2015; Boj et al., Cell 2015). Organoids recapitulate the original tissue response to external stimuli and therefore provide a unique and robust in vitro model for drug development, diagnostics, and patient stratification.The HUB is collaborating with and licensing the technology to the Pharmaceutical and Biotech industry. In addition, HUB has built a comprehensive Living Biobank of well-characterized Organoids from different healthy, disease and cancerous tissues of multiple organs. In combination of the Living Biobank and Organoid technology, HUB offers a unique platform to develop assays and provide services for preclinical drug discovery, toxicity, validation, personalized and regenerative medicine.
Keywords: Organoids, Drug Discovery, Personalized Medicine, Regenerative Medicine
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 81 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O97
Personalized Medicine, Technologies Involved, Self Management and It’s Societal Dimension on Human Life from Philosophical Point of View
Masoud Garshasbi *
By completion of human genome project, we were very enthusiastic in the beginning, but quite soon we realized that just the genome of a person doesn’t tell you enough to understand human life or to understand, for example, the onset of a particular disease or the origin and the causation of a particular disease. In order to do so, it is always necessary to combine the genome with the environment. Personalized medicine is a new development within the medical research which could have enormous consequences for healthcare. It separates patients into different groups with medical decisions, practices, interventions and/or products being tailored to the individual patient based on their predicted response or risk of disease.It’s an intriguing and fascinating development, but at the same time some critical questions have to be asked. For example, on cultural level, it could change the way we see ourselves and we think about ourselves as human beings.Therefore, we need to think about the positive and possibly negative side effects that personalized medicine may have for us and how to address them. Also, it’s a very important objective for philosophy, to try to explore the future on the basis of what is happening in laboratories today and think through the scenarios that are currently being developed. Additionally, we need to believe that on the basis of these new technologies and these new forms of knowledge, the way we think about health and about ourselves is bound to change.
Keywords: Personalized Medicine
O98
Applications of Next Generation Sequencing in Health Care / Focus on Personalized Cancer Management
Mohammad Keramatipour 1 *
1- Assistant Professor, Department of Medical Genetics, Tehran University of Medical Sciences [email protected]
During last several years Next Generation Sequencing (NGS) revolutionized the genomic approach to human diseases. The basis of this revolution is the possibility of sequencing any fraction or the entire human genome in a matter of hours, something that took 13 years when it was done for the first time.By applying proper strategy, NGS proved very powerful in identification of novel or known genomic variants related to diagnosis and management of human diseases. Cancer genetics is one of important areas that NGS was applied successfully over the last several years. There are several applications for NGS in cancer management, including targeted personalized therapy.Interestingly, the discovery of circulating cell free DNA enhanced the power of NGS even in already known applications. Combining the use of tumoral circulating cell free DNA (liquid biopsy) with NGS created a magic tool to tackle many issues related to cancer management including the personalized targeted therapy.This talk aims in introducing the current available technologies mentioned above with presenting appropriate cases to show these application in real practice.
Keywords: NGS, Liquid Biopsy
82 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O99 Personolized Treatment in Multiple Sclerosis
Seyed Mohammad Baghbanian 1 *
1- Seyed Mohammad Baghbanian M.D. Assistant Professor, Clinical Neurology, Multiple Sclerosis Fellowship Bualicina Hospital, Neurology Department Mazandaran University of Medical sciences [email protected],[email protected]
Regarding body fluid biomarkers, CHI3L1 and NF-L have consolidated their prognostic role in CIS patients not only in terms of predicting conversion to MS but also in relation with the development of disability, and it is probably time we consider their incorporation into routine clinical practice. Other biomarkers such as SLC9A9 or the NLRP3 inflammasome need further confirmation in independent studies. Finally, biomarkers in natalizumab-treated patients like the lipid-specific IgM oligoclonal bands in the CSF and CD62L in peripheral blood may help to improve current algorithms evaluating the risk of PML. Although more studies are needed, a great deal of progress has already been made in the field of biomarkers in MS, and recent findings suggest that precision medicine, a utopia in the past, is slowly but steadily becoming reality in MS. A general criticism to the published studies is that sensitivity of the biomarker is more important than specificity, particularly in the initial phases of the disease, because the aim of an early monitoring of treatment response is to pick up patients at increased risk of treatment failure.
Keywords: Multiple Sclerosis, Personolized Treatment
O100 Opportunities and Challenges of Application of Next Generation Sequencing in Routine Clinical Practice: Iran Experience
Saeed Reza Ghafari 1 *, Maryam Rafati 1
1- Reproductive Biotechnology Research Center, Avicenna Research Institute, ACECR, Tehran, Iran [email protected], [email protected]
Most of genetic disorders are caused by point mutations or small deletions/duplications which are detectable by sequencing methods. The potential of conventional sequencing method, called Sanger sequencing, is limited to sequence a few hundred base pairs in each reaction. So, in case of large genes or heterogeneous disorders (eg. intellectual disability, developmental delay, hereditary visual loss, hereditary hearing impairment, motor disorders and etc.), such technique could not be applied in routine clinical practice. Application of next generation sequencing has overcome such limitation, as this method can sequence thousands of genes or even a whole genome in a single reaction. Moreover, the feasibility of chromosome analysis, both cytogenetically and submicroscopic, using NGS data has recently been shown. Therefore, NGS has become a diagnostic tool in routine medical genetic practices with the following applications: Mutation detection of heterogeneous disorders ،Personalized medicine ،Targetedcancer treatment،Pharmacogenetics،Pre-symptomatic early diagnosis of potentially lethal disorders (hereditary cancer, inherited arrhythmias, …) High resolution HLA typing using NGS Preimplantation genetic diagnosis of chromosome abnormalities (PGS-NGS) Genomic copy number variation analysis Beside NGS advantages, limitations of this technique should also be considered which are listed below: False positive variants: some of detected variants are due to sequencing errors. So, all variants detected by NGS should be verified by Sanger sequencing Limitation in detection of trinucleotide repeat expansion mutations incomplete coverage in current exome or target panels Data analysis is one of the main challenging aspects of NGS. Thousands of variants are detected in each sample.Identification of a single mutation among those variants requires a stepwise filtering approach. As the variants are population specific, knowing the common mutation in each population is a necessary step. Even some null variants like nonsense mutations or INDELs are common in some populations. Our experience in set up and optimization of NGS for the first time in Iran and data analysis of hundreds of Iranian people has revealed that each Iranian person, on average has 700-900 novel or low frequency variants which are not classified as common in large databases (eg. 1000 genomes, 5000 exomes, …). However, among such variants, a lot of them are common in Iranian patients, which should be considered in variant interpretation (see Iran Variation Database: http:// variome.ir) Though, application of NGS in routine clinical practice has revolutionized the diagnosis of genetic disorders, the above mentioned advantages and limitations should be considered to maximize its usefulness and minimize the potential errors.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 83 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Prenatal Screening: New Methods and Challenges O101 – O106
Prenatal screening for risk determination of fetal abnormalities including, Triosomies 21 (down syndrome), 18 (Edward syndrome), 13 (patoau syndrome) and open neural tube defects (ONTD) is one of the important and challengable subjects throughout the world including IRAN. Some main challenges are the role of different factors including, the influence of ultrasound results, softwares used for risk calculation and different methods of laboratory assessment. The influence of related factors on mother and fetus such as maternal and fetal age, weight of mother,race,being a smoker, insulin dependent diabetes mellitus (IDDM), twin pregnancy, invitro fertilization (IVF) and previous history of fetal abnormality approximately are considered in prenatal softwares, but generally current strategies including double marker and combined test, triple marker, quadruple marker, integrated test, stepwise and contingent sequential strategies in the best conditions have a detection rate between 70 to 94 percent. The main disadvantage of these strategies is high false positive and false negative results. False positive results lead to unnecessary invasive procedures (CVS and amniocentesis) and false negative results increase the risk of having a baby with an abnormality. Nowadays, improving non invasive prenatal testing (NIPT) such as non invasive fetal triosomy (NIFTY) and measuring cell free fetal DNA increases the detection rate of triosomies more than 99.5 percent. The aforementioned topic was chosen for the congress on quality improvement in order to evaluate different methods of prenatal screening which is focused on screening challenges and new methods which are based on cell free fetal DNA, So, all researchers are invited to send their articles and experiences to exchange the information in order to meet the challenges. Dr. S. M. Sezavar Kamali, DCLS Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O101
The Role of Farensic Medicine in Legal Abortion
Amina Beikmohamadi 1 *
1-Medical forensic Administrative of Tehran- L.M.O [email protected]
The legal abortion law authorized in 1384 ; legal abortion is carried out due to definite diagnosis of serious fetal developmental problems accompany with mother’s severe hardship or mother’s disease, before the time of incarnation of fetus (4 month of ovulation) That follows mother’s willing .The offenders will face penalty according to Islamic punishment law .File processing ; Free of charge file processing taken place at first , achievement of medical documents as well as identification , consultation if needed , Then , permission issue and charging money in case of indication of legal abortion .Islamic punishment law correlate to legal abortion ; clauses 2 (guilt definition ) , 17 (compensation) , 145 (failure refutation ) , 245 (pure wrongdoing )Failure refutation evaluation instruction ; in all cases of mother’s who could benefit from legal abortion but due to medical diagnosis failure they couldn’t and claim compensation subsequently ,The file is susceptible to be considered as a wrongdoing medical diagnosis process , which can seriously involve Gynecologists , radiologists , Genetisians , lab. experts and the others .
Keywords: Legal Abortion, Medical Farensic
O102
Quality Assurance for Prenatal Screening Testing
Majid Sezavar Kamali 1 *
1- Dr.Sezavar Laboratory [email protected]
Errors may occur at any point in the prenatal test processing chain from the time the test is ordered by the clinician to clinical decisions based on the result. Quality assurance progrommes guide and monitor all related activities and include the following: 1- Preanalytic activities ,from the time the test is ordered to the time the sample arrives in the lab,including test ordering process ,patient preparation for the test , Patient identification ,completeness of patient information,Specimen collection procedures and transport to the lab.2- Analytic activities, the handling and analysis of the sample in the laboratory,including instrument operations,assay methodology and reagents, standards and calibration procedures,internal and external quality control , and testing personnel . 3- Postanalytic activities , what happens after a result is obtained and includes how and when it is reported to the provider or clinician,including Report sent to appropriate party ,Timely reporting of data ,Reference intervals and Critical limits. Therefore quality assurance for prenatal screening includes preventing mistakes or defects throughout the preanalytic, analytic and postanalytic process . It involves accreditation of laboratories and radiology imaging centers, genetic councelling, patient information, specimen collection, transportation, processing and specimen storage, assay methodologies and quality control, standards and calibration procedures and result reporting .There is a responsibility now to reassess current standards for minimising risks of error in the field. As a result, it is necessary to revise the guidelines for quality assurance and standardization in prenatal screening.
Keywords: Quality Assurance, Prenatal Screening, Guidelines
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 85 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O103
Non-Invasive Fetal Cell-Free DNA Novel Testing for Aneuploidy Screening
Mohammad Reza Abbaszadegan 1 *
1-Mashhad University of Medical Sciences, Mashhad, Iran- Medical Genetics Research Center [email protected]
Genomics-based non-invasive prenatal screening using cell-free DNA (cfDNA screening) was proposed to reduce the number of invasive procedures in current prenatal diagnosis for fetal aneuploidies. In high-risk pregnant women, noninvasive prenatal testing with the use of massively parallel sequencing of maternal plasma cell-free DNA (cfDNA testing) accurately detects fetal autosomal aneuploidy. Its performance in low-risk women is unclear. In a general obstetrical population, prenatal testing with the use of cfDNA had significantly lower false positive rates and higher positive predictive values for detection of trisomies 21 and 18 than standard screening. While many professional societies currently recommend that NIPT be used as a screening method, not a diagnostic test, its high sensitivity (true positive rate) and specificity (true negative rate) make it an attractive alternative to the serum screens and invasive tests currently in use. Professional societies also recommend that NIPT be accompanied by genetic counseling so that families can make informed reproductive choices.
Keywords: Fetal, Cell-Free DNA, Aneuploides, NIPT, Genetic Counseling
O104
Half a Century of Progress in Antenatal Screening for Down’s Syndrome
Nicholas Wald *
Antenatal screening for Down’s syndrome and other chromosomal abnormalities has made enormous progress over the past 40 years. The history of this progress will be reviewed leading to how new modern DNA sequencing technology can now be used in conjunction with conventional screening markers to achieve a high screening performance which translates into significant benefits to women undergoing screening.
86 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O105
National Protocol and Current Methods for Prenatal Screening
Mir Majid Mosalaei 1 *
1- Parseh Pathobiology & Genetics Laboratory [email protected]
Prenatal screening programs for Down Syndrome in the industrious countries had been started with amniocentesis and chromosomal analysis of fetal cells which initially have been presented to high risk pregnant women ( older than 40 years old & those who previously delivered an affected baby and/or those who carried a chromosomal rearrangement). Increasing the laboratory capacity and discovering different biochemical and sonographic markers and introducing modern diagnostic technologies gradually have reduced the rate of delivering babies affected with Down syndrome at mentioned countries, and it has emerged this idea that we may proposed some screening protocols for younger mothers. Increasing the age of marriage and therefore the age of pregnant women and new population policies reflect the importance of screening of Down syndrome as one of the important and essential programs in health system in the whole country. In the other hand data analysis shows that inborn malformation of the babies is the second factor of the baby death after accidents in our country. Down syndrome screening protocols have other benefits also, for example: Neural tube defects screening and other prevalent trisomies like Tri. 18 & 13 simultaneously and reduces the rate of baby death, still birth, mental retardation and complication related to expenses for surviving these patients. There is a necessity to have a well organized program for prenatal screening to reach its goals because it is a multidisciplinary activity consist of co-operation between clinical departments, laboratory specialists, geneticists, sonologists, prenatalogists and legal medicine specialists.
Keywords: Screening, Down Syndrome, Prenatal, Trisomy, Protocol
O106
Interpretation of Prenatal Screening Results
Sedigheh Hantoushzadeh 1 *
1- Gynecologist and Obstetrics of Tehran University of Medical Sciences [email protected]
The most important issue in screening is conselling. Both consellers and patients have to be aware of limitations, indications, methods of the interpretation of test results, and the next actions.For example,for families who culturally disagree and disbelieve in therapeutic abortion, it is not necessary to reffer for screening, because it has no benefits and it is just waste of time,money and energy. In these cases prenatal screening is only indicated for parents awareness, it means they have to permit for prenatal testing before any other action.There are different strategies for Down syndrom screening with various cost effectiveness.In most developed countries prenatal screening starts with combined test and if NT scan is more than 3 mm, the patient will be candidate for diagnostic tests.(Amniocenthesis or CVS) and If NT scan is less than 3 mm, PAPPA and BHCG will be done.If the result has high risk, patients will be candidate for NIPT or invasive diagnostic tests.If the result has intermediate risk, it deponds on the patient to choose NIPTor sequential second trimester screening.If result has high risk,the patient will be candidate for diagnostic tests, and also if the combined screening has low risk, routine pregnancy care continues.If the patient refers during the second trimester, one of the trimester screening or NIPT is recommended.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 87 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Scientific Management in Laboratory O107 – O109
Management is programming process, organizing, leading, controlling the function of organization and all organizational resources for determined purposes. Managing is defined as the art of performing by means of others. Because managers with adopting measures for doing the work by others, not all by themselves would achieve the aims of organization. Every organization such as laboratory for achieving its goals and targets and orienting employees’s activities needs supervision, administration, coordination and direction. The compilation of duties of organizational comportment and activity in the aimed course which regulate, amends, reinforces and leads is called management. All organizations as small and big manufacturing and servicing as laboratory for continuity and persistence of its activities need management. Deprivation of management causes inconsistency, goal deviation, time and energy dissipation and leads organizations into disorder and interruption. Survey of laboratories status indicates that in most of them, there is managing deficiency and the founder of the laboratory has plenty of problems in financing resources and resource management such as financial, equipment and human resources and this deficiency makes the vulnerable. Economic changes in the country and defaulting demands of laboratories and changing in establishing pattern and integral managing of laboratories and patterned transference augments the essential use of academic management in laboratories. Despite these, in the training courses, technical executives do not get trained for academic management Laboratories like all small and big organizations have common elements as: Aim: The clearest element for establishing any organization is the aims. Without any aim no organization would exist. Program: Organizations for achieving their goals regulate programs. They would not have any efficient activity without program. Management: Finally, organizations in order to achieve their goals, performing programs and financing resources need managers that lead towards organizational goals. In this panel we are trying to review academic management discussion in laboratory and inform the true use of resources and resource management. Dr. H. Gholami, DCLS Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O107
A Proposed Model for Cost Management in Medical Laboratory
Hossein Dargahi 1 *
1- Tehran University of Medical Sciences School of Allied Medicine [email protected]
There are four elements of laboratory operations that must be included in a laboratory systems analysis to appropriately improve productivity and efficiency, reduce cost, and increase profit/contribution: (a) equipment (technology) management, human resource management, management of reagents and supplies, and space management. Each elements is interrelated and is dependent on increases or decreases in one of the other elements. A systematic analysis undertaken on one element will be useful only in the context that it will provide 25% of the information that the director or manager needs to make an informed decision on how to change operations. Analysis of each one of the four basic elements depends on the use of tools and techniques specifically designed to assess the conductions under which the elements exists. Laboratory workflow is for the process of designing human, physical, and machine-based systems to make a work unit functionally optimal. The aim of this research is designing a graphical model of the elements of workflow and the tools and techniques needed to analyze workflow.
Keywords: Medical Laboratory, Cost Management, Increased of Productivity
O108
Fundamental of Financial Management in Medical Laboratory
Hossein gholami *
Any business that is based on profit foundation seeking ways to increase productivity. The profits is given of the two methods: The increase in revenue Reduce costs Taking advantage of these methods requires learning the basics of financial management. In this lecture we try to be familiar with the principles of financial management. And learn how to implement these concepts in clinical laboratory. Concepts such as: Service cost Cost per test Revenue Management Ratio Analyzing Financial Decision Making Investment Budgeting will be reviewed. These concepts will help us to make the right financial decisions in our laboratory. When we decide to buy an equipment in our laboratory? When we set up a laboratory method? How to manage costs? How would mean more income? How We’ve got to be more profitable?
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 89 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O109
Role of QMS in Cost Management of Medical Labs
Mehrdad Vanaki 1 *
1- Trainer and Counsellor of Quality Management System in Clinical Laboratories [email protected]
The truth is ugly and some realities are not desirable for some of our colleagues in lab.These days because of multiple direct and indirect and invisible costs that exist in labs ,they are confronting with a serious threat of bankruptcy and most of them are closed(especially those small and medium one with poor financial situation that actually became staffs of large companies of selling laboratory equipment and kits .In this way these labs have to spend all of their incomes in buying materials or employees’ salary and other invisible dazzling costs)Mainly the causes of this problem in view of colleagues and trade associations and health ministry include :Unreal tariffs, no control on increasing instruments’ price and consuming materials, no support from insurance organizations, poor financial situation of clients.All these reasons are crucial and undeniable and solving most of them is out of control of laboratory society, but unfortunately the issue that we have never paid attention to it and completely is about lab’s control and management is scientific issue of management of costs and practical and effective settlement of quality control system that our weakness in this area is because of our pale look to effective control of sources in laboratory.According to Rial-operation criteria in private labs and bedridden from all of direct costs in lab (personnel, consuming material, repairing and maintenance of instruments, energy and installation,...)approximately 40-45% of cost is in personnel area and 25-30% is in consuming materials,25-30% in other areas. Of course in governmental centers and private centers with different situation and different size this static is different and changeable. Certainly management strategies to decreasing total costs need a control and bookkeeping and exact performance in area of management of laboratory’s costs that in this way can increase profit and making the lab’s process be effective and absolutely just the lab that pays attention to control of costs can develop physical space and equipment and employ qualified personnel and finally promote quality in all areas .so in order to have crucial management of current dazzling costs there is no way except settlement of quality control system in clinical labs.
90 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Standardization and Harmonization of Clinical Laboratory Tests Results O110 – O114
There is a lot of evidence from discrepancies between results of testing a sample in different laboratories. Using different methods is one reason for these discrepancies. Focusing on quantification of methods, standardization puts emphasis on the same calibration of methods. This is while that harmonization focuses more on words and units of measurement, model of reporting, reference range, test specifications of and tests interpretation indicators. Today, in addition to the emphasis on methods and results the debate on homogenization of test requests by physicians and integration of pre and post analytical processes are also highlighted and recommended. Dr. S. M. Boutorabi, DCLS, PhD Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O110
Standardization of Critical Result Reporting in Medical Labs
Mehrdad Vanaki 1 *
1- Trainer and Counsellor of Quality Management System in Clinical Laboratories [email protected]
Introduction :After analysis the most important and key process in clinical laboratories in quality area is standardization of critical results. In this direction comparing with abnormal and urgent results ,critical results follow an independent and sensitive procedure which need an accurate training in the way that clerical and technical personnels understand the importance of these results so standardization of this procedure will promote it and make it more effective.Key points of this procedure are:1-Importance of clear and complete description and a list of critical tests in the lab and hospital conforming with their situation and physicians’ orders and differences between these tow titles .2-Importance of finalization of reporting the critical results for the lab’s personnels to make them understand the bad consequences of late reporting .They have to know just recording in the system doesn’t mean reporting(according to the standard reporting in the lab should be finalized maximum in one hour after fixing the critical result and the longer time means delay in reporting except that the reason of delaying is in out of the lab that can be proved.3-Importance of complete training and selecting the permissible and qualified people for reporting critical results in labs and selecting qualified substitutes for them in different shifts and qualified personnels for reporting in bedridden and outpatient area in the standard framework.4-Importance of delta check and patient’s condition before final report of critical results(without delay in reporting procedure):Lab’s specified plan in executive way of reporting critical results in the patients with critical background in outpatient or bedridden or the patients that that this is their first time that the results don’t match their clinical situation(necessity of record and rapid telephonic report of critical results without written type up to taking new sample and conforming the first result).Conclusion The goal of standardization the reporting of critical results ,mainly is standardization and unifying the executive way of reporting. We should n’t expect that different hospitals have the similar critical result ranges list, because of multiple creditable references and variety of specialities and demands of physicians in different hospitals that are according to clinical demands of those hospitals!
O111
The Role of External Quality Assessment Program in Monitoring and Improving the Standardization Process
Gye Cheol Kwon 1 *
1- Department of Laboratory Medicine, Chungnam National University Hospital, Korea [email protected]
A high level of testing accuracy especially for analytes such as HbA1c, lipids (total cholesterol, triglycerides, HDL-cholesterol and LDL-cholesterol) and creatinine is clinically important, to patients who are managed using national guidelines. By participating in accuracy-based proficiency testing (ABPT), a laboratory can easily determine how well its assay results compared with national reference method results. To assess the accuracy of each laboratory, the accuracy-based PT uses survey specimens that are commutable, free from matrix effects and have target values traceable to certified reference measurement procedure. ABPT enables a laboratory to measure the “trueness” of critical assays in situations where a high level of testing accuracy makes a clinical difference.In Korea, the clinical chemistry subcommittee of The Korean Association of Quality Assessment Service (KEQAS) has been providing ABPT for HbA1c since 2009 and lipids (total cholesterol, triglycerides, HDL-cholesterol, LDL-cholesterol) and creatinine since 2011. To do this, we produced commutable PT materials according the Clinical Laboratory Standards Institute C37-A guideline and obtained target values from Reference Material Institute for Clinical Chemistry Standard, Japan and Cholesterol Reference Method Laboratory Network (CRMLN) laboratory of Centers for Disease Control and Prevention (CDC), USA initially. Since the Korea CDC has become an IFCC Network laboratory for HbA1c and CRMLN laboratory for total cholesterol, we have obtained target values from KCDC. Two trials, comprising of three samples each, were performed every year. The number of participants were 327 for HbA1c and 145 for lipids and creatinine in 2013. Bias between each participant results and reference target values were evaluated.Accuracy-based PT has decreased, the overall bias of each laboratory result from reference target and method-specific inter-laboratory variability. Therefore, the continuous improvement in the quality of laboratory testing can be achieved through participation in the accuracy-based PT programs. The introduction of ABPT including analytes of which reference measurement procedures are available is needed to improve the quality of laboratory testing in Iran.
92 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O112
Standardization and Harmonization of Extra-Analytical Phases
Mario Plebani 1 *
1- Department of Laboratory Medicine, University-Hospital of Padova, ITALY [email protected]
Evidence collected in the last few decades demonstrates that pre - and post - analytical phases of the testing cycle are more error- prone than the analytical phase. In addition, an accurate exploration of the initial and final steps of the cycle has revealed that the pre-pre-analytical phase (initial procedures performed for test request, sample collection, handling and transportation) and the post-post-analytical phase (final procedures performed after the notification of laboratory results) are even more vulnerable to errors and to errors more frequently related to the risk for patient harm. There is the need for valuable quality indicators (QIs) and extra-analytical performance specifications to provide guidance for improving all steps of the TTP. However, no data are available in the literature on extra-analytical performance specifications based on outcomes, neither is possible to set them on calculations involving biological variability, while work is in progress to collect data representing the state-of-the-art based on quality indicators. The adoption of a harmonized set of QIs, a common data collection and reporting method is mandatory not only to allow the accreditation of clinical laboratories according to the International Standard, but to assure guidance to promote improvement processes and to guarantee quality and patient safety.
O113
Standardization of Methods for Determining Glycosylated Hemoglobin (HbA1c)
Reza Mohammadi 1 *
1- Department of Biochemistry and Pharmacology, Islamic Azad University, Tehran Medical Sciences Branch, Tehran, Iran [email protected]
Glycated hemoglobin (GHb), reported as HbA1c, has central role in diagnosis and monitoring glycemic control in patients with diabetes. Many methods have been developed for the measurement of GHb on the basis of differences in charge or structure between glycated and nonglycated hemoglobins. These include ion-exchange chromatography, capillary electrophoresis, boronate affinity chromatography, immunoassay, and enzymatic methods. The result of blood HbA1c of one patient measured by different methods or kits may be significantly different. So, clinicians are usually worried about reliability of HbA1c test results which may effect on patient treatment.There are numerous analytical problems associated with HbA1c measurement, including assay standardization, interference by hemoglobin variants in patients with hemoglobinopathies, and presence of hemoglobin derivatives in uremic patients. In order to obtain same results of HbA1c in a whole blood specimen by different methods, standardization of these methods is essential. Standardization of HbA1c methods needs definition of measurand, reference method, traceability, and reporting unit. Standardization of HbA1c assays was began in 1996 by The National Glycohemoglobin Standardization Program (NGSP). American Diabetes Association (ADA) recommends using NGSP certified assays for measuring HbA1c in whole blood.
Keywords: Glycated Hemoglobin, HbA1c, Standardization, Diabetes
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 93 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O114
An Overview of Harmonization on Clinical Laboratory Tests Results
Seyed Mehdi Boutorabi *
In the context of Laboratory Medicine, harmonization of laboratory testing refers to our ability to achieve the same result (within clinically acceptable limits) and the same interpretation irrespective of the measurement procedure used, the unit or reference interval applied, and when and/or where a measurement is made.Laboratories may use different analytical methods that may not be harmonized, possibly with different units of reporting.When laboratory test results differ the potential exists for misinterpretation of results, wrong treatments and adverse patient outcomes. It is our responsibility as laboratory professionals to identify where gaps exist in laboratory testing to harmonize these where possible, thereby minimizing misinterpretation of test results.Current efforts to harmonization of laboratory tests result focus on total testing process including pre analytical, analytical and post analytical phases of testing process. In pre analytical phase harmonization done on test requesting, clinical laboratory guidelines, patient preparation, sample handling and transport and quality indicators. In analytical phase harmonization most stakeholder’s emphasis on traceability and commutability of reference materials.In post analytical phase harmonization focus is on standardization of reporting units, standardization of reporting terminology, common reference interval, critical laboratory values and interpretative comments.The key stakeholders who will benefit from harmonization are the patients, the clinical Laboratory community, diagnostic industry, clinicians, professional societies, information technology providers, regulatory and governmental bodies.
94 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
The Main Challenges of Laboratory: Referral System, Laboratory Network, Mega Labs O115 – O118
In the last few years with the implementation of various initiatives in the field of healthcare, the clinical diagnostic laboratory system of the country has endured changes and sometimes serious damages. By continuing this trend, serious risks will be faced by especially small and medium-sized laboratories that constitute more than 70 percent of the country’s laboratories. As the technology pioneers, clinical diagnostic laboratories by applying the latest knowledge must be inevitably equipped with new technologies in the areas of software and hardware. The performance of this process without considering its consequences and effects on traditional laboratories will cause a lot of challenges in the activities of these laboratories. The objective of this topic is to explore a ways to minimize serious damages to the body of existing laboratories and even optimizing their current situation during the upcoming changes. Dr. K. Bagheri, DCLS Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O115
The Integration of Laboratory Services in Iran: Qualitative Study
Ali Mouseli 1 *, Mohammadreza Amir Esmaili 1, Mohsen Barouni 1, Siamak Mirab Samiee 2, Leila Vali 2
1- Kerman University of Medical Sciences, 2- Health Reference Laboratory Research Center, Ministry of Health and Medical Education [email protected], [email protected], [email protected], [email protected], [email protected]
Background: Laboratory Services fragmentation, creates problems such as lack of cost and quality accountability, not patient- centered and unsustainability of services in long run. Thus, health systems across the world regarded laboratory services integration an inevitable path. This study aimed to investigate the challenges and barriers to the integration of laboratory services in Iran. Methodology: This is a qualitative case study which was conducted in 2016. Semi-structured interviews by purposive sampling with 34 informed participants was done. Each interview lasted between 30 to 60 minutes. Acceptability, transferability, reliability, and Verifiability were used to assess the validity, accuracy and reliability of qualitative data. A framework approach was used for data analysis. Results: lack of economic of scale, fair access, leveling, good quality, national strategies to create an integrated network of laboratories, necessary infrastructure, empowered the private sector and standardization of indicators to Laboratory services in Iran were identified as the main integration problems that were classified into two main themes. Conclusion: Identified issues, are challenges which adversely impact the integration of laboratory services. Therefore, providing infrastructure, together with increased cooperation between various organizations to increase access to services in the form of an integrated network of laboratory services is essential.
Keywords: Integration, Laboratory Services, Integration, Networking, Iran, Qualitative Study
O116
Laboratory Referral System Case Study Challenges Health Deputy of Tabriz University of Medical Sciences
Mohsen Nouri *, Ahad Shahnami, Mehdi Parsaei, Mehdi Hassanzadeh
The purpose and importance of the lab: health centres play an important role in the prevention of diseases. In this study to examine the challenges facing the health system in the referral system laboratory of Tabriz University of medical sciences. Method: this is a qualitative study with the participation of 10 experts and officials in Tabriz University of medical sciences with laboratory analysis the content. With respect to the objective study of qualitative research and structured interviews to obtain information that is rich and deep, is used. Findings: After analyzing the results, the challenges were divided into the following 5 axis 1) emergency services referral system examples of origin to destination 2) supply and update the reference laboratories in health devices 3) timely supply of consumables and replacement personnel training psanl 4) plan 5) visit and audit of vast geographic dispersion sampling Labs discussion and conclusions Establishing appropriate conditions in order to: provide the referral system drivers and those on the path to the task of transporting the samples, you must have the necessary education. Must be the corresponding system for the replacement of the reference laboratories are currently providing services. Provide at least half of health personnel trained reference staff (contractual official), audit services outsourcing sample Labs gear.
Keywords: Challenge, Laboratory, Reference
96 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O117
Opportunities and Threats for Developing Laboratory Networks and Mega Labs in Iran
Gholamreza Hamzeloo 1 *
1- Head of Reference Health Lab of Tehran University of medical sciences [email protected]
Resource limitations in health care and its disproportion with the growth and development of services as well as inefficient management and improper distribution of the resources in different sectors of the health care system have always been of the main challenges for the government. Principally, economic crises also intensify such limitations.The new approach of the Ministry of Health and Medical Education in the eleventh government is to improve outsourcing and benefiting the private sector capacities and also to attract foreign investment in various sectors in order to achieve the health care system objectives and improving health indicators. Experiences of developed countries in the field of clinical laboratory services indicate that creating laboratory networks and large-scale laboratories (Mega Labs) is one of the substantial strategies in increasing the efficiency of laboratory services and achieving many objectives of the health system development plans and improving access to high quality laboratory services. This issue has also attracted the attention of Iranian health policymakers. Obviously, every unexpected and rapid change in the method and approach of providing laboratory services can have significant impact in this regard, considering the current system and structure of medical laboratories in the country and domestic capacity and support services in the field of laboratory as well as production of diagnostic kits and laboratory equipment and relevant legislations. In this study it will be tired to address the challenges and opportunities arising in the mentioned parameters.
O118
Establishing Stages in Laboratorial Networks
Kamal Eddin Bagheri1*
1-Laboratorial Sciences, Ph.D [email protected]
There are a few years that laboratory networks in European countries and America have been commenced and modern laboratory systems based on features and needs have been created. Since in our country the necessity of establishing laboratory networks in the ministry of health and laboratory academic associations is in attention and it is better to use the experiences and knowledge of pioneers in this matter.Possibly, the most important role that laboratory networks is to up to date gathering information from sanitary index and broad health level in the society that can be used in the health ministry macro decision making. And also more access to advanced laboratory services for all people in society.This article, which is the 17-year experience of the author in establishing and developing in laboratory network in one of the states in the USA, can be a practical guide for enthusiasts in this professional. This article by support and in several records is mentioned as a reference. Establishers of laboratory networks can regard with defined in the article and maintenance of basics and rudiments, congenial features, aims, local and geographical situations, financial capabilities and legal requirements and changes in details of needed case. For Establishing and developing laboratory networks, 7 stages must be gone through.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 97 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
The Role of Laboratory Science Education in Providing Sufficient Laboratory Director O119 – O123
The term “laboratory” or “laboratorians” has a broad concept and refers to a wide range of professions from all Associate and Bachelor degrees in Clinical Laboratory Science and related fields (who actually undertake laboratory tests) to holders of Doctoral degrees who as technical director of laboratories are responsible for the leadership and administration of the system. This broad educational and professional range represents the sophisticated nature of laboratory activities. Therefore, all people in this field are required to be trained and dedicated for laboratory science in a correct way, so that the output which is the results of laboratory tests has adequate validity and accuracy. This is important since the clinical decisions are made based on these lab results. In all countries, laboratory technical authorities are from two main groups as follows: Those who are in Basic Medical Sciences Those who basically are general practitioner and eventually become Pathology subspecialist Thanks to advances in technology and computer sciences in recent years, the progress of medical sciences and laboratory sciences, in particular has been broad and fast. On the other hand, the changes that are taking place in the laboratory management system and issues such as integration of laboratories and emergence of Megalabs, complicate the problem further. With regard to the medium-term plans in the country whether our education system is prepared for dramatic changes that will take place over the coming years? Are our laboratories ready for Iran in the 1404/1414 in terms of administration and leadership? What kind of graduates do we need in the future for the administration of public and private laboratories? What characteristics these individuals must have? How the experience of other countries, especially European and North American countries would help us? Dr. M. M. Mosallayi, DCLS Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O119
The Role of the Laboratory Administrator in the Future Clinical Laboratory Science
Jacqueline Vartanoosian 1 *, Maryam Saberi 1, Mir Mahdi Najafi1
1- Department of Basic Sciences, School of Nursing & Midwifery, Shahid Beheshti University of Medical Sciences, Tehran, Iran [email protected], [email protected], [email protected]
New demands are constantly being made on clinical laboratories due to developments in medicine, technology and society. Rapid developments in laboratory medicine and technology have led to constant changes within the clinical laboratory scientist profession. The ability of clinical laboratory scientists to acquire new knowledge and positively contribute to further development is the greatest guarantee that medical laboratories will be able to adapt to needs of patients and the health services also in the future. This requires the education of sufficient numbers of clinical laboratory scientists and for educational programmes to be adapted to future need for expertise in clinical laboratory science. Changes in the health service, with subsequent changes of professional boundaries and transfer of tasks will increase the need for clinical laboratory scientists with specialized competence on a Master’s & Doctorate’s degrees. There is also a need for new interdisciplinary Master’s & Doctorate’s degrees for clinical laboratory scientists and other groups of health service personnel. Success of laboratories in future would increasingly depends on desighning new academic educational programs like Master of Science in Laboratory Administration for BSc degree of clinical laboratory science and selecting appropriate students in this new MSc degree to enable them to manage laboratory services efficiently and effectively usong foundamentals of management. It is, therefore, essential to equip clinical laboratory scientists with understanding of challenges in managing the delivery of quality clinical laboratory services at affordable prices to patients, desired timely and quality reports to physicians, and ensure adequate financial returns to the laboratories.
Keywords: Laboratory Administration, Clinical Laboratory Science
O120
Effectiveness Education Laboratory Sciences as the Technical Laboratories
Tajaddin Akbarzadeh Khiavi 1 *
The PhD Laboratory Sciences master in Iran, which was one of the inventions of Supreme Council of Cultural Revolution, was be able to meet much scientific needs of medical and diagnostic laboratories of Iran, in a short time. a quick look at the record of medical diagnostic laboratory analysis shows that training in Clinical Laboratory Sciences laboratories as technical officials in the process of improving the quality of laboratory services will have an important role because of following reasons: 1) Given that laboratories are at the forefront of diagnostic, so promoting the scientific knowledge of graduates will be more effective in improving public health as well in diagnosis and treatment of disease. 2) Given that immediately after entering to university, students are educated in laboratory science merely, therefore the graduates will be a worthy linkage between the doctor and laboratory.3) Validitation and standardization of medical diagnostic laboratories will be done better with responsibility of these graduates comparing to other technical authorities. 4) Several thousand health and medical laboratories which havent any technical supervisor, will possess competent Technical Officer. 5) Unqualified staff employment with unscientific reasons by technical officials in some laboratories will be prevented. 6) Laboratory results should only interpreted by professional physician, while unscientific claims of some technical officials in relation with interpretation which can be in responsibility of some technical officials, is not a valid process.
Keywords: Education, Science Laboratory
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 99 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O121
How You Can Get a Doctorate Degree in Clinical Lab. Sciences?
Mir Majid Mosalaei 1*
1- Parseh Pathobiology and Genetic Laboratory [email protected]
Laboratory sciences which in English is referred as ‘laboratory Sciences’ and ‘Medical Technology’ is containing a broad spectrum of activities which converges among science, technology and medical services. Researchers of laboratory sciences in doing researches and presenting innovations have provided the possibility of diagnosis and better treatment of diseases in different fields. By attaining Ph.D or Ph.D in laboratory sciences you can take the first step in entering researchers of laboratory sciences’ circle. The Ph.d dgree not only as a university certificate in the respect of strategic matters of researches will be in your hand, but also accesses you to resources in the direction of doing these infinitesimal researches. Working and simultaneously directing laboratories which are state-of-art is one of these resources. By finishing the Ph.D course you have enough experience and connections for reaching improvement goals in laboratory sciences., In the world you can attain Ph.D in laboratory sciences in three ways: Ph.D in Basic Medical Sciences, Ph.D in Laboratory Sciences, Ph.D by Research (Ph.D in Laboratory Sciences),All three Ph.ds are largely close, but with this different that Ph.D in basic medical sciences and Ph.D by research of laboratory sciences are more active in research, development and training. But professional Ph.D in laboratory sciences uses the results of researches being done in a specific and practical field.
O122
Human Brucellosis: Genesis, Extent of Disease and Main Diagnostic Methods
Myrna Germanos 1 *
1- Head of Immunology Lab at Hotel Dieu de France Hospital [email protected]
Human brucellosis remains the commonest zoonotic disease worldwide with more than 500,000 new cases annually. It is associated with substantial residual disability and it has been recognized as an important cause of travel-associated morbidity. While basic science and epidemiology of human brucellosis is known, it is often under-detected and therefore under-reported, despite inflicting a high burden of disease. The incidence of chronic brucellosis has been amply described in the scientific literature, underscoring the importance of including brucellosis in the differential diagnosis in areas of endemic disease, even if clinical features are not entirely compatible.
Keywords: Human Brucellosis, Genesis, Extent of Disease, Main Diagnostic Methods
100 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
O123 The Necessity of the Establishment of the Laboratory Network and Its Characteristics in Developed Countries
Gholamreza Hamzehloo 1*
1- DCLS , Head of Reference Health Lab of Tehran university of medical sciences [email protected]
As a major provider of laboratory diagnosis, sensitivity and importance in the health economy. This property is especially in developing countries due to economic infrastructure and severe vulnerability in the face of fluctuations in currency and commodity markets is twofold. Along with the arrival of new technologies, the explosion of knowledge, knowledgeable customer needs transformation and epidemiological and demographic transitions, the public sector in financing health care has been a great challenge.A total other hand, technological innovation and enhance productivity remarkably improved clinical laboratories, but increasingly services provided by clinical laboratories has increased. How we react to current developments might, in the future laboratory medicine and how to deal with these changes affect. There are many reasons that should be ready for the future, clinical laboratories have formed alliances and networking, consolidation, integration or outsourcing, increase productivity and reduce costs. And, more importantly, by providing knowledge-based services related to laboratory diagnostics equipment, to create added value.Joining laboratory to laboratory networks and save on costs associated with ownership, a solution that the market mechanism, facing tested to overcome the problems associated with rising costs. Laboratory network and policy management advantages of centralized planning and other benefits associated with large-size organizations to do so. In many countries, the majority of private laboratories and profit in the form of laboratory networks are engaged in providing services. This lecture will be established by comparing the laboratory system in developed countries and neighboring, successful patterns are identified and introduced.
O124
Needed Infrastructure for Establishing Mega Labs
Ruprecht Keller * 1
1-Head of Central Laboratory bei Municipal Hospital Cologne, Deutschland- Biotechnologie [email protected]
“Mega Labs” are larger production units in clinical pathology that benefit from economies of scale in the production units of clinical chemical laboratories. This tendency is mainly technology-driven. The introduction of “Mega Labs” is enforced by changes in the reimbursement system. There is a general tendency in most if not all countries to decrease the reimbursement in clinical chemistry as a result of new techniques that allow production in large laboratories at lower costs. This in turn pushes for more and more “Mega Labs”. “Mega Labs” are currently being built worldwide.These large production units in clinical chemistry can be built by centralizing former small laboratories. The remaining decentralized places are reduced in size. They focus on the analysis of samples for rapid response analysis while all other samples are transported to the central laboratory for further processing. This central laboratory requires new measures in total quality management. Analytical reliability, turn around times and costs must be controlled by newly developed tools and IT. Control of coherence between all production sites, logistic schemes, new IT structures, personnel training routine, logistic schemes and many more features need to be introduced. In general: laboratory routine changes from handcraft to factory.The status of laboratory medicine in Iran can be compared to a phase that was found in many other countries before consolidation. Iran with a population of 80 million inhabitants is of similar size as Germany. There are more than 2,500 laboratories in Iran whereas Germany has appr. 35 laboratories for outpatient care. Laboratory medicine in Iran is now awaiting dramatic changes coming up in the near future. Conditions will most likely change the same way as in many other countries.Our team has been involved in more than 100 laboratory projects worldwide. The main focus of all projects was always to produce larger production units for decreasing costs and increasing quality. Out team members have been heading large central laboratories in Germany and have participated in consulting projects for the build-up of “Mega Labs” worldwide.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 101 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Posters
102 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Accreditation of Clinical Laboratories P1
P1
Assessment and Management of Laboratory Error in Shahid Yahyanejad Hospital Laboratory in Babol, Iran
Ahmad Salehi Gatabi 1 *, Fezeh Mollazade Jelodar 2
1- Babol University of Medical Sciences, 2- Mazandaran University of Medical Sciences [email protected]
Background and aim: Provide lab accurate results for diagnosis and treatment of disease of the utmost importance and Laboratory errors should be examined before the test. Enjoy this study was to determine sources of error in the laboratory Hospital martyr Yahya was performed. Methods: Analytic study, during the first six months of 1395 about patients and Bajm record collection errors before the test was performed. 66 thousand samples sent to the hospital laboratory Yahyanejad were evaluated. The collected data were analyzed using descriptive-analytical SPSS and K2 test. Results: Study the frequency of errors 7.4% respectively. Of these, 33.6% error unconventional and non-compliance instances, 20.3% hemolysis sample error, 16.1% sample error clot that sampling was performed by nursing personnel. 11.5% non- compliance sampling error, 9.8% hemolysis sample error, 8.7% percent of the clot was an error, the sampling was done by laboratory personnel. Errors than nurses to lab personnel almost 2.34 respectively. Based on statistical analysis, no significant relationship between the two groups in terms of sampling error was (P <0.02). Conclusion: Based on the 70% error by nursing staff and 30% error by the laboratory staff. Total showed only 2.3% error in the lab and 5.1% percent error occurred in the Clinical Hospital, Therefore, it is suggested with an accurate record of errors and monitoring upgrades sampling process, considered by case.
Keywords: Assessment and Management of Laboratory Error Martyr of Yahyanejad Hospital Laboratory in Babol, Iran Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Antimicrobial Susceptibility and Resistance Inhibition Testing P2 – P47
P2
Antibiotic Resistance Pattern of Bacterial Enteritis among Hospitalized Children in Ardabil: a Single Center Experience
Roghayeh Aslanian 1 *, Manouchehr Barak 2
1- Ghaem Hospital, 2- Ardabil University of Medical Science [email protected], [email protected]
Gastroenteritis is one of the most important diseases in all parts of the world; and more dangerous among children, elderly, people who are undernourished and those who live in worse conditions. This study was set up to assess the antibiotic resistance pattern of bacterial enteritis among hospitalized children in Ardabil. Methods: This prospective cross-sectional study was carried out on 52 children who were referred to Bu- Ali hospital with dysentery in 2014. Results: Among all 52 collected Stool samples, 33 (63.4%) yielded Shigella. The most common Shigella isolate was S. flexneri (n = 17, 48.6%). Of 52 cases, 61.5% were boy, with the average age of 4.8 years. In the antibiogram, Ciprofloxacin and Gentamiycin were the most sensitive antibiotics to Shigella spp. and Co-trimoxazole and Azithromycin showed the highest resistance. Also, Imipenem, Ciprofloxacin and Gentamicin were the most sensitive antibiotics to E. coli and Co-trimoxazole showed the highest resistance. Conclusions: The results showed that different bacterial species showed maximum sensitivity to different drugs whereas the majority of them were resistant to Co-trimoxazole.
Keywords: Antibiotic Resistance, E.coli, Gastroenteritis, Hospitalized Children, Shigella spp Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P3
Check the Causative Agents of Urinary Tract Infections and Antibiotic Resistance Pattern Inpatients Referred Torazi Hospital in Rasht
Katayoun Zamini 1 *, Tooba Shafighi 2, Hamid Ghahremani 2
1-Islamic Azad University, Rasht Branch- Islamic Azad University, Rasht branch, 2-Rasht-Ostan Health Center- Guilan University of Medical Sciences, Rasht, Iran [email protected], [email protected], [email protected]
Background: Urinary Tract Infections (UTI) is one of the most common bacterial infectious diseases. By proper treatment of urinary tract infections, selecting an antibiotic with high efficiency and low cost due to antibiotic-resistance patterns of isolates that this pattern is different in different geographical areas. The aim of this study was to investigate common bacterial agents and antibiotic resistance in urinary tract infections in patients referred to Razi hospital in Rasht city. Materials and Methods: This study is cross-sectional analysis within six months (Persian date Bahman 94 to tir 95) on 628 of the patients (inpatient - outpatient) Razi hospital in Rasht that the result was positive urine culture.Results: Based on this study, the most common bacteria isolated from patients with urinary tract infection bacteria Escherichia coli(48.2%), Citrobacter species(17.5%), Klebsiella species(16.7%),Enterococcus species(6.7%).patogen E.coli most susceptible to nitrofurantoin (69.7%) And more resistance to piperacillin at a rate (88%) showed. results were analyzed using SPSS-V 16 software and Fisher test were analyzed. The significance level was considered less than 0.05.Conclusion: UTI-producing bacteria in this study mainly belonging to the family Enterobacteriaceae. Due to the recognition of antibiotic resistance in common pathogens in the study area, the use of antibiotics for empirical treatment of reported UTI, help is effective.
Keywords: Urinary Tract Infection, Antibiotic Resistance Pattern
P4
Comparison of Antibacterial Activities of Some Common Antibiotics with Endophytic Metabolites of Pelargonium Hortorum Plant
Sharareh Lotfalian 1 *, Azizollah Ebrahimi 1
1-Department of Pathobiology, School of Veterinary Science, Shahrekord University [email protected], [email protected]
Background: Endophytic bacteria are safe microorganisms that reside within the plant hosts and known to enhance the growth and development of host plants probably by secreting growth hormones. Objectives: In this study, we focused on the isolation of bacterial endophytes from medicinal plant, Pelargonium hortorum and screened them for activities against nosocomial isolates of Staphylococcus aureus. Methods: Random samples from asymptomatic leaves and branches of medicinal plant P. hortorum were collected. For isolation of endophytic bacteria, the disinfected portions of the plants were distributed onto the isolation media. To examine endophytic bacterial contents, bioassays were conducted using growing colonies in PA and YEA. To test antibacterial activity of endophytic bacterial culture broth, filter-sterilized supernatants were poured in cylinders on each surface cultured indicator bacterial plate. And by measuring the diameters of inhibition zones, the results compared with the results of inhibition zones of antibiotics: namely Oxacillin, Penicillin, Ciprofloxacin, Erythromycin, Methicillin, Vancomycin, Azithromycin, Ofloxacin, Clindamycin and Lincospectin against ten isolates of S. aureus. Results: A total of 10 phenotypically distinguishable bacterial endophytes were isolated in pure from medicinal plant P. hortorum. All of 10 endophytes showed antibacterial activity (more than 20 mm inhibition zone) against S. aureus, isolates. While the average inhibition zones of examined antibiotics were less than 20 mm. Conclusion: Generally endophytic microorganisms reside in P. hortorum, are promising source for production of anti bacterial bioactive compounds. Keywords: Medicinal Plants, Endophytes, Antibacterial Activity, Antibiotic, Pelargonium Hortorum, Iran
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 105 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P5
Mutagenic and Anti Mutagenic Activities of Total Extracts of Hammada Salicornica by Ames Method Using Salmonella Typhimurium Strain
Nahid Rahimifard 1 , Mahdieh Mehrali 2 * , Fatemeh Bagheri 2 , Azadeh Manaii 3
1- Food and Drug Laboratory Research Center (FDLRC), Food and Drug Control Laboratories (FDCLs), Ministry of Health (MOH), Tehran, Iran, 2- Microbiology Department, Pharmaceutical Sciences Branch, Islamic Azad University (IAUPS), Tehran, Iran, 3- Pharmacy Faculty,Tehran university of Medical Sciences Tehran, Iran [email protected], [email protected], [email protected], [email protected]
Background: Mutagenic and anti-mutagenic activities of Hammada salicornica were determined using Ames test due to use of that as traditional plant. Objective: It’s very important to know the mutagenic effects of the extracts of Hammada salicornica. Meanwhile, the growth of cancer disease and insufficient chemical treatments are among main reasons for the anti mutagenic effect of the extracts of Hammada salicornica to be assessed. Methods: In this study we investigated the mutagenic and antimutagenic activities of the extracts of Hammada salicornica by the bacterial reverse mutation assay in salmonella typhimurium TA100 strains with and without S9 (microsomal mutagenesis assay) for 6 dilutions of each . The concentrations were since 62.5μg/ml (0.006mg/plate) to 2000μg/ml (0.2mg/plate), of Aqua fraction and Methanolic extract. Results: The mutagenicity effects were not seen in all dilutions of each, and also antimutagenicity effect were not seen in all concentrations. by the bacterial reverse mutation assay in salmonella typhimurium TA100 strains with and without S9. Conclusion: Assessment of genotoxic potential and identification of mutagenic components of the extracts of Hammada salicornica has been considered widely after their increasing consumption rate, in order to investigate possible new activities of herbal extract like antimutagnic effect possibly leading to new and safer products.
Keywords: Bacterial Reverse Mutation Assay, Antimutagenicity, Hammada Salicornica
P6
Mutagenic, Anti Mutagenic Activities of Acacia Ehrenbergiana by Ames Method Using Salmonella Typhimurium Strain and Antibacterial Effects of Total Extracts and Different Fraction of that
Nahid Rahimifard 1 , Saeed Langari 2 * , Saeed Pakzad 1 , Jinous Asgarpanah 2
1- Food and Drug Laboratory Research Center (FDLRC), Food and Drug Control Laboratories (FDCLs), Ministry of Health (MOH), Tehran, Iran, 2- Microbiology Department, Pharmaceutical Sciences Branch, Islamic Azad University (IAUPS), Tehran, Iran [email protected], [email protected], [email protected], [email protected]
Background: Antibacterial , Mutagenic and anti-mutagenic activities of four fractions and methanolic extraction of Acacia ehrenbergiana were determined due to use of that as traditional food plant. Objective: The main reason for the study of the extracts of Acacia ehrenbergiana was its use as food and also the antibacterial effects of that. Methods: In this study we investigated the antibacterial, mutagenic and antimutagenic activities of four fractions and methanolic extract of Acacia ehrenbergiana by cup plate and the bacterial reverse mutation assay in salmonella typhimurium TA100 strains with and without S9 (microsomal mutagenesis assay) for 6 dilutions of each . The concentrations were since 250g/ml (0.02mg/ plate to 400mg/ml (40mg/plate), of four fractions and Methanolic extract. Results: The antibacterial effects were seen but the mutagenicity effects were not seen in all dilutions of each, and also antimutagenicity effect were not seen in all concentrations by the bacterial reverse mutation assay in salmonella typhimurium TA100 strains without S9 with and Conclusion: Assessment of genotoxic potential and identification of mutagenic components of Acacia ehrenbergiana has been considered widely after their increasing consumption rate, in order to investigate possible new activities of herbal extract like antimutagnic effect possibly leading to new and safer products.
Keywords: Acacia Ehrenbergiana, Mutagenicity and Anti Mutagenicity, Antibacterial Activity
106 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P7
Association between Cytokine Gene Polymorphisms and Human Susceptibility to Brucellosis
Ramazan Rajabnia 1 *, Abazar Pournajaf 2
1- Infectious Diseases and Tropical Medicine Research Center, Babol University of Medical Sciences, Babol, IR Iran, 2- Department of Microbiology, Faculty of Medicine, Iran University of Medical Sciences, Iran, IR Iran [email protected], [email protected]
Background: Allelic polymorphisms in cytokine encoded genes can affect the degree of cytokine production, and may be related to the tendency to infectious illnesses as well as various clinical consequences.Objectives: The purpose of the work was to examine the relationship of the polymorphisms of IL-10 (-592), IL-15 (-367), IL-18 (-656), IL-12 (+1188), IFNγ (+874), TNF-α (-308) and TNF-β (+252) genes as a risk factor for brucellosis in terms of susceptibility and resistance to the illness or incidence of crucial complications.Patients and Methods: In a period of one year, 125 patients with acute brucellosis refereed to 3 large public teaching hospitals were enrolled in this study. We studied the polymorphisms of IL-10, IL-15, IL-18, IL-12, IFNγ and TNF-α/β genes using the allele specific polymerase chain reaction (AS-PCR) with sequence-specific primers.Results: Frequency of GG genotype in the TNF-α and TNF-β encoding genes was significantly increased in patients (52%) and control groups, respectively (31.2%). For IFN-γ, TA genotype was found highly enhanced in patients (60%), while the frequency of AA and TT genotypes were higher in control (23.2% and 26.4%, respectively). The AA and CC polymorphisms in IL-12 were dominant in patients (78.4%) and control (14.4%), respectively. In the patient group, the GG and TT genotypes had a higher frequency in IL-15 (33.6%) and IL-18 (89.6%), respectively.
Keywords: Brucellosis, Cytokines, Polymorphism, Single Nucleotide
P8
Antibiotic Resistance Patterns of Enterococcus Isolated from Patients with Urinary Tract Infections in Tehran at the Months April-October 2016
Nahid Rahimifard 1 , Fateme Dankoub 2 * , Babak Pourakbari 3 , Fatemeh Bagheri 3
1- Food and Drug Laboratory Research Center (FDLRC), Food and Drug Control Laboratories (FDCLs), Ministry of Health (MOH), Tehran, Iran, 2- Microbiology Department, Pharmaceutical Sciences Branch, Islamic Azad University (IAUPS), Tehran, Iran, 3- Infectious Disease Center, Tehran University of Medical Sciences, Tehran,Iran [email protected], [email protected], [email protected], [email protected]
Introduction and Background: Enterococcus recently became as one of the most commonly microorganisms isolated from urinary tract infections. Unfortunately, antibiotic resistance has become increasingly as a pressing clinical issue in many countries. Thus vancomycin-resistant enterococci is a major concern in medical practice. Methods: For identifying antibiotic resistance, 121 urine samples have been collected from urine of patients with UTI at 2 hospitals in Tehran. To detect enterococcus bacteria, by identifying isolated species using gram stain and biochemical tests, 58 positive cultures have been detected.For determining antibiotic resistance, the antibiotic susceptibility test (Antibiogram) is adopted on Enterococcus isolateds by disk diffusion method (Kirby-Bauer) for 6 different antibiotics including Ciprofloxacin, Vancomycin, Trtracycline, Nitrofurantoin, Penicillin and Cephalexin according to CLSI guidelines. Results: By analyzing 121 urine samples, 58 Enterococcus have been separated. The antibiogram test shown following resistances against to the mentioned antibiotics; 42 (72.42%) to Ciprofloxacin, 22 (37.94%) to Vancomycin, 49 (84.48%) to Trtracycline, 8 (13.79) to Nitrofurantoin, 37 (63.79%) to Penicillin, 39 (67.24%) to Cephalexin. Also the results shown that 50 (i.e. 86% of all species) isolates are MDR (Multiple-Drug Resistance). Discussion and Conclusion: In this paper an investigate has been done to determine enterococcus antibiotic resistant over six effective antibiotics in UTI by disk diffusion Kirby-Bauer method. Empirical selection of antibiotics must be based on the local information of organisms and antibiotic sensitivities.
Keywords: Antibiotic Resistance, Urinary Tract Infection, Enterococcus, Multiple-Drug Resistance
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 107 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P9
The Effect of Fluconazole on the Common Dermatophytes Compared to Four Antifungal Drugs
Mohammad Ali Afshari 1 *, Masomeh Shams 1, Mehdi Razaghi Abyaneh 2
1- Tarbiat Modares, 2- Pastor [email protected], [email protected], [email protected]
Background: Until recently carried out tests to determine drug sensitivity, due to the rarity of antifungal agents and resistance to them is not common. But in recent years, a new antifungal compounds for drug discovery and drug sensitivity testing for fungi need, more than ever has been. Objective: To evaluate the effects of antifungal drug compounds, including Fluconazole, Itraconazole, ketoconazole, Greseofulvin and Terbinafine. Methods: To test the drug sensitivity of the agar diffusion method and microdilution method was used. In this study, 5 antifungal drug often used to treat dermatophytosis. It results was tested. To determine the minimum inhibitory concentration MIC dilution of the microplate ELISA was used. Results: In both methods, the effect of fluconazole in preventing the growth of dermatophytes were studied and all of them were resistant to other drugs and sensitivity to the highest sensitivity to itraconazole, ketoconazole, terbinafine and greseofulvin was observed. Discussion: Bazcort and et.al sensitivity of 44 strains of dermatophytes with imidazole derivatives effective than fluconazole were all that was consistent with our review. Ali and colleagues investigated the effect greseofulvin in dermatophytes and proved it had little effect. Yusheda the comparative study of two methods of susceptibility testing confirmed that the similarities between them are consistent with our review. Vieldfer in their search for higher activity than ketoconazole itraconazole and greseofulvin observed that was consistent with our results.
Keywords: Fluconazole, Antifungal Drug, Itraconazole, Ketoconazole, Greseofulvin, Terbinafine
P10
The Effectuality Assessment of Sofosbuvir in Patients with Hepatitis C in Studies Published
Mahin Ahangar Oskouee 1 *, Farzad Bahari 2, Hossein Banazadeh Baghi 1
1- Infectious and Tropical Diseases Research Center, & Immunology Research Center and Department of Microbiology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran 2- Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran [email protected], [email protected], [email protected]
Aims: Hepatitis C virus is a frequent cause of hepatocellular carcinoma. Sofosbuvir is a nucleotide analogue HCV NS5B polymerase inhibitor with similar in vitro activity against all HCV genotypes. The aims of this study were to compare the safety and efficacy of sofosbuvir for the initial treatment of chronic hepatitis C. Methods: The methodology for this review involved Wiley online library search from 1995 to 2015 using the keywords, sofosbuvir and Hepatitis C. The Titles of articles were reviewed, and those who were more patients out of 10 were selected. Results: A total of 65 articles published between the years 1995-2015 were studied. In 19 of the reviewed articles, the number of the patients and results were studied quantitatively. In total, Sofosbuvir was found to be used in the treatment process of 4108 patients for a total duration of 12 to 24 weeks. The efficiency of the drug was estimated to be 87.9 % on the average; it varied for different genotypes of the disease. Conclusion: The study shows that Sofosbuvir can be used as an effective drug for the treatment of Hepatitis C. The duration of the consumption of this drug, which is used in combination with other drugs like Ribavirin, is variable between 12 to 24 weeks. It is also found that it can have effective results for all genotypes of the disease. Because the therapeutic effect of this medication, it is suggested that this drug is also being used in Iranian patients with hepatitis C virus.
Keywords: Sofosbuvir, Hepatitis, Hepatocellular Carcinoma
108 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P11
Antibiotic Resistance Patterns of Clinical Pseudomonas Aeruginosa by PCR in Tehran at the Months April-October 2016
Nahid Rahimifard 1, Narges Hatami 2 *, Babak Pourakbari 3
1- Food and Drug Laboratory Research Center (FDLRC), Food and Drug Control Laboratories (FDCLs), Ministry of Health (MOH), Tehran, Iran, 2- Microbiology Department, Pharmaceutical Sciences Branch, Islamic Azad University (IAUPS), Tehran, Iran, 3- Infectious Research Center, Tehran University of Medical Sciences,Tehran ,Iran [email protected], [email protected], [email protected]
Increase of antibiotic resistance and generating strains resistant to carbapenem and producers of metallobetalactamases today is considered as one of challenges of curing patients with burning afflicted to infection. Infections deriving from resistance to common anti-pseudomonas antibiotics are a serious problem and considering the occurrence of medication resistance phenomena recently researchers try to find the alternative compounds and therapies with less danger. This paper aims to examine the pattern of antibiotic allergy and existence of metallobetalactamases genes blaIMP-1, blaVIM-1, blaVIM-2 in strains of pseudomonas aeruginosa. For doing so, 50 clinical strain of pseudomonas aeruginosa are collected from burning wounds of patients hospitalized in Tehran Shahid Motahari burning incidents hospital, and antibiogram test with diffusion disk method has been done for determining resistance of strain, results are as follows: degree of resistance to cephalexine, cefixim, meropenem, amoxiciline, siprofloxasin 100, pepracilin- tazobactam 12%, Colestin 22%, Sephatasidim 22%, Gentamycine 28%, Amicasine 22%. Strains producing metallobetalactamases are identified by IPM-EDTA disk phenotypic method and resistance of blaIMP-genes, blaVIM-1, 1 and blaVIM-2 have been examined by PCR methods in strains. 36% of strains were resistant against Amipenem. Among which 75% have been identified using hybrid disk method of metallobetalactamases producers and in analysis of obtained results PCR, 83.3% carries BlaVIM-1 gene, 50% carries blaVIM-2 gene and 58.3% carries blaIMP-1 gene. According to high percentage of resistance to amipenem, identifying strains producing metallobetalactamases for preventing dispersion of multi-resistance strains and failure of treatment is essential.
Keywords: Pseudomonas Aeruginosa, Metallobetalactamases, PCR
P12
Report of a Pseudomonas Aeruginosa Clone with Rare Mutation in parC Gene and Resistant to all Tested Antibiotics from Tabriz Hospitals
Roghayeh Nouri 1 *, Mohammad Ahangarzadeh Rezaee 1, Alka Hasani 1
1- Infectious and Tropical Diseases Research Center, Tabriz University of Medical Sciences, Tabriz, Iran [email protected], [email protected], [email protected]
Background and aim: Multi-drug resistant Pseudomonas aeruginosa strains are one of the most important problems in the field of health. The aims of this study were determination of antimicrobial resistance of P. aeruginosa clinical isolates and evaluation of their quinolone-resistance-determining region (QRDR). Methods: In a prospective study a total of 100 clinical isolates of P. aeruginosa were obtained from Educational-Health Care Centers of Tabriz University of Medical Sciences. Standard disk diffusion method was used for determination of antimicrobial resistance pattern of the isolates. Moreover, QRDR of the isolates have sequenced in regard to gyrA and parC genes. Results: Of the 100 P. aeruginosa clinical isolates tested for antimicrobial susceptibility, 71 of them found multidrug resistance (MDR). The highest rate of resistance was observed against ticarcillin (84%) Moreover, the highest susceptibility rate was obtained against ceftazidime (45%). Of the total isolates, 8 isolates (from three hospitals) with rare mutation in parC gene (Ala-88→ Pro alteration) were resistant to all tested antibiotics. Moreover all these isolates had the same colony characteristics on Mueller-Hinton agar. Conclusion: It seems that the resistant isolates with alteration in parc gene most probably originated from an uncommon clone and have been spread in Tabriz Health Care Centers, as a result of wrong antibiotic therapies.
Keywords: Pseudomonas Aeruginosa, Antimicrobial Resistance, ParC, Tabriz
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 109 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P13
Molecular Analysis of Resistance in Clinical Isolates of Pseudomonas Aeruginosa Carbapenemase Firoozgar Hospital in 93 to 94
Farzaneh Hoseni 1, Abdolreza Mohammadniya 2, Hoda Namdarimoghaddam 3 *
1- Azad University, 2- Msih Daneshvari Hospital, 3- Firozgar Hospital [email protected], [email protected]
The Pseudomonas aeruginosa has known as on of the most important clinical sepsis regardless of progressive intensive care and disinfectant solution the admitted at hospital wards infected with pseudomonae as a common factor according to daily increase of drug resistancy reveal to study drug susceptibility of pseudomonas spices to B-lactamase complex. The aim of this study to evaluate the frequency of IMPVIM̗ NDM̗ ̗ SPM metalobete lactamase genes pseudomonae species isolated of admitted cases at firoozgar hospital.Metod:During 2years(2014 to 2015),cases isolated and species confirmed by biochemical asseys.drug susceptibility based on CLSI recommendation by Kirby-baur assay MBL frequency confirmed by disk combined asseyappearance of blaIM‚‚bla VIM‚ bla NDM ‚ bla SPM genes cheked by pcr.Result: The most antibiotic resistance is Colistin with 78.81% efficiency and the least antibiotic resistance goes to IM /MP Whith 68.64Out of 118 pseudomonas species isolated from candidates 28 cases were MBL (+) and 53 species were MBL (-) result of MBL (+) gene sequencing.
Keywords: Pseudomonas Aeruginosa‚ Metalobete Lactamase‚ Antibiotic Resistance
P14
Prevalence of ESBL-Producing (Extended-Spectrum Beta Lactamase) Entrobacteriaceae Isolated from Urinary Tract Infection in Shahid Rahimi Hospital of Khorramabad
Masoumeh Motamedi 1 *, Zinab Minaei 1, Alireza Barfipoosalar1 , Hadith Babahosini 1, Masood Salehi 1
1-Shahid Rahimi Hospital, Lorestan University of Medical Sciences, Khorramabad, Iran- University of Medical Sciences [email protected], [email protected], [email protected], [email protected], [email protected]
Background&objectives: Urinary tract infection is the most common human infections. Mostly caused by Enterobacteriaceae. The number of ESBL-producing Enterobacteriaceae is increasing, which leads to treatment failure. The aim of this study was to investigate the prevalence of ESBL-producing Entrobacteriaceae Isolated from urine samples in shahid Rahimi hospital of Khorramabad.Methods: nterobacteriaceae isolates from urine samples were included in this study. Antimicrobial susceptibility testing was performed using Kirby-Bauer method. Confirmatory test for ESBL production by combined disk test cefatzidim, cefotaxime acid was performed with and without clavulanic acid.Results: 545 cases of urinary pathogens Enterobacteriaceae, 245 cases of ESBL-producing Enterobacteriaceae isolates was. Although the incidence of urinary tract infection in women (71.3%) more than men, But ESBL-producing bacteria in men with urinary tract infection was 60.8% and for women 30.6%.The most common pathogen E.coli bacteria (81.2%) and the largest number of Enterobacteriaceae producing ESBL (83.6%) was among Enterobacteriaceae. But the prevalence of ESBL-producing bacteria as pathogenic as compared to the total number of Klebsiella, E.coli and Proteus was. Conclusion: According to our study, the high prevalence (44.95%) ESBL-producing bacteria in the urinary tract infection the importance of routine testing in medical centers and doctors to pay more attention to it. On the other hand the higher the percentage of ESBL-producing bacteria in men despite a lower percentage of urinary tract infection in men may be due to self-medication, non-use or treatment completion is correct.
Keywords: Extended-Spectrum Beta-Lactamase (ESBL), Entrobacteriaceae, Urinary Tract Infection
110 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P15
Prevalence of Methicillin Resistant Staphylococcus Strains Isolated of Urinary Tract Infections During the First Six Months of 1395 in the Hospital of Khorram Abad Shahid Rahimi
Alireza Barfipoosalar1 *, Hadith Babahossini 1, Masoumeh Motamedi 1, Zaynab Minaeii 1
1-Shahid Rahimi Hospital, Lorestan University of Medical Sciences, Khorramabad, Iran- University of Medical Sciences [email protected], [email protected], [email protected], [email protected]
Introduction: Staphylococcus is often asymptomatic opportunistic pathogen buildup. Strains of methicillin (MRSA), dangerous pathogens that are resistant to most commonly used antibiotics and disease-specific treatment is difficult. The aim of this study was to evaluate the prevalence of MRSA strains in the hospital shahid Rahimi is Khorramabad. Method: MRSA strains were identified by phenotypic methods. The pattern of antibiotic resistance in MRSA strains by disk diffusion method according to CLSI protocol was performed by using cefoxitin. Results: In this study, a total of 128 bacterial isolates, 37 strains of Staphylococcus aureus and 91 strains of coagulase-negative Staphylococcus was detected. Methicillin-resistant staphylococcus 14.08% was. Staphylococcus aureus 44.4% and coagulase negative Staphylococcus 55.6% of methicillin-resistant Staphylococcus aureus were included. MRSA strains of S. aureus in women (62.5%) and was more than males, but no differences were seen in coagulase staphylococcus. Conclusion: The prevalence of MRSA can result from long-term hospitalization of patients and overdosing of antibiotics to more effectively treat infections. Methicillin-resistant coagulase-negative Staphylococci observed with regard to pay more attention to this bacteria and routine hospital procedure seems necessary.
Keywords: Staphylococcus Aureus, Coagulase-Negative Staphylococcus, Methicillin Resistant Staphylococcus, Urinary Tract Infections
P16
The Effect of Nanomicelle Curcumin on the Expression of Meca Gene in Methiciliin-Resistant Staphylococcus Aureus (MRSA)
Hoda Tajik 1 *, Samaneh Dolatabadi 2, Hamid Reza Rahimi 3
1- Islamic Azad University, 2- Islamic Azad University, 3- Mashhad University of Medical Sciences [email protected], [email protected], [email protected]
Methicillin- Resistant Staphylococcus Aureus (MRSA) is considered to be a serious threat to the society and one of the most common causes of death in hospitals. Curcumin is a polyphenol compounds from turmeric rhizome. This combination has numerous benefits, including treatment of skin inflammations, powerful antioxidants, improving the cardio-vascular system and also is used in prevention of cancer. Nowadays the antibacterial properties of curcumin to reduce the function of gram positive and negative bacteria have attracted attention of scholars. In this regard, the aim of this study is to evaluate the effect of curcumin on the MRSA activity. Unfortunately Curcumin is identified with very low solubility, chemical instability and poor bioavailability. As a result, use of nanomicelle method can be effective way to increase the absorption of this substance. Reduction of antibiotic resistance is one of the remarkable properties of curcumin. Thus it can be used in order to reducing the Multiple antibiotic resistances of MRSA. According to this findings, using nanomicelle of curcumin may reduce or suppress the expression of antibiotic resistance gene (mecA) in MRSA.
Keywords: Curcumin, Methiciliin-Resistant Staphylococcus Aureus, Meca Gene
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 111 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P17
Antibiotic Resistance Patterns of Escherichia Coli Isolated from Patients with Urinary Tract Infections in Tehran at the Months April-October 2016
Nahid Rahimifard 1, Fateme Dankoub 2 *, Babak Pourakbari 3
1- Food and Drug Laboratory Research Center (FDLRC), Food and Drug Control Laboratories (Fdcls), Ministry of Health (MOH), Tehran, Iran, 2- Microbiology Department, Pharmaceutical Sciences Branch, Islamic Azad University (IAUPS), Tehran, Iran, 3- Infectious Research Center, Tehran University of Medical Sciences,Tehran, Iran [email protected], [email protected], [email protected]
Objective: In patients with suspected urinary tract infectin (UTI), antibiotic treatment is usually started empirically, before urine culture results are available. Unfortunately, antibiotic resistance has become an increasingly pressing clinical issue in many countries. Our objective was to assess the changing susceptibility of urinary pathogens and evaluate the options for empirical antibiotic therapy. Methods: For identifying antibiotic resistance, 150 urine samples have been collected from urine of patients with UTI at 2 hospitals in Tehran. To detect Escherichia coli bacteria, by identifying isolated species using gram stain and biochemical tests, 96 positive cultures have been detected.For determining antibiotic resistance, the antibiotic susceptibility test (Antibiogram) is adopted on E. coli isolateds by disk diffusion method (Kirby-Bauer) for 10 different according to CLSI guidelines. Results: By analyzing 150 urine samples, 96 Escherichia coli have been separated. The antibiogram test shown following resistances against to the mentioned antibiotics; 74 (77%) to Cotrimoxazole, 9 (9.4 %) to Nitrofurantoin, 56 to (58.3%) Nalidixic Acid, 42 (43.6%) to Gentamicin, 2 (2.1%) to Amikacin, 21 (21.9%) to Ciprofloxacin, 38 (39.7%) to Ofloxacin, 90 (93.7%) to Cefixim, 94 (97.9%) to Ampicillin and none of the isolates was found to be resistant to Imipenem.Also the results shown that 42 (i.e. 43% of all species) isolateds have MDR (Multiple-Drug Resistance).Conclusions:As a result, it is concluded that a resistance increase is observed for Ciprofloxacin and Ofloxacin with respect to Escherichia coli in IRAN. Regular determination of antibiogram and public education on different locations and times are recommended.
Keywords: Antibiotic Resistance, Urinary Tract Infection, Multiple-Drug Resistance, Escherichia Coli
P18
Consideration of Relation Between Motility and ESBL in Uropathogenic E.Coli (UPEC) with Multi-Drug Resistance(MDR)
Hanieh Bagheri 1 * , Ezzat Allah Ghaemi 1
1- Golestan University of Medical Science.Microb.Dep [email protected], [email protected]
Introduction:Emergence of drug resistance to broad-spectrum beta lactams mediated by extended spectrum beta lactamases (ESBLs) and especially multi-drug resistant (MDR) clonal groups among UPEC strains increase the serious threat to global public health. In this study, we considered relation between motility and ESBL in uropathogenic E.coli (UPEC) with multi-drug resistance.Methods:200 E.coli isolated from Urinary tract, confirmed with biochemical test. Antibiogram with Kirby-Bauer method based on CLSI standards were done with different antibiotics. Then, results were studied and analysed in the program was SPSS18.Results:On Basis of this study, 74.5% strains were MDR. 74.5% of MDR strains were Motile and 60.8% were non-motile.(P=0.05). In some strains that resistance to 1-2 antibiotic classes and have ESBL, non of them observed motile. But in this type of resistance 100% of non-ESBL strains were motile. 35% of total of strains were resistance to 3-4 classes of antibiotic. In strain with resistance to over than 7 classes of antibiotics, ESBL strains were high prevalence, 100% of ESBL strains were non-motile and 83.8% were motile.Discussion:Most of UTIs are resulted by E. coli and antibiotics are increasingly used to treat UTIs leading to increased resistance in bacteria in addition to emergence of multi-drug resistant bacteria. In this study most of isolated were MDR and motile.
Keywords: ESBL, Motility, Uropathogenic E.Coli (UPEC), Multi-Drug Resistance(MDR)
112 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P19
Zika Virus: A Systematic Review
Saber Samadiafshar *
Introduction and Objectives: Zika virus (ZIKV) is an emerging arthropod borne virus (arbovirus) transmitted by Aedes (Stegomyia) mosquitoes.The virus belongs to the genus Flavivirus, family Flaviviridae, and is closely related to other flaviviruses of public health relevance including dengue, yellow fever and West Nile viruses.Materials and Methods.We conducted a systematic review of the literature by searching through, Global Health Library, as well as the epidemiological bulletins and alerts from the World Health Organization, the Pan American Health Organization, and the European Centre for Disease Prevention and Control over the period 1990 to 2016.Results.The search yielded 63 records. We systematically reviewed 19 articles and reports, revealing some epidemiological features, Genotype, life cycle and patterns of spread of the Zika virus worldwide, as well as pathological outcomes suspected to be linked to Zika outbreaks. Incidence of zika infection in pregnant women is not known.ConclusionsThe World Health Organization declared the ongoing Zika crisis an emergency, On February 1, 2016, although not yet scientifically proven, the link between the virus and growing numbers of microcephaly cases was “strongly suspected.” However, the causal relationship between zika and microcephaly is not universallyaccepted.
Keywords: Zika, Virus, Epidemiology, Genotype, Dispersion, Life Cycle
P20
Side Effects of Treatment with Interferon Alfa-2b in Hepatitis C Patients
Mahin Ahangar Oskouee 1 *, Hossein Banazadeh Baghi 1, Sahar Afsar 2, Mahsa Zehisaadat 2, Mahya Mansouri 2
1-Department of Microbiology, Faculty of Medicine & Infectious and Tropical Diseases Research Center, Tabriz University of Medical Sciences, Tabriz, 2-Medical Student Faculty of Medicine, Tabriz University of Medical Sciences [email protected], [email protected], [email protected], [email protected], [email protected]
Introduction Chronic hepatitis C infection is now recognized as an important health care problem. Alpha interferon is administered either daily or three times weekly for a period of 6 to as long as 24 months. Several side effects of alpha interferon have been described. Method In our study all the papers of the Online Library website with title ((Interferon Alfa-2b)) from 1995 to 2015 were searched. After full text study of articles (papers that mentioned), the adverse effects of Interferon were separated. Then the numbers of repetition of each side effect in the papers were determined also, some articles randomly selected from different journals for assessment Iranian Studies. Results: We found 58 articles that in 16 of them, the adverse effects caused in patients were discussed.In 4 studies that determined 537 patients, the side effect wasn’t reported. In 14 studies that determined 2643 patients, the side effect, in order to the number of reports was: depressing, thrombocytopenia, and leukopenia, flu like effects, abdominal pain, anemia and vomiting. We found 8 Iranian articles that determined 757 patients, the side effect, in order to number of reports, were: anemia, depression, Conclusion Interferon, which is a medicine used for the cure of Hepatitis C has adverse effects that can cause problem for patients due to its long cure period.Careful assessment is required before treatment, and monitoring is required during treatment. It seems combination antiviral therapy is likely to be given to many patients with chronic hepatitis C.
Keywords: Interferon, Hepatitis C, Side Effect
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 113 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P21
Antimicrobial Potential of Biosurfactants Isolated from Oil-Degrading Bacteria against Multi- Drug-Resistant Pathogens
Somaye Imanparast 1 *, Anita Shafiee 2, Kimia Sarparast 2
1- Microbial Biotechnology Laboratory, College of Science, University of Tehran, Iran, 2- Farzanegan 1 High Schools, Tehran, Iran [email protected], [email protected], [email protected]
Introduction: Biofilms are conglomerations of bacterial cells protected by self-synthesized extracellular polysaccharide matrices. Biofilm infections are extremely challenging to treat because antimicrobials are less effective than planktonic cells. Recent studies have indicated that biosurfactants (BSs) play an important role in dispersal of cells from biofilms. Methods: In this study, BSs producers were isolated from oil-contaminated soil from refinery site in Iran by using minimal saline medium ((NH4)2SO4, 0.5 %; KH2PO4, 0.1 %; K2HPO4, 0.35 %; NaCl, 0.25 %; MgSO4.7H2O, 0.05 %; olive oil,1 %;). The bacterial isolates were purified by repeated sub-culturing on LB medium followed by the pure cultures were subjected to produce of BS by fermentation in flasks for one week at 28°C. The surface activities of crude BSs samples were evaluated using an oil spreading assay. The antimicrobial and anti-biofilm activities of BSs against Staphylococcus aureus and Pseudomonas aeruginosa were determined.results and conclusion: In this study, Fifteen strains were isolated from 5 soil samples, 50% of isolates were positive for the oil-spreading assay .30% of the microorganisms showed the highest oil spread in activity with more than 10 cm clearing zone diameter. Antimicrobiale and anti-biofilm activities were also observed for the aforementioned pathogens. From the above findings, it can be concluded that isolated strain of oil contaminated soil is a valuable candidate of promising antibacterial BS-producing bacteria for the inhibition of biofilms.
Keywords: Biofilm, Biosurfactant, Oil-Contaminated Soil
P22 Evaluation of Drug Resistance in Strains Isolated from Patients Admitted to the Hospital from Yahyanejad Babol
Zore Eslamdoust 1 *, Norozali Nori 1, Mojtaba Mehdipourmir 1, Reza Razghnia 2, Parvin Hasanjanzadeh 3
1-Babol- Hospital-Yahyaneshad- Babol University of Medical Sciences, 2-Deputy Treatment- Babol University of Medical Science, 3-Health Department- Babol University of Medical Sciences [email protected], [email protected], [email protected], [email protected]
Background: Antibiotic resistance due to widespread use of antibiotics, one of the biggest reasons for failure in treatment of antibiotics. Identify common antibiotic resistance in the community is very important to treat infections and can be useful in preventing treatment failure. The aim of this study was to investigate antibiotic resistance in strains isolated from hospital is Yahyanejad. Method: In a study of three months from August till October 95 of 1486 isolates and clinical urine, blood, wounds, respiratory secretions, body fluids of patients admitted to the hospital martyr Yahyanejad the culture of the EMB and blood agar and differential environment and antibiotic susceptibility tests to disk by disk diffusion method on Mueller-Hinton agar and inhibition are evaluated according to CLSI. results obtained were analyzed with SPSS software. Findings:Out of a total 1486 samples, 159 samples (10.7%) positive cultures Md.byshtryn resistance to vancomycin, respectively 83%, 81.8% erythromycin, clindamycin, 75.8%, 69.3% ceftriaxone, ciprofloxacin and amikacin, respectively 66.9% and the highest sensitivity of 65% and meropenem 52%. Conclusion: According to the results of this study, antibiotic amikacin has the highest sensitivity, and clinical as the first drug used in the treatment of infections is recommended that antibiotics vancomycin Gyrd.hmchnyn Varytrvmaysyn to their high resistance to initial treatment infection control and monitoring Shvd.lza less use of antibiotics in the hospital is essential.
Keywords: Drug Resistance, Bacterial Infection, Babol
114 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P23 Study of Antibiotic Resistance Pattern and Blatem, Blactx-M and Blafhv Genes Assessment on 50 Clinical Strains of Escherichia Coli and Antibacterial Effects of Juniperus Excelsa on Them Nahid Rahimifard 1, Fateme Rangriz 2 *, Babak Pourakbari 3, Saeed Mohamadimotamed 4 1- Food and Drug Laboratory Research Center (FDLRC), Food and Drug Control Laboratories (FDCLs), Ministry of Health (MOH), Tehran, Iran, 2- Microbiology Department, Pharmaceutical Sciences Branch, Islamic Azad University (IAUPS), Tehran, Iran, 3- Infectious Disease Research Center, Tehran University of Medical Sciences,Tehran, Iran, 4- Pharmaceutical Sciences Branch, Islamic Azad University (IAUPS), Tehran, Iran [email protected], [email protected], [email protected], [email protected] The plant Juniperus excelsa belonging to Cupressaceae family grows in mountain areas. The tree is found in southern slopes of Alborz Mountains and from Azarbijan to Khorasan. Phytochemical studies were performed to recommend it instead of chemical therapies. Determination of antibiotic resistance genes from isolated strain is done by PCR method.Clinical sample was collected from patients hospitalized in Tehran Imam Khomeini hospital and was assessed by standard biochemical methods and determination of antimicrobial sensitivity to eight common antibiotic drug. Study of antibiotic resistance pattern and blaTEM, blaCTX-M and blaSHV genes assessment was performed out on 50 clinical strains of Escherichia coli and Ecoli ATCC 25922 standard strains. Results: a total of 167 urine sample was assessed and 100 Escherichia coli sample was separated from samples after biochemical tests. Antibiotic sensitivity test results showed that the maximum and minimum rate of resistance was associated to ampicillin (97%) and nitrofurantoin (11%). 63 samples were ESBL positive. analysis of SHV, TEM and CTX-M genes spread was 4.44%, 90.61% and 42.71% respectively. Discussion and Conclusion: Results show that antibiotic resistance has an increasing trend. Multi drug resistant (MDR) strains development is a serious threat to health. Resistance pattern can be different in any region, so exact identifying of resistant strains in any region, preparing antibiograms, educating laboratory workers about correct interpretation of antibiogram results and presenting accurate reports to physicians can cause decrease in mortality rate and treatment costs, and prevention of therapy failure and resistant dissemination. Keywords: Juniperus Excels, Methanolic Extract, Antioxidant, Phytochemical, SHV, TEM, CTX-M, ESBL, Multiplex PCR
P24 Determination of blaCTX-M ،blaTEM and blaSHV Genes in Escherichia Coli Isolated from Shahid Motahari Hospital, Tehran Nahid Rahimifard 1, Mona Rohamrad 2 *, Gholamreza Javadi 2, Babak Pourakbari 3 1- Food and Drug Laboratory Research Center (FDLRC), Food and Drug Control Laboratories (FDCLs), Ministry of Health (MOH), Tehran, Iran, 2- Sciences and Research Center, Islamic Azad University (IAUPS), Tehran, Iran, 3- Infectious Disease Research Center, Tehran University of Medical Sciences,Tehran,Iran [email protected], [email protected], [email protected],[email protected] Introduction: The enzyme beta-lactamase CTX-M, TEM, SHV that are located on transferable elements. ESBL beta-lactamase hydrolysis of penicillins and cephalosporins are broad-spectrum. The prevalence of ESBL-producing Escherichia coli genes beta- lactamase CTX-M, TEM, SHV by Multiplex PCR and its relation to antibiotic resistance in E.coli strains, were performed. Materials & Methods: Clinical specimens from hospitalized patients Shahid-Motahari-Tehran were collected in the last quarter of 1394 with assessed using standard biochemical methods Antimicrobial susceptibility testing of bacterial strains of E.coli with common antibiotics in the pharmaceutical market of Iran to using Kirby - Bauer do then The bacterial DNA extracted and Determining antibiotic resistance genes from strains by PCR and multiplex PCR took placed. Results: A total of 167 urine samples were analyzed under the following biochemical tests 100 samples of Escherichia coli was isolated from samples. Antibiotic susceptibility test results showed that the highest and lowest resistance to ampicillin respectively 97% and 11% nitrofurantoin; 63 samples were positive ESBL. SHV, TEM and CTX-M were respectively 4/44%, 90/61% and 42/71%, respectively. Conclusion: The results suggest that antibiotic resistance is increasing trend by creating strains resistant to several antibiotics (MDR), which are a major health threat, we will face. The resistance patterns can vary per region, so accurate identification of resistant strains of each region, do Antibiogram, proper training of laboratory personnel in the interpretation of results Antibiogram and provide detailed reports to the doctor can reduce mortality, reduce costs treat, prevent treatment failure and reduce the emission of lead resistance. Keywords: ESBL, Multiplex PCR, SHV, TEM, CTX-M
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 115 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P25
Investigation on Prevalence of Bacterial Nosocomial Infections with Multidrug Resistant in Hospitalized Patients Referred to Gerash Amir Al -Momenin Hospital
Mohammad Jafari 1 *, Aliyar Pirouzi 1, Mojtaba Dehghan 1, Abdollah Taheri 1
1- Cellular and Molecular Gerash Research Center, Gerash University of Medical Sciences, Gerash, Iran [email protected], [email protected], [email protected], [email protected]
Introduction: Nosocomial infections are one of the major and important medical, social and economical problems in all countries, which affect through loss of life and property in infected patients. This study is aimed to investigate the prevalence of bacterial nosocomial infections with multidrug-resistant in the hospitalized patients referred to Gerash Amir Al-Momenin Hospital during a period of 6 months. Methods: this cross-sectional study was performed within 6 months, from the beginning of October 2014 to the end of April 2015, on 300 hospitalized patients referred to Gerash Amir Al- Momenin Hospital. Specific culture mediums were used on the basis of each sample and bacterial strains were isolated sterilely. Appropriate antibiotics were used in terms of each isolated strains. Urinary tract infection was excluded from this study and nosocomial infection diagnosis criteria were according to the Center for Disease Control and Prevention (CDC) definitions for nosocomial infections.Results: the prevalence of bacterial nosocomial infection and the occurrence these infections with multidrug-resistant in this study were calculated 9.6% and 6%, respectively. The most isolated microorganisms were respectively Staphylococcus epidermidis (44%) and Escherichia coli (17%). The most cases of these infections were isolated from blood samples (60%) and sputum samples (20%). The greatest resistance was shown to cefixime and ampicillin antibiotics. Discussion and Conclusion: Early diagnosis of infection, continuous assessment of available microorganisms, their sensitivity and resistance to medications and creation of necessary measures to prevent the spread of infection and hygiene education are recommended to reduce hospital infections.
Keywords: Nosocomial Infections, Multi Drug-Resistance, Gerash
P26
Role of Bacterial Agents in Newborn’s Septicemia
Mohammad Jafari 1 *, Aliyar Pirouzi 1, Fereshteh Zahabi 1, Abdollah Taheri 1
1- Cellular and Molecular Gerash Research Center, Gerash University of Medical Sciences, Gerash, Iran [email protected], [email protected], [email protected], [email protected]
Introduction: Neonatal septicemia is a common cause of newborn deaths in developing countries. Also, the prevalence of multidrug-resistant organisms has increased in these countries. This research is aimed to determine the most common bacterial agents in septicemia of newborn babies. This study was conducted in Evaz Omidvar Hospital on 516 newborn babies and infants with an average age of eight months suspected to infection.Materials and Method: This retrospective study was done on 516 newborns referred to Evaz Omidvar hospital. Followed by collecting blood samples and performing of microbial culture, evaluation of antibiotic sensitivity was performed by disk diffusion (kirby-bauer) method. Results: Among 516 samples of blood cultures, 20 samples (3.8%) of cultures were positive, of them 12(2.3%) were male and 8(1.5%) female. Bacteria which cause blood infections include Staphylococcus epidermidis (30%), Klebsiella pneumonia (30%), Escherichia coli (25%), Enterobacter (10%) and Staphylococcus aureus (5%).The most sensitivity for both Gram positive and Gram negative bacteria were to ciprofloxacin and the highest resistance of Gram negative bacteria was against Cefixime and Cephalexin, and the highest resistance of Gram positive bacteria was against Tetracycline and Oxacillin. Discussion and Conclusion: According to our finding and other studies, the high frequency of infection with Staphylococcus epidermidis is very high. For reduction of mortality and morbidity in newborn, we suggest proper usage of antibiotics in newborn septicemia and observation of hygiene principles in pediatrics and neonatal wards.
Keywords: Septicemia, Newborn, Antibiotic Resistance
116 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P27
Anti-Helicobacter Pylori Property of Thyme Honey and Royal Jelly
Nahid Rahimifard 1, Behrang Hosseinzadeh Shanjani 2 *, Shahram Shoeibi 2
1- Food and Drug Laboratory Research Center (FDLRC), Food and Drug Control Laboratories (Fdcls), Ministry of Health (MOH), Tehran, Iran, 2- Islamic Azad University Central Tehran Branch Faculty of Science – Department of Biology [email protected], [email protected], [email protected]
Infection with Helicobacter pylori has been associated with the pathogenesis of numerous stomach and gastro duodenal diseases that pose threats to public health. Eradication of this pathogen is a global challenge due to its alarming rate of multidrug resistance. Consequently, to find an alternative treatment, the search is increasingly focused on new antimicrobial product from natural sources including honey. Honey and Royal Jelly from old times in many cultures due to many bio- medicine activities, have been used as a medicine.Their beneficial effects related to their antimicrobial, antioxidant and anti-inflammatory compounds that have been confirmed.Materials and Methods: In this study, anti-Helicobacter pylori property of thyme honey and Royal Jelly, harvested from hives located in Damavand region near Tehran-Iran, and mixture of them, against the standard strain of H.pylori ATCC 43504, was evaluated by MIC[1] method. This method as the golden standard technique for determining the sensitivity of microorganisms to antimicrobial agents has been known and in accordance with standard procedures in the BSAC [2] guidelines, was performed. Result: each sample with positive control sample as cephalexin, showed inhibitory effect against standard strain of H. pylori, also there was no synergy effect between honey and Royal Jelly in this study.
Keywords: Helicobacter Pylori, Thyme Honey, Royal Jelly
P28
Investigation of Clinical and Epidemiological Features of Patients with Cutaneous Leishmaniasis in Larestan County
Mohammad Jafari 1 *, Aliyar Pirouzi 1, Afsaneh Besharati 1, Abdollah Taheri 1
1- Cellular and Molecular Gerash Research Center, Gerash University of Medical Sciences, Gerash, Iran [email protected], [email protected], [email protected], [email protected]
Introduction: Cutaneous Leishmaniasis is an important public health in many countries. The annual incidence of Cutaneous Leishmaniasis is around 1.5 to 2 million cases in the world that about 90 percent of cases of leishmaniasis have been occurred in the Middle East countries. Our aim, in this study, is to investigation of clinical and epidemiological aspects Cutaneous Leishmaniasis in Larestan region.Methods: This study was performed on 223 patients that diagnosed in 2014- 2015. The patients were studied in aspects of nationality, age, sex, stricken limb, leishmaniasis type (urban or rural), and number of lesions. The samples were taken from wound exudates and the parasite was distinguished by Giemsa staining. Results: Of two hundred twenty-three patients, 95persent of them were Iranian and the rest (5percent) of patients were Afghanistanian. 51percent of patients were female and 49percent were male. The highest incidence of infections with 55percent was among people with less than nine years. The frequency of dry or urban Leishmaniasis was 81percent and 19percent of them had wet or rural Leishmaniasis. 39 percent of patients had Leishmania lesion on their hands, And the involvement of the neck, legs, and other part of the body were 33%, 24%, and 4%, respectively. About 51 percent of patients had only one lesion and just 1 percent of them had more than 6 lesions in the body.Discussion and Conclusion: Training individuals that exposed to infections, especially parents of elementary students that have the highest infection rate, can help to rapid diagnosis and following the early treatment of patients.
Keywords: Cutaneous Leishmania, Training, Larestan
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 117 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P29
Investigation on Prevalence of Klebsiella Infection and Drug Resistance among Inpatients and Outpatients Referring to Gerash Amir Al-Momenin Hospital
Mohammad Jafari 1 *, Aliyar Pirouzi 1, Afsaneh Besharati 1, Abdollah Taheri 1
1- Cellular and Molecular Gerash Research Center, Gerash University of Medical Sciences, Gerash, Iran [email protected], [email protected], [email protected], [email protected]
Introduction: Strains of Klebsiella pneumonia are present as a saprophyte in the nasopharynx and in the intestinal tract. The vast majority of Klebsiella infections, however, are associated with hospitalization and individuals that suffer from severe underlying diseases such as diabetes mellitus. Drug resistance to Klebsiella is continuously increased and therefore the use of drug resistance tests seems to be necessary before prescribing an antibiotic.This study is aimed to determine antibiotic resistance patterns of Klebsiella species from patients’clinical samples.Methods:A descriptive study performed on patients referring to Gerash Amir Al-Momenin Hospital, within 6 months from September 2014 to February 2015. Sixty samples, that have a positive culture for Klebsiella, were examined for antibiotic resistance patterns by the disk diffusion (kirby-bauer) method. Results: The following results were obtained from a disk-diffusion test for Klebsiella resistant or sensitivity to various antibiotics. These are Antibiotic resistance in Klebsiella: vancomycin (83.3%), amikacin (71.6%), cephalexin (56.6%), nitrofurantoin (53.3%), ceftriaxone (25%), cefotaxime (25%), trimethoprim-sulfamethoxazole (21.6%), cefixime (18.3%), nalidixic acid (16.6%), ampicillin (11.6%), ciprofloxacin (10%), and gentamicin (6.6%). But, Klebsiella sensitivity against ciprofloxacin, cefixime, and nalidixic acid were 83.3%, 75%, and 71.6% respectively. Discussion and Conclusion: The results of this study can be used by physicians and health care administrators to monitor and control multiple drug resistance and fundamental planning for offering effective treatments against resistant infections that caused by Klebsiella. Our results suggest that ciprofloxacin has the highest sensitivity against Klebsiella, and then has been the most effective antibiotic.
Keywords: Klebsiella, Antibiotic Resistance Pattern, Gerash
P30
Effect of Saccharomyces Cerevisiae Lysate on Staphylococcus Aureus Biofilm Formation
Navid Saidi 1 *, Horieh Saderi 1, Parviz Owlia1 , Seyed Mahmoud Amin Marashi 2
1- Molecular Microbiology Research Center, Shahed University, Tehran, Iran, 2- Department of Microbiology and Immunology, Alborz University of Medical Sciences, Karaj, Iran [email protected], [email protected], [email protected], [email protected]
Biofilm is a community of microorganisms attached to each other on a surface, which is covered by extracellular polymeric matrix (EPM). Staphylococci are known as the most common infectious agents associated with biofilm. Most infections associated with Staphylococcus aureus biofilms are difficult to treat with antibiotics. The use of probiotics is one of the ways to prevent the formation or elimination of biofilms. In the present study, effect of Saccharomyces cerevisiae, probiotic yeast, was investigated on formation of S. aureus biofilm.The 24 hour broth culture of the Indigenous S. cerevisiae yeast was centrifuged and the pellets were suspended in distilled water. The cells were lysed by sonicator and the lysate was dried by a rotary evaporator. Effect of the lysate at three concentrations of 2048, 1024 and 512 µg/ml was evaluated on biofilm formation of two standard strains of S. aureus, ATCC 29213 (methicillin-susceptible) and ATCC 33591 (methicillin-resistant), using microtiter plate assay in six replications.All three concentrations of lysate were led to a significant reduction (P<0.001) in biofilm formation of both strains of S. aureus. This effect was partly dependent on the concentration for both strain and significant difference was found between concentration 2048 μg/ml to 512μg/ml.In this study, the reduction in biofilm formation for methicillin-susceptible and resistant S. aureus was observed by S. cerevisiae lysate.This finding can be taken into consideration in the treatment of S. aureus biofilm-associated infections.
Keywords: Staphylococcus Aureus, Biofilm, Probiotic
118 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P31
Antibacterial Activities of Hammada Salicornia
Nahid Rahimifard 1, Farsan Hoseini Hamedanpour 2 *, Saeed Reza Pakzad 2, Fatemeh Bagheri 2, Faraz Mojab 3
1- Food and Drug Control Laboratories, Ministry of Health, 2- Pharmacy Sciences Branch, Islamic Azad University, 3- Shahid Beheshti University of Medical Sciences [email protected], [email protected], [email protected], [email protected], [email protected]
Hammada Salicornia is a member of Chenopodiaceae which is distributed across south of Iran specially Hormozgan province. Activities against some species has been reported from the extracts and fractions of this plant.The aim of this study is to evaluate the antimicrobial effects of four Hammada Salicornia extracts (aqueous, total methanolic, chloroform, petroleum ether) against 50 clinical species of Staphylococcus aureus and 50 clinical species of Escherichia coli isolated from wound of burnt patients.Methods: The samples of plant were first dried and blended and extracts were prepared by standard methods of maceration. Microplate and agar-well diffusion methods were used to examine different concentrations plant extracts against bacteria.Results: all four extracts had significant antibacterial effects. In well diffusion method, chloroform extract at 500 µg/ml showed the maximum inhibition zone (19mm) on Staphylococcus aureus. Chloroform, petroleum ether, aqueous & total methanolic had the same antimicrobial effect on Staphylococcus aureus and showed growth inhibition zone from 12 to 18 mm. In microplate method based on MIC total methanolic and aqueous extract showed the most antibacterial effect on Escherichia coli and all four extracts showed the same antibacterial effect on Staphylococcus aureus with MIC 31.25 µg/ml.Conclusions:This present study shows that different extracts of Hammada Salicornia has remarkable antibacterial activities and should be investigated more in future studies.
Keywords: Antibacterial, Hammada Salicornia, Staphylococcus Aureus, Escherichia Coli
P32
Antibacterial Activities of Launaea Procombens
Nahid Rahimifard 1, Mediya Khomayezian 2 *, Saeed Reza Pakzad 2, Fatemeh Bagheri 2, Faraz Mojab 3
1- Food and Drug Control Laboratories, Ministry of Health, 2- Pharmacy Sciences Branch, Islamic Azad University, 3- Shahid Beheshti University of Medical Sciences [email protected], [email protected], [email protected], [email protected], [email protected]
Launaea Procombens is a member of Asteraceae family which can be found in the south part of Iran especially the province of Hormozgan.This plant has got a variety of usage in traditional medicine for curing the skin diseases. As some studies have been carried out on antifungal and antibacterial effects of L. Procombens, we decided to determine the antibacterial effect of total methanolic extract, methanolic and Petroleum ether fractions against 50 clinical stubs of Klebsiella pneumonia and 50 clinical stubs of Staphylococcus aureus separated from the wound of burned patient of Imam Khomeini hospital with Microplate and cap plate methods. Flowering aerial parts of the plant were initially dried and blended. Total methanolic extract was prepared with the standard method of maceration. Different fractions were either prepared by liquid-liquid fractionation.The extracts then dried with rotary evaporator. The dried concentrated extracts were kept within glass vials under standard conditions until used. The results indicate that in cap plate method, Petroleum ether fraction at 500ug/mL has got the biggest effect against Staphylococcus aureus and showed the maximum inhibition zone (19mm).Total methanolic extract and methanolic fraction had the same antibacterial effect on Staphylococcus aureus and Klebsiella pneumonia (12-18mm). In microplate method based on MIC, extract and fractions showed the same antibacterial effect on Staphylococcus aureus and Klebsiella pneumonia with MIC 31.25. This study shows that fraction and the extracts of Launaea Procombens have valuable antibacterial effects.
Keywords: Launaea Procombens, Klebsiella Pneumonia, Staphylococcus Aureus, Antibacterial Effects
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 119 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P33
Antibacterial Activities of Dionysia Revoluta Boiss
Azin Mirmoini 1*, Nahid Rahimifard 2, Saeed Reza Pakzad 2, Farzad Mojab 3, Fatemeh Bagheri 3
1- Pharmacy Sciences Branch, Islamic Azad University, 2- Food and Drug Control Laboratories, Ministry of Health, 3- Shahid Beheshti University of Medical Sciences [email protected] ,[email protected], [email protected], [email protected], [email protected]
Dionysia revoluta Boiss is a member of primulaceae.This plant is distributed locally across south region of iran specially Hormozgan province.Antimicrobial activities against some species have been reported from the extracts and fractions of this plant.The aim of this study was to evaluate the antibacterial effects of three Dionysia revoluta Boiss extracts (aqueous, total methanolic and chloroform) against 50 clinical species of Acinetobacter baumannii and 50 clinical species of Pseudomonas aeruginosa isolates from wound of burned patients. Methods: The plant were first dried and blended and extracts were prepared by standard methods of maceration.The extracts then dried with rotary evaporator.The dried concentrated extracts were kept within glass vials under standard conditions until used. Microplate and well diffusion methods were used to examine different concentrations plant extracts against bacteria. Results: All three extracts had significant antibacterial effects. In microplate method based on MIC, aqueous extract and total methanolic extract had the maximum and same effect on Acinetobacter baumannii with MIC 31.25 and total methanolic extract with MIC 62.5 had the maximum effect on Pseudomonas aeruginosa. In well diffusion method, aqueous extract at 500 ug/ml showed the maximum inhibition zone (19mm) on Acinetobacter baumannii and total methanolic extract showed the maximum inhibition zone (18mm) on Pseudomonas aeruginosa. Conclusions: This study shows that fractions and extracts of Dionysia revoluta Boiss have valuable antibacterial effects on Acinetobacter baumannii and Pseudomonas aeruginosa and should be investigated more in future studies.
Keywords: Dionysia Revolute Boiss, Antibacterial Effect, Pseudomonas Aeruginosa, Acinetobacter Baumannii
P34
Using PCR Method in the Contamination of Cattle Milk in the Ranches of Jahram City
Mohsen Farhang Zargar 1 *, Rehane Rouhi 2, Bahareh Razeghi Haghighi 2, Kavus Solhju 3, Zabi Allah Faraji 3, Manuchehr Shabani 3, Hamide Saeid Ju 4
1- Student Research Committee, Jahrom University of Medical Sciences, Jahrom, Iran, 2- Department of Microbiology, School of Medicine, Jahrom University of Medical Sciences, Jahrom, Iran, 3- Zoonoses Research Center Jahrom University of Medical Science, 4- Veterinary Organization of Jahrom City [email protected], [email protected], [email protected], [email protected]
Introduction & purpose: Brucellosis is one of the infectious diseases caused by genus of Brucella bacteria in humans and animals. We use Rev1 and IRIBA vaccines for prevention of brucellosis. The immunogenicity of the vaccine Rev1has not been reported until now. Polymerase chain reaction (PCR) is one of the methods that can diagnose slow-growing bacteria quickly so this research is done with the aim of using PCR method in the contamination of cattle milk in the ranches of Jahram city that vaccinated by IRIBA and Rev1 vaccines.Methods:We done random sampling ( 506 cows and 435sheeps were studied).50 ml of studied cattle milk in the ranches of Jahram city were collected in the Sterile containers, Full details written on samples and were transported to the laboratory on ice, investigated by PCR for presence of contamination and finally the results were analyzed by using SPSS.Results: The contamination of Brucella bacteria in cattle milk vaccinated by IRIBA and Rev1 vaccines was 19%.18% of contamination was related to cattle vaccinated by Rev1 vaccine(sheeps) and 20% of that was cattle vaccinated by IRIBA vaccine(cows).the contamination frequency in the milk of vaccinated cattle was 38/9% in those which vaccinated with Rev1 and 37/1% in those which vaccinated with IRIBA. The rancher’s knowledge about injectable vaccine was extremely low (18%), about cattle and their product contamination was moderate and about contamination symptoms was good (66%).Conclusion: Multiple gene vaccines should also be considered because of the high rate of contamination in the vaccinated cattle that shows low protectivity of vaccine.
Keywords: Brucella, IRIBA - Rev1 Milk Vaccine
120 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P35
A Research on Frequency Rate of Campylobacter in Chicken Meat and Other by- Products of by Molecular and Cultural Methods
Mohsen Farhang Zargar 1 *, Rehane Rouhi 2, Bahareh Razeghi Haghighi 2, Farhad Moradi 2, Saeide Erfanian 3 , Zabi Allah Faraji 3
1- Student of Laboratory Sciences, Student Research Committee, Jahrom University of Medical Sciences, Jahrom, Iran, 2- Department of Microbiology, School of Medicine, Jahrom University of Medical Sciences, Jahrom, Iran, 3- Jahrom University of Medical Sciences Research Center of Non-Communicable Diseases [email protected], [email protected], [email protected]
Introduction & purpose: Family Campylobacter spp is one of the most common causes of Gastroenteritis in human. Meat and it’s by- products are the main source of this human infection.This study investigates the prevalence of Campylobacter spp in chicken meat and by-products in Jahrom by using molecular and cultural methods .Methods:in this cross sectional study 328 poultry carcasses were randomly selected , their sediments cultured for 48 hours in microaerophilic conditions, diagnostic tests performed on Suspected colonies of Campylobacter bacteria to the species levels and finally The multiplex PCR method performed on all samples for validation. In this way method we use four pairs of primers to detect the presence of bacteria (Universal Primer), presence of Campylobacter and identification of campylobacter jejuni and campylobacter coli was Simultaneously done by multiplex PCR.Results:This research was shown that 11.9 percent of all chicken meat samples were contaminated by Campylobacter spp(9.8 contaminated by campylobacter coli ,0.2 by campylobacter jejuni and 0.9 by other species of campylobacter).in culture method we had 15(4.6%) contaminated samples(12 samples (80%) contaminated by campylobacter coli,2 (13.3%)samples by campylobacter jejuni and 6.7% by other species).In multiplex PCR method we had 39 (11.9%) contaminated samples(32 (82%)samples by campylobacter coli,4 samples (3.2%) by campylobacter jejuni and 3 samples by (7.7%) by other species.)Conclusion: The results of this study showed that the molecular methods had higher the potential for the detection of Campylobacter spp and most of contamination of chicken meat production caused by Campylobacter coli in Jahrom.
Keywords: Campylobacter, Molecular and Cultural Methods, Contamination
P36
Isolation and Detection of Enterotoxgenic Bacteroid Fragillis from Diarrhea Specimen in under 5 Years Old Children in Tabriz
Mahin Ahangar Oskouee 1 * Sirus Jedari Seifi1 , Mohammad Taghi Akhi 1
1-Department of Microbiology, Faculty of Medicine, Infectious and Tropical Diseases Research Center, Tabriz University of Medical Sciences, Tabriz [email protected], [email protected], [email protected]
Background: Diarrhea is a major cause of childhood morbidity and mortality in developing countries. It can be caused by a wide range of infectious agents such as: bacteria, viruses, and parasites. Material& Method: In this study, 100 diarrheal stools were cultured for detection of aerobic and anaerobic bacteria. The entertoxigenic gene among B. fragilis isolates was also investigated using the polymerase chain reaction (PCR) method.Results: Ten B. fragilis were isolated from 100 diarrheal fecal specimens. All isolates were susceptible to metronidazole, while 10% were susceptible to clindamycin. Four (40%) ETBF were isolated.Conclusions: According to our finding, Metronidazole is the best choice drug for treatment of B. fragilis in diarrheas specimen. It is recommended, it is better to start treatment of antibiotic drug resistance must be tested.
Keywords: Bacteroides Fragillis, Diarrhea, PCR
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 121 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P37
Rapid Detection of UV-Active Antibacterial Metabolites from Herbal Plants for the Treatment of Acne Vulgaris
Somaye Imanparast 1 *, Rozhin Razi 2, Mohaddeseh Karimmansour 2
1- Microbial Biotechnology Laboratory, College of Science, University of Tehran, Iran, 2- Farzanegan 1 High School [email protected], [email protected], [email protected]
Acne vulgaris is an infectious disease and one of the most prevalent human diseases. Staphylococcus aureus and Streptococcus epidermidis have been attributed to acne vulgaris. A wide variety of treatment regimens exist for acne vulgaris. Many plants seem to have inhibitory effects on the growth of bacteria. Thin layer chromatography (TLC) helps in determining of secondary metabolite patterns, while Bioautography helps in pinpointing the exact bioactive fraction(s). In this project, aqueous and alcoholic extracts of Propolis, Pelargonium root, Barberry, and Cinnamon were prepared by adding 10 g powdered plant material to 100 ml of ethanol.Extracts were incubated for 48 h at 250C followed by were centrifuged and filtered via 0.22 mm filter. Antimicrobial bioassay was carried out by agar well and disk diffusion. The diameter of the inhibition zone around each well and disk was measured. TLC bioautographic overlay assay was used to rapid detection of the antimicrobial compounds against test strains. The maximal antimicrobial assays against Staphylococcus aureus was obtained for alcoholic extracts of Barberry, cinnamon and propolis with 27 mm followed by aqueous extract of Barberry.with 15 mm inhibition zone and for Streptococcus epidermidis was obtained for alcoholic extracts of Barberry and cinanamon with 18 mm inhibition zone. TLC bioautographic of the extracts showed antimicrobial activity of fractions against test strains. From the above findings, it can be concluded that the extracts are having very good anti acne effect so, in further research it can be developed as a potent product in the manufacture of anti-acne products.
Keywords: Acne Vulgaris, TLC Bioautographic, Herbal Plants
P38
Determining Pattern of Antimicrobial Resistance of Escherichia Coli Isolated from Urinary Tract Infections Patients
Fariba Lahoorpour 1, Nahid Hagh Nazari 2, Ali Jalili 3, Seyedhamid Seyedi 4, Hiresh Nadimi 4 *
1- Department of Pathology and Medical Laboratory Sciences, Faculty of Para Medicine, Kurdistan University of Medical Sciences, Sanandaj Iran, 2- Department of Biology, Faculty of Science, Sanandaj Branch, Islamic Azad University, Sanandaj, Iran, 3- Kurdistan Molecular & Cellular Research Center, Kurdistan University of Medical Sciences, Sanadaj, Iran, 4- Department of Biology, Sanandaj Branch, Islamic Azad University, Sanandaj, Iran [email protected], [email protected], [email protected], [email protected], [email protected]
Objective: Urinary Tract Infections (UTIs) are the most common infections after the respiratory tract infection in humans and Escherichia coli is the most common bacteria causing UTI. The aim of this study is detecting drug resistance E.coli in patients with UTI. Material and methods : A retrospective , record based , study carried out based on the records of culture and sensitivity (cS) ,according CLSI gridlines, reports of 300 patients referred to Razi Labratoray in Sanandaj, in the first half of year 2015.The type of The most common organism and drug resistance noted. Results: A total of 64 Escherichia coli isolates from human urine specimens (300 subjects) were recorded and screened for their antibiograms. E.coli was the most frequent isolate (35.35%). The lowest percentage of resistance manifested against fosfomycin (88.9%), nitrophorantoein (74/2%), ofloxacin (73.3%) and the highest resistance related to cephazolin (71.4%), cephalohin (61.5%) and cefotaxime (38.7%) respectively. Conclusion: It’s recommended , Due to the high resistance to cephalosporines, for treatment of UTI causing agent E.coli , fosfomycin, nitrophorantoein, ofloxacin Drugs be used as the first choice.
Keywords: UTI, E.coli, Antibiotic Resistance
122 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P39
Antibacterial Activity of Pomegranate (Punica Granatum L.) Extracts against Enterohemorrhagic Escherichia Coli O157:H7
Mohammad Mehdi Attarpour Yazdi 1 *
1- Department of Microbiology, Faculty of Medicine, Shahed University, Tehran, Iran [email protected]
Background: Medical herbs with anti microbial activity have always been important in traditional medicine and might be useful in antibacterial activity against the many food and waterborne pathogenic bacteria cause serious gastrointestinal infections .Thus, search of effective Medical herbs for this antibacterial activity are necessary. The aim of this study was to determine the antibacterial activity of aqueous and ethanolic extracts from Punica granatum (Pomegranate) against Enterohemorrhagic Escherichia coli (EHEC) O157:H7 in vitro.Methods: At first a sample of aqueous and ethanolic extracts from the combination of the Punica granatum constituents was prepare in ten different concentrations and then its antibacterial activity against 3 standard strains of EHEC O157:H7 was tested for the determination of MIC (minimum inhibitory concentration) and MBC (minimum bactericidal concentration) using well diffusion and agar serial dilution assays. Also the antibacterial activity of trimethoprim antibiotic was tested by the disk diffusion method.Results: The results demonstrated that the Punica granatum aqueous and ethanolic extracts been effective against all of the 3 standard strain bacteria. The aqueous extract of pomegranate was highly effective against EHEC O157:H7 with MIC and MBC values of 0.19 and 0.39 mg/ml, respectively. The ethanolic extract of pomegranate had MICs of 0.49 to 1.95 mg/ml and MBCs of 1.95 to 3.91 mg/ml against EHEC O157:H7.Conclusion: This study demonstrates that aqueous and ethanolic extracts from the combination of the Punica granatum constituents have excellent anti bacterial activity against the EHEC O157:H7. Further investigations will be necessary.
Keywords: Enterohemorrhagic Escherichia Coli O157:H7, Antibacterial Activity, Punica Granatum, Pomegranate
P40
Antibacterial Activity of Pomegranate (Punica granatum L.) Extracts against Shigella spp. in vitro
Mohammad Mehdi Attarpour Yazdi 1 *
1- Department of Microbiology, Faculty of Medicine, Shahed University, Tehran, Iran [email protected]
Background and Aim: Medical herbs with anti microbial activity have always been important in traditional medicine. Thus, search of effective Medical herbs for this antibacterial activity are necessary. The aim of this study was to determine the antibacterial activity of aqueous and ethanolic extracts from Punica granatum (Pomegranate) against Shigella spp. in vitro.Methods: At first a sample of aqueous and ethanolic extracts from the combination of the Punica granatum constituents was prepare in ten different concentrations and then its antibacterial activity against 4 standard strain of Shigella spp. (S.dysenteriae, S.boydii, S.flexneri, S.sonnei) was tested for the determination of MIC (minimum inhibitory concentration) and MBC (minimum bactericidal concentration) using well diffusion and agar serial dilution assays. Also the antibacterial activity of chloramphenicol and trimethoprim antibiotics was tested by the disk diffusion method. Results: The results demonstrated that the Punica granatum aqueous and ethanolic extracts been effective against all of the 4 standard strain of Shigella spp. The ethanolic extract of pomegranate was highly effective against Shigella spp. For Shigella sonnei, the ethanolic pomegranate extract exhibited greater antibacterial activity than the antibiotic chloramphenicol, but lower activity than trimethoprim. Shigella sonnei showed the highest susceptibility to the extracts. Conclusion: This study demonstrates that aqueous and ethanolic extracts from the combination of the Punica granatum constituents have excellent anti bacterial activity against the 4 standard strain of Shigella spp. Further investigations will be necessary.
Keywords: Shigella Spp, Antibacterial Activity, Punica Granatum, Pomegranate
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 123 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P41
Association among H. pylori Virulence Markers dupA, cagA and vacA in Iranian Patients
Shahrooz Konjedi 1 *, Nahid Rahimifard2, Leila Kohan 2, Babak Pourakbari 3
1- Islamic Azad University,Arsanjan Food, 2- And Drug Control Laboratories, Ministry of Health, 3- Tehran university of Medical Sciences [email protected], [email protected], [email protected], [email protected]
Background and aim: It is estimated that Helicobacter pylori colonizes the stomachs of half the world’s population and cagA-positive strains are present in 60–70% of infections in Western countries. Our aim was to determine the prevalence of the cagA, vacA and dupA in H. pylori isolates among patients with gasteric disease in Tehran, Iran.Material and Method: A total of 437 non repeated gastric biopsies obtained from patients undergoing endoscopy in Laleh and Emam Khomeini hospital endoscopy center. The presence of cagA, vacA and dupA genes were determined by PCR method. Results: Of 437 gastric biopsies, 200 (45.76%) samples were positive for various H. pylori virulence genes. Molecular analysis of these virulence factors showed that the frequency of cagA, vacA and dupA were 178 (89%), 147(73.5%) and 82 (41%), respectively.Conclusion: The PCR assay developed herein was able to genotype H. pylori isolates based on the main virulence genes. The ability to detect H. pylori and most of its virulence genes using PCR is helpful in early detection of this disease.
Keywords: H. oylori, cagA, vacA, dupA
P42
Study of Mupirocin Resistance Phenotype and Determination of Antibiotic Resistance Pattern of S.aureus Strains Obtained from the Noses of Staffs who Works at the Hospitals of Zahedan University of Medical Sciences in 2015-2016
Mohsen Rakhshani 1 *, Setareh Gorgij 1
1- Laboratory Scientists at Zahedan University of Medical Sciences [email protected]
Background and Purposes: S.aureus is one of the hospital infectious agents. Nowadays the strains of this bacteria that is resisting and sensitive to Methicillin and Mupirocin are a major cause of hospital infections. The purposes of this study were identification and study of Mupirocin resistance phenotype and antibiotic resistance in S.aureus strains obtained from the noses of staffs who worked at the hospitals of Zahedan University of medical sciences in 2015-2016. Methods: In this descriptive-sectional study, 200 S.aureus suspicious clinical samples collected during 4 months were studied by using standard tests such as Catalase, Mannitol fermentation, Coagulase and etc. The sensitivity of verified strains with diffusion disk method were evaluated compared with commonly used antibiotics and were analyzed with descriptive statistical tests. Results: 52 S.aureus strains were verified from 200 suspicious samples that were totally (17.2%) resistant to Mupirocin. Also the resistance to Clindamycin, Cefotaxime, Erythromycin, Cefalotin, Gentamycin and Tetracycline were in order 73, 68, 62, 30, 60 and 44 percent. Conclusion: this study showed there was a high resistance to the studied antibiotics in Methicillin and Mupirocin resistant S.aureus strains in the hospitals of Zahedan University of medical sciences. Abundance of MRSAs were 85.9% in area of study. The same time resistance of MRSAs to the other antibiotics were limited the treatments.
Keywords: S.Aureus, Mupirocin, Antibiotic Resistance
124 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P43
The Study of Susceptible and Resistant Streptococcus Pneumoniae Strains Isolated from Children (up to 6 years)
Masoume Parzadeh 1 *, Masoumeh Parzadeh2, Seyed Fazlollah Mousavi 2, Zahra Nour Mohammadi 2
1- Islamic Azad University Science and Research Branch, Tehran, 2-Department of Microbiology, Pasteur Institute of Iran, Tehran, Iran [email protected], [email protected]
Increased prevalence of multi-drug resistant strains of pneumococci in recent decades is a serious concern. Given the insufficient comprehensive information regarding carrier frequency rate and prevalence of bacteria in children in our Country, it seems that studding on antibiotic resistance of the bacteria for proper treatment is necessary.The present study was conducted in 420 swab samples from the nasopharynx of healthy children less than 6 years of Children’s Medical Center in Tehran and childcare centers held in centers under welfare organization in Tehran during spring to summer 2014.One hundred and eleven strains of S. pneumoniae were confirmed by culture and biochemical tests. The preseace of cpsA gene also was confirmed in all strains. In order to study drug susceptibility in strains, the minimum inhibitory concentration (MIC) and disk diffusion method were used.Ten antibiotics were used which the highest one resistant belonged to cotrimoxazole (TS) (72.4%) and oxacillin (OX) (66.3%) while the lowest percentage of resistance belonged to Amoxicillin (A) (6/3%). MIC of Oxacillin (47.69%) from 31 samples and Tetracyclin (38.46%) from 13 samples was more than 512µg/mL that showed high resistance to these two antibiotics. According to our results, there has been evidence of resistance to selected antibiotics among children. It will be great problem to infectious caused by S. pneumonia in our country.However, cefotaxime and levofloxacin could be a good choice to antibiotic therapy of pneumococcal infections.
Keywords: Streptococcus Pneumonia, MIC, Antibiotic
P44
Antibiotic Sensitivity of Isolated Shigella spp. from Tehran
Mohammad Mehdi Attarpour Yazdi 1 *
1- Department of Microbiology, Faculty of Medicine, Shahed University, Tehran, Iran [email protected]
Objectives: Shigella species are the cause of acute infectious diarrhea. Approximately 40 million cases of shigellosis with 600,000 deaths are reported annually throughout the world. As many Shigella species show multiple antibiotic resistance markers on plasmid, if antibiotic therapy is undertaken, it is advised that isolated species should be subjected to In-vitro antibiotic susceptibility test. Methods: In this study fecal specimens of suspected diarrhea cases of five hospitals of Tehran cultured by plating on various selective or differential media, from Jun 2015 to September 2016. Isolated samples then subjected to specific biochemical tests. Species that non motile, didn’t ferment lactose and produce no gas from carbohydrate and fail to produce hydrogen sulfide confirmed by serological testing. Results: Results analyzed by chi- square and t-test. Out of 140 suspected dysenteric cases (male and female) 70Shigella spp. were isolated with included S.flexneri 35.7% (n=25), S.dysenteriae 31.4% (n=22), S.sonnei 22.9% (n=16), S.boydii 11% (n=7). Conclusion: Results showed that S.flexneri and S.dysenteriae were dominated serotypes (67.1%). There was no significant difference between male (51.3. %) and female (48.7%) (P<0.3). The most cases were found in summer (49.8%) and the least in spring (9%). Most of the isolated strains were sensitive to ceftriaxone and ceftizoxime (91.2%), ciprofloxacine (92%) and Nalidixic acid (85%). They showed resistance to ampicilline, amoxicilline, furazolidone, SXT, tetracycline and neomycine.
Keywords: Shigella spp, Antibiotic Sensitivity, Tehran
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 125 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P45
Assessing the Drug Resistance and Sensitivity to the Escherichia Coli (the Main Cause of UTI) among the Referees to Ayatollah Bahari Hospital in Hamedan Province in the Episode of 1395
Amirhossein Rahbari 1 *, Seyyed Jalal Mosavibahar 1, Sorayya Zibaee 1, Sasan Amini 1, Leila Morshedloo 1, Fereshteh Samvatian 1, Sara Salari 1, Seyyedeh Sahar Khamooshi 1, Shahla Rahimbakhsh 1
1- Ayatollah Bahari Hospital, Hamadan University of Medical Sciences [email protected]
Introduction and Objectives: The urinary tract infection (UTI) (also known as acute cystitis or bladder infection) is the second most common type of infection in the body, accounting for about 8.1 million visits to health care providers each year. These infections are most commonly caused with a bacteria called Escherichia coli (E. coli), which usually lives in the digestive system and bowel. Considering the excessive use of antibacterial drugs and the consequent antibiotic-resistant in the recent years, lots of concerns have been raised about the effectiveness of infection treatments. This paper seeks to address the drug resistance of this special bacteria.Methods: In this research, after collecting midstream samples and separating the E. coli, the Antibiogram was performed with using Disk Diffusion method by common antibiotics.Results: This experiment indicates that among 121 positive samples , the majority of 86.4% is detected to be E. coli contaminated, and the main drug sensitivity cases were related respectively to Amikasin, Ceftriaxone and Gentamycin. Moreover, the highest drug resistances were detected respectively to Ampicillin, Nalidixic acid and Trimethoprim. Concluding Remarks: This paper has given evidences to support the excessive use of drugs and self-treatment as the main causes of the widespread drug resistance. Hence, doctors are recommended to refer the patients to Antibiogram in case of uncertain diagnosis.
Keywords: Urinary Tract Infections, Drug Resistance, Drug Sensitivity, Ayatollah Bahari
P46
The Survey of Microorganisms Causing Urinary Tract Infections and Their Susceptibility to Antibiotics in the Rural and Urban Population in Iran. A Retrospective Study. 2015
Rahman Radmehr 1 *, Mohamad Reza Khalili 1
1- Tabriz Medical University [email protected]
Background and objectives: Improper drug usage induces microbial resistance. Therefore, for the best treatment by physicians, it is better that the common agents of infection and susceptible antibiotics are detected in every geographical region. The aim of this retrospective study is to determine the agents of urinary tract infection and their drug resistance. Materials and Methods: A descriptive study on patients had referred to clinical laboratory was carried out. Classic microbiological techniques were used to identify the agents. Their resistances to the 8 different antibiotics were determined by disk diffusion agar (Kirby-Bauer method). Data were analyzed by SPSS software.Results: 70% of patients were women. Also 83.6% of positive cases were rural. The bacterial agents were: E.coli 81%, coagulase negative staph 6.6%, klebsiella pneumonia 3.5%, Citrobacter frundi 3.3%, Proteus mirabilis 3%, Enterococcus 1.5%, and Enterobacter 1.2%. The most common symptom was dysuria 28.2%, frequency 25.9%, fever 22.4%, hesitancy 3.6%, hematuria 2.7%, and other symptoms 4.7%.The most infection rate was seen among farmers. The most cases were seen among higher age group 36-40 age group, 97.5% .Also the most sensitivity was related to Ciprofloxacin (99.1%) and the most resistance was referring to Ampicillin (85.4%). Conclusion: Results had well corresponding with some previous studies in Iran. That is to be proposed that study of infection aspects in the various geographical regions, and antibiotic advising according antibiogram test.
Keywords: Urinary Tract Infection, Resistance, Bacteria, Antibiogram
126 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P47
Detection of Mutation in gyr(A),par(C),tet(M) Genes in Ureaplasma Urealyticum Isolated from Women with PCR and Sequencing in Sanandaj City, iran
Rashid Ramazanzadeh 1, Amir Safari 1 *
1- Cellular & Molecular Research Center, Kurdistan University of Medical Sciences [email protected], [email protected]
Ureaplasma urealyticum associated with pelvic inflammatory disease, Salpingitis bacterial vaginitis, infertility, ectopic pregnancy, as well as perinatal disorders. Point mutations in DNA grease are responsible for quinolones resistance and tetM gene for tetracycline resistance. Aim in this research was survey on mutations in Ureaplasma urealyticum parC, gyrA genes and detection of tetM gene.100 swab specimens collected from women that aged 19 to 43 years from obstetrics and gynecology section of Beasat and Toohid Hospitals, Sanandaj, Kurdistan Province, Iran, 2014). After DNA extraction, PCR diagnostic test was performed and samples sending for sequencing and then with NCBI website results were compared.From 100 samples of ureaplasma urealyticum, 30 parC gene and 30 gyrA gene PCR product sent for sequencing. In parC 27% (n=6/30) point mutation in codon 83 happened and leading to displacement of serine amnio acids with lusin in 5 sample as well as in codon 82 Aspartic acid with Aspargine amnio acids switch in 1 sample occurred.in gyrA 7% (n=2/30) in codon 104 GUL displace with LYS amino acids in 2 samples, cause Quinolones resistance.exsit of tetM gene 25% (n=25/100) sufficient for tetracycline resistance. quinolones and tetracycline are the most effective and common antibiotics for treatment of ureaplasma urealyticum infections.in our study wide range of mutation in parC gene was funded ,and mutation at region 83(seràluc) of parC gene and 104(QàK) of gyrA gene as a marker for Quinolones resistance.so it is better sequencing for detection of resistance isolates before antibiotics prescription.
Keywords: Mutations, Ureaplasma Urealyticum, PCR , Sequencing
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 127 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Information Technology Management in Laboratory P48 – P52
P48
Evaluating the Role of Debriefing for Brucellosis from Public and Private Laboratories in Ardabil Province in 2015 Compared to 2014
Sadegh Hazrati 1, Seyyedeh Negar Modarres Sadrani 2 *, Dariush Emdadi 3
1-Ardabil Province Health Center, Ardabil University of Medical Sciences, Ardabil, Iran- Occupational Health PhD 2-Ardabil Province Health Center, Ardabil University of Medical Sciences, Ardabil, Iran- M.Sc in Biochemistry, 3-Ardabil Province Health Center, Ardabil University of Medical Sciences, Ardabil, Iran- M.Sc in Entomology [email protected], [email protected], [email protected]
Background: Brucellosis is one of the most common zoonotic diseases in the Ardabil province, Iran.This study shows the importance of reporting cases of brucellosis from private and public laboratories. Methods: In this research, coordination meeting with technical officials of the public and private laboratories in the city of Ardabil was held in collaboration with treatment deputy of university and expert in charge of health laboratories in the session hall of health deputy. According to the program schedule, the expert in diseases for collecting statistics on a monthly basis referred to 15 private laboratories, 5 laboratories in public health training centers and 11 health laboratories. In these visits, 205 cases of brucellosis were recorded. Results: The number of brucellosis reported was 37 cases in 2014 that had increased by 205 cases in 2015. The number of brucellosis reported from private laboratories was two cases in 2014 that had increased to 111 cases in 2015. The number of brucellosis reported from public laboratories was 20 cases in 2014 that had increased to 39 cases in 2015. The number of brucellosis reported from health laboratories was 15 in 2014 that had increased to 55 cases in 2015. Conclusion: Given the fundamental role of care systems and debriefing to control brucellosis, it is essential to strengthen and intensify debriefing program through public and private laboratories to achieve the actual incidence rate of the disease, interaction and cooperation with the laboratories was the most basic strategies. It is recommended to strengthen inter and intra sectoral cooperation.
Keywords: Brucellosis, Ardabil, Debriefing, Private Laboratories Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P49
Information Technology Management: a Review of the Role of Information Technology in the Laboratory
Sahar Valizadeh 1 *, Maryam Dehghani 1, Mojtaba Mirzaii 1
1- Lorestan University of Medical Sciences [email protected], [email protected], [email protected]
Introduction: Use of Information Technology (IT) as a key element in health care in recent decades has made significant progress so that thought in any part of the hospitals health care is difficult without it. The aim of the research methods: So this study was conducted to review the role of IT in laboratories. Reaserch method: This study is a review article by searching for keywords related to laboratories, technology, information technology and management of information technology and received numerous databases and jornal articles,in English and Persian and is done without time limitation. Result: The lab is part of a health service provider that has set the conditions for Science experiments for laboratory examination. Lab manager by using information technology can play an important role in promoting laboratory sampels. Use of information technology, tremendous opportunities to reduce clinical errors (such as medical errors, diagnostic errors and medication errors), support from experts health care (such as the ability to timely access to information on patient days) and provides improved quality of patient care. Discussion and Conclusion: The results showed that in the field of health information technology to improve the quality of services provided and often pay health promotion. It is suggested that hospital administrators and IT applications in laboratories to enhance the provision of quality laboratory services to patients, take steps.
Keywords: Laboratories, Quality Promoting, Information Technology, IT Management
P50
The Electronic Health Record (EHR) Usage in Laboratory Data Management
Arwin Hesami 1 *
1- Student Research Committee, Urmia University of Medical Sciences, Urmia, IR Iran [email protected]
Introduction: EHR refers to the systematized collection of patient and population electronically-stored health information in a digital format. These records can be shared across different health care settings. We want to know what the role of laboratory data in the EHR IS. Method: Use of information in certification site like CDC, AACC, CLIA, and information in some article is founded in NCBI, Google Scholar and etc. Result: 1-Lab results can reportable to registration and employment of government organization or local law or to public health agencies that cases saving your practice time and paper and reduction of manual data entry errors, and reports that are more complete. 2-Determine the normal range values of each region based on local results of lab tests and for Epidemiology studies 3-Aware of organ donate need and who can donate (ABO group & etc.) 4-Point of care test data can be recorded in EHR/ELR. 5-Viewing information with iPads, tablets, and smart phones that with this specialty nurse or physician or person/patient can check the lab result in any time or place and take consultation on internet network. 6-storing images samples Lam instead maintenance Laboratory Lam or pathological samples.7-Knowing a person’s diet or drug and its interaction with laboratory tests.8-Follow-up treatment by the information stored in the system at any place and time. Conclusion: EHR can keeping patients safe and increase patient scientific knowledge and help to legal/health organization for data management and saving practice time, papers and reduction of manual data entry errors.
Keywords: EHR Functional In Laboratory, Electronic Laboratory Records (ELR), and Etc...
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 129 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P51
Comparison of Error Rate Two Methods: Automatic and Manual Method in Recording the Results of Laboratory Tests at the Department of Biochemistry and Hematology
Pezhman Sharifi1 *, Mehran Mohammadi 2, Woria Babahajian 3, Khaled Rasouli 2
1- Kurdistan University of Medical Sciances, 2- Shahid Beheshti University of Tehran, 3- Iran Blood Transfusion Organization, Kurdistan, Sanandaj [email protected], [email protected], [email protected], [email protected]
Background and aims: laboratories are known as the most important Diagnostic pillars and Laboratory errors can be hazardous for patients. Laboratory errors can lead to incorrect treatment or delayed treatment; in this study we examined the error rate in recording the results as compared manual methods with automated methods. Methods: In this cross- sectional study, the first, 500 test results biochemistry and 500 hematology tests, from device, by a network called LIS transferred to the Journal software of Parsicpol Company and then with the approval of the operator transferred to Central software record the results of this company. These results by the two experts, in both sections, manually entered and then error rate was controlled by the other two experts. Finally, the error rate in the both methods were compared. Results: In the manual method, in 500 tests the Department of Biochemistry, 18 errors (%3.6) And in Hematology, 13 errors (2.6%) seen (Total error: 3.1%). However in the automatic method, in any of the results, no error was detected (0%) Conclusion: According to direct impact of the laboratory errors on the process of treatment and diagnosis, In order to reduce costs, decrease patients stress and reduce the length of treatment, this method is recommended for all laboratories.
Keywords: Automatic Method, Manual Method, Recording the Results, Biochemistry, Hematology
P52
Making Cooling Rack for Keeping Temperature in Laboratories
Hasan Vahidi Emami, Rojhina Nikfarman, Mina Ghiyasi, Abbas Morovvati *
Purpose: Making suitable equipment for produce appropriate temperature for keeping microtubes in laboratories and for doing different tests without using dry ice or other substance that can cause temperature fluctuations. Material and method: Rack is metallic equipment in different sizes that we use it for keeping microtubes and test tubes. Thermoelectric cooling, is a solid-state method of heat transfer through dissimilar semiconductor materials. Thermoelectric cooling systems obey the basic laws of thermodynamics. However, the actual system for cooling is different. The evaporator surface is where the liquid refrigerant boils, changes to vapor, and absorbs heat energy. Result: We made a special system for different range of temperatures. We compare our system with other cooling systems in laboratory like thermo blocks or other cooling racks and we figure out that our system have a better result. We are able to supply range temperature between 0 to 4˚C. Discussion:One of the disadvantages is that the ice buckets cannot keep the microtubes cool for more than 3-4 hours and after that we should change the ice bucket that it cause wasting time. But the system that we are going to make can produce different temperatures easily. If we want to import this system from other countries we should spend lots of money.
Keywords: Cooling RacK, Keeping Temperature, Laboratories
130 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Laboratory and Clinic: Anemia P53 – P55
P53
Four Rare Haplotypes of Three Common Polymorphisms in the Beta-Thalassemia Gene with Application in Prenatal Diagnosis
Masoume Amini 1 *, Elham Davoudi-Dehaghani 2, Tina Shirzad 1, Samira DabbaghBagheri 1, Sadaf Asnavandi 1, Sirous Zeinali 2
1- Kawsar Human Genetics Research Center, 2-Molecular Medicine Department, Biotechnology Research Center, Pasteur Institute of Iran, Tehran, Iran [email protected], [email protected], [email protected], [email protected], [email protected], [email protected]
Introduction: Beta-thalassemia is one of the most common recessive inherited disorders in the world. Iran is one of the countries with high prevalence of this disease. There are different single nucleotide polymorphisms (SNP) in the beta-thalassemia gene (HBB) which can be used as polymorphic DNA markers for indirect genetic diagnosis. Aim of study: Indirect tests are helpful to confirm results of direct prenatal diagnosis. Here we report four rare haplotypes of three common polymorphisms in the HBB gene. Materials and methods: A population of 1402 Iranian individuals referred to Medical Genetics Laboratory of Dr. Zeinali was selected for this study. Sanger sequencing of all three exons of HBB gene and intron-exon boundary regions was used to find variants in this gene. Haplotypes of three common polymorphisms of this gene (Cd2 CAC>CAT (His>His), IVS – II-16 G>C and IVS-II-666 T>C) were identified and their frequencies were determined. Results: Seven different haplotypes (C-G-T, T-C-C, T-G-C, T-C-T, C-C-T, C-C-C & T-G-T) were identified among investigated population. Three haplotypes (C-G-T, T-C-C & T-G-C) were the most common. The frequencies of four rare haplotypes (T-C-T, C-C-T, and C-C-C & T-G-T) were 0.0018, 0.0014, 0.0003 and 0.0003 respectively. Discussion: Regarding to application of different SNPs as the DNA markers in beta-thalassemia prenatal diagnosis, study of variants in HBB gene in different populations can be helpful. Until now only few studies have been performed about HBB gene SNPs in Iran. More studies in this country can be valuable in beta-thalassemia genetic diagnostic tests.
Keywords: Beta-Thalassemia, Variant, Haplotype Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P54
Prevalence and Etiology of Anemia in Neonatal Patients Referred to Tertiary Care Kosar Hospital
Fatemeh Samieerad 1 *, Amir Farzam 2, Mehri Kalhor 3, Fatemeh Pashazade 3, Mahsa Ziaee-Ardestani 4
1- Qazvin Metabolic Research Center, Qazvin University of Medical Sciences Qazvin , Iran, 2- Qazvin University of Medical Sciences. Qazvin, Iran, 3- Kosar Hospital Development and Clinical Research Center, Qazvin, 4- Tehran University of Medical Sciences. Tehran, Iran [email protected]
Background: Anemia in neonates is the more importance particularly due to its effect on the cognitive and physical maturation of growing neonates. The causes of anemia in neonates are multifactorial in source and are age specific. It may be developed by blood loss, isoimmunization, congenital hemolytic anemia, congenital infection, and congenital diseases. Our objective is to evaluate the Prevalence and etiology of anemia in neonatal patients referred to Kosar Hospital. Materials and Methods: For this cross-sectional study data were evaluated from 350 neonate patients who admitted in neonatal and NICU wards of Kosar Hospital between February 2011 and November 2015. The data from these participants were obtained by a check list and laboratory findings. The results were expressed by complete blood count(CBC), reticulocyte count and peripheral blood smear( PBS), serum ferritin serum B12 and folic acid levels and Hb electrophoresis. Both descriptive and statistical analysis methods were applied. Results: Prevalence of anemia was 10% (35). Age range of subjects in present study was 1-29 days and more common in male patients (% 64). The etiological distribution of cases were as following: iron deficiency anemia 18 (5.1%), megaloblastic anemia 9 (2.6%), hemolytic anemia 5 (1.4%), β thalassemia major 1 (0.3%), thalassemia minor 1 (0.3%), persistent Hb F 1 (0.3%). Five cases with more than one type of anemia, iron deficiency anemia and megaloblastic anemia. Conclusions: For accurate planning of neonatal anemia control programmes, genetic counselling and proper education about haemolytic anaemias should form an important domain.
Keywords: Anemia, Etiology, Neonate
P55
Prevalence of Preoperative Anemia and Its Relationship with Transfusion Requirements in Patients Undergoing Elective Cardiac Surgery
Elham Khalaf Adeli 1 *, Ali Akbar Pourfathollah 1, Seyed Mostafa Alavi 2, Fatemeh Eslami 2
1- Blood Transfusion Research Center, High Institute for Research and Education in Transfusion Medicine, Tehran, Iran, 2- Rajaie Cardiovascular Medical and Research Center, Iran University of Medical Science, Tehran, Iran [email protected], [email protected], [email protected], [email protected]
Background: Preoperative anemia has been reported as a risk factor for poor clinical outcomes in various types of surgery. We surveyed the prevalence of preoperative anemia as well as its relationship with transfusion requirements and postoperative bleeding in patients undergoing elective cardiac surgeries.Patients and Method: 193 adult patients scheduled for elective cardiac surgery at Rajaei cardiovascular medical center were included in a descriptive study between September 2015 and June 2016. Preoperative Hb<13g/dl for men and Hb<12g/dl for women considered as anemia. Transfusion of any allogeneic blood products during the operation and 24 hours later, was recorded. Chest tube drainage at 24 hours following admission to the intensive care unit (ICU) was recorded as postoperative bleeding volume. Results: 126 male (65.3%) and 67 female patients (34.7%) with mean age of 53.3 ± 15.7 years were enrolled in this study. Overall, 29.9% of patients were anemic before surgery. Anemia was mild in 58%, moderate in 28%, and sever in 14% of anemic patients. Transfusion prevalence was 81% in patients with preoperative anemia compared with 53% in patients with preoperative normal hemoglobin (P=0.007). There were no significant difference in the mean volume postoperative bleeding between anemic and non-anemic patients (173±23ml vs. 122±58ml, respectively, P value < 0.05).Conclusion: Our data show that preoperative anemia especially mild anemia, has considerable prevalence in patients undergoing elective cardiac surgery and is associated with higher perioperative transfusion requirements. To prevent of inappropriate transfusion, the anemic patients should be identified and treated for anemia before surgery.
Keywords: Preoperative Anemia, Cardiac Surgery
132 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Laboratory and Clinic: Biomarkers in Neurology P56 – P60
P56
Interleukin-32 Might be as a Prognostic Biomarker in Multiple Sclerosis
Alireza Rafiei1 *, Zaher Morsaljahan 1, Mahmoud Abedini 2
1- Molecular and Cell Biology Research Center, Department of Immunology, Faculty of Medicine, Mazandaran University of Medical Sciences, Sari, Iran, 2- Department of Neurology, Faculty of Medicine, Mazandaran University of Medical Sciences, Sari, Iran [email protected], [email protected], [email protected]
Background and aim: Multiple sclerosis (MS) is a chronic inflammatory disease of the central nervous system (CNS). Environmental and genetic factors play a key role in the development of the disease. Interleukin-32 (IL-32) is a cytokine inducing crucial inflammatory cytokines such as TNFα, IL-6, IL-1b, and MIP-2. The present study was an attempt to reveal any association between IL-32 levels and C/T promoter SNP with susceptibility to MS.Methods: This case control study recruited a total of 304 subjects including 132 MS patients and 172 sex- and age-matched healthy controls. Clinical and epidemiological characteristics of the RRMS, PPMS, and PPMS populations were assessed. Serum levels and C/T polymorphism of IL-32 were determined by ELISA and RFLP-PCR methods, respectively.Results: Serum levels of IL- 32 were significantly different between MS patients and controls. IL-32 was dramatically higher in the patients than that healthy controls (2297.4 ± 280.2 ver. 712.9 ± 90.2, p=0.005). T allele was prominent in MS patients than the controls and might increase the risk of MS up to 1.6 fold (95% CI; 1.02-2.4, p=0.038). In addition, the presence of T allele enhanced IL-32 production drastically.Conclusion: This is the first study in which IL-32 gene promoter C/T polymorphism and its serum levels were investigated. The increase in serum levels of IL-32 in accordance with additive effect of the presence of T allele in MS patients might introduce IL-32 as a key player in MS pathogenesis.
Keywords: IL-32, Multiple Sclerosis, Polymorphism, RRMS, SPMS Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P57
A Clinical Laboratory Approach to Diagnosis of Autoimmune Encephalitis
Alireza Pourreza 1 *
1- Danesh Medical lab [email protected]
Advanced in neurological autoantibodies research in the recent years led to the identification autoimmune disorders of neurologic system. It is now recognized that many central nervous system disorder previously considered neurodegenerative or unknown cause have an autoimmune cause. The new evolution categorizes disorders in three diseases: Autoimmune encephalopathy, Autoimmune Dementia and Autoimmune Epilepsy. This review provides a laboratory approach to diagnosis of the autoimmune encephalopathy. And also review the algorithms to diagnosis the autoimmune encephalopathy based to detection of autoantibodies. As those tests are unknown for many laboratories .it is necessary to present this issue in this congress.
Keywords: Auto-Antibodies, Autoimmune, Neurodegenerative, Encephalopathy
P58
Estrogen and Calcitonin Gene-Related Peptide:Relevance to Menstrual Migraine
Azam Karkhaneh 1 *, Mohammad Ansari 2, Solaleh Emamgholipour 2, Mohammad Hessam Rafiee 3
1- Reference Laboratory, Iranian Social security Organization, Tehran, Iran, 2- Department of Biochemistry, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran., 3- High Institute for Research and Education in Transfusion Medicine, Tehran, Iran [email protected], [email protected], [email protected], [email protected]
The neuropeptide calcitonin gene-related peptide (CGRP) has long been postulated to play an integral role in the pathophysiology of migraine. The homeostasis of CGRP is strongly influenced by sex steroids. Earlier studies showed that CGRP can stimulate the synthesis and release of nitric oxide (NO) and cytokines from trigeminal ganglion glial cells. The goal of this study was to determine the effect of 17β-estradiol in regulation of CGRP expression, inducible nitric oxide synthase (iNOS) activity, NO and Interleukin-1beta (IL-1β) release in cultured peripheral blood mononuclear cells (PBMCs) from pure menstrual migraine patients and healthy subjects.This study was performed on twelve pure menstrual migraine patients and twelve age-and sex-matched healthy subjects. PBMCs were isolated and treated with 17β-estradiol for 24 hours at physiological and pharmacological doses. Gene expression was evaluated by real time-PCR. CGRP and IL-1β proteins in culture supernatant were determined by ELISA method. iNOS activity in PBMCs was determined by colorimetric assays. Total nitrite was measured using a colorimetric assay.17β-estradiol treatment had a biphasic effect on expression of CGRP. We found that 17β-estradiol treatment at pharmacological dose significantly increases mRNA expression of CGRP in both groups (P<0.001), whereas at physiological dose could significantly decrease CGRP mRNA expression (P<0.001), CGRP protein levels, IL-1β release, NO production and iNOS activity only in patient groups (P<0.05).Collectively, it appears that 17β-estradiol can exert protective effect on decrease of inflammation in migraine via decrease in levels of CGRP, IL-1β and iNOS activity, however more studies are necessary in this regard..
Keywords: Pure Menstrual Migraine, Neurogenic Inflammation, CGRP, 17β-Estradiol, Inos, NO
134 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P59
Prevalence of Neonatal Hyperphenylalaninemia Based on HPLC Confirmatory Technique in Mazandaran Province,Iran (2007-2015)
Parvaneh Afshar 1 *, Daniel Zamanfar 2, Mohammad Shokrzadeh 2, Hamed Rouhanizadeh 2, Einollah Asadpoor 3
1- Department of Pediatrics, School of Medicine, Mazandaran University of Medical Sciences, Sari, Iran, 2- Research and Development Unit of Referral Laboratory, Deputy of Health Management, Mazandaran University of Medical Sciences, Sari, Iran, 3- Deputy of Health, Mazandaran University of Medical Sciences, Sari, Iran [email protected], [email protected], [email protected], [email protected], [email protected]
Classic phenylketonuria (PKU) is a metabolic disorder. The purpose of this study was to assess about epidemiological factors of PKU phenotypes in a neonatal screening program for Mazandaran ,Iran. Neonates screening for PKU were conducted by Serum Phenylalanine level based on a biochemical technique by ELISA and then HPLC methods. Of the screened newborns 407,244 (48.7% girls and 51.3%boys) 14girls and 13 boys neonates were diagnosed definitely as having 465 cases suspicious phenylketonuria .The incidence of phenylketonuria was 0.66in10,000 which assessed in different severity ;Severe PKU 1:67,874, Mild PKU 1:45,249 and HPA 1:33,937 at the living births. In addition, don’t detect any cases of NonClassic PKU.Although the consanguineous marriage is a major cause of that pattern particular in Iranian, but this difference in the present study not very significant. Now screening should be executed for all of the family that they have the familial history of PKU in Iran. According to varies actual of prevalence and incidence rate of PKU reported a real patient and taking PKU with Mild Phenylketonuria and Hyperphenylalaninemia ,it is recommended, the will provide the Phenylketonuria reports based on the severity of the disease.
Keywords: Neonatal Screening, Phenylketonuria, Blood Spots, ELISA, HPLC, Mazandaran, Iran
P60
Chronic Morphine use Revealed Long-Lasting Effects on Hippocampus Levels of TNF-Α and S100B
Jamal Amri 1, Mehdi Sadegh 2 *
1- Department of Biochemistry and Genetic, Faculty of Medicine, Arak University of Medical Sciences, Arak, Iran, 2- Department of Physiology, Faculty of Medicine, Arak University of Medical Sciences, Arak, Iran [email protected], [email protected]
Introduction: TNF-α and S100B are declared as important markers of inflammatory diseases of the nervous system. We planned here to examine the consequences of chronic morphine consumption on hippocampus levels of TNF-α and S100B in both male and female rats.Materials and Methods: Twelve female and twelve male adult wistar rats were used for study. Each male and female gender was divided randomly into two groups: control and morphine consumer. Control groups (male and female) were received water, while morphine consumer groups (male and female) were received morphine sulfate dissolved in drinking water (0.4 mg/ml) for 60 days. Thereafter, morphine use was stopped and all 4 groups were received water for 90 days. Finally, hippocampus was extracted to measure TNF-α and S100B levels through ELISA kits. Results: Hippocampus TNF-α level was significantly increased due to chronic morphine in both male and female rats in compare with control groups (P<0.01). Hippocampus level of S100B was significantly decreased in male (P<0.05) but not female rats of morphine consumers in compare with control groups.Conclusion: It seems chronic morphine use had long term effects on hippocampus chemical factors. Femaleness may affect the outcomes.
Keywords: Addiction, ELISA, Neuroinflammation, Opioids
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 135 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Laboratory and Clinic: Cardiovascular Disease Biomarkers P61 – P65
P61
Evaluation of Serum Resistin Concentration in Obese Subjects and Its Physiological Relevance with Obesity Related Cardiovascular Risk Factors
Fatemeh Morovvat 1 *, Seyyed Ziaedin Samsamshariat 2
1- MSc in Clinical Biochemistry, Department of Clinical Biochemistry, School of Pharmacy and Pharmaceutical Sciences, Isfahan University of Medical Sciences, Isfahan, Iran, 2- Department of Clinical Biochemistry, school of Pharmacy and Pharmaceutical Sciences, Isfahan University of Medical Sciences, Isfahan [email protected], [email protected]
Background and aims: Resistin is one of those cytokines increases interest of investigators in evaluation of relationship between this cytokine and its role in the pathogenesis of obesity and cardiovascular diseases. As obesity is a global health problem and obesity related cardiovascular risk factors can cause mortality, we decided to determine serum resistin concentration and also cardiovascular risk factors in obese subjects. Methods: This study had a case-control design, Serum samples from 44 obese subjects and 46 healthy controls were analyzed for resistin using enzyme-linked immunosorbent assay. Association between serum resistin and levels of total (TC), low- (LDL-C) and high-density (HDL-C) lipoprotein cholesterol, triglycerides (TG), fasting blood sugar (FBS), body mass index, and systolic and diastolic blood pressures was determined. Results: Serum resistin levels were significantly higher in the obese subjects compared with control group (3.64 ± 1.63, P = 0.040). Serum levels of resistin were found to be significantly correlated with levels of TC(r = _0.347; P = 0.027) and LDL-C (r = _0.311; P = 0.050), but not with systolic and diastolic blood pressure, TG, HDL-C and FBS (P > 0.05) in the obese subjects, after adjustment for age, gender and BMI. No significant correlation between resistin and cardiovascular risk factors including TC, low- (LDL-C), systolic and diastolic blood pressure, TG, HDL-C and FBS was observed in the control group (P > 0.05). Conclusion: Serum resistin level is significantly higher in obese subjects and it is suggested that cardiovascular risk factors may be related to the resistin level.
Keywords: Resistin, Obesity, Cardiovascular Risk Factors Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P62
Investigation of the Association between Circulating Antibodies to Heat Shock Protein 27 and Hypertension in Patients without Underlying Cardiovascular Disease
Mahdieh Khazaee 1 * , Mahdi Taheri Bonakdar 2 , Mahmoud Ebrahimi 3 , Mohsen Mouhebati 3 , Faezeh Ghasemi 4 , Maryam Tayefi 7 , Shima Tavallaie 2 , Hamide Ghazizade 2 , Amirhosein Sahebkar 5 , Majid Ghayour-Mobarhana 2 , Seyed Mohammad Reza Parizadeh 2 , Gordon A. Ferns 6
1-Immunology Research Center, BuAli Research Institute, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran, 2-Biochemistry of Nutrition Research Center, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran, 3- Cardiovascular Research Center, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran, 4- Department of Medical Biotechnology Faculty of Medicine, Arak University of Medical Sciences, Arak, Iran, 5- Biotechnology Research Center Mashhad University of Medical Sciences 6-Brighton & Sussex Medical School, Division of Medical Education, Falmer, Brighton 5- Department of New Sciences and Technologies, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected]
Background: Heat shock protein 27 (Hsp27) is a chaperone protein that is also involved in cell migration, apoptosis, endothelial barrier function, protection against oxidative stress and inflammation. Hsp27 has also been suggested to play a role during atherogenesis and its association with cardiovascular risk factors has been proposed. Objective: In order to further clarify the role of Hsp27 in atherosclerotic cardiovascular disease, we sought to evaluate the association between Hsp27 antibodies and hypertension as a major cardiovascular risk factor. Methods: We used a population of hypertensive patient without underlying cardiovascular disease from the Mashhad stroke and atherosclerosis heart study to assess the relationship between serum Hsp27 antibodies and hypertension; independent of other cardiovascular risk factors. A total of 1645 people were studied from which 394 people had hypertension. Results: Mean serum anti-Hsp27 was 0.20 (0.27) OD in our population and its amount was not significantly different between normotensive and hypertensive subjects at different stages of hypertension. Conclusion: Findings of the present study did not suggest any association between serum concentrations of anti-Hsp27 levels and either presence or severity of hypertension. Future studies are warranted to explore this association for Hsp27 antigen levels, and also look at changes in other HSPs involved in atherosclerosis, in relation to hypertension.
Keywords: Heat Shock Protein 27 Antibodies, Hypertension, Atherosclerosis, Cardiovascular Disease
P63 Blood Trimethylamine N-Oxide Levels Can Predict Peripheral Artery Disease
Maryam Saberi 1 *, Mir Mahdi Najafi 1, Jacqueline Vartanoosian 1
1- Department of Basic Sciences, School of Nursing & Midwifery, Shahid Beheshti University of Medical Sciences, Tehran, Iran [email protected], [email protected], [email protected] Background: Peripheral Artery Disease (PAD) is a manifestation of systemic atherosclerosis. It affects nearly 202 million people worldwide, and is often asymptomatic; leading to under diagnosis and under treatment. PAD is diagnosed based on medical and family histories, a physical exam and test results, and often after symptoms are reported. A correct diagnosis is important because people who have PAD are at higher risk for CHD, heart attack and stroke. Despite its association with high prevalence and extremely poor prognosis, PAD remains undiagnosed. Therefore, there is a need to find new prognostic markers that may provide insight into underlying pathophysiology, improve long-term clinical risk prediction incremental to traditional risk factors, and suggest avenues for therapeutic development in PAD. A new blood test that measures levels of TMAO (trimethylamine N-oxide) - a metabolite derived from gut bacteria - can powerfully predict future risk for heart attack, stroke. Method: Literature review searches were carried out in 2016 with a combination of keywords, MeSH terms, and other free text terms as suitable for the purpose. A comprehensive search strategy was developed to search Medline by the Scopus interface. The first specific interest was PAD and the second was TMAO. Result: TMAO plasma levels elevated in patients with a PAD. It predicts future risk of major adverse cardiovascular events. Conclusion: TMAO helps to improve selection of high-risk PAD patients with or without significant coronary artery disease, and to reduce mortality among them.
Keywords: Trimethylamine N-Oxide, Peripheral Artery Disease
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 137 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P64
Cardiovascular Biomarkers in Saliva
Vahid Pouresmeil 1 *
1- Assistant professor, Department of Biochemistry, Faculty of Medicine, Mashhad Branch, Islamic Azad University, Mashhad, Iran [email protected]
Cardiovascular disease (CVD) is a major threat to global health, estimated to 31 % (17.5 million) of deaths every year, and the number of deaths caused by CVD is expected to increase further, reaching 23.3 million by 2030. Saliva is a non-invasive and accessible biofluid that permits early detection of various diseases. Saliva contains biomarkers derived from serum and other body fluids which are useful in multiplexed assays that are being developed as point-of-care devices, rapid tests, or in more standardized formats for centralized clinical laboratory operations.This review was done by searching on PubMed, Scopus, Science Direct and Web of Science by entering Saliva biomarkers, cardiovascular disease as keywords.Due to the advantages of cardiac biomarkers in saliva, compared to distinguish between non-invasive method (saliva) and invasive (blood) associated with C-reactive protein (CRP) for non-invasive method marks better results. In CVD, levels of salivary inflammatory cytokines including IL-1β, IL-6, IL-10, TNFα and prostaglandin E2 increased significantly. These cytokines might be potential biomarkers for diagnosis of CVD. Moreover, the levels of α-2-HS-glycoprotein in saliva decreased in patients with CVD, which indicate might a potential way for early diagnostic of CVD. It is also possible to detect cardiac troponin (cTn) in saliva that is released in response to cardiac cell necrosis. Saliva is used diagnostically for numerous diseases including cancers, diabetes mellitus and cardiovascular diseases. The diagnostic use of salivary biomarkers poses several advantages over the traditional measurements of biomarkers in blood.
Keywords: Saliva Biomarkers, Cardiovascular Disease
P65
Soluble Tumor Necrosis Factor Like Weak Inducer of Apoptosis and Vitamin D in Hemodialysis Patients: Relation to Carotid Intima-Media Thickness
Farahnaz Askarian 1 *, Amir Ghorbani Aghjo 1, Roya Askarian 1
1- Department of Clinical Biochemistry and Laboratory Medicine, Tabriz University of Medical Sciences, Tabriz, Iran [email protected], [email protected], [email protected]
Background Cardiovascular disease, which simply could be predicted by carotid atherosclerosis, is the leading cause of death in patients with chronic kidney disease (CKD). The aim of the present study was to evaluate a possible relation between serum soluble tumor necrosis factor (TNF)-like weak inducer of apoptosis (sTWEAK) and Vitamin D levels with mean right/left carotid intima-media thickness (cIMT), in the hemodialysis (HD) patients. Methods In this cross-sectional study, serums were obtained from 50 stable chronic HD patients and 39 healthy controls. The serum levels of sTWEAK, Vitamin D, iPTH in both groups, and carotid IMT were determined in HD patients by standard methods. Results: Serum levels of sTWEAK were higher versus control sampies and Vitamin D levels were lower in the hemodialysis patients than in the healthy control. The sTWEAK level was significantly higher in men than women. No important correlation was found between sTWEAK, Vitamin D levels and mean right and left cIMT in the HD patients. Conclusions: Our study shows that sTWEAK levels are elevated in HD patients. This elevation has no association with the cIMT.
Keywords: Carotid Intima-Media Thickness, Hemodialysis, sTWEAK, Vitamin D
138 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Laboratory and Clinic: Cancer Biomarkers P66 – P88
P66
Study of Survivin Gene and Protein Expression in Breast Cancer Patients and Compare with Healthy Controls
Farzaneh Karimi 1 *, Noosha Zia Jahromi 1, Seyed Hossein Hejazi 2
1-Basic Sciences Faculty- Shahrekord Branch, Islamic Azad University, Shahrekord, Iran, 2- Department of Parasitology and Mycology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran [email protected], [email protected], [email protected]
Background and Purpose: Breast cancer is developed as a result of asymmetric proliferation of breast cells. Breast cancer is known as the major cancer among women. Genetic has an important role in affection to breast cancer. Among these genes Survivin belongs to IAP family, which is the same family of Apoptosis inhibitor. In the process of operation, this gene have a high expression among breast cancer. Materials and Methods: In this study, sample was carried out from 35 breast cancer patients and 35 healthy people and afterwards the tissues were kept in RNA later. After RNA extraction, c-DNA was synthesized. Then RNA was measured in 280/260 nanometers wavelength. Afterwards by using genes, dedicated- primers with RT-PCR technique, Survivin gene expression was studied qualitatively. Also protein extraction from tissue was done and then by SDS-page technique Survivin protein expression was studied. Results: Studies have indicated that the survivin gene expression is high in people with breast cancer, also extracted protein from samples confirms the relation of gene expression and tumor progression in patient with this cancer. Conclusion: Due to difference between protein and gene expression in healthy and diseased samples, it can be stated that we use as biomarker in detection in the disease progression.
Keywords: Breast Cancer, Survivin Gene, Metastasis Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P67
Study of Survivin Gene and Protein Expression in Prostate Cancer Patients and Compare with Healthy Controls
Farzaneh Karimi 1 *, Noosha Zia Jahromi 2, Forough Karimi 3
1- Shahrekord Branch, Islamic Azad University, Shahrekord, Iran, 2- Shahrekord Branch, Islamic Azad University, Shahrekord, Iran, 3- North Tehran Branch, Islamic Azad University, Tehran, Iran [email protected], [email protected], [email protected]
Background and Purpose: Prostate cancer is developed as a result of asymmetric proliferation of prostate cells. This cancer is ranked the fourth fatal illness worldwide proceeding lung, breast, and colon cancers. Different factors such as environmental and genetic cases take part in forming this cancer. In prostate cancer, like some other cancers a series of genes in metastasis will be highly expressed among these genes Survivin belongs to IAP family, which is the same family of Apoptosis inhibitor. Materials and Methods: In this study samples were carried out from 30 prostate cancer patients and 30 healthy people and afterwards the tissues were kept in RNA later. Then by using tripure kit, RNA and protein was extracted and in order to qualitative study the light absorption of extracted RNA was measured in 280/260 nanometers wavelength and by Termo Science kit, its CDNA was synthesized. Afterwards by using genes, dedicated-primers with RT-PCR technique, Survivin gene and then by SDS page technique, Survivin protein expression was studied qualitatively. Results: Studies have indicated that the survivin gene expression has highly expressed in prostate cancer, also extracted protein from tumor samples and normal samples confirm it. Due to difference between protein and gene expression in healthy and diseased samples it can be stated that we can use this gene as biomarker in detection in the disease progression.
Keywords: Prostate Cancer, Survivin Gene, Metastasis, Protein
P68
The Effect of Fe4Nio4Zn, Fe2Nio4 Nanoparticles on Hepatic, Renal and Spleen Tissues in Vivo
Sonia Mohammadi 1 *, Zahra Hoshmandi 2, Mahbubeh Setorki 3
1- Department of Biology, Hamadan Branch, Islamic Azad University, 2- Department of Biology, Sanandaj Branch, Islamic Azad University, 3- Department of Biology, Izeh Branch, Islamic Azad University [email protected], [email protected], [email protected]
Introduction: Nanoparticles are used in a wide range of consumer products. The aim of this study is to evaluate the effect of the nanoparticle Fe2NiO4 and Fe4NiO4Zn on the hepatic, renal and spleen tissues. Materials and methods: This study was conducted on 40 male Wistar rats by average weight of 43 ± 234 g and divided into 5 groups. Including: Group I: control by 0. 5ml physiological saline received. Respectively second to fifth group were injected with concentration 100 or 200 ppm of Fe4Nio4Zn or Fe2Nio4 nanoparticles. These injections were performed for 7 consecutive days intraperitoneally. After 14 days, hepatic, renal and spleen tissues were stained with Haematoxylin and Eosin and Iron stain (Prussian blue) specifically. Results: Results of H and E showed that both of doze Fe4NiO4Zn nanoparticles (100,200nm) had effect on the hepatic tissue and cause damaged on it. Conversely upper doze of (200 nm), was damaged on spleen tissue.Fe2NiO4 nanoparticle with doze (200nm) was damaged on renal tissue but, Fe2NiO4 nanoparticle with doze (100nm) was not any effect on hepatic, renal, and spleen tissues. On the results iron stain of this study showed that iron is deposited on the spleen tissue in all of groups but, this iron sediment in the spleen in Fe4NiO4Zn treatment group (100,200nm); compared with the control group was great (groups that contain zinc nanoparticles).Both of Fe2NiO4 and Fe4NiO4Zn nanoparticles damage on Hepatic, renal and spleen tissues but, in both of them damage was more in an upper doze and iron stain showed that Fe4NiO4Zn has more damage on spleen.
Keywords: Fe2NiO4, Fe4NiO4Zn, Nanoparticles, Rat, Liver, Spleen, Kidney
140 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P69
Early Detection and Screening of Colorectal Cancer with Peripheral-Blood Biomarkers
Hadi Bagheri 1 *, Shima Rahimirad 2
1- Department of Genetics, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran, 2- MSc Student, Department of Genetic, School of Sciences, Shahrekord University, Shahrekord, Iran [email protected], [email protected]
Introduction: Colorectal cancer (CRC) is the third most common cancer in the world and is often diagnosed at late stage. Promoter hypermethylation occurs in CRC and leads to silencing of tumor-relevant genes. Identification of hypermethylated tumor suppressor genes in peripheral blood mononuclear cells (PBMC) is an appealing strategy for the noninvasive and early detection of CRC.Purpose: We analyzed the amount of DNA methylation in the promoter region of selected genes (BMP3, VIM, and GATA4) as a peripheral-blood biomarker for early detection and non-invasive screening of CRC.Method: In this study, DNA was extracted from PBMC in 110 patient and 110 control groups. The experiment was carried out using MethyQESD technique that combines enzymatic digestion and Real-Time PCR. Mann– Whitney–U-test was used in case of two groups.Results: The amounts of methylation for BMP3, VIM and GATA4 genes in CRC patients were 43.75%, 56.68% and 62/2% respectively, And in control groups were 9.3%, 12.56% and 11.2% respectively. The rate of methylation of these genes were significantly different between the control and patient groups (p <0.001).Conclusion: These results suggested that the promoter regions of selected tumor suppressor genes were hyper methylated during tumorigenic process and thus their expression were suppressed and lead to cancer progression. Thus, the quantitative analysis of methylation in these genes may be used for early detection of colorectal cancer in non-invasive manner.
Keywords: Biomarker, Colorectal Cancer, Methylation
P70
Low Frequency of C-MPL Gene Mutations in Iranian Patients with Philadelphia-Negative Myeloproliferative Disorders
Abbas Ghotaslou 1 *, Hassan Boustani 1, Omid Kiani Ghalesardi 1
1- PhD Student of Hematology and Blood Transfusion Sciences, Student Research Committee Faculty of Allied Medical Sciences, Iran University of Medical Sciences, Tehran, Iran [email protected]
Background: Myeloproliferative disorders are a group of diseases characterized by increasing proliferation of myeloid lineage. In addition to JAK2V617F mutation, several mutations in the c-MPL gene have been reported in patients with Philadelphia negative chronic myeloproliferative disorders that could be important in the pathogenesis of diseases. The aim of the present study is to investigate the frequency of c-MPL and JAK2V617F mutations in Iranian patients with Philadelphia-negative myeloproliferative disorders. Material and Methods: Peripheral blood samples were collected from 60 patients with Philadelphia-negative MPD (Subgroups ET and PMF) and 25 healthy subjects as control group. The mutation status of c-MPL and Jak2V617F were investigated by using Amplification-Refractory Mutation System (ARMS) and Allele-Specific PCR (AS-PCR), respectively. The results were confirmed by sequencing. Results: Among 60 patients, 34 (56.6%) and 1(1.7%) had Jak2V617F and c-MPL mutation, respectively. Patients with Jak2V617F mutation had higher WBC counts and hemoglobin concentration than those without the mutation (p= 0.005, p=0.003). In addition, for all healthy subjects in control group, mutations were negative. Conclusions The present study revealed that the c-MPL mutations unlike the Jak2V617F mutations are rare in Iranian patients with PH-negative MPNs and the low mutation rate should be considered in the design of screening strategies of MPD patients.
Keywords: ARMS –PCR, c- MPL Mutation, JAK2V617F, Myeloproliferative Disorders
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 141 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P71
Viruses Associated with Female Breast Cancer
Mahin Ahangar Oskouee 1 *, Hossein Banazadeh Baghi 1, Farbod Alinezhad 1
1- Medical Student, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran [email protected], [email protected], [email protected]
Introduction: Breast cancer is the second most common cancer in the world. While this disease accounts for 25% of all cancers in women, the search for a viral cause for human breast cancer has generated considerable controversy. The aims of our study were to investigate the presence of high risk HPV type (16- 18) and HMLTV -DNA in breast tissue in two groups of Iranian women, one with and the other without breast cancer. Materials & methods: Paraffin-embedded specimens from 65 cancerous breast cancer cases and 65 cases with benign breast lesions were investigated for the presence of HPV and HMLTV -DNA by nested polymerase chain reaction. Results: In our study all cancerous and non- cancerous breast samples were negative for the HMLTV DNA, but we detected HPV-6 (low- risk) in 17 (26.2%) cases with breast cancer. This data is approximately in accordance with the reports that found no evidence of high-risk HPVs (16- 18) in breast cancer. Conclusion: The data presented in our study indicate a strong need for more epidemiological studies correlating different HPV types and HMLTV in Iranian women with breast cancer.
Keywords: Human MMTV-Env like Sequences, Breast Cancer, Human Papillomavirus
P72
Daphne Extract Effects on Apoptosis of Chronic Myelogenous Leukemia Cell in Compared to Imatinib
Alireza Khorshid 1 *, Saeed Abroun 1, Faeze Ghanati 1
1- Tarbiyat Modares University [email protected], [email protected], [email protected]
Objectives: Herbal medicines because of fewer side effects rather than chemical drugs and the existence of diverse plant species in Iran have attracted the attention of researchers. The anticancer effect of plant extracts Daphne (Daphne Mucronata) which is native to Iran on chronic myelogenous leukemia cells (CML) was examined. Methods: Daphne plants were collected from the Zagros Mountain in the province of Kermanshah. Extraction was performed with a rotary evaporator. The minimal inhibitory dose was measured by MTT. Study of apoptosis by flowcytometry test (Annexin V, PI) was performed. Changes in the expression of Bax and Bcl-2 were measured on K-562 Cell line. The minimal inhibitory dose of the extract was evaluated in combination with imatinib. Results: Minimal inhibitor dose 250ng/ml was determined. Cell death after 24 hours and decreased expression of Bcl-2 gene was associated with an increase in concentration. Cell death in K-562 cell line was more than mesenchymal cells and lymphocytes. The combination of herbal extracts with imatinib has more cytotoxic effects on the K-562 cell line. Conclusion: The effect of plant extracts was less than imatinib, but in combination with imatinib its effect can be increased. It can be combined with the extraction and used in the treatment of patients with lower doses of imatinib so reduces imatinib resistance.
Keywords: Daphne, Imatinib, Apoptosis, Chronic Myelogenous Leukemia
142 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P73
Urinary Bladder Malignant Neoplasms and Histopathology Findings
Fatemeh Samieerad 1 *, Amir Farzam 2, Mehri Kalhor 3, Fatemeh Pashazade 3, Mahsa Ziaee-Ardestani 4
1- Qazvin Metabolic Research Center, 2- Qazvin University of Medical Sciences, Qazvin , Iran, 3- Kosar Hospital Development and Clinical Research Center, Qazvin, 4- Tehran University of Medical Sciences, Tehran , Iran [email protected], [email protected], [email protected]
Background: Malignant urinary bladder neoplasms are prevalent in urological field and present important diagnostic and therapeutic turbulences to both the urologists and uropathologists. The incidence of urinary bladder carcinoma differences among world countries and between various regions of the same country. The clinical presentations of urinary bladder carcinoma are not specific and definite diagnosis was based on histopathologic examination of biopsy specimens. Our objective is about evaluating the histopathology findings of urinary bladder malignant neoplasms. Patients and Methods: For this cross-sectional study data were evaluated from 60 patients who underwent cystoscopy biopsy for urinary tract symptoms at Velayat Hospital in 2013. The data from these participants were obtained by a check list and review of biopsy specimens. The results were expressed by pathologic diagnosis. Both descriptive and statistical analysis methods were applied. (P < 0.05) Results: Age range of subjects in this study was 45-86 years and more common in men (%76).The most common chief complains were hematuria and dysuria. Histopathological findings were as following: High grade transitional cell carcinoma 38 (63%), low grade transitional cell carcinoma11 (19%), papillary neoplasm of low malignant potential 6 (10%) adenocarcinoma 1 (1.5%), squamous cell carcinoma1 (1.5%), metastatic prostatic carcinoma 3 (5%). Muscular invasion was found in 40(67%) examined cases. Conclusions: Like other malignant neoplasms, an immediate and precise diagnosis of urinary bladder carcinoma is crucial importance, because a cure is happened in the initial stages of disease. Adoption most favorable approach to the handling and outcome, were based on accurate and comprehensive histopathology diagnosis.
Keywords: Urinary Bladder, Malignant Neoplasms, Transitional Cell Carcinoma
P74
Evaluation of the Effects of Interferon Beta on the Gene Expression of Osteopontin, and Cell Migration in Cancer Cell Lines of Myeloma
Roghaye Sabzfrosh Aghdam 1 *, Saied Kaviani 1, Amir Atashi 1
1- Tarbiat Modares University [email protected], [email protected], [email protected]
According to the America Cancer Society cancer is a group of disease characterized by uncontrolled growth and spread of abnormal cells. Current investigation introduces the anti-cancer effect of interferon beta on cancer cell lines U266 and RPMI-8226.MTT test was used to determine the IC50 of INFβ in U266 and RPMI-8226 cell lines. So, MTT assay was used in order to study INFβ cytotoxic effect on myeloma cell lines. The ratio of cells invasion and migration was confirmed by trans-well chamber results. The gene expression of OPN and MMP9 was measured by Real Time-PCR in order to evaluate the effect of INFβ on gene expression in cancer cells. The IC50 was determined 400 mg/ml for U266 and RPMI-8226 cells in 24h by MTT test. Results of MTT test and cell count with Neobauer slide showed cytotoxic effect of the INFβ on both cells. RNA expression analysis showed decreasing on MMP9 and OPN expression. Moreover the INFβ decreased both of two cell lines growth versus of untreated cells. The Decreased expression showed decreased cell invation. So, INFβ can be one of the cytokines affecting multiple myeloma and the effect was evaluated as reducing the expression of OPN and MMP9. So, it can be under further review.
Keywords: OPN, MMP9.INF-B, U266, MMP9
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 143 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P75
Codon 72 (Exon4) TP53 Polymorphism in Women Breast Cancer
Jalal Farshbafei 1, Mahin Ahangar Oskouee 2 *, Javid Sadegi 2
1- Department of Microbiology Azad University of Branch Ahar, Ahar, Iran, 2- Medical Student, Faculty of Medicine, Tabriz, Iran Tabriz University of Medical Sciences [email protected], [email protected], [email protected]
Introduction: The TP53 tumor-suppressor protein plays a critical role in the prevention of human cancer. Several studies have examined the involvement of TP53 gene polymorphisms as a risk factor in human breast cancer, and variations due to ethnicity or race have been reported. Material & Method: A total of 80 formalin-fixed-paraffin-embedded breast cancer tissue blocks and 80 non-cancerous breast tissue were investigated for the presence of codon 72 (exon4) TP53 polymorphisms by PCR- RFLP. Result: In our study, the frequency of the Arg/ Pro allele was 61.5% in cancerous samples and 20% in no- cancerous sample (P< 0.0001). The majority of cases with recessive alleles of codon 72 (exon4) of TP53 were in the age group ≤50. The difference between cancerous and noncancerous groups was statistically significant (P< 0.001). Conclusion: Our results indicate that recessive alleles in codon 72 (exon 4) of TP53 gene might play a role in the breast cancer development, especially in women younger than 50 years. However, additional large studies are required to validate this association in different populations.
Keywords: Breast Cancer, TP53 Polymorphism, PCR- RFLP
P76
Prevalence Rate of Instability in NR21 and NR24 Microsatellite Markers in Patients with Familial Cancer
Narges Saeidi 1 *, Pegah Larki 1, Mohammad Taleghani 1, Ehsan Nazemalhoseini Mojarad 1, Hamid Asadzade Oghadaei 1
1- Gastroenterology and Liver Disease Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences Tehran Iran [email protected], [email protected]
Aim of the study: In patients with the positive family history of colorectal cancer (CRC), ovarian cancer, endometrial cancer and Gastric cancer, the incidence of hereditary syndromes like Hereditary nonpolyposis colorectal cancer (HNPCC) is growing.CRC with microsatellite instability (MSI) may occur sporadically or be inherited in cases of HNPCC syndrome. Considering the importance role of MSI in patients as a predisposing factor to HNPCC, we investigated the rate of NR21 and NR24, as mononucleotide markers,among the Iranian patients with familial cancer. Patients & Methods: 73 formalin-fixed paraffin-embedded tumors and their matched normal tissues from CRC patients with familial history of cancer who underwent curative surgery were selected. Determination of MSI status was carried out using 2 mononucleotide repeat microsatellite targets (NR21 and NR24) using standard PCR techniques.The primer sequences of fragments were as follows: NR-21: (F) GAGTCGCTGGCACAGTTCTA, (R) 6FAM CTGGTCACTCGCGTTTACAA, NR-24: (F) GCTGAATTTTACCTCCTGAC, (R) NED- ATTGTGCCATTGCATTCCAA.PCR products were denatured by electrophoresis on 5% denaturing polyacrylamide gels and were analyzed by an ABI 3130xl automated sequencer (Applied Biosystems, USA). Results: Among 73 patients, mean age was 56.4 years, pathology records showed that most of them were in stage II and III (65 %).The frequencies of instability NR21 and NR24 markers were determined in 20%, 23% samples respectively. Also instability in two markers confirmed in 15/73 (20 %) of cases. Conclusion: In defining individuals with patients with Familial cancer NR21 and NR24 may provide diagnostic assistance. These two markers can be used as an accurate diagnostic tool for the prediction and screening of molecular biomarkers along with IHC data and histopathological reports.
Keywords: Microsatellite Instability, NR21, NR27, Familial Cancer, HNPCC
144 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P77 A New Method of Study on Head and Neck Squamous Cell Carcinoma (HNSCC) Razieh Zarifian Yeganeh 1, Saman Mehrabi 1, Nader Ebadi 1, Maziar Motiee Langroudi 2, Abbas Shakoori Garakani 2 * 1- Tehran University of Medical Science, 2- Imam Khomeini Hospital Cancer Institute [email protected], [email protected], [email protected], [email protected], [email protected] Introduction: Head and neck squamous cell carcinoma (HNSCC) is the sixth most common among all malignancies and the most common among all types of head and neck cancers in the world. The worldwide statistics is about 600,000 incidences and 350,000 mortalities. The usual samples for diagnosis studies are blood, tumor sample and radiography from involved part of head or neck. The usual signs and symptoms are: 1) Persistent and incurable swelling problem 2) Sore throat as the most common symptom 3) Patch or hard mass in the head or neck area often more than two weeks. One of the most common pathways which involved in all cancers, is RAS/MAPK signaling pathway; and two common molecules in HNSCC formation, are KRAS and BRAF (in more than 30% of HNSCC cases). Materials and Methods: In the present study, we studied on 40 patients with head and neck squamous cell carcinoma and 10 normal people. The techniques we used, are Multiplex PCR (M-PCR) and KRAS and BRAF Strip Assay. Results: In this study, we observed 7 mutations in KRAS gene (about 17.5%) and 4 mutations in BRAF gene (about 10%) of these tumor samples. The hotspot mutation was Codon 12 Asp (10%) and Codon 12 Ser (5%) respectively. In BRAF, the most common mutation, according to the researches, was observed in codon V600E. Conclusion: We also found out that 29 patients were male (about 72.5%) and 11 patients were female (about 27.5%). In addition, 28 people were over 50 years, and 7 patients were below the age of 50. Keywords: KRAS, BRAF, Head and Neck Squamous Cell Carcinoma, HNSCC, Strip Assay
P78 Novel Formulated Forms of Curcumin Inhibits Cell Growth Via Modulation of NF-Kb and Wnt Pathways in Esophageal Cancer Amir Reza Hesari 1, Faezeh Ghasemi 2 , Amirhossein Sahebkar 3 , Seyed Mahdi Hassanian 4, Amir Avan 5 * 1- Department of Biology, Damghan Branch, Islamic Azad University 2- Department of Medical Biotechnology, Faculty of Medicine, Arak University of Medical Sciences, Arak, Iran, 3- Biotechnology Research Center, Mashhad University of Medical Sciences, Mashhad, Iran, 4- Department of Medical Biochemistry, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran, 5- Molecular Medicine Group, Department of Modern Sciences and Technologies, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran [email protected], [email protected], [email protected], [email protected], [email protected] Background: Esophageal cancer is a disease in which malignant (cancer) cells form in the tissues of the esophagus. Esophageal cancer is often diagnosed at an advanced stage because there are no early signs or symptoms. Thus novel anticancer agents are warranted to overcome these problems. Recently the antitumor activity of curcumin has been investigated in different tumor types. In the present study, we explored the molecular mechanism underlying the anti-proliferative activity of curcumin in vitro. Methods: KYSE-30cells were cultured and maintained in RPMI media with 10% FBS, 1% penicillin and streptomycin followed by incubation at 37oC_5%CO2. The viability of the cells in different concentrations of curcumin was evaluated using MTT assay. The cytotoxicity of this agent was also determined in 3 dimensional cell culture models (spheroid). Apoptosis was evaluated by PI staining. The expression levels of p65 and cyclin D1 genes were assessed using real-time quantitative RT- PCR. Statistical analysis was performed with Excel and prism software. Results: Curcumin inhibited cell growth and induced apoptosis via modulation of the NF-kB (P65) pathway. Tumor shrinkage was observed in the cells treated with curcumin at IC50. Curcumin stopped cell cycle of KYSE-30 cells through perturbation of Cyclin D1 expression. Moreover, curcumin suppressed the expression levels of genes involved in NF-κB pathway. Conclusion: The present results showed the antiproliferative activity of curcumin in esophageal cancer cells, and the capacity of this phytochemical to inhibit NF-κB signaling pathway, supporting further investigation on the role of this inhibitor in invivo models. Keywords: Esophageal Cancer, KYSE-30, Curcumin, Anti-Tumor Effect, RT-PCR
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 145 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P79
The Effects of IL-17 (Rs763780t>C) Polymorphisms on Breast Cancer in Iranian Women
Saba Hajazimian 1 *, Alireza Isazadeh 1, Seyyed Ali Rahmani 2, Naeimeh Shibaei 3
1- Department of Genetic, Tabriz Branch, Islamic Azad University, Tabriz, Iran, 2- Department of Molecular biology, Ahar Branch, Islamic Azad University, Ahar, Iran, 3- Department of Molecular Biology, National Institute for Genetic Engineering and Biotechnology, Tehran, Iran [email protected], [email protected], [email protected], [email protected]
Background and Aim: Breast cancer is the most prevalent cancer and the major cause of death from cancer in women. Interleukin-17 is a most important pro-inflammatory cytokine and play important role in the inflammatory response. The aim of this study was to investigate association between breast cancer and IL-17 gene rs763780T>C polymorphisms in Iranian women. Materials and Methods: This study is an association study with a case-control design. The case group consisted of 50 women with breast cancer from Iranian population. The control group consisted of 50 ethnically women. Genomic DNA was extracted from the whole blood using kit (Sina Gene) and genotyping was performed by polymerase chain reaction (PCR) amplification followed by restriction fragment length polymorphism (RFLP) analysis. Finally the data were analyzed using the statistical package SPSS (version 23) and P˂0.05 was considered statistically significant. Results: The genotype frequencies in case group were 41.0% (TT), 39.0% (TC) and 20.0% (CC) and in control group were 44.5% (TT), 41.0 % (TC) and 14.5% (CC). There is no significant association between this polymorphism and breast cancer (P>0.05). Conclusion: This study showed no significant association between IL-17 gene rs763780T>C polymorphisms and breast cancer in Iranian women population.
Keywords: IL-17, Polymorphism, Breast Cancer
P80
The Anticancer Effect of Aloe Vera Extraction on Bcl-2 Expression in AGS Cells
Nazila Tariverdi 1 *, Zahra Deylami Khiabani 1
1- Zanjane Azad University [email protected], [email protected]
Background: Gastric cancer is the fourth most common cancer and the second leading cause of cancer death in the world. In prevention of cancer, plants and natural combinations in reason of low side effects are in attention. Aloe Vera plant belongs to the Liliaceae family and contains a variety of valuable minerals, vitamins, amino acids and antioxidant. In most cases, changes in genes expression could be an element in progress or control of cancer. Expressing Bcl-2 gene in many cancer cells prevent death and preservation of these cells. The aim of this study was investigate changes in gene expression of Bcl-2 in human AGS adenocarcinoma cells, which treated with aqueous extract of Aloe Vera, using Real- Time PCR quantitative methods. Materials and Methods: The present study is case-control. The aqueous extract of Aloe Vera were prepared in different concentrations. AGS adenocarcinoma cells were treated with aloe Vera aqueous extract in different groups and times. RNA extraction and CDNA synthesis was performed, and gene expression of BCL-2 was evaluated by Real time PCR. Finally the obtained results were analyzed by statistical software. Results: BCL-2 expression at 48 hours, showed significant changes only in 800 mg/ml dose.BCL-2 gene showed significant reduce at 48hand significant increase and at 72hours. Conclusion: Aloe Vera extract decreases the expression of Bax to Bcl-2 in 48 hours and AGS cells leading the gastric cancer cells to apoptosis.
Keywords: Aloe Vera, Bcl-2, AGS, Gastric Cancer
146 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P81
Bioinformatics Prediction of Mirnas Targeting NOTCH1 and Hbx in Chronic Hepatitis B-Induced Hepatocellular Carcinoma
Niloofar Moradi 1, Mahdi Paryan 2, Behzad Khansarinejad 3, Mohammad Rafiei 4, Mahdieh Mondanizadeh 1 *
1- Department of Biotechnology and Molecular Medicine, Arak University of Medical Sciences, Arak, Iran, 2- Department of Research and Development, Production and Research Complex, Pasteur Institute of Iran, Tehran, Iran, 3- Department of Microbiology and Immunology, Arak University of Medical Sciences, Arak, Iran, 4- Department of Biostatistics, Arak University of Medical Sciences, Arak, Iran [email protected], [email protected], [email protected], [email protected], [email protected]
Background: Hepatocellular Carcinoma (HCC) is the third major cause of cancer death worldwide. Hepatitis B virus (HBV) and HBx gene play an important role in the development of HCC by influencing signaling pathways. Since there is no detectable symptom in the early phase of HCC, there is need to find new HCC-specific markers with high sensitivity for early detection and diagnosis of HCC. On the other hand, by the advent and development of bioinformatic sciences, software applications, and web-based applications and databases, it is now possible to predict miRNAs as biomarkers, and their targets. Therefore, in the present study, based on the results of the bioinformatic software applications, we selected the miRNA targeting HBx and NOTCH1 mRNAs. Materials and methods: First, the sequences of NOTCH1 and HBx genes were retrieved from GeneBank, NCBI. Afterwards, several software applications such as TargetScan, mirWalk, miRBase, Miranda, PicTar, miRVir, and DIANA were applied to predict miRNAs that target the desired genes. Results: Evaluation of novel therapeutic targets is essential for strong clinical outcomes. Hereupon, with this ascertainment, we analyzed specific crosstalk between miRNAs and genes selected (HBx and NOTCH1), as a result of our analysis, we found out miRNA-34a, miRNA-5193, miRNA-214 and miRNA-6510 have an effective role on down-expression of HBx and NOTCH1 in HCC. Conclusion: Using bioinformatics science to investigate and find new miRNA biomarkers will lead to cheaper and more rapid detection, prognosis, and diagnosis of cancers.
Keywords: Hepatocellular Carcinoma, Microrna, Bioinformatics
P82
Evaluation of the Potential Anticancerogenic Effects of the Hydro-Alcoholic Extracts of Camellia Sinensis and Lepidium Sativum on HeLa Cell Lines
Somayeh Jahani 1 *, Zahra Hedari 2, Mehdi Azami 3
1-Infectious Diseases and Tropical Medicine Research Center, Zahedan University of Medical Sciences, Zahedan, IR Iran, 2- Zahedan University of Medical Sciences, Zahedan, IR Iran, 3-Slamic Azad Univercity Shahre Kord [email protected], [email protected], [email protected]
Introduction: Medicinal plants with specific pharmacological effects and lower side effects have been considered to synthesis new drugs. The anti-tumor activity of L. Sativum extracts has been found previously. Materials and Methods: In the current laboratory experimental study, the leaves of L. Sativum plants were used. They were extracted using maceration method (50% of Ethanol 96% and 50% of water). HeLa cells were cultured in DMEM medium and incubated with different concentrations (1, 10, 50, 100 mg/ml) of extracts of Green tea and cress. Cell viability was assessed by MTT assay. Results: The hydro-alcoholic extract of hydro-alcoholic extract of cress did not show any active cytotoxic activity against the HeLa cell lines in the first day (IC50 > 100 mg/ml) and revealed a mild cytotoxic effect screened against HeLa cells in the second day (IC50 100 mg/ml). Conclusion: The present study demonstrated that the hydro- alcoholic extract of L. Sativum had cytotoxic effects against HeLa cells.
Keywords: Cervical Cancer, Hela, Cytotoxic, Lepidium Sativum
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 147 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P83
Metabolomics Profile Comparison of A2780 and A2780CP Ovarian Cancer Cell Lines by NMR Spectroscopy
Ziba Akbari 1 *, Mohammad Arjmand 2, Amir Amanzadeh 3, Ali Mellati 1
1- Zanjan Metabolic Disease Research Center, Zanjan University of Medical Sciences, Zanjan, Iran, 2- Department of Biochemistry, Pasteur Institute of Iran, Tehran, Iran, 3- Department of National cell Bank, Pasteur Institute of Iran, Tehran, Iran [email protected], [email protected], [email protected], [email protected]
Introduction: Epithelial ovarian carcinomas accounts for more than 85% of ovarian carcinomas. The chosen chemotherapeutical treatment of choice is cisplatin. However, long-term use of this drug mostly results in drug resistance phenomenon. Proton nuclear magnetic resonance spectroscopy (1H-NMR) is non-invasive and high reproducible technique used in metabolomics. Aim: In the present investigation, we tried to find out biochemical pathways and its metabolites alterations in epithelial cells of ovarian carcinoma and the study of the mechanism involved in cisplatin drug resistance. Materials and Methods: The cell lines A2780 and A2780CP (cisplatin resistance) were cultured. Cell metabolites extraction was performed and 1H-NMR spectroscopy were applied on a Bruker spectrometer operating at 400 MHz. After processing the data, final metabolites were identified and their biochemical pathways were worked out by Metaboanalyst (a web server for metabolomics data analysis and interpretation) and Human Metabolome Database (HMDB). Results: Our finding indicated that cisplatin drug resistance results in decreases in lipophilic metabolites such as progesterone, aldosterone, 2-Methoxyestradiol, Sphingosine and sphingosine, oleic acid in cell lines A2780 and A2780CP. Meanwhile, hydrophilic metabolites such as galactonite, mannose, sorbitol, fucose were showed increases and mannitol and glucuronate registered increases in these cells. Conclusion: Significant alteration in cell lines A2780 and A2780CP metabolome profile and changes in steroid hormones, sphingolipids, fatty acid, amino sugar, galactose, fructose and mannose metabolome pattern probably were resulted by Cisplatin drug resistance in ovarian carcinoma and hence require further investigation to confirm these valuable findings.
Keywords: Ovarian Carcinoma, Metabolomics, Cisplatin, Drug Resistance, 1H-NMR
P84
Evaluation of Haptoglobin Genotypes in Patients with Esophageal Cancer: A Population-Based Study in Golestan Province, Iran
Sara Hosseinzadeh 1 *, Abolfazl Amini 2
1- Laboratory Sciences Research Center, Golestan University of Medical Sciences, Gorgan, Iran, 2- Student Research Committee, Golestan University of Medical Sciences, Gorgan, Iran [email protected], [email protected]
Background: Haptoglobin is an acute-phase glycoprotein that affects host responses to infections and tumors. The haptoglobin locus is polymorphic consisting of 2 classes of alleles, Hp-1 and Hp-2, yielding 3 different phenotypes including Hp1-1, Hp2-2 and Hp2-1.The phenotypes generate structurally and functionally distinct protein products, indicating that haptoglobin polymorphism may influence susceptibility to infections and cancers. Materials & Methods: To evaluate the polymorphism of haptoglobin genes in patients with esophageal cancer, a total of44 patients and 44 healthy controls were included in this study. Genomic DNA was extracted from blood samples, and investigated by polymerase chain reactions (PCR). Results: Results from this study demonstrated that there is a significant difference between the groups regarding Hp genotypes. Our data showed thatHp1-1 is the most common genotype in the patientgroup. The distribution of the three major Hp phenotypes, Hp1-1, Hp2-1 and Hp2-2, was found to be 56.1, 14.6 and 29.3%in esophageal cancer patients, respectively. However, the distribution of Hp genotypes in healthy individuals was 21.4, 23.8, and 54.8% for Hp1-1, Hp2-1 and Hp2-2, respectively Conclusion: Our findings emphasized an increased risk of esophageal cancer among patients with the Hp1-1 phenotype. This highlights the important role of the Hp 1-1 phenotype, as an important predictor to identify a subset of patients with an increased need for preventive measures.
Keywords: Esophageal Cancer, Haptoglobin, Genetic Polymorphism
148 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P85
Expression of Key Long Non-Coding Rnas, 7SK and PCA3, in Newly Diagnosed ALL Patients
Mojtaba Mollaei 1, Parviz Fallah 1 *, Behzad Poopak 2, Tahereh Madani 3, Ali-Ehsan Heidari 4 , Masoud Soleimani 5 , Mahdi Jahedi-Zargar 1, Mojan Asadi 6, Kaveh Haratian 7
1- Medical Laboratory Department, Para-Medicine Faculty, Alborz University of Medical Sciences, Karaj, Iran, 2- Islamic Azad University, Tehran Medical Sciences Branch, Tehran, Iran, 3- Payvand Clinical and Specialty Laboratory, Tehran, Iran, 4- Medical Parasitology Department, School of Medicine, Alborz University of Medical Sciences, Karaj, Iran, 5- Department of Hematology, Faculty of Medical Sciences,Tarbiat Modares University, Tehran, Iran, 6- Department of Oncology, Shahid Madani Hospital, Alborz University of Medical Sciences, Karaj, Iran, 7- Microbiology Department, School of Medicine, Alborz University of Medical Sciences, Karaj, Iran [email protected], [email protected], [email protected], [email protected], [email protected] soleim [email protected], [email protected], [email protected], [email protected]
Introduction: Acute Lymphoblastic Leukemia (ALL) is an aggressive neoplasm disorder which is defined by the type of cells generated from malignant lymphocyte progenitors. ALL occurs in both children and adults but most of its incidence has been shown to be in 2-5 years old children. Long non-coding RNAs (LncRNAs) are one of the RNA families with the sequence length of 200 nts up to 100kbs or more. LncRNAs are located within the nucleus. They play role in cell homeostasis, proliferation, regulation of DNA bending, RNA transcription and splicing. Despite its poor coding potential, they act as oncogene and tumor suppressor. This study aimed to investigate the relative expression of HOTAIR and H19 as key LNCRNAs in ALL patients in comparison with Healthy control. Material and Method: 40 bone marrow samples of newly diagnosed acute lymphoblastic leukemia cases were collected. RNA isolation, cDNA synthesis, and quantitative Real-Time PCR were subsequently carried out in order to evaluate the gene expression level of LncRNAs. Results: In this study we demonstrated that the relative expression of 7SK and PCA3 was significantly up-regulated in ALL patient. Conclusion: The expression alteration of these LncRNAs might be associated with their role in etiology of ALL.
Keywords: Long Non Coding RNA, 7SK, PCA3, ALL, RT-PCR
P86
Expression Study of Mirna-378 and Mirna-451: Their Relation with Gastric Cancer
Farideh Rahmani 1 *
1- Department of Genetic and Molecular Medicine, Hamadan University of Medical Sciences, Hamedan, Iran kazhall.rahmani89 @gmail.com
Context and objective: Due to the high incidence of gastric cancer, limits of early detection methods and a lack of new molecular markers, the microRNA as a new generation of tumor markers are used for diagnostic purposes, treatment and prognosis. This study aimed to investigate changes in the expression levels of miRNA-451 and miRNA-378 in tumor tissues and normal adjacent tissues of patients with early stages of stomach cancer. DESIGN AND SETTING: case- control study, Hamedan University of Medical Sciences, Hamadan, Iran. METHODS: The total RNA of 60 samples (tumor tissues=30, normal adjacent tissues= 30) were extracted and after cDNA synthesis, expression value of mentioned miRNAs in samples was determined by real-time PCR (RT-PCR) using 2-∆∆CT method. SPSS and Excel software were used for data analysis. p <0.05 was considered significant. Results: The relative expression of the miR-451 and miR-378 was found not to be significantly difference in stomach cancer tissues com.
Keywords: Gastric Cancer, miR-345, miR-387, Biomarker
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 149 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P87
Serum Levels of Toxic Ages (TAGE) May Be a Promising Novel Biomarker for the Lifestyle-Related Diseases (LSRD)
Roya Askarian 1 *, Farahnaz Askarian 2
1- Bushehr-Medical Biochemistry 2-Tabriz- Medical Biochemistry [email protected], [email protected]
Advanced Glycation End-products (AGEs) generated with aging or in the presence of several disease such as cardiovascular disease, nonalcoholic steatohepatitis, Alzheimer،s disease, infertility and cancer. The AGEs derived particularly from the glucose/fructose metabolism intermediate glyceraldehyde (Glycer-AGEs; termed toxic AGEs (TAGE)) is very important. In this study, we aimed to investigate of its association with elevation of TAGE levels in serum and canceric patients. Material and Methods: In this study, serum samples were collected from 50 canceric patient (Digestive system) in khalige Fars Hospital, Bushehr, Iran. The samples were used for conducting tests of oxidant/antioxidant balance, TAGE, HbA1c, glucose and fructose tests. After studying the demographic data (age, sex), diet containing and stage of cancer, the data were analyzed by statistical tests. SPSS software was used for statistical analysis and interpretation. Results: Serum TAGE levels was elevated and related to high quantity of serum sugers. Serum PAB level was elevated. All patients had no limitation on sugar intake, and, had no a history of physical exercise. Conclusion: Changes in serum TAGE levels are closely associated with LSRD related to overeating, a lack of exercise, or excessive ingestion of sugars/dietary AGEs. Further research is needed in order to investigate the roles of TAGE in the onset of Digestive cancer.
Keywords: Advanced Glycation End-Products (AGEs), Biomarker, Toxic AGEs (TAGE), Cancer, Lifestyle-Related Diseases (LSRD)
P88
Measuring of CEA, CA15-3 and CA27-29 Markers in Breast Cancer Patients
Hossein Alimohammadi Asl 1 *, Iraj Feizi 1, Amir Mohammadi Ney 1, Nasrin Fouladi 1
1- Ardebil University of Medical Sciences [email protected], [email protected], [email protected], [email protected]
Background: This study measured blood level of CEA, CA15-3, and CA27-29 markers in different stages of Breast cancer to determine significant relationship between stage of Breast cancer and blood markers. Material and methods: The present study sectional study was studied 180 patients suffered from breast cancer. Results: In this present study 57.8%of patients were studied because of mass and 52.8% because of micro-calcification in mammography. %25 of patients had positive Family history. Patients in this study were all present in every stages of breast cancer. The pathology of 70% of patients had ductal carcinoma and the rest were from different kinds. 10/5% of patients had metastatic tumor. Significant relation was found between serum Levels of CEA, CA15-3 and stages of breast cancer (p= 0/001, p= 0/0001 respectively). No significant relationship between serum level of CA27-29 and different stages of breast cancer was found. Discussion: Significant and positive relation was found between serum levels of CEA, CA15-3 with different stages of breast cancer. Also, there wasn’t a significant relation between serum level of CA27-29 and different stages of breast cancer. The results were considered that we can use CAE and CA15-3 for predicting and evaluating of breast cancer. Although, because of 70% sensitivity of CA15-3 and 50% of CEA using other diagnostic methods seemed obligatory.
Keywords: Tumor Marker, Breast Cancer ,CEA, CA15-3
150 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Laboratory and Clinic: Diabetes and New Findings P89 – P95
P89
Study of Prevalence of Diabetes Mellitus Rural Population Older than 30 years Esfarayen City in 94 Years
Fateme Tashrifi 1 *, Ozra Haghani Nasimi 1, Mehdi Abdollahi 1
1- Medical University of Esfarayen [email protected], [email protected], [email protected]
Introduction: Diabetes is a group of common metabolic disorders that many health problems for patients and society brings. World Diabetes incidence is due to increased rates of obesity and decreasing levels of physical activity is on the rise. The purpose of this study, the prevalence of diabetes incidence in the isEsfarayens city. Materials and methods: In this cross-sectional descriptive study on 9039 people over 30 years in 94 that One of the factors susceptible to diabetes including (High BMI, Family history of diabetes, High bloodpressure and...) they were, FBS were performed. Findings: In this study, 23,965 patients were screened that 9039 people were tested that 3046 men and 5993 women were that 66 men and 116 women, patients were observed diabetes, 128 men and 219 women were per diabetic. And Of individuals screened, 205 were males and 610 females aged diabetic patients. Conclusion: Of 9039 people 2.1% new diabetic men and 1.9% new Diabetes women and 4.2% new per diabetic men and 3.6% women were new per diabetic. Diabetes lower in this region compared to studies in other regions of Iran .And compared to the previous survey the area has increased.
Keywords: Diabetes, Per Diabetic, New, Fasting Blood Sugar Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P90
Title: Prevalence of Gestational Diabetes in Pregnant Women Referred to Birjand Health Center Laboratory During 2014
Batool Hosseini 1 *
1- Medical Science University of Birjand [email protected]
Introduction: According to the instructions in the country, the World Health Organization and group work of pregnancy, the International Association of Diabetes IADPSG in 2013, testing one-stop GTT two-hour 75-g glucose officially for the screening and diagnosis of gestational diabetes recommended. Therefore, for all pregnant women non-diabetic’s normal per- diabetics, this test at 24-28 weeks of pregnancy should be carried out. Methods: In this study, 1520 pregnant women during 2014 in the laboratory of Birjand health center referred the gestational age between 24 and 28 weeks, respectively. First, on all of them, FBS were made and 75 grams of eatable glucose from Dextrose Company of Iran has given them. 1 and 2 hours after taking glucose collected blood samples A15 auto analyzer measured the amount of sugar in accordance with national TB program in the medical sciences universities were interpreting their results. Results: Of the 1520 women, 334 (22%) persons pregnancy were diagnosed. In other words, one of the three sugars was defined escalated normal values was defined as the number of 106 (7%) of patients were pre-diabetic diagnosed average age with diabetes 34 ± 3 years of pre-diabetic mean age was 32 ± 2 years. Conclusion: According to the instructions, lifestyle modification is recommended for pre-diabetic women including exercise the right dietary choices and diabetes screening is recommended every two years for women with normal results.
Keywords: Gestational Diabetes, Pre-Diabetes-Glucose of Oral GTT
P91
Evaluation of Erythrocyte Membrane Sodium-Potassium Pump Activity in Type 2 Diabetic Patients
Fouzieh Zadhoush 1 *, Morteza Pourfarzam 1, Masoumeh Sadeghi 2
1-Department of Clinical Biochemistry, School of Pharmacy and Pharmaceutical Sciences, Isfahan University of Medical Sciences, Isfahan, Iran, 2- Cardiovascular Research Center and Isfahan Cardiovascular Research Institute, Isfahan University of Medical Sciences, Isfahan, Iran [email protected], [email protected], [email protected]
Background: Altered levels of erythrocyte membrane sodium-potassium pump activity thought to play an important role in pathophysiology of diabetic complications, but its relationship to blood parameters poorly understood. This study aims to evaluate erythrocyte membrane sodium-potassium pump activity and its relationship to atherogenic and anti- atherogenic parameters in type 2 diabetic patients.Materials & Methods: A total of 90 type 2 diabetic patients and 40 non-diabetic controls were enrolled. Fasting plasma levels of glucose (FBS), total cholesterol, triglycerides, HDL-C, LDL-C and HbA1c were determined. Erythrocyte membrane were prepared for the estimation of sodium-potassium pump activity by osmotic lysis in terms of inorganic phosphate released/mg protein/hour.Results:Results indicate significant (P< 0.05) reduction in erythrocyte membrane sodium-potassium pump activity in diabetic patients compared to the controls (0.509 ± 0.08 vs. 0.949 ± 0.07 µM Pi/mg protein/h). Correlation analysis further revealed that the pump activity was negatively associated with FBS (r = −0.18, P = 0.044), HbA1c (r = −0.214, P = 0.030) and waist- hip ratio (r = −0.183, P = 0.043) and non-significant but positively correlated with HDL-C (r = 0.161, P = 0.072).Discussion: Our data indicates that erythrocyte sodium-potassium pump activity is significantly related to glycemic status of individuals. Sodium-potassium pump dysfunction and changes in lipid profile induced by diabetes may be implicated in the pathology of neuropathy, nephropathy and vascular complications in humans.
Keywords: Erythrocyte Membrane, Sodium-Potassium Pump, Type 2 Diabetic
152 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P92
Studying the Association between D/I Polymorphism of Uncoupling Protein 2 Gene and Diabetes in Ardabil Province
Hashem Yaghoubi1 *, Behnaz Narimani 1, Mehdi Haghi 2
1-Department of Biology, Ardabil Branch, Islamic Azad University, Ardabil, Iran, 2-Department of Genetics, Faculty of Natural Sciences, University of Tabriz, Tabriz, Iran [email protected], [email protected], [email protected]
Background and Aim: Diabetes mellitus is a common metabolic disorder caused by lack of insulin production, insulin resistance or the combination of both. The Uncoupling Protein 2 (UCP2) is a part of inner mitochondrial membrane proteins that has a role in transferring of protons. The UCP2 gens and polymorphisms could be a factor in the prediction of diabetes and its complications. Thus, the aim of this study is to examine common polymorphisms of these genes (45bp Ins/del) in Exon 8 in Turkish population in Ardabil province. Methods: DNA was extracted from peripheral blood of 150 subjects with and 150 subjects without diabetes by using saturated salt method.The all of extracted DNA amplified by usingPCR and then electrophoresied .At the end, the electrophoresis gels were analysed for gene insertion and deletion.P-value test was used to comparison with results. Results: DD genotypes frequency in patients was 58.7 % which was more than many healthy people. D alleles frequency in patients was 74.7% and this amount for healthy group was 63.3%.The results showed that genotype DD increase the risk of diabetes.(P=0/004). Conclusion: The findings resulted from this study has shown that UCP2 polymorphism gene is related to diabetes in Ardabil province. Permutation of proteins has a role.
Keywords: Diabetes, Polymorphism, Uncoupling Proteins, Deletion/ Insertion
P93
Aerobic Endurance Training Improves Nonalcoholic Fatty Liver Disease (NAFLD) Features via Mir-33 Dependent Autophagy Induction in High Fat Diet Fed Mice
Sattar Gorgani-Firuzjaee 1 *, Mehrnoosh Shanaki 2, Ali Reza Khoshdel 1, Maryam Delfan 3, Reza Meshkani 4
1- Department of Medical Laboratory Sciences, School of Allied Health Medicine, AJA University of Medical sciences, 2- Shahidbeheshti University of Medical Sciences, Tehran, Iran, 3- Department of Exercise Physiology, Faculty of Physical Education and Sport Sciences, Alzahar University, 4- Tehran University of Medical Sciences, Tehran, Iran [email protected], [email protected], [email protected], [email protected], [email protected]
Due to the changes in life style, obesity and obesity related complication such as insulin resistance, type 2 diabetes and non-alcoholic fatty liver disease caused worldwide health problems. Regular exercise has been frequently prescribed to combat metabolic complication of obesity but its molecular mechanism has not been fully illustrated. We investigated molecular mechanism of lipid lowering effect of exercise training in high fat diet fed mice by focusing on miR-33 expression and autophagy pathway. 24 mice were assigned to normal chow (NC) (n=8), high-fat diet (HFD) (n=16) group and subjected to NC and HFD for 13-weeks. HFD groups were divided to sedentary (HFD n=8) or continuous endurance training (HFD+CET, n=8) subgroups. The HFD+CET mice were subjected to treadmill running for 10-weeks in 23- week HFD course. HFD increased body weight, fasting blood sugar, triglyceride, cholesterol, aspartate aminotransferase (AST), alanine aminotransferase (ALT), liver lipogenic genes expression and reduced miR-33 mRNA expression and autopahgy pathway while training program reversed them. Exogenous miR-33 mimic sequence induced autophagy and reduced lipogenesis in HepG2 cells. Autophagy induction by rapamycin reduced lipogenesis and autophagy inhibition by chloroquine, enhanced lipogenesis in HepG2 cells. These findings suggest that aerobic exercise training as a non- pharmacological therapy exerts its lipid lowering effects by miR-33 dependent autophagy induction.
Keywords: Autophagy, Obesity, Fatty Liver, Exercise and Insulin Resistance
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 153 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P94
Evaluation of Serum Level of Calcium, Phosphate and Magnesium in Diabetic Type 2 Qazvin ShahidRajaee Hospital Patients
Mostafa Irandoost 1 *, Azam Molapour2
1-Qazvin Shahid Rajaee Hospital Padegan Street- Qazvin Univercity Medical Science, 2-Padegan Street- Qazvin Univercity Medical Science [email protected], [email protected]
Background: Type 2 Diabetes is a metabolic disease that is very common in Iran (7% of people). Diabetes mellitus is known to have its effect on almost all body systems causing various structural and biochemical changes.variation of Serum Bone Minerals Level a cause of the development of insulin resistance in T2DM.methods:This is cross- sectional study carried out among Qazvin Shahid Rajaee Hospital Patients with diabetes mellitus type .The aim of the study is to evaluate bone minerals (calcium, magnesium and phosphrus) serum levels in patients with type 2 diabetes mellitus and compare it with normal healthy individulas. the serum level of calcium phosphate and magnesium was estimated photometerically in 100 patients with diabetes type 2 as study group and 100 healthy individuals as control group.results:the mean concentration of Calcium was 9.23 ± 0.68 mg /dl, Phosphate was 3.86±0.63 mg /dl and Magnesium was 1.61 ± 0.28 mg /dl in the study group, which decreased when compared with control group the mean concentrations of Calcium was 10.86±0.71 mg /dl but not differ with control group the mean concentrations of Phosphate was 3.87 ± 0.54 mg /dl and Magnesium was 1.86 ±0.30mg /d but .Conclusion:the study concluded that the level of serum calcium was signifcantly decreased in Qazvin Shahid Rajaee Hospital type 2 diabetic patients while magnsium and phosphate was not differ. Thererfor need regular monitoring for design supplementation protocols and further studies are required to understand underline mechanism.
Keywords: Diabetes Type 2, Bone Minerals, Hospital
P95
Compare Helicobacter Pylori Infection in Patients with Diabetes Type II and Healthy Control Group in Zanjan
Abdolreza Osali 1 *, Mina Zhiani 2, SadraddinKalantari 1, Seyed Mohammad MohiadinKazemeini 3, Morteza Bayat 4
1-Zanjan- Booali Medical Diagnostic Laboratory and Beheshti Hospital Zanjan University of Medical Science,Zanjan,Iran 2-Zanjan- Department of Biochemistry, Zanjan University of Medical Science, Zanjan, Iran, Iran, 3-Zanjan- Beheshti Hospital, Zanjan University of Medical Science, 4-Zanjan- Sina Medical Diagnostic Laboratory [email protected], [email protected], [email protected], [email protected], [email protected]
Introduction: Infection with Helicobacter pylori has been recognized as a public health problem worldwide [1]. Helicobacter pylori (HP) infections are very common worldwide, affecting approximately 50% of the world’s population, and are more common especially in developing countries [2].The incidence of Helicobacter pylori is increased in diabetes mellitus.[3] .Materials & Methods: In this case-control study on 750 patients, 350 patients with type II diabetes and 400 healthy subjects as controls were carried out over a period of 10 months. Whole blood and serum were collected from all patients and testing H.pyloria IgG whit ELFA method by Vidas and Hb A1C tests were evaluated using column chromatography by Permier. The data was analyzed by SPSS 19 software.Results:The average age of patients with diabetes type II 45.62 ± 6, as well as healthy people as a control group mean age was 44.32 ± 4.Measuring Anti-HP IgG showed that 197 patients (56.28%) of serum antibodies against Helicobacter pylori in patients with diabetes had higher than normal. In the control group, 93 patients (23.25%) were positive for IgG antibodies titer.The prevalence of H. pylori infection between the two groups in terms of age were examined separately on any significant difference was found.Conclusions: The main objective of this study was to assess the prevalence of H. pylori infection in patients with diabetes and wasted in comparison with the control group. The prevalence of Helicobacter pylori is higher in diabetics than the non-diabetics.Treatment and eradication of Helicobacter pylori in patients with diabetes is essential.
Keywords: Diabetes Type II, Helicobacter Pylori, Hb A1C, Zanjan, Iran
154 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Laboratory and Clinic: Endocrine Disorders, Pituitary – Gonadal P96 – P102
P96
Chemiluminescence Systems; Do All Produce Same Results for Prolactin Analysis?
Mehri Aliasgharpour1 *, Marjan Rahnamay Farzami1
1- Ministry of Health & Med Edu [email protected], [email protected]
Background: Human prolactin (PRL) level may be determined in serum or plasma quantitatively by several different measurement systems in clouding chemiluminescence systems. However, comparison of the measured values between systems is difficult.Methods. In the present study we compared the prolactin values obtained in two chemiluminescence systems; AUTOBIO MICROPLATE LUMOMETER (CLIA-China) and LIAISON XL Analyzer (CLIA-Italy). Serum samples from n=40 female subjects (Age mean & range =33: 21-65 years) were collected in the measuring intervals of the measurement procedures. BioRad serum quality control materials (three level) were ran in two systems as well.Results. Obtained mean PRL concentrations for Autobio and Liason systems were X=558.56±369.32 µlU/mL;Range (152.2- 1502.3 µlU/mL) and X=504.58 ± 363.73 µlU/mL; range (150.8-1407.0 µlU/mL) respectively. The values for BioRad tri level serum quality control were in the stated ranges. Both method results were satisfactory (Pearson product moment correlation r =0.99 at p=0.01 and Regression Analysis) .Conclusion.Based on the differences between two CLIA systems and obtained results the authors conclude that laboratory’s measuring range for PRL be accomplished on the particular analyzer and verified against stated reference interval by the manufacture. More importantly, consecutive patients PRL level determinations and follow ups concluded on one analyzer and not on different analyzers with one reference range. In this regard, mentioning the method and system type used for PRL determination on the final laboratory’s report becomes important and verifies that a laboratory considers the quality assurance scheme in performing the PRL determination.
Keywords: Prolactin, Chemiluminescence, Pituitary Gland, Adenoma, Prolactinoma Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P97
Incidence of Congenital Hypothyroidism in Newborns South Khorasan Province from 2010 to 2014
Shaghayegh Naseri 1 *
1- Birjand Medical University [email protected]
Background: Hypothyroidism is a disease of newborns as the most common preventable cause retardation in children. The disease thyroxin hormone deficiency in newborns and infants referred the main feature of this disease is that most babies seem perfectly normal at birth with special brush no evidence of disease. The purpose and significance of the research: The high prevalence of the disease in the country irreparable brain complications if not diagnosed and treated on time, except that screening is not preventable disease, research shows the importance of this. Results Discussion: 101862 infants who were born of that within four years, 5743 individuals were studied (5/63%) has the answer TSH between 9/9 - 5 and 406 patients (0/4%) has the answer frequently for testing serum TSH above 10 were recalled. Where she 317 people (0/36%) acquired the disease. Of this number, 156 cases (49.3%) were female and 161 (50/7%) were boys. Family of parents of children in the study factor, the incidence of this disease in 153 patients (48/2%) had a family relationship. Also, of the 89 patients (28%) were diagnosed with transient hypothyroidism with medication and were treated in a certain time decisively A survey conducted in the prevalence of the disease 90 to 94 years respectively. 3.3 /1000, 3.2 /1000, 3.9/1000. 5 /1000. 3 /1000 has been Thus, we can conclude incidence of hypothyroidism South Khorasan province 3/68 people per 1,000 live births, which is a higher incidence country.
Keywords: Screen, Hypothyroidism, Elisa, Retardation, Concussion
P98
The Prevalence of Hypothyroidism in the First Trimester of Pregnancy in Pregnant Women Referred to a Health Center in the City of Esfarayen
Azra Haghani Nasimi 1 *, Fateme Tashrifi1, Mahdi Abdollahi1
1- Medical University of Esfarayen [email protected], [email protected], [email protected]
Introduction: Thyroid disorders are common endocrine diseases which are the second largest in women of reproductive age. The ratio of prevalence of these disorders in pregnant women are high, 2-3 percent of pregnant women are suffering from hypothyroidism. The problems caused by hypothyroidism in pregnancy includes: miscarriage, premature delivery, gestational toxicity, pregnancy-caused high blood pressure, child growth disorders, are symptoms such as decreased body iron, cerebral damage in the child-like cognitive disabilities. Therefore, in order to check the amount of thyroid hormones level during pregnancy is of special importance. Methods: The present study is a cross-sectional study in for interval 9 months from April to December 2016 on the 921 pregnant mothers referring to the health center in Esfarayen. In this study the serum levels of TSH hormone in the first trimester with the use of the in Elisa method and Autobio TSH Kit. Findings: Based on valid scientific sources of suffering in non-pregnant adults TSH normal 0.3- 5.1µIU/ml and in pregnant subjects 0.3-3.5 IU/ml µ. In this study which 921 pregnant mothers were investigated, 121 patients (13.1%) had High TSH serum level 5.3 without previous history of the disease. Discussion and conclusions: Due to the prevalence of subclinical hypothyroidism to the top of the thyroid function in early pregnancy, the study results showed that 13.1% of the subjects in the first trimester suffered from hypothyroidism, the necessity for public screening in the first trimester and disease treatments to prevent its side-effects were clear and obvious.
Keywords: Pregnancy, Hypothyroidism, TSH, Screening
156 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P99
Statistics of Babies with PKU in the Ahvaz 2013-2117
Elham Eskandari 1 *, Masoume Mardani 1, Mehdi Tavalla 1
1- Ahvaz Jundishapour University [email protected]
Phenylketonuria (PKU) is a rare congenital metabolic defect which is transmitted as a recessive autosomal. hyper- phenylalaninemia caused by hydroxylation of phenylalanine.The disorder prevents the conversion of phenylalanine to tyrosine. Purpose and Importance of Research: Rapid diagnosis and appropriate treatment of infants with PKU with proper diet is to benefit from the intelligence and natural growth. Research Method: by investigating the registered statics results in health Nrakz Ahvaz Health Center, during April 2013 to February 2017 with paper Guthrie test was performed on filter paper and determined by Neuelisa. It was found that out of 7153 infants aged 3 to 5 days that they were referred to our center 187 people were suspected. Results: The project aims to quickly identifies people with (PKU) congenital defects and identify ways to work around this cause and appropriate treatments to reduce the disease. In this plane after an initial positive result was considered suspicious and called the patients to test their blood to introduce ELISA. The results of statistics of the centers of Ahvaz, during April 2014 to February 2017 with paper Guthrie test was performed on filter paper determined by Neuelisa showed that during the follow-up carried out by ELISA method proved that out of the number of neonates with suspected venous blood 9 of them were positive.
Keywords: Phenylketonuria, Infants Aged 3 to 5 Days
P100
Survey of Permanent Congenital Hypothyroidism in Newborns under Treatment in Qazvin During 2005-2014
Ameneh Ahadizadeh * , Zahra Eskandari , Fateme Kiani , Maryam Yarahmadi , Masoome Ahadizadeh , Shahla Mohebbi Maryam Moradi
Author’s Complete Name: Introduction: Congenital hypothyroidism is the main cause of preventable mental retar in newborns, performing the newborn screening programs and early diagnosis and appropriate treatment of patients, Prognosis of newborns with congenital hypothyroidism is significantly improved. But no treatment or delayed treatment for mental retardation is inevitable. This article studies the process and outcomes of treatment of identified patients that were under treatment for three years. Materials & Methods: In a descriptive study of identified patients through screening programs according to state instructions to find out whether the hypothyroidism after three years, is permanent or not, medication was discontinued for 4 weeks. After this time, the concentration TSH and T4 are measured. In case of abnormal tests, the infant is stricken to permanent hypothyroidism and requires treatment with Levothyroxine tablets. Results: From the beginning of 2005 until the end of 2014, 93082 infants were in screened 284 patient infants were identified, of 284 patients, 188 patients analyzed became three years old. The results of the evaluation of these patients is followed as this: Of 188 patients, 93 patients had permanent hypothyroidism (50.2%) and 49.8% has improve. Of 93 patients with permanent hypothyroidism 49% were male and 51% female -50% had initial TSH between 9.9 to 5 and 23% had TSH between 19.9 to 10 and 27% had TSH above 20.
Keywords: Hypothyroidism
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 157 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P101
Nonmedical Treatment Effect on Physical and Hormonal Variables in Patients with Pcos
Sara Abedian1 *
1- Islamic Azad University of Semnan [email protected]
Introduction: Polycystic ovary syndrome, is a common disorder that affects almost 10% of women of reproductive age. Methods: It utilizes a library of texts and information on the internet and notification system reliable source review article published in this field.Results: studies shown that aerobic exercise (three times a week for 12 weeks) decrease in body weight, body fat percentage and the luteinizing hormone. Green tea (green tea tablets for 12 weeks) in women with PCOS due to weight loss and reduction in fasting insulin levels and reducing the level of free testosterone. The effect of fasting in patients with PCO showed that the level of cortisol (P=0/049) and noradrenaline (P=0/047) in the fasting group was lower than the group without fasting.capsulesShilan (jujube) is also a cause of pregnancy and treatment of oligomenorea was similar to metformin. Several studies shawn that examined the impact of nutrition on disease PCOS, It was shown that significant inverse correlation between serum zinc with serum levels of insulin and insulin resistance was observed in women with PCOs (P=0/001). It is also one of the factors influencing the development of individual nutrition and nutritional deficiencies is PCOs. Conclusion: The findings suggest that lifestyle changes (exercise and suitable nutrition) improve many physical and hormonal variables and enhance the metabolic status and fertility of this women.
Keywords: Non-Drug Treatments, Variable Physical, Hormonal, PCO
P102
From AFP and Open Neural Tube Defects to Cell Free (cf)DNA and Aneuploidy: A Review of Prenatal Screening
Prof. Glenn E. Palomaki
In the 1970s, new immunoassays for alpha-fetoprotein (AFP) allowed, for the first time, for general population based screening for open neural tube defects. Instrumental in this development was the use of multiples of the median and clear expectations of detection and false positive rates with mathematical modeling. In the 1980s, low AFP levels were found to be associated with Down syndrome, and the search for additional markers was begun. By the 1990s, these newer markers had evolved into second trimester screens (quadruple marker serum screening) as well as first trimester screening (serum markers with nuchal translucency). By 2000, various types of screening using both first and second trimester markers was becoming more common. Serum/ultrasound screening was widely practiced throughout the world and the ‘best’ combinations of markers could identify about 90% of common aneuploidies with a 2 to 3% false positive rate. With the appearance of next generation sequencing (NGS) around 2008, research turned towards the circulating, and highly fragmented cfDNA in maternal circulation. As prices for NGS dropped, cfDNA-based screening was offered as a clinical test in 2011. Performance was an order of magnitude better than serum/ultrasound screening for the common autosomal aneuploidies, and had the potential to identify smaller chromosome abnormalities as well – up to 98% detection (or better) with less than a 0.5% false positive rate. Whether cfDNA testing should be a first line prenatal screening test, or be offered to women already identified as being at increased risk is currently being explored.
158 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Laboratory and Clinic: Hemoglobinopathies P103 – P108
P103
The Study of Association between Fetal Hemoglobin Levels and Genotypes Of Xmn1, HBS1L-MYB, BCL11A Loci in Iranian Beta-Thalassemia Carriers
Alireza Kordafshari 1 *, Zahra Noormohamadi 2, Sirous Zeinali 1, Morteza Karimipoor 1
1-Molecular Medicine Department, Pasteur Institute, Pasteur st., Tehran, Iran, 2- Science and Research Branch of Islamic Azad University [email protected], [email protected], [email protected], [email protected]
Introduction: Fetal hemoglobin is dominant hemoglobin in the prenatal time. During the first six months after birth adult hemoglobin is replaced and its percentage is minimized. High levels of fetal hemoglobin in patients with beta thalassemia are created organized benefits, resulting improvement of symptom. The known genetic factors which are affected on increasing HBF in this study were polymorphism (rs7482144) XmnI beta globin gene cluster on chromosome 11, SNP (rs9384268) in region between HBS1L-MYB (HMIP) on chromosome 6q and SNP (rs11886868) in BCL11A gene on chromosome 2p.Materials and Methods: In this study, 40 individuals with beta thalassemia mutation IVSII-1 and HBF less than 2% were selected as a control group as well as 40 individuals with beta thalassemia mutation IVSII-1and HBF more than 3% as patients whom referred to the genetics Clinic Pasteur Institute of Iran. Genomic DNA was extracted by using salting out method. The BCL11A gene polymorphism and polymorphism area between HBS1L-MYB genes were checked by ARMS-PCR method, while XmnI polymorphism was examined by PCR-RFLP technique. Data were analyzed by chi square and logestic regression tests using software SNPStats.The result of this study showed that in XmnI polymorphism, ancestral allele A and MAF allele G were not been able to increase fetal hemoglobin. In BCL11A polymorphism, ancestral allele C was been able to increase fetal hemoglobin. In HBS1L-MYB polymorphism, ancestral allele A was been able to increase fetal hemoglobin.
Keywords: Beta Thalassemia, Fetal Hemoglobin, Polymorphism, BCL11A, HBS1L-MYB, XmnI Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P104
Proficiency Testing in Hematology in Mazandaran of University of Medical Sciences
Mehrdad Jalalian 1 * , Mohammad Shokrzadeh 1, Masomeh Majidi 1, Shahrbano Nandost 1 Azar Hasel Mehri 1, Asghar Fazel Tabar Malakshah 1, Ahmad Tabrizi 1
1- Mazandaran University of Medical Sciences [email protected], [email protected], sh [email protected], [email protected], [email protected], ahmad Ta [email protected]
Objective: In order to achive quality services laboratories need to implement quality assurance programs, including internal and external quality control programs with control samples.In the world of external quality control programs as a valuable tool for evaluating the performance of Laboratories. The laboratory results obtained in the laboratory is compared with average group. Purpose:The purpose of the external of quality control is (Govermental,Private) take total errors for each index has been provide .Method and materials:Control blood samples were taken as reference. Sustainablity indices under standard conditions to all provincial laboratories were sent.The results obtained by the laboratory as paper and electronics was sent to the office of university laboratories .After removing the out- of-range results and determine the range ±2.5 SD were analyzed by software SPSS versions 18 .To determine the total error of tested .laboratories base on reporting of internal CV.After analysis with 95 % confidene interval P<0.05 results of laboratory error (TE=1.65CV+Bias)were report to the laboratories.Results: After analyzing the results of reported to hospitals(23 hospital)52 % acceptable results (Total errors indices)and 48 percent of results unacceptable(Total errors indices).In privat laboratories (109 Lab) 61 % acceptable and 39 percent of the results unacceptable. Health centers (17 Lab) 88 % accepted and 12 % results are unacceptable.Discussion:External quality control programs is useful for improving the performace laboratories .Performing regular implementation of External control program is an important guide to assess the performance of laboratories.
Keywords: Quality Control, Proficiency Testing, Hematology
P105
Coinheritance of Common α-globin Gene Deletions and β-thalassemia in an Iranian Population and Importance of it for Screening Program of β-thalassemia
Azam Moosavi 1 *, Ali M. Ardekani 2
1- Department of Biochemistry, School of Medicine, Alborz University of Medical Sciences, Alborz, Iran, 2- Department of Medical Biotechnology, National Institute of Genetic Engineering and Biotechnology, Tehran, Iran [email protected], [email protected]
In the view of high prevalence of α-thalassemia mutations in many parts of the country, the aim of this study was to determine the carrier frequency of common alpha deletions, as a secondary modifier in clinical manifestations of beta thalassemia, in known beta-thalassemia carriers and consideration of some hematology parameter changes importance. The study includes families referred from different primary health care centers with microcytic hypochromic anemia [MCV<80fl; MCH<27pg] and A2> 3.4%]. Genomic DNA was extracted from peripheral blood leukocytes by salting out method. For common β-globin gene mutation analysis, amplification refractory mutation system- polymerase chain reaction (ARMS-PCR) and for rare β-thal alleles, DNA sequencing was used. Also for investigation of common α-globin gene cluster deletions (-α3.7, -α4.2, --MED and -α20.5), multiplex Gap-PCR was performed. Among 227 β-thalassemia minor individuals studied, we found α-globin gene deletions in 43 cases. Also the co-inheritance of α-globin gene deletion and triplication was not found in the studied individuals. Comparing mean of some hematology parameter didn’t show concerning changes for screening program of beta thalassemia. Although it is highly recommended that physicians and genetic counselors involved in the screening program of beta-thal major in the country consider this phenomenon because of high prevalence of this coinheritance, hematologic indices changes are very slight and our statistic compares showed there is no concern about screening of beta thalassemia in cases with coinheritance of α-thalassemia mutations and β-thalassemia.
Keywords: Alpha Thalassemia, Beta Thalassemia, Microcytic Hypochromic Anemia
160 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P106
Prevalence of Hemoglobin D in Isfahan Province of Iran
Ali Ajami 1 *, Masoud Edalati 1, Mehdi Hojati Far 1, Nazanin Sharifpour 1
1- Esfahane Nobel Medical Diagnostic [email protected], [email protected], [email protected], [email protected]
Introduction: The hemoglobinopathies are among the most common single gene disorders worldwide (7% of population). Hemoglobin (Hb) D is more common in northwestern India and also Middle East, often presenting with mild degree of hemolytic anemia and mild to moderate splenomegaly. Coinheritance of HbD with beta-thalassemia and HbS can lead to clinically significant conditions like thalassemia intermedia of moderate severity. Objectives: We performed this study to determine the prevalence of hemoglobin D trait and also its coinheritance with other hemoglobin disorders in Isfahan city. Material and Methods: From June 2015 to December 2016, 1829 of patients with a suspected diagnosis of hemoglobin disorder referred to Nobel Medical Diagnostic Center, Isfahan. The samples were analyzed by Capillary electrophoresis and proved with HPLC method. Results: 850 patients revealed hemoglobinopathy of which 84 showed Heterozygote HbD pattern in electrophoresis. Among the cases with hemoglobin D disorder, 6 out of 84 (7.14 %) revealed coinheritance of beta zero-thalassemia and Hb-D Conclusion: As hemoglobinopathies are relatively common in Middle East region, Hemoglobin electrophoresis seems mandatory not only for patients with microcytosis (not related to iron deficiency anemia), but also for those with chronic hemolytic anemia, and the patients with high clinical suspicion of hemoglobinopathies such as cyanosis and splenomegaly. To prevent major clinical problems in future children, hemoglobin electrophoresis also seems necessary for both genders as a part of laboratory evaluation during pre- marriage genetic counseling.
Keywords: HemoglobinoPathies, Electrophoresis, Hemoglobin (Hb) D
P107
Detecting Unexpected Antibodies in Patients with Hemoglobinopathies in Boushehr
Narges Obeidi 1, Ali Amrooni 2 *, Fatemeh Hosseinpour Soleimani 2, Reza Dehghani 2, Abdolreza Nejadbolkheyr 3, Hengameh Abdoli 3, Mousavi MJ 4, Keramat Namvari 3
1- Department of Hematology, School of ParaMedicine, Bushehr University of Medical Sciences, Bushehr, Iran, 2- Master Student of Hematology, Student Research Committee, Bushehr University of Medical Sciences, Bushehr, Iran, 3- Bushehr Blood Transfusion Organization, Bushehr, Iran, 4- Immunology Department, School Of Medicine, Tehran University Of Medical Sciences (TUMS) [email protected], [email protected], [email protected], [email protected]
Background: There are over 600 antigens on Red blood cells (RBCs) surface, which are separated into 30 blood group systems. When a person is exposed to these different antigens than his or her own, he or she can form antibodies that can occur in extravascular and/or intravascular hemolysis. We used antibody screening cells to detect unexpected antibodies in patients with hemoglobinopathies in Bushehr. Methods: In a cross-sectional study, 102 (49 male and 53 female) transfused patients with hemoglobinopathies were evaluated in Bushehr Blood Transfusion Organization. Results: In our study, the age of onset of symptoms ranged from 10 to 80 years(46.46 ± 18.80 years). Red cell alloantibodies were detected in 48 patients (13 thalassemia, sickle cell anemia and 27 other diseases). The red cell antibodies developed in this report were mainly Kell (%27.1) and cold antibodies (%25.0). Our data showed that alloimmunization to minor erythrocyte antigens and erythrocyte autoimmunization of significant clinical variables are frequent findings in transfused thalassemia patients. Conclusion: There is no relation between the number of blood units transfused and antibody formation in transfused patients, but it is an important factor for increased alloimmunization.
Keywords: Antibody Screening, Transfused Patients, Alloantibodies, Cold Antibodies
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 161 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P108
Evaluation of Beta- Thalassemia Minor Prevalence in Referrals to Clinical Centers of Alborz Province in Year 1394
Reza Darvishvand 1 , Fateme Mousavi 1 , Zahra Ahmadzadeh 1 , Laya Kafami 2 , Malihe Farid 3, Kian Javadi 4 , Manijeh Ghelich-Vatan 4 , Parviz Fallah 1 * , Zeinab Khodabande 5, Sadegh Saedi 5
1- Medical Laboratory Department, Para-Medicine Faculty, Alborz University of Medical Sciences, Karaj, Iran, 2- Immunology Department, Medicine Faculty, Alborz University of Medical Sciences, Karaj, Iran, 3- Social Medicine, Medicine Faculty, Alborz University of Medical Sciences, Karaj, Iran, 4- Razi Pathobiology and Medical Genetic Laboratory, Karaj, Iran, 5- Shahid Rajaei Hospital Laboratory [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected]
Introduction: Beta-thalassemia is one of the most important monogenic disorders that presents with defect or decreased production of beta-globin chain. Prevalence of beta-thalassemia trait (BTT) is about 3-4% in some areas of Iran and global average estimated around 1.5%.Method: This study is designed to estimated BTT prevalence in referrals to Rajaei General Hospital and Razi Pathobology laboratory in Karaj in year 1394. We collected 1243 Complete Blood Count (CBC) and Hemoglobin Electrophoresis data according to ethical approval that the ones who shows BTT pattern in their dates ( RBC >5.5×1012 /L, MCV <75 fl, MCH< 270 pg/l, Hb A2 >3.5%) considered as a BTT.Result: The dates show that 43.1% of our population has MCV lower than 75 fl, 56.9% of these people had MCH < 270 pg/l. 25.5% of them had RBC > 5.5 × 1012 /L ,15% of 1243 patients had Hb A2 level above 3.5% that 14.8% of them was men and 15.2% of them was women. Among them 28.5% of them was child, 9.8% was teenager 59.3% was adults and 2.4% had elderly.Conclusion:In overly, analysis demonstrate that among 1243 referrals 9.9% of them had MCH < 75 fl, MCH < 26 pg/dl, RBC > 5.5 × 1012 /l and increased Hb A2 ( above 3.5%) that is considered as BTT that 12.1% of them was men and 8.7% of them was women.
Keywords: Beta Globin, CBC, Electrophoresis Beta-Thalassemia
162 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Laboratory and Clinic: Obesity P109 – P111
P109
Methylation Status of Promoter Region of FTO Gene in Obese Diabetic Patients with Hypertension
Navid Sarakhs Asbaghi 1 *, Nosratollah Zarghami 2
1- Department of Biology/Genetics, Tabriz Branch, Islamic Azad University Tabriz, Iran, 2- Tabriz University of Medical Sciences [email protected], [email protected]
Introduction: Increasing the overweight not only does cause to physiological problems, but also does lead to death by increasing the peril of chronic diseases like diabetes type2.FTO gen which is placed in 16q12.2 was the first gen which was discovered in relation to overweight and metabolic diseases. It is considered that the methylation changes of DNA cause to change the talent of person toward diabetes type2 and other common humanistic disease. Materials and Method: By attention to the volume of the selected samples, the current study was done on63fat ladies .The control group included 13 fat non-diabetic ladies with natural blood pressure .The experimental was classified in two groups which included25fat diabetics with high blood pressure and25fat diabetics with natural blood pressure .The biochemical tests were done by auto analyzer set and their DNA was extracted by RGDE method ;FTO Methylation Promoter Gen was done also by MSP method. Results: After analyzing data ,there is a significant relationship between the TC and Height variables with methylation in patient and control groups. From the methylation point of view ,the non-diabetics fat people without blood pressure were23%methylated and77%unmethylated. The fat diabetics people with high blood pressure were32%methylated and68%unmethylated and the fat diabetics people without blood pressure were23%methylated and76%unmethylated. Discussion and Conclusion: In base of accessed results, it can be said that genetic fields and AP genetics factors of overweight cause to much changes on FTO Methylation Promoter Gen.
Keywords: Overweight, Diabetes Type 2, Hypertension, FTO Gene, Methylation, MSPCR Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P110
Cigarette Smoking is Associated with Obesity Through H2S Signaling Pathway
Nasim Ghafari 1*
1- Cellular and Molecular Endocrine Research Center, Research Institute for Endocrine Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran [email protected]
Background: Obesity and smoking are the major health problems in all over the world. There is increasing evidence that smoking is associated with abdominal obesity and other risk factors for the metabolic syndrome. This study will try to shed light of the association between cigarette smoking and obesity. Material and Methods: In this review article we surveyed available literature in PubMed database during 2000 to 2015 to find original articles, bibliographic reviews and books. Results: Studies showed that the number of cigarettes smoked per day was significantly associated with higher body weight and BMI. Heavy smokers also had an unhealthier lipid profile. Cigarette smoke has Hydrogen sulfide (H2S) per se. interestingly H2S is synthesized in the adipose tissue mainly by cystathionine & gamma;-lyase (CSE). Several studies have demonstrated that H2S is involved in adipogenesis, that is the differentiation of preadipocytes to adipocytes, most likely by inhibiting phosphodiesterases and increasing cyclic AMP concentration.Conclusion: It seems that cigarette smoking can make disruption in H2S signaling pathway. Consequently dysregulation of H2S signaling pathway changes adipogenesis and affect body fat and lipid profiles.
Keywords: Smoking, Obesity, H2S
P111
Effects of APOE and SCARB1 Gene Variants on Weight Loss after Laparoscopic Sleeve Gastrectomy
Reza Ebrahimi 1 *, Nasim Ghafari 2
1- Obesity Treatment Center, Department of Surgery, Shahid University, Tehran, Islamic Republic of Iran 2- Cellular and Molecular Research Center, Research Institute for Endocrine Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran [email protected], [email protected]
Background: Obesity is a major health problem that causes high rate of morbidity and mortality. There is a interaction between genetic susceptibility and exposure to environmental cues; however, the mechanisms that link these factors are unclear. For many patients, bariatric surgery markedly reduces body mass. However, the response to surgical intervention varies across individuals and depends on the type of surgical procedure and genetically variations. Some genes are suggested that have important role in predicting response to interventions. The aims of this study is to review single nucleotide polymorphisms effect on obesity surgical treatment response.Material and methods: In this review article we surveyed available literature in PubMed database during 2000 to 2017 to find original articles, bibliographic reviews and books.Results: Single nucleotide polymorphisms (SNPs) were identified in genes involved in laparoscopic adjustable gastric banding (LAGB) response are lipid metabolic regulation genes , APOE and Roux-en-Y gastric bypass (RYGB) response, lipid transport (SCARB1). The important SNPs that can effect treatment response are rs439401 APOE and rs10846744 SCARB1. Studies showed that rs439401 APOE and rs10846744 SCARB1 are associated with response to weight loss have been observed in obese patients undergoing LSG, LAGB and RYGB.Conclusion: Further studies are warranted to explore the effects of the rs439401 and rs10846744 on weight loss among severely obese patients applying for LSG. Information derived from patient DNA may be advantageous to predict surgical weight loss outcomes and guide selection of surgical approach.
Keywords: Obesity, Laparoscopic Sleeve Gastrectomy, SCARB1, APOE
164 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Law and Ethics in Laboratory P112 – P113
P112
Check Ethics and Law Training in Educational-Diagnostic Laboratories Affiliated to Urmia University of Medical Sciences
Arwin Hesami 1 *, Mehrdad Saeidi 1, Azad Mohammadi 1
1-Student Research Committee, Urmia University of Medical Sciences, Urmia, IR Iran [email protected], [email protected], [email protected]
Introduction:Basic of all ethics codes is correct performance. Activity unwanted mistake (actual/potential) is cause of financial losses in lab, physical, financial or mental damage to patient or trainee.Recognition of ethics inclinical lab training, with having working skills and knowledge before starting training can be made patient safety and better performance of trainees.Aim:Evaluation and signification of observance of ethics and law in clinical laboratory sciences training. Method:This descriptive-sectional study be performed with selected 40 trainees of clinical laboratory sciences through census in Urmia University of medical sciences and completion of a questionnaire that its justifiability and validity be confirmed.Result: 77.42% of questionnaire be responded.Satisfaction about education system was 70.97% and their training activities was 48.39%.All of trainees aware of department of their training but 38.71% of them reading work guidelines.83.88% of trainee point to training mistakes-32.26% point to observation of unknown reporting system. Fear (41.94%) and ignoring wrong (54.84%) was Reason of not-reporting mistake.Discuss and conclusion:-Providing laboratory activities and ethics guidelines for trainee by the Department of Laboratory Sciences.-Evaluation of knowledge and skills of volunteer of lab training by scientific interview and, if necessary, a short-term training courses to be held.- holding daily exam about trainee daily activity.-Use unknown reporting system for errors reporting-to reducing anxiety- in laboratory.-Repetition of trainee suspicious activity by educator.-Moderation hour’s trainee’s activity based on the physical-mental condition.-Motivation/amenability increasing by participation of trainees in research or awarding salary to them.
Keywords: Ethics, Trainee, Laboratory Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P113
Medical Laboratory Services in the Light of Moral Teachings
Ahmad Gatabi 1 *
1- Babol University of Medical Sciences, Yahyanejad Hospital. Babol, Iran [email protected]
As one of the pillars of the diagnostic laboratory in the care, control and prevention of diseases plays an important role. Respect for human dignity and protect the rights of patients, including the health service received standard of moral philosophy and hospital accreditation is one of the axes. The need for ethical reasons, such as complicated planning and decision-making depends on the area of ethics. Testing the accuracy and speed in addition to standard scientific methods and attention to the protection of the rights, ethics, honesty and respect for human dignity are the characteristics of good laboratory Parallel to the establishment of quality management, can have a significant impact on increasing client satisfaction. Medical ethics in professional training and promoting the concepts of commitment, policy and advice as well as serving an important role. More than request physician-patient experiment to introduce patients to a special laboratory, providing test answers to another person, the confidentiality of the tests, report results, research activities specimens, preserved specimens that contain characteristics of patients Patient Genetic and physical condition and other similar cases, including popular titles and lab diagnostics are important moral issues That laboratory errors must be considered. In this study, using reliable sources have been trying to improve laboratory science community staff, With the goal of Using this material, technical staff and laboratory staff be diligent promotion of laboratory services.
Keywords: Medical Ethics, Professional Conduct, a Medical Laboratory, Patient Rights
166 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
New Findings in Laboratory Diagnostics: Biochemistry P114 – P127
P114
Optimized Measurement of Total Phenolic Level in Human Serum Using Folin-Ciocalteu Method
Alireza Ebadollahi Natanzi 1 *, Gholamreza Arab Rahmatipour 2
1- Department of Medicinal Plants, Imam Khomeini Higher Education Center, Agricultural Research and Extension Organization (AREEO), 2-Department of Biochemistry, Farabi Hospital Laboratory, Medical Sciences of Tehran University, Tehran, Iran ebad@ ihec.ir, [email protected]
Objectives: Polyphenols are a special group of plant secondary metabolites that play a role in protecting tissues against the oxidizing effects of free radicals. These compounds include some valuable natural antioxidants such as flavonoids and Catechins. Obviously, determination of these phenolic compounds in serum levels of human would be of importance for prevention of disease and also antioxidant capacity evaluation in human body. Therefore the present study was spectrophotometrically done to optimize the measurement of poly phenol contents in blood serum based on Folin- Ciocalteu reagent. Methods: Blood samples (N=18) taken from male and females volunteers who were in fast condition. Having separated the serums, they were put in test tubes with different volume, ranged from 0.1 to 2 ml. Then 2.0 ml of Folin-Ciocalteu reagent (1/10 v/v dilution) was transferred into tubes and after 5 minutes, 8.0 ml of sodium carbonate (7.5 % w/v) was added and the samples were kept 2 hours in darkness. Finally the absorbance of the sample was spectrophotometrically read at 765 nm. The total phenol human level was then calculated based on standard curve of gallic acid. Results: O.D. Values in serum samples with volume more than 1.5 ml; showed the absorbance which were unacceptable to be read (>2). Whilst the optimized O.D. values (0.339 – 0.772) were related to samples with volume ranged from 0.1 to 0.2 ml. Conclusion: From this approach, it can be concluded that the most appropriate serum volume by which total phenol level in human can be determined is in the range of 0.1 to 0.2 ml.
Keywords: Total Phenol, Folin-Ciocalteu, Human Serum Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P115
P116
Prevalence of Vitamin D Deficiency in Patients Referred to a Laboratory Parsa
Amin Delavari 1 *, Mitra Pilehvar 2, Mis Banafshe Bizhani 1, Akram Valizadeh 1
1- Ahvaz Jundishapur University of Medical Sciences, 2- Ahvaz University of Chamran [email protected], [email protected], [email protected], [email protected]
Background: Vitamin D is one of the fat-soluble vitamins and essential for body. it can be synthesized by the human body through UV-mediated sunlight and food. This hormone has many important results on the diabetes, blood pressure and cancer.Vitamin D has other roles in the body, including modulation of cell growth. Vitamin D has the significant roles in the body including: regulating the concentration of calcium and phosphorus, modulation of cell growth and proliferation, cardiovascular effects, neuromuscular and safety effects. The objective of this study is to determine the prevalence of vitamin D deficiency in patients. Methods: In this cross-sectional study, samples were taken randomly from 350 of the patients referred to the laboratory on the second and third quarter of 1395. Venous blood sampling and the necessary information were taken from the patients with their permission. Serum levels of vitamin D were measured by ELISA method. Data were analyzed using SPSS software. Results: 89 of participating people (%25.5) were men and 261(%74.5) women. Women are more affected by the vitamin D deficiency than men. In this study 34% of people have severe deficiency, 33% has moderate deficiency and 17.5% has mild deficiency. Most of the deficiency in both two sexes was more at age 30-45. 44 people (37%) of these patients are affected by severe deficiency. Conclusion: The prevalence of low vitamin D status increases healthcare providers awareness in the community to take measures and to relieve the problem among the people.
Keywords: Lack of Vitamin D, Vitamin D Quantities, Laboratory Patients
168 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P117
In Vitro Study of Relationship between Rosmarinic Acid and Human Islet Amyloid Polypeptide Aggregation
Zary Jafari 1, Farzaneh Khalaji 1, Mahdi Aarabi 1, Mahammad Hosein Mirhashemi 1 *
1- Research Center for Biochemistry and Nutrition in Metabolic Diseases, Kashan University of Medical Sciences, Kashan, I.R. Iran [email protected], [email protected], [email protected], [email protected]
Human islet amyloid polypeptide called amylin is normally formed by pancreatic beta cell and co-secreted with insulin in to blood circulation. Recent data indicate that amyloid deposition is present in pancreas of more than 90% of diabetic patients. In this project relationship between Rosmarinic acid as a phenolic derivative of caffeic acid and amylin deposition was investigated, experimentally. Human amylin peptide and other substances were purchased from Sigma-Aldrich Company. Aggregation was induced by adding stock solution to PBS buffer, pH: 7.4, to a final concentration of 10 μM and incubating at 37oC for 192h. Rosmarinic Acid with concentrations of 10 and 40 μM were prepared in the peptide containing solution, separately. The solution without Rosmarinic Acid was selected as control. To monitor the peptide precipitation Thioflavin T fluorescence assay was performed. The results have shown as Mean ± SD and differences were statistically significant at p<0.05.Data indicated that at zero time, ThT-fluorescence mean value for control group was 34.02 which at 192 h had increased to mean value of 51.07 (P<0.05). In Rosmarinic acid treated groups, ThT fluorescence assay indicated that, 10 and 40 μM of Rosmarinic acid inhibited amyloid formation by 18.6 and 19.2% respectively (P<0.05). Rosmarinic acid did not show dose dependent effect (P>0.05).This research expressed that Rosmarinic Acid inhibited amylin aggregation and deposition in vitro (p<0.05). It may be concluded that if amylin precipitation had toxic effects on pancreatic beta-cells, these effects may be reduced by using Rosmarinic Acid supplements.
Keywords: Diabetes Mellitus, Amylin, Rosmarinic Acid, Amyloidogenesis
P118
Determining the Effects of Curcumin on Polymerization of Human Amylin Hormone under Experimental Conditions
Farzaneh Khalaji 1, Zary Jafari 1, Mahammad Hosein Aarabi 1, Mahdi Mirhashemi 1 *
1- Research Center for Biochemistry and Nutrition in Metabolic Diseases, Kashan University of Medical Sciences ,Kashan ,I.R. Iran [email protected], [email protected], [email protected], [email protected]
Introduction: Islet amyloid formation causes destruction of insulin-producing β-cells of the pancreas. The subsequent lack of insulin leads to increased blood and urine glucose. In this research, the effects of curcumin as the active component of the nutritional spice turmeric on amylin polymerization were studied under experimental conditions.Materials and Methods: Human amylin peptide and other substances were purchased from Sigma-Aldrich Company. Peptide stock solution was prepared by adding 1 ml dimethyl sulfoxide and was diluted to a final concentration of 10 μM with PBS, pH: 7.4. Curcumin with concentrations of 10 and 40 μM were prepared in the two separate groups. The samples without curcumin were selected as controls. All samples were incubated at 37oC for 192h with shaking. To monitor the peptide polymerization, Thioflavin T (ThT) assay was performed. The results have shown as Mean ± SEM. Means comparison were carried out using t-test and differences are statistically significant at p<0.05.Results: Data indicated that at zero time, ThT-fluorescence mean value for control group was 34.02 which at 192 h had increased to mean value of 51.07 (P<0.05). Compared to control group, ThT-fluorescence was decreased significantly in the presence of 10 and 40 μM of Curcumin by17.3% and 29.9%, respectively (P<0.05).Discussion: This research expressed that curcumin inhibited amylin polymerization, significantly in a dose-dependent manner (p<0.05). It may be concluded that toxic effects of amylin precipitation on pancreatic beta-cells should be decreased by curcumin supplementations.
Keywords: Amylin, Diabetes, Herbal Compounds, Polymerization
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 169 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P119 Comparison of Conventional Reference Method with New Direct Assay of Total Iron Binding Capacity (TIBC)
Amirhosein Khoshi 1 *, Shadi Sharifi 1, Mohammad Javadzadeh 1, Ali Sherafatnia 2, Reza Ghorbani 2, Elham Sharifian 3
1- Department of Molecular Sciences, School of Medicine, North Khorasan University of Medical Sciences, Bojnurd, Iran, 2- Clinical Laboratory of Emam Reza Hospital, Bojnurd, Iran, 3- Department of Social medicine, School of Medicine, North Khorasan University of Medical Sciences, Bojnurd, Iran [email protected], [email protected], [email protected], [email protected]
Introduction: Total iron binding capacity (TIBC) assay is important investigation of body iron state. One of the common methods is conventional reference method with adding of iron to serum as pre-analysis step. New diagnostic approaches for TIBC direct assay are suggested to simplicity and reducing the time of analysis. Then, the aim of study was comparison of accuracy and precision of TIBC direct assay with conventional method. Methods: Under standard laboratory condition, twenty-five serums of referred individuals to clinical laboratory were randomly selected and analyzed as triplicate by two methods. To investigation of analytical accuracy and precision, the assayed serum controls were used for within-run and between-run precision analyses. Results: There was not significant difference between individuals serum TIBC, statistically (P=0.25); however, there was more differences between serum TIBC that analyzed by conventional method. To investigation of within-run precision, the mean and coefficient variation (CV%) in reference and direct assays were 316.2±19.4 (6.1%) and 305.9±8.07 (2.6%), respectively. In addition, to investigation of between-run precision, the mean and coefficient variation in reference and direct assays were 327.4±45.3 (13.8%) and 325.8±25.8 (7.9%), respectively. However, there were not significant differences in within/between run precisions of both methods (P=0.53). Conclusion: The results of present study have shown that despite of allowable accuracy and no significant differences between reference and direct methods of TIBC measurement, because of lower standard deviation and CV%, and also simplicity of direct assay than reference method, it could suggest the replacement of TIBC direct method instead conventional reference method.
Keywords: Total Iron Binding Capacity, Conventional Reference Method, Direct Assay Method, Within-Run Precision, Between-Run Precision, Accuracy
P120
Circulating Resistin in Ulcerative Colitis, Relation with Anthropometric, Body Composition and Inflammatory Parameters
Behrooz Motlagh 1 *, Nasim Abedimanesh 2, Alireza Ostadrahimi 2
1- Zanjan University of Medical Sciences, 2- Tabriz University of Medical Sciences [email protected], [email protected], [email protected]
Background: Chronic inflammation, altered body composition and development of abdominal obesity are distinct characteristic of Inflammatory bowel diseases (IBDs). Resistin, a white adipose tissue-secreted protein, play an important role in metabolism and inflammation. Aim: To evaluate serum resistin in ulcerative colitis (UC) and healthy controls and its association with anthropometric, body composition, inflammatory parameters and clinical disease activity inUC. Methods: Fifty UC patients and 43 healthy age and sex matched participants were recruited for the study. Clinical disease activity of UC patients was determined according to the Powell-Tuck activity index. Anthropometric parameters and body composition were assessed in UC patients. Serum resistin, hs-CRP and white blood cell (WBC) count were evaluated, too. Univariate and multivariate regression analyses used to determine the association between parameters. Results: Patients BMI (24.76±5.08) and fat mass (20.21±9.86) were similar in comparison to controls, respectively (P=0.102 and P= 0.406). Serum resistin levels were significantly increased in UC patients compared with controls (P= 0.004). It was correlated with disease activity scores(P= 0.016), hs-CRP levels (P= 0.009) and fat mass (P= 0.023) in UC patients but not with anthropometric factors and lean body mass. Results have showed that the most sensitive independent predictors of resistin among patients with UC were inflammatory parameters (P=0.015). Conclusion: We found elevated levels of resistin in mild to moderate UC patients compared to healthy subjects. It was strongly correlated with inflammatory parameters but not anthropometric factors and body composition.
Keywords: Resistin, Body Composition, Inflammation, Anthropometry
170 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P121
Evaluation of Serum Levels of Beta-Microglobulin in the Peripheral Blood of Patients with Rheumatoid Arthritis in Hajar Hospital of Shahr-e-Kord
Ghadir Tavakoli Hafshejane 1 *
1- Department of Internal Medicine, Shahrekord University of Medical Sciences, Shahrekord, Iran [email protected]
Introduction: Rheumatoid Arthritis (RA) as a CD4 + T cell-mediated immunity is impaired and considered as a group of acquired immune system cells. Beta 2 Micro Globulin (B2MG) is a serum protein with low molecular weight which is derived from the cell membrane and is the light chain constant part of human leukocyte antigen class I complex. Methods: In this study, 32 healthy subjects as controls for 8 patients witness. Blood samples were taken from healthy serum test and were stored at -20 till the test day and then, provided with the kit Abnova Company made in Taiwan were measured. Conclusion: Since the number of Th17 cell differentiation pages and peripheral blood mononuclear cells compared to control increases, the Beta 2 Micro Globulin (B2MG) in rheumatoid Arthritis patients increased in comparison with healthy subjects increased.
Keywords: Rheumatoid Arthritis, Beta Two Micro Globulin (B2MG), Th17
P122
Comparison of Plasma Nitric Oxide Levels in Radiologist Subjects of Government Radiology Centers in Hamedan and Non-Radiologist Individuals
Mohammadreza Safari 1 *, Masoud Karimi 1, Zahra Kokabian 1, Momeneh Eftekhari 1, Fatemeh Tayebi 1, Mohammad Taheri 1
1- School of Paramedicine, Department of Laboratory Sciences Hamadan University of Medical Sciences [email protected], [email protected], [email protected], [email protected], [email protected] [email protected]
Objective: The variety of levels in Plasma oxide nitric displays the key role in atherogenesis, carcinogenesis and infected diseases. In this study, the plasma nitric oxide levels were measured in radiologists and non-radiologists. Material and Methods: The present study was undertaken in 80 radiologist and 80 non-radiologists that the age and sex matched healthy volunteers and work in radiology centers of Hamadan hospitals. Their venous blood samples were collected and separated the plasma fractions. Then, the plasma nitric oxide levels were measured by Griess method and the data analyzed by statistical analysis. Results: Results showed that the plasma nitric oxide levels in radiologists (21.16 ± 1.14mmol/L) increased in comparison with non-radiologists subjects (17.24± 0.48 mol/L) with P<0.05 significance. Conclusion: The present results suggest that the plasma nitric oxide levels in radiologists were higher that non-radiologists. Therefore radiologists have more sensitivity to the risk from various of plasma nitric oxide levels.
Keywords: Nitric Oxide, Radiology
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 171 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P123
Prenatal Effect of Electromagnetic Fields on ALT and ALP Enzymes in Adult Male Rats
Hamideh Gharamaleki 1 *
1- Department of Anatomical Sciences, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz-Iran [email protected]
Objective: Electromagnetic fields (EMF) in this environment are mostly contributed by around electric power generating stations, high voltage distribution lines and electric appliances. Detrimental effects of EMF, 50-60 Hz have been notified during the last few decades in biological systems. There are only a few publications on prenatal effects of EMF on alanine aminotransferase (ALT) and Alkaline phosphatase (ALP) as suitable prognostic indicators of liver dysfunction in F1 generation, therefore the aim of the present study was to evaluate the effect of EMF exposure during developmental period on ALT and ALP levels in male adult rats. Method and Material: In treatment group pregnant Wistar rats were exposed 3mT, EMF for 21 days, 4 hours per day. Pregnant rats under same condition of treatment group, but off the field as a sham group intended and pregnant rats were used as control in the room. After delivery, the male pups (F1 generation) were kept until maturity, then blood samples from each three group for biochemical analyze provided. Results: Biochemical analysis showed that serum levels of ALT and ALP was significantly increased (P<0.05) in the treatment group in comparing with the control group, but no found significantly difference between control with sham group. Conclusion: Significant increase in ALT and ALP activity indicates the cytotoxic effect of non-ionizing radiation on hepatocytes inducing apoptosis, necrosis and cell damages. This changes are representative of damage to the liver tissue can effect on health of organisms.
Keywords: Electromagnetic Field, ALT, ALP, Prenatal
P124
Evaluation of Lipoprotein A and Its Association with Cardiovascular Disease Risk in Women with Subclinical Hypothyroidism
Hassan Mohajery Shahrebabki 1 *, Elham Zarei 1, Fatemeh Aliakbari 1, Sharabeh Hezarkhani 2 , Azadreza Mansourian 3
1- Metabolic Disorders Research Center , Student Research Committee, Golestan University of Medical Sciences, Gorgan, Iran, 2- Department of Internal Medicine-Golestan University Of Medical Sciences, Gorgan, IRAN, 3- Metabolic Disorders Research Center, Golestan University of Medical Sciences, Gorgan, Iran [email protected], [email protected], [email protected], [email protected]
Background and Objective: Subclinical Hypothyroidism (SCH) is defined as high levels of TSH and normal levels of free-T4. Cardiovascular Disease (CVD) risk was shown to be higher in people with SCH. Also, lipoprotein (Lp-(a)) was indicated as one of the independent risk factors of CVD. Present study aimed to investigate Lp-(a) levels and its association with CVD risk among women with SCH. Methods: Present case-control study was done on 40 women with SCH and 40 healthy women that were matched based on age and BMI. Serum levels of TSH, T3, T4, free-T3, free-T4 and Lp-(a) were measured. Then the results were compared between the two groups and correlations were investigated. Results: TSH levels were significantly higher in SCH group than the healthy people. Also, Lp-(a) levels were higher in patients that were not significant. Lp-(a) showed inverted and sensible correlation with T4 and fT4 in SCH group. Dyslipidemia occurrence (57.8 % in patients) and CVD risk (58.3 % in patients) were not significant in any groups. Conclusion: Lp-(a) levels were independent of SCH occurrence; however, based on evidences, thyroid hormones could affect Lp-(a) metabolism. According to studies, because of age raise is accompanied by increasing of SCH occurrence, study results could be affected based on wide range of study subject ages.
Keywords: Subclinical Hypothyroidism, Lp-(A), Cardiovascular Disease (CVD) Risk
172 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P125
The Optimum Concentration of L - Carnitine to Reduce Bacterial Contamination in Platelet Concentrates
Zahra Velashjerdi 1 *, Mohammadreza Deyhim 2
1- Islamic Azad University, Science and Research, 2- High Institute for Research and Education in Transfusion Medicine [email protected], [email protected]
Introduction: Standard condition for storage of platelets at temperature of 22C° for5day. The temperature suitable for bacterial growth during storage. The gradual loss of quality in stored platelets as measured collectively with various metabolic, functional, and morphologic in vitro assays is known as the platelet storage lesion in this study the best concentration L-carnitine as an additive to reduce bacterial contamination in platelets was investigated for first time. Aim: By adding different concentrations of L-carnitine to platelets. The best concentration to reduce bacterial contamination and main the quality of platelets was determined. Material and method: This study was performed on 5bags containing platelets and each bag was vided into five equal parts. A negative control group and positive control Group (containing staphylococcus epidermidis)was considered and other groups contained platelets and bacteria suspension and different concentration of L-carnitine (20,50,100mmol).Then the groups were sampled on consecutive days and cultured on blood agar medium and they were incubated for 24h at 37C° and the growth of bacterial in the case control groups were compared. Result: The growth of bacteria on plates containing L-carnitine 50 mmol, compared to the positive control group and other groups had a significant decrease. It was found that the concentration of 50mmol L-carnitine has the best effect on platelet metabolism. Conclusion: L-carnitine 50mmol as a platelet additive solution improve metabolism and L-carnitine can reduce platelet contamination by staphylococcus epidermidis.
Keywords: L-Carnitine, Platelet Contamination, Platelet Concentrate
P126
Study of Neonates Hypothyroid Screen During Last 9 Months Year 1394
Hosein Mojabi 1 * , Fatemeh Najafi 1 , Reza Eslami 1 , Maryam Azimi 1 , Zohreh Taheri 1, Samira Parhizgar 1 , Fatemeh Taherkhani 1 , Mahin Mirza Babaii 1
1- Qazvin U.M.S, Central Health of Shahid Bolandian [email protected], [email protected]
Study of neonates hypothyroid screen during last 9 mounths year 1394in province of Qazvin.Neonatal congenital hypothyroid is a clinical syndrome due to decay in thyroid hormone. Some defects that result in this disease are anatomical deficiency of thyroid gland, iodine deficiency of thyroid gland, iodine deficiency and congenital metabolic deficiencies of thyroid. Regard to side effects as mental retardation and cretinism, screening program began in Qazvin since in last 6 month we tested 9598 newborns samples taken from Qazvin, Takestan, Booeen-zahra and Abyek. In this cross- sectional prospective Study neonatal TSH (thyroid Stimulation Hormone) test Using ELISA method, with two antibodies, simple antibody and antibody with peroxidase as a Marker. Blood Sampling Was taken from newborns foot heel, 72 hours after birth on gutery 303 Paper. Kits were prepared from reliable corpotations by reference laboratory approval .Results analysed by SPSS soft ware. From 9598 cases 9200(95.85%) were normal, 358(3.73%) were doubt. Doubted results rechecked by vein blood. Finally 22(0.23%) definitely positive . In the other word 2.3 from 1000 newborns are involved in congenital hypothyroid .According to findings , prevalence of hypothyroid in Qazvin is higher than the country’s mean this (about 2 folds ).this recognize in test importance , personal expertness and correct sampling , more than previous.
Keywords: Screening, Hypothyroid Qazvin, Neonatal TSH
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 173 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P127
Evaluation of ‘CKD-EPI Pakistan’ Equation for Estimated Glomerular Filtration Rate (eGFR) Using Serum Creatinine: an Experience from Pakistan
Sibtain Ahmed 1, Lena Jafri 1 *, Aysha Habib Khan 1
1- The Aga Khan University Karachi [email protected], [email protected]
Introduction: National Kidney Disease Education Program strongly suggests reporting estimated glomerular filtration rate (eGFR) when serum creatinine (Cr) is measured and reported by laboratories. The aim of this study was to evaluate the results of 24 hours urinary creatinine clearance (CrCl) with eGFR using the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI), CKD-EPI Pakistan (CKD-EPI Pak), Cockcroft Gault (CG) and 4-variable Modifications of Diet in Renal Disease (MDRD) equations. Methods: Laboratory data of subjects ≥ 18 years ordering 24 hour urinary CrCl from June to October 2013 was retrieved. Statistical comparison of eGFR using CKD-EPI, CKD-EPI Pak, CG and MDRD with the timed urine collection CrCl was done using regression analysis.Results: Mean age of the group (n=670) was 51.3 ±15.4 years, 55.7 % being males. Mean BMI of males and females was 27.8 ± 13 kg/m2 and 27.6 ±5.8 kg/m2 respectively. Mean GFR using 24 hours creatinine clearance was 57.1 ± 35.9 ml/min/1.73m2. Urinary creatinine clearance showed strong correlation with CG, MDRD, CKD-EPI and CKD-EPI Pak r=0.7, r=0.7, r= 0.82, and r= 0.83 respectively. Sensitivity was highest for the CKD-EPI Pakistan (84.7%). Similarly CKD-EPI Pakistan equation showed the highest agreement (88.7%) with CrCl compared to the other formulae. Conclusion: The CKD-EPI Pak equation is more accurate and precise than the CG, CKD-EPI and MDRD in estimating GFR in Pakistani population.
Keywords: GFR, Creatinine, Cockcroft Gault, Modification of Diet in Renal Disease, CKD-EPI
174 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
New Findings in Laboratory Diagnostics: Immunology and Serology P128 – P141
P128
Immunogenicity Increases Following DNA Vaccination with Cocktail of LeIF, LACK and TSA Genes against Cutaneous Leishmaniasis
Nahid Maspi 1 *, Fatemeh Ghaffarifar 1, Abdolhossein Dalimi 1
1- Department of Medical Parasitology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran [email protected], [email protected], [email protected]
Objectives: In this study, we evaluated the protective effects of DNA vaccine containing LeIF, TSA and LACK genes alone or cocktail of them against cutaneous leishmaniasis. Material and Methods: Immunization was done intramuscularly three times and with interval of 3 weeks with 100 µg of each plasmid DNA containing the gene. Phosphate buffer saline and empty vector were used as control groups. Then, mice were infected with 2 × 106 L.major promastigotes in stationary phase. We evaluated cellular and humoral immune responses and lesion size before and after the 4-weeks challenge. Results: all immunized mice showed partial immunity in comparison with control groups. However, cocktail group indicated stronger immune responses characterizing by high levels of IgG2a and IFN -γ and low levels of IL-4 and IgG1 compared with each gene alone. In addition, mean lesion size decreased in cocktail group rather than each gene alone. Conclusion: The results indicated that the use of combination of three antigens can induce more potent immunity and acts a more effect vaccine candidate against leishmaniasis in comparison with one gene alone.
Keywords: Leishmania, Vaccine, Immunization, LeIF, LACK, TSA Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P129
Multiplexed Microarrays Based on Optically Encoded Microbeads
Azin Rostami 1, Atieh Vafajoo 1 *, Sanam Foroutan 1, Mohammad Rabiee 1
1- Department of Biomedical Engineering, Amir Kabir University of Technology [email protected], [email protected], [email protected], [email protected]
In recent years there has been a growing interest in using encoded functionalized microbeads as a solid support to capture proteins or nucleotides which act as disease biomarkers. Multiplexing technologies (suspension array and planar array) based on optically encoded microspheres make the observation of small changes related to specific diseases possible. Identifying the small alterations corresponding to an incurable disease provides the ability to detect disease in early stages. As the accuracy of current diagnostic methods to predict some diseases is generally quite low, multiplexed assays based on optically encoded microbeads can play a key role in detecting the biomarkers of disease in an invasive and accurate way. However, detection system based on functionalized encoded microbeads is an emerging technology and more researches need to be done in the future. This review paper is a preliminary attempt to collect all necessary data around microbeads; from microsphere composition, synthesis and encoding methods to detection systems based on microbeads and applications.
Keywords: Microbeads, Encoding, Multiplexing Technologies, Early Diagnosis
P130
Determination of Helicobacter Pylori Antigen in Stool Samples and Comparison with the Urease Test in Patients Suspected of Helicobacter Infection
Reza Marvinam 1, Fatemeh Zare 1, Mehdi Dehghan-Manshadi 1, Hossein Hadinedoushan 1 *
1- Shahid Sadoughi University of Medical Sciences, Yazd, Iran [email protected], [email protected], [email protected], [email protected]
Introduction: There are several invasive and non-invasive methods for diagnosis of Helicobacter pylori (H.Pylori) infection. The main objective of this study was to evaluate antigen of H. Pylori in feces with H. pylori stool antigen test and comparison with rapid urease test in patients suspected to be infected. Material and Methods: 137 patients (56 males, 81 females) were recruited from those patients undergoing a gastrointestinal endoscopic examination in the endoscopy units of Shahid Sadoughi University of medical sciences. Endoscopy was performed under intravenous sedation and endoscopic findings were recorded. One biopsy specimen was taken from the stomach and each biopsy specimen per subject was tested for the presence of urease using the commercially available CLO test. Stool specimens were taken concurrently with the endoscopic examination and tested with an ELISA kit for presence of H.Pylori stool antigen (HpSA). The gold standard in this study was urease test. Results: The mean age was 40.4 ±1.12 years. 13.3% of our patients result were shown HpSA-positive and negative urease test and 12.9% were shown HpSA-negative and positive urease test. Sensitivity was 86.6% with HpSA test and specificity was 87.1. Positive and negative predictive values and accuracy were 89%, 84.3%, 86.2% respectively. Conclusion: The stool enzyme immunoassay for H. pylori is a useful method for the primary diagnosis of H. pylori in patients. It delivered sufficiently accurate results and showed itself to be a suitable and cheaper alternative to invasive tests, thus the test seems suitable for both epidemiological studies and clinical purposes.
Keywords: Helicobacter Pylori, Stool Antigen Test, Urease Test
176 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P131
Detection of Hepatitis Virus (HBV and HDV) Infection by ELISA and PCR Methods among Clinical Laboratory in Mashhad City
Mahbobeh Taghavi 1 *, Abbas Amin 2, Eissa Soleymani 1, Sanaz Birjandi 3
1- Department of Parasitology and Mycology, Mazandaran University of Medical Sciences, Sari, Iran, 2- Department of Parasitology and Mycology, Zanjan University of Medical Sciences, Zanjan, Iran, 3- Department of Molecular and Cellular Biology, College of Science, Tehran University, Tehran, Iran [email protected], [email protected], [email protected], [email protected]
Introduction: Hepatitis virus (HBVand HDV) are worldwide public health problem. Hepatitis B and Care two potentially life threatening liver infections. The aim of this study patients are tested by serological kits based onenzyme-linked immunosorbent assay (ELISA) and Polimerase Chain Reaction (PCR). Methods: This study was conducted from March 2014 till November 2016 among clinical laboratory in Mashhad City. Patients were tested for anti-HCV antibodies and hepatitis B surface antigen (HBsAg) by ELISA and PCR. RESULTS: The overall 340 patients had an ELISA test positive for HBV, 303 (89.11%) were found to be positive for HBsAg by PCR. In addition 37 (10.88%) had a negative result by PCR. Of the total 113 patients had an ELISA test positive for HCV, 98 (86.72%) were found to be positive by PCR for HCV infection in addition 15 (13.27%) had a negative result by PCR.CONCLUSIONS: The present study provides the preliminary information between the ELISA and PCR methods for Detection hepatitis virus (HBVand HDV) infection. We found, the high-sensitive methode was PCR.
Keywords: Enzyme-Linked Immunosorbent Assay (ELISA), Polimerase Chain Reaction (PCR), HBV Infection, HCV Infection
P132
Evaluation of Serum Levels of IL-22 in Peripheral Blood of Patients with Rheumatoid Arthritis among Patients out of the Hajar Hospital
Ghadir Tavakoli Hafshejane 1 *
1- Department of Internal Medicine, Shahrekord University of Medical Sciences, Shahrekord, Iran [email protected]
Introduction: Rheumatoid Arthritis (RA) as a CD4 + T cell-mediated immunity is impaired and considered as a group of acquired immune system cells. CD4 + T cell subsets play an important role in the pathogenesis of rheumatoid arthritis not only patients, but also most patients of their safety. Th17 cells, IL-17 and IL-22 can simultaneously produce control IL- 23. Method: In this study, 32 healthy subjects as controls for 8 patients witness. Blood samples were taken from healthy serum and were stored at -20 till the test day and then, provided with the kit Abnova Company made in Taiwan were measured. Conclusion: Since the number of subset Th17 cell differentiation pages and peripheral blood mononuclear cells compared to control increases, the amount of IL-22 in patients with Rheumatoid Arthritis increased in comparison with healthy controls.
Keywords: Rheumatoid Arthritis, Th17, IL-22
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 177 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P133
The Effect of Medication on Oxidative Stress and Sperm Parameters of Infertile Men with Chlamydia Trachomatis Infection Referred to Royan Institute
Reza Azmakan 1 *, Reza Salman Yazdi 1, Faramarz Farahi 1, Seyyed Kazem Bidoki 2
1-Department of Andrology, Reproductive Biomedicine Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran, 2- Payame Noor University, Tehran [email protected], [email protected], [email protected], [email protected]
Sexually Transmitted Diseases (STDs) are known as major public health problem in the world. Bacterial agents such as Chlamydia Trachomatis (CT), Neisseria gonorrhoeae, Mycoplasma genitalium and Treponema pallidum are the cause of sexually transmitted diseases. Chlamydia trachomatis infection is often mentioned as a silent disease because in most cases there are not evident symptoms. Complications of this infection are infertility and ectopic pregnancy in women and epididymitis in men. More than 50 percent of women and 80 percent of men with chlamydia infection do not Show any signs.The role of CT infection in decreased sperm motility, increased sperm abnormalities, reduced sperm concentration, viability and increase leukocytospermia has been approved. ROS includes oxygen ions, free radicals and peroxides which are produced by leukocytes and sperms in the semen. In this study, infertile men showing positive result of CT by NESTED PCR method comprise our statistical population. After selecting samples based on the mentioned criteria, the Chlamydia trachomatis IgA antibodies in semen were measured by ELISA and confirmed by NESTED PCR.The amount of ROS was determined in semen of CT positive samples patients by Chemiluminescence. These people were referred to the urologist and after treatment, sperm parameters, CT infection and ROS levels were assessed again. To analyse the results statistical nonparametric test Wilcoxon were used. The results indicated that CT infection and sperm parameters are associated with rate of ROS in infertile men. Nevertheless upon treatment, ROS value dropped allowing the recovery of certion sperm parameters.
Keywords: Oxidative Stress, Reactive Oxygen Species, Chlamydia Trachomatis, Spermatogenesis, Apoptosis
P134
Sero Epidemiology Infectious Factors Torch in Women in Gorgan City between 2013 2015
Mojtaba Pourmomen *, Alijan Tabarraei, Hamidreza Pordeli
[email protected], [email protected], [email protected]
Introduction: The Torch tests are using for screening of at least 4 types of infectious diseases, these infectious factors in mothers during pregnancy can infect the infant during birth and they cause serious abnormality in a fetus. The Purpose of this study was checking the history of suffering or current infection with Rubella, Toxoplasmas, Cytomegalovirus and Herpes simplex virus in women in purpose of pregnancy in Gorgan. Methods: Blood samples were taken from 318 people between 18 and 42 years. Their serum used for recognizing Toxoplasmosis, Cytomegalovirus and Herpes simplex viruses antibodies by Elisa method by use of Orgentec, Euroimmun and Pishtaz teb clinical diagnostic instruments. Results: The positive results were acquired respectively, in the group under 28 years and above 28 years, IgG Toxoplasma antibody (%38.8), (%61.2), IgM Toxoplasma antibody (% 0), (% 100), Rubella IgG antibody (%49.7), (%50.3), Rubella IgM antibody (%0), (%100), IgG Cmv antibody (%49.0), (%51.0), IgM Cmv antibody (%33.3), (%66.7), Hsv IgG antibody (%46.2), (%53.8) and Hsv IgM antibody (%0), (%100). Conclusion: With changing the age, except for Anti Toxoplasma IgG, the other parameters were statistically no significant difference between the two age groups, but the positive Anti Toxoplasma IgG in the people over 28 years were more than people under 28 years old that have similarity with the others studies.
Keywords: Torch, Rubella, Toxoplasmas, Cytomegalovirus, Herpes Simplex
178 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P135
Evaluation of the Use of Blood and Blood Products in the Hospital Yahyanejad Babol
Mojtaba Mehdipourmir 1 *, Roholah Shaban 1, Norozali Nori 1, Reza Razghnia 2, Parvin Hasanjanzadeh 3
1- Hospital Yahyanejad, Babol University of Medical Sciences, 2- Laboratory, Department of Medical Sciences, Babol, 3- Midwifery, Department of Health, University of Medical Sciences, Babol [email protected]
Introduction: Get too much blood stored in blood banks and hospitals to reduce waste and increase the costs in blood banks and hospitals to be climbed. Study to evaluate the use of blood and blood products in the hospital was Yahyanejad hospital. Materials and methods: Descriptive study on 549 blood order forms in the third quarter of 1395 from the hospital blood bank. See application form by form hmovijalance monitoring of blood transfusions in the second quarter of 1395 of hospital blood banks have been collected and were analyzed with SPSS software. findings Blood from 549 applications, 45.7% male and 54.3% female, 99.8% Bvd.mtvst number given to a patient Bvd.nsbt C/ T to 1.The most requested blood- related emergency 208 units (38%)department 80 units (14.6 %) ICU80 units (14.6%) of operating room 61 units (11.1%) heart 54 units (9.9%) infected 43 units (7.8%) maternity midwifery 22 (4%), respectively. Most causes of ordering chronic anemia of patients with cancer and hospitalized in sections (72%), GIB (15.5%), surgical 5%, 2.5% and others 5% of the underlying disease. Result: The results of this study show that compared with other centers the amount of blood to the question is one. Which reflects the actual blood reserve is in the hospital. Good reasons this study seems to be more related to the training of nurses, the continuous presence of senior doctor hmovijalance, operation orders blood donors, blood banks and clinical departments of internal audit, continuous formation Banking Committee blood, negative blood group bookings by base blood transfusion.
Keywords: Blood Bank, Hemovijalance, Yahya Nejad Hospital
P136
Isolation and Culture of Mesenchymal Stem Cells from the Bone Marrow of Balb/C Mice
Hossein Rezvan 1 *, Sahar Hamoonnavard 1, Roya Abedizadeh 1
1- Department of Pathobiology School of Veterinary Science Bu-Ali Sina University Hamedan, Iran [email protected], [email protected], [email protected]
Background: Bone marrow mesenchymal stem cells with multiple features are isolated and cultured in the laboratory for cell therapy. This study expresses how to isolate these cells from the bone marrow of Balb/c mice, due to the ease of separation of these cells in other mammals except Balb/c mice. Materials and Methods: After anesthetizing the Balb/c mice, femur and tibia bones were removed and kept in medium, containing antibiotics for 15 minutes. After harvesting the cells were cultured in T25 flasks and cell media was replaced every 24 hours for 72 hours. Cells were cultured at the end of the seventh day (to the third passage). To confirm the cells were differentiated into two classes (bone and fat cells). The cells were investigated to express markers (CD 90, CD44, CD73, and CD105) and lack of hematopoietic markers (CD34, CD45). Results: With this method, cells are easily isolated from mouse bone marrow and were differentiated to fat and bone cell lines. On the other hand, the expression of CD90, CD44, CD73 and CD105 markers of mesenchymal stem cells are 74%, 79%, 86% and 81%, respectively. And the markers CD34 and CD45 are related to hematopoietic cells; 8.7% and 0.28%, respectively. Conclusion: The results suggest that cells obtained by this method are mesenchymal stem cells.
Keywords: Isolation, Bone Marrow, Balb/c Mice
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 179 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P137
The Serological Study of Toxoplasma Gondii Infection in Schizophrenia Inpatients in Mashhad, Iran
Bahareh Meftahi Molayaghoub 1 *, Gholam Reza Razmi 1, Ebrahim Abdollahian 2, Ahmad Nematollahi 3, Najmeh Shahini 2
1- Department of Pathobiology, Faculty of Veterinary Medicine, Ferdowsi Univercity of Mashhad, 2-Psychiatry and Behavioral Sciences Research Center, Ibn-e-Sina Hospital, Faculty of Medicine, Mashhad University of Medical Sciences, 3- Department of Pathobiology, Faculty of Veterinary Medicine, University of Tabriz
[email protected], [email protected], [email protected], [email protected], [email protected]
Schizophrenia is a major psychiatric disorder with unknown etiology. This disease often described with positive -delusion and hallucination- and negative -flat affect and social withdrawal- symptoms. Studies have shown Toxoplasma gondii congenital infection can play a role in developing schizophrenia in adulthood. The aim of this study is to evaluate the serofrequency of T.gondii infection in schizophrenic patients. In this cross sectional study, the blood samples were collected from sixty (29 female and 31male) inpatients of Ibn Sina and Dr Hejazi hospitals in Mashhad, Iran, after obtaining written informed consent from parents of patients, during June to November 2016. Then, sera were separated from samples and measured the level of IgG antibodies against T.gondii by enzyme-linked immunosorbent assay (ELISA). The Chi-Square test was used for statistical analysis of data. In total, of 60 schizophrenic patients, 33(55%) of them were T.gondii seropositive, that detected 50% and 60% infection in female and male respectively. The highest seropositivity observed (83%) in the group of patient with 60-70 years old and the lowest (30%) was of the age group with 20-30. The infection rate of 21 patients with positive symptoms were 57%, and 54%were about 39 patients with negative symptoms. Statistical analysis did not show any significant difference in T.gondii infection with age, sex and schizophrenia symptom factors. (p>0.05) According to Toxoplasma seroprevalence (in an average 33%) in the general population, the present study reported high frequency of Toxoplasma-positive in schizophrenia patients, whereas did not observe any significant correlation between socio-demographic and clinical symptoms with T.gondii infection.
Keywords: Toxoplasma Gondii, Schizophrenia, IgG T Gondii, ELISA
P138
Procuction of Software Program for Neubauer Slide
Mitra Shaghaghi 1 *, Kimya Rezaei 1
1- Farzangan1 High school [email protected]
Neubauer slide for white and red blood cell count is used. Personalized medicine and stem cell biology and cell in use of the design and construction of the project aim convenience and easy access for everyone and everywher MATLAB is a programming language project. The relatively high level of academic language and very functional. How it works is this program. Which is saw as a microscope slide is and post-processing to our program and delete unnecessary information (dead cells) and averaged counting and announcement of results as percentages do. (Number of cells / 5 * 2 * 10000) The difference between dead and live cells also means painting it with color (Trypan blue) and to separate the cells from each action is realized done Pyptazh.
Keywords: Neubauer, White and Red Blood, MATLAB, Cell Count
180 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P139
Evaluation of IgG Avidity ELISA Test for the Diagnosis of Acute Toxoplasmosis in Human
Amirhossein Rahbari 1 *
1- Ayatollah Bahari Hospital, Hamedan University of Medical Sciences [email protected]
Introduction and Objectives: Toxoplasma gondii is one of the most prevalent parasitic infections of human and other warm blooded animals. It is important to determine the stages of toxoplasmosis in both pregnant women and immunocompromised individuals. This study was performed for determining of acute toxoplasmosis by IgG avidity ELISA. Methods: One hundred serum samples were collected from different laboratories in Tehran and tested for the detection of anti-Toxoplasma IgG and IgM antibodies with indirect immunoflurescent antibody test (IFAT). The IgG avidity ELISA test was performed in duplicate rows of 96 well microtiter plates, one row was washed with 6M urea and the other with phosphate buffer saline (PBS.pH 7.2), and then the avidity index (AI) was calculated.Results Sixteen out of 18(88.9%) sera with acute toxoplasmosis showed low avidity levels (AI≤50) and 76 out of 82(92.7%) sera in chronic phase showed high avidity index (AI>60). Six sera had borderline ranges of AI. Conclusion: The IgG avidity ELISA could distinguish the acute and chronic stages of toxoplasmosis.
Keywords: Toxoplasmosis, IgG Avidity, ELISA, Acute, Chronic, Human
P140
Serological Estimation of Prevalence of Chlamydia Trachomatis Infection in Asymptomatic Women of Age Group (20_45 Yrs) by ELISA & Indirect Immunofluorescent (Iift) Method in Zanjan
Azra Tofighi 1 *, Noor Amir Mozaffari 2, Sousan Alaie 3, Ahmad Jalilvand 4, Nooredin Moosavi-Nasab 1
1- Zanjan University of Med- Science, 2- Microbiology Department of Iran University of Med- Science, 3- Pathology Department of Zanjan University of Med- Science, Vienna Breast Cancer Reaserch Center, 4-Pathology Department of Zanjan University of Med- Science- Zanjan University Zanjan University of Med- Science [email protected], [email protected], [email protected], [email protected], [email protected]
STD. The most infected womenare asymptomatic. Untreatd women can develop PID, infertility, and transmit the infection. Screening of these women for C.trachomatis important in social health care. The main aim of this sero – epidemiologic study is determination of prevalence in asymptomatic women (20- 45 yrs.) by ELISA & IIFT in Zanjancomparing the ELISA with IIFT as a gold standard. Method: ELISA test based on purified MOMP antigen, for detection of anti chlamydia trachomatis specific IgG and done in serum of 222 asymptomatic women attending to Vali`asr hospital. Results: By ELISA, 8.6% of 222 asymptomatic women and by IIFT 7.2 % of them were seropositive. Mean age of the study group was 33.23 and the mean age ofseropositivewas 32.06 .There was no statistically significant differences in prevalence rate of infection between the age groups. , number of gravidity, abortion and kind of contraceptive. Comparing with IIFT, sensitivity, specificity, PPV and NPV for ELISA were 75 %, 96.6 %, 63.2 %, and 98 % respectively. Conclusion: As a prevalence rate of 8.6 %, for asymptomatic women and no statistically significant findings in prevalence rate between age groups and because of late complications, periodic screening of sexually active women with serological tests ELISA simple, cheap is recommended. As Peptide _based ELISA assays comparing with IIFT, have high specificity and NPV, they good alternatives to the more expensive, laborious, time consuming and individual dependent assays such as MIF, WIF and IIFT, in sero_epidemiological studies for the analysis of past and current C. trachomatis infections.
Keywords: Chlamydia Trachomatis, Anti Chlamydia Trachomatis IgG, Asymptomatic Women, ELISA, Indirect Immunofluorescent
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 181 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P141
Seroepidemiology of HEV, A Retrospective Study 2014-2015
Reza Pishkarieh Asl 1 *, Samad Farhadi 1, Mina Salmanian 1, Solmaz Madadi 1, Farahnaz Faraji 1
1- Tabriz Medical University [email protected]
Background and objectives: Hepatitis can be caused by a variety of different viruses namely hepatitis A, B, C, D and E. The aim of this research is surveying of seroepidemiology of HEV among patients who referring to the lab in the basis of age, gender, and other effective factors for disease prevalence. Materials and Methods: Blood samples of 260 people were collected. HEV Ab Total and HEV IgM were calculated by ELISA method. Questionnaire including with effective factors questions on Hepatitis development was fulfilled for each person. Data were analyzed by SPSS software. Results: 55 people (21.1%) had HEV ab total but no for HEV IgM. Therefore, there was any active phase patient. Moreover, there was no significant correlation for gender (female 26.5%, Male 21.2%). There were no significant difference in HEV Ab positive prevalence between males and females (21.2% vs 26.5%) or for family member number and also for the kind of drinking water. The positive cases in 0-6 age group and over 40 year’s old group were 1.8% and 45.45% respectively. Conclusion: Prevalence rate was more in rural areas but without any significant correlation (P>0.05) however literacy rate of cases and their fathers had (P<0.05). The low concentration of Ab shows decrease of endemicity regarding to higher socio- economic standards in Iran. Also due to high risk of HEV infection especially in the period of pregnancy, HEV Ab measurement for pregnant women is suggested.
Keywords: Hepatitis E, HEV Ab Total, ELISA, HEV IgM
182 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
New Findings in Laboratory Diagnostics: Microbiology P142 – P181
P142
Seroepidemiological Survey of Toxoplasmosis in Women Referring to Health Centers of Shush, Southwest of Iran in 2016
Somayeh Fallahizadeh 1 *, Ali Jelowdar 1, Bahman Cheraghian 2, Reza Afrisham 3
1- Department of Parasitology, Faculty of Medicine, Ahvaz Jundishapur University of Medical Science, Ahvaz, Iran, 2- Department of Statistics, Faculty of Health, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran, 3- Department of Clinical Biochemistry, Faculty of Medicine, Tehran University of Medical Science, Tehran, Iransomayeh [email protected], [email protected], [email protected]
Introduction: Toxoplasma gondii is an obligate intracellular parasite that causes toxoplasmosis. T. gondii can cause serious pathological effects in fetus of infected women. A definitive and rapid diagnosis is important in these women. Thus, the aim of this study was to investigate Seroepidemiology of toxoplasmosis in women referring to health centers of Shush, southwest of Iran in 2016. Methods: In this descriptive cross-sectional study, the studied population was 276. IgG and IgM antibodies of T. Gondii were measured by ELISA (Enzyme-linked immunosorbent assay) test. Chi-square test was for significance differences. Results: Of 276 women, 85 (30.8%) and 2 (0.7%) were positive for IgG and IgM, respectively. Of 276, 146 (52.90%) were urban and 130 (47.10%) from rural parts of Shush. Of 146 urban women, 43 (29.5%) was positive for IgG and of the 130 rural women, 42 (32.3%) was positive for IgG. There was no significant difference between rural and urban women for IgG antibody (P >.05). Of 146 urban women, 2 (1.4%) was positive for IgM. All of the 130 rural women were negative for IgM. Conclusion: The findings indicate that there is a relatively high prevalence of T. gondii in the women. Because of the symptoms of hydrocephalus, microcephaly, cerebral calcification and chorioretinitis in the infected fetus and regarding the irreversible complications that this parasite causes in pregnant women and the fetus, the use of a routine test for evaluation of T. gondii, before marriage and pregnancy is important.
Keywords: Seroepidemiology, Toxoplasma Gondii, Women, Shush, Iran Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P143
The Application of Molecular Methods to Detect Fungal Infections
Sousan Mohammadi 1 *, Fatemeh Keshavarzi 2, Fariba Lahourpour 2
1- Islamic Azad University- Kurdistan Branch, 2- University of Medical Science of Kurdistan [email protected], [email protected], [email protected]
Background: Candida albicans is one of the diploid funguses, grows as yeast or flagellated cells which is one of the main cause of vaginal and other opportunistic infections in humans. This species of candida is symbiotic and consider as human body micro flora and regularly does not cause disease. The imbalance of micro flora in human body leads to uncontrolled growth of fungus causing infections like vaginal candidiasis. In this regard, accurate identification of candida species is considered as one of the important therapeutic strategies. Methods: vaginal specimens were collected from 100 pregnant women between 18-45 years old who referred to Sanandaj’s TaminEjtemaie hospital and after microscopic diagnosis and based on chromogenic medium cultured detections, prevalence of the fungus in patients evaluated. In the next, amount of different species present were recognized using Polymerase chain reaction (PCR) based on ITS regions and restriction enzyme applied on PCR amplified product which refer to digestion pattern. Results: In this study three species of Candida, C. albicans, C. parapsilosis and C. grabrata recognized by CHROM agar medium. Data of this study revealed that, Candida albicans specie has highest prevalence (86%) among patients. Two other species, C. parapsilosis and C. glabrata had less prevalence, 11% and 3% respectively. Conclusion: It be conclude that PCR technique could be as a useful, efficient, quick and inexpensive tool to identifying these species in comprise to medium cultured based detections.
Keywords: Candida, ITS Region, Candidiasis, Polymerase Chain Reaction
P144
Survey Effect of a Single Phage and a Phage Cocktail in Eliminate of Staphylococcus Aureus Isolated from Hospitalized Patient and Carriers Invitro
Sima Agazadeh 1 *, Behrooz Ghezelbash 2, Gholamreza Zarrini 3
1- Ardabil University of Medical Sciences, Ardabil, Iran, 2- Blood Transfusion Research Center, High Institute for Research and Education in Transfusion Medicine, Tehran, Iran and Ardabil University of Medical Sciences, Ardabil, Iran, 3- Department of Biology, Faculty of Natural Sciences, University of Tabriz, Tabriz, Iran [email protected], [email protected], [email protected]
Objectives: Nowadays S. aureus is one of the most common causes of nosocomial and community-acquired infections and often resistant to traditional antibiotic therapy. Bacteriophages (“phages”) are a potential candidate for a new, effective therapy for infectious diseases. This study aimed to assess the in vitro activity of a phage cocktail (CockTail of Staphylococcus aureus specific bacteriophage) against S. aureus isolates. Methods In this study 150 S.aureus isolated from hospitalized patient and carriers (90 from carriers and 60 from patients). All samples antibiogramed by disc diffusion method for 7 antibiotics and examined against 3 specific phages with names PZA 4, PZA11 and PZA14 that were selected from a collection of phages in our laboratory. Also all isolates were tested with the cocktail of these three phages (PZA 4, 11, 14). The susceptibility to phage screened by presence of plaque. Results Antibiogram determined that 109/150 samples were MRSA. Monophage PZA 4 lysed 93/150(%62) and monophage PZA 11 lysed 57/150(%38) and monophage PZA 14 lysed 94/150(%63).The phage cocktail lysed 114 of 150 (76%) of S. aureus (79% cases carrier and 72% cases patient). Also this study manifested the lytic ability of CT-SA better than mono-phage. It look if we increased number of phages in cocktail significantly reduced, effectively rescued and completely prevented their development of S. aureus. Conclusion this study indicates the phage cocktail CT-SA can effectively lysis S. aureus in vitro. In addition, CT-SA can be as a candidate to prevention of S. aureus in carriers especially in health care staffs.
Keywords: Bacteriophage Therapy, Phage Cocktail, Staphylococcusaureus
184 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P145
The Effect of Tobramycin Incorporated with Bismuth-Ethanedithiol Loaded on Niosomes on the Quorum Sensing of Pseudomonas Aeruginosa
Faeze Mahdiun 1 *
1- School of Medicine, Kerman University of Medical Sciences [email protected]
Background: Pseudomonas aeruginosa is an opportunistic pathogen with high resistance to various antibiotics. In this study, we survey the effect of tobramycin incorporated with bismuth-ethanedithiol loaded on niosomes on the quorum sensing and biofilm produced by P. aeruginosa. Methods: Thin layer hydration method with different concentrations of cholesterol, Span and Tween used for making of niosomes. Afterwards, we investigated the physical properties and particle size of the niosomes. Micro dilution method used to determine of Minimum Inhibition Concentration (MIC). Examined the effect drugs of on N-acyl homoserine lactone (AHL) secretion by P. aeruginosa in the presence of Agrobacterium tumefaciens reporter strain (GV3101). Results: The suitable formulation for drug loading of niosomes included: Span 40, Tween 40 and concentration of 30% cholesterol. The results of inhibition of P. aeruginosa growth in various concentrations was: 16.64 μg/ml for Tobramycin (TOB), 1.3 μg/ml for niosomal tobramycin ( Nio-TOB), 163μM for Bismuth ethanedithiol (BiEDT), 163μM for niosomal bismuth ethanedithiol ( Nio- BiEDT), 0.006 μg /ml, 0.6 Mμ for tobramycin incorporationed with bismuth-ethanedithiol (TOB- BiEDT) and 0.0002 μg/ ml, 0.02 μm for niosomal tobramycin incorporationed with bismuth-ethanedithiol (Nio- TOB- BiEDT), respectively. The concentration of 1/2 MIC and 1/4MIC for TOB-BiEDT and Nio-BiEDT-TOB inhibited the production of AHL molecule. Conclusion: These nano-carrying layer containing non-ionic surfactants, can kept the drug and gradually release the drug. In This way increases the effectiveness of antibiotics in treating P.aeruginosa infection, and reduced resistance of an antibiotic after encapsulation into niosomes.
Keywords: AHL, Niosomes, Tobramycin, Bismuth Ethanedithiol, Pseudomonas Aeruginosa
P146
Second Proficiency Testing in Bacteriology in University of Medical Sciences I Mazandaran in 2016
Mohammad Shokrzadeh 1 , Mehrdad Jalalian 1 * , Halimeh Rashidaei 1 , Asghar Alizadeh 1 , Shahrbanoo Nandost 1 , Masomeh Majidi 1 , Feraidon Barzegar 1 , Motaharehh Hossein Zadeh Gan 1
1- Mazandaran University of Medical Sciences [email protected], jalaliyan330@yaho, [email protected], [email protected], [email protected], [email protected], [email protected], [email protected]
Objective: One of the most important skills is bacteriological tests verification, is the conformity assessment procedures. The medical bacteriology laboratories implementation of internal quality control and proficiency testing programs (PT) appropriate instrument to ensure the quality of services in the bacteriology laboratory. Purpose: The purpose of Proficiency Testing (PT) in medical bacteriology is planning for quality improvement based on identified indexes in the section of Bacteriology. Method and Materials: Commercial samples of bacteria (ATCC strains of Enterococus.faecalis, Kelebsiela pneumoniae, Salmonella thiphimurium) were prepared. After amplification, the samples were sent to all laboratories under standard conditions. The results reported by the laboratories were sent strain. Antibiogram results with a standard diameter (on the basis CLSI) were investigated. Mean, CV was calculated based on the diameter by software SPSS versions 18. Results were reported as the amount of CV disks for laboratories. Results: Medical education Centers (5 units), 40% acceptable, Governmental hospitals (19 units), 44 percent acceptable, Social security hospitals (5 units), 80 percent is acceptable, private hospitals (7 units), 43 percent acceptable, health care (9 units) Health centers (9 units) 33 acceptable.(Compare groups based on the strains transmitted and the diameter of inhibition zone on the basis CLSI) Discussion: Proficiency testing is a efficient tool in identifying performance indicators in the laboratories. Regular application of proficiency testing is a perfect tool in improving the quality and garuntee the level of service in bacteriology.
Keywords: Quality Control, Proficiency Testing, Quality Assurance, Bacteriology
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 185 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P147
Role of Mobiluncus Spp. in Preterm Labor
Sedigheh Livani 1 *, Naemeh Javid 1, Ezzat-Allah Ghaemi 1
1- Department of Microbiology, School of Medicine, Golestan University of Medical Sciences [email protected], [email protected], [email protected]
Introduction: Preterm labor (PTL) is defined as regular contractions of the uterus that start before 37 weeks of pregnancy. Preterm labor can lead to an early birth. According to the WHO, Every year, an estimated 15 million babies are born preterm. Several infectious agents associated with preterm birth have been found. Mobiluncus spp. is isolated from bacterial vaginosis patients. In this study, the role of Mobiluncus spp. in preterm birth is studied.Material and methods: 100 pregnant women with term delivery (the control group) and 100 pregnant women with preterm labor (as the case group) were included in this study. Vaginal secretion was collected by Dacron swab. After DNA extraction and PCR, statistical analysis X2 and relative risk were performed. Results: The total average age of patients were 27(±5.7). The prevalence of Mobiluncus in term labor and preterm labor group were 25% and 45%, respectively (Pvalue=0.002). The relative risk of preterm labor for Mobiluncus was 1.62 (95% CI; 1.14-2.29).Discussion: This study found a significant relationship between PTL and Mobiluncus presence alone. Large number of this organism is a feature of bacterial vaginosis. Thus it should be consider wheather this adverse pregnancy outcome is related to other bacteria that are a part of BV or is specific to Mobiluncus. Conclusion: We found a significant relationship between presence of Mobiluncus in vaginal secretion and PTL.
Keywords: Mobiluncus, Preterm Labor, Pregnancy
P148
An Investigation on the Effect of Lactobacillus Acidophilus on the Meca Gene Expression in Methicillin-Resistant Staphylococcus Aureus
Mahsa Abasi 1 *, Samaneh Dolatabadi 1, Hamid Reza Rahimi 2
1-Department of Biology, Neyshabur Branch, Islamic Azad University,Neyshabur,Iran, 2-Department of Modern Sciences and New Technologies, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran [email protected], [email protected], [email protected]
Introduction: Methicillin-Resistant Staphylococcus Aureus (MRSA) is a nosocomial pathogen with high spread around the world. Infections caused by S. aureus are among the most common causes of morbidity and mortality worldwide. This bacteria is identified as a resistant pathogen and it has become a serious public health concern due to its resistance to antibiotic agents. According to the unique antibacterial properties of LAB, the aim of this study is to evaluate the inhibitory effect of Lactobacillus acidophilus against growth of MRSA. Methods: First antagonistic effect of Lactobacillus acidophilus on the growth of MRSA cells was observed in solid medium with agar diffusion method. Then antibacterial activity of selected probiotic was measured in liquid medium with co-culture method. At the end the reduction of antibiotic-resistance gene (mec A) on MRSA was evaluated by Real Time PCR technique. Discussion and Conclusion: Based on these findings Lactobacillus acidophilus have bactericidal effects against MRSA cells and in general LAB are promising. They produce antimicrobial compounds that Inhibit and eliminated MRSA cell growth. In addition, the treatment with the selected probiotic species may eventually respond to MRSA colonization as they do not increase the risk of multidrug-resistant pathogen.
Keywords: MRSA, LAB, Co-Culture, Mec A
186 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P149
Prevalence of Shigella, Salmonella and Giardia in Applicant Patients of Health Care Center Laboratory of Semnan for Health Card from October 2013 to October 2016
Masood Monem 1 * , Mehrdad Ameri 1 , Hossein Nazari 1 , Alam Taj Salehiyan 1 , Yaqoub Ali Abbasi 1 , Zahra Ehsani 1 , Ali khodabakhshi 1 , Elham Shafiee 1 , Abbas Azaad 1 , Habibeh Najar 1 , Hedie Hatamipour 1
1- Healths Care Center Laboratory of Semnan University of Medical Sciences [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected]
Introduction: Despite human efforts for controlling and preventing infectious diseases transmitted via food, the subject has been considered as a major problem in communities and monitoring the sanitation of people is essential. This study has been done with the purpose of evaluating the prevalence of Shigella, Salmonella and Giardia in applicant patients of Health care center Laboratory of Semnan for health card. Methods: This study was done from October 2013 to October 2016 on 8267 patients. Stool sample of people who came to Health care center Laboratory of Semnan was evaluated by direct methods for presence of Giardia. Stool culture was used to recognize Shigella and Salmonella. Results: In this study 92% of samples belonged to males and 8% were for females. Of the 8267 samples, Giardia was found in 36 cases (0.43%). None of the stool cultures were infected by Shigella and Salmonella. Conclusion: Results indicate a high prevalence of Giardia (Pathogenic protozoa) among the patients. Therefore, it is necessary to increase health control, and based to this subject-related-trainings should be done to promote awareness of the society.
Keywords: Shigella, Salmonella, Giardia, Health Card
P150
Opportunistic Fungi Isolated from the Operating Room of a Hospital in Babol, Potentially Dangerous for Patients
Saeid Mahdavi Omran 1 *, Fatemeh Nazari 1, Mojtaba Taghizadeh 2
1- Dept. of Medical Parasitology and Mycology, Faculty of Medicine, Babol University of Medical Sciences 2- Dept. of Medical Parasitology and Mycology, Faculty of Medicine, Mazandaran University of Medical Sciences [email protected], [email protected], [email protected]
Introduction: Saprophytic fungi are caused fatal disease in people if there is a predisposing occasion. Among the factors underlyied opening different parts of the body is due to the surgery in the operating room. According to special circumstances of surgery, the present study aimed to determine the fungi in the operating room of a hospital in Babol. Methods: In this study, a sample of the air of operating room was taken in two times in the morning and evening using Andersen air sampler. There was a dextrose agar medium plate supplemented with chloramphenicol. After fungal growth, genus or species of fungi were identified by using the macroscopic and microscopic characteristics (wet mount or slide culture). Results: A total of 103 colonies of fungi grew in 6 genera (12.88 colonies/plate). The most fungus was Cladosporium (86Colonies, 83.5%), followed by the Aspergillus and mucoracae each with 4 cases (3.88%), respectively. Contamination in morning was more than (76.7%) the afternoon sampling (23.3%). Conclusion: According to the high fungal contamination in operating roomair, in this survey to the potential allergens and pathogenic fungi, control measures for removal andreducing the fungi with appropriate disinfectants and care personnel, help will be useful to avoid of fungal diseases.
Keywords: Babol, Hospital, Operating Room, Fungus, Aspergillus
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 187 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P151
Prevalence of Parasitic Infections among Appendectomy Specimens in Qom Province, Central Iran: a Retrospective Analysis and Text Review
Ahmad Mardani 1 *, Fatemeh Feizi 2, Mahdi Fakhar 3, Hossein Barani Beyranvand 4, Mohsen Farrokhi 4, Mohammad Abbasi 5
1- Department of Microbiology, Blood Transfusion Research Center, High Institute for Research and Education in Transfusion Medicine, Iranian Blood Transfusion Organization (IBTO) Building, 2- Qom University of Medical Sciences, Qom, Iran, 3- Molecular and Cell Biology Research Center, Department of Parasitology, School of Medicine, Mazandaran University of Medical Sciences, Sari, Iran, 4- School of Paramedicine, Qom University of Medical Sciences, Qom, Iran, 5- Medical Laboratory of Nekoii Hospital, Qom University of Medical Sciences, Qom, Iran [email protected], [email protected], [email protected], [email protected] [email protected], [email protected]
Background and Aims: The role of parasites in the pathogenesis of appendicitis has long been discussed. Enterobius vermicularis is the most common parasitic worm found in the removed appendixes. The main objective of this study is to determine the prevalence of parasitic infections among appendectomy specimens in Qom Province, Central Iran. Methods: This retrospective study was conducted in Nekoii Hospital of Qom City, Iran from 21 March 2005 to 19 March 2016 (11-year period). The histopathology reports and recorded demographic data of the 13,744 performed appendectomies were reviewed and then extracted using a structured template form. Results: Out of the 13,744 surgically removed appendixes, E. vermicularis was observed in 31 (0.22%) specimens. Of the patients with E. vermicularis infection of the appendix, 21 (67.74%) were female and 22 (70.97%) were less than 15 years old. According to the histopathology examinations, the appendix tissue was inflamed in 3 (9.68%) specimens infected with E. vermicularis parasite. Discussion and Conclusion: The presence of E. vermicularis in the appendix lumen rarely causes inflammation, and in most cases can lead to clinical signs of appendiceal colic or symptoms resembling true appendicitis.
Keywords: Parasitic Infections, Appendectomy, Enterobius Vermicularis, Appendicitis, Iran
P152
Prevalence of Intestinal Parasitic Infections in Shush County, Southwest of Iran During 2014-2016
Somayeh Fallahizadeh 1 *, Forough Kazemi 1, Mohammadhosein Feizhadad 1
1- Department of Parasitology, Faculty of Medicine, Ahvaz Jundishapur University of Medical Science, Ahvaz, Iran [email protected], [email protected]
Introduction: One-third of the people of the world are in the influence of intestinal parasite infections (IPIs). The infections can cause a whole range of clinical symptoms such as watery or mucoid diarrhea, dehydration, vomiting and nausea, abdominal pains and fever. The aim of this study was to evaluate prevalence of intestinal parasitic infections in Shush County, southwest of Iran during 2014-2016. Methods: In this descriptive cross-sectional survey, 15132 stool samples were collected during 2014- 2016. The samples were evaluated microscopically for the presence of parasite trophozoites, cysts and eggs using direct and formalin-ether concentration methods. The data were analyzed by SPSS version 21 and statistical test of Chi-square Results: Of 15132 samples, 778 (5.14%) were positive for IPIs that 429 (55.14%) and 349 (44.85%) were observed in women and men, respectively. Entamoeba histolitica/dispar was detected in 313 (2.06%) specimens as the commonest parasite that was 172 and 141 in women and men, respectively. Other parasites were included 158 (1.04%) Giardia lamblia (83 women and 75 men), 150 (0.99%) Blastocystis hominis (84 women and 66 men) and 155 (1.02%) Entamoeba coli (90 women and 65 men). Also, 2 (.0.013%) Trichuris trichiura were detected only in men. Conclusion: The results show that relatively high parasitic infections were observed in individuals referred to Shush Health Center. Since IPIs can cause malabsorption, diarrhea, intestinal obstruction, cholecystitis, liver inflammation, pulmonary and renal complications, Therefore, health authorities of Shush County must pay more attention to control and prevention of the transmission of intestinal parasites to individuals.
Keywords: Prevalence, Intestinal Parasites, Infection, Shush, Iran
188 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P153
Mutations in the Hepatitis B Virus Polymerase Gene in Golestan Province-Iran
Mona Rezanezhadi 1 *
1- Islamic Azad University of Damghan, Department of Microbiology, Damghan, Iran [email protected]
Background: Hepatitis B Virus (HBV) infection is a major health problem worldwide, with 2 billion infected people each year. The limited numbers of NAs available and development of drug resistance conferred by viral mutations in the HBV Reverse Transcriptase (RT) domain during long term treatment remains the major concern leading to treatment failure. The aim of this study was detecting of the mutations in the RT domain of the Polymerase Gene Region of Hepatitis B Virus in Golestan Province-Iran. Materials and Methods: HBV-DNA extractions from plasma and PCR of 120 patients were performed. Direct sequencing and alignment of P gene were applied using reference sequence from Gene Bank database. Results: All isolates were belonged to genotype D, sub genotype D1, subtype ayw2. Overall 216 point mutations occurred. Of them, 106 (49.07%) were missense and 110 (50.92%) were silent. Frame shift mutations were seen in 38 cases (31.66%). Mutations related to lamivudine, adefovir, tenofovire, and entecavir occurred in 15.83% (n=19), 25% (n=30), 0.83% (n=1) and 0.83% (n=1) of patients, respectively. Conclusion: The frequency of polymerase gene mutations that lead to drug resistance in patients with chronic hepatitis B is indicated.
Keywords: Chronic Hepatitis B Virus, P Gene Mutations, Golestan Province
P154
High Bacteria Contamination of Personnel Cell Phone of the Ali-Ibne Abi Taleb Hospital, Rafsanjan, During Summer 2016
Seyed Mohsen Mousavi 1 *, Somayeh Kazempour 2, Mozhdeh Amiri 2, Ahmadreza Sayady 2, Khatereh Hoseyni Pour 2, Seyed Mojtaba Mortazavi 3
1-Medical Lab Dep Faculty of Paramedical, Rafsanjan University Medical Science, Rafsanjan, 2- Faculty of Paramedical, Rafsanjan University Medical Science, Rafsanjan, 3- Bam University of Medical Science; Bam, Rafsanjan University of Medical Sciences [email protected], [email protected], [email protected], [email protected] [email protected], [email protected]
Introduction: It has been hypothesized that the contamination of the cell phone by Nosocomial infection can be considered as a main route for bacteria transmission to hospitalized patients. Therefore, the main aim of this study was to evaluate the contamination of the personnel’s mobile contamination in Ali-Ibne Abitaleb Hospital, Rafsanjan. Materials and Methods: This cross sectional study has been performed on the 80 samples which have been collected from the cell phone of personnel of Laboratory, Radiology, ICU and Emergency department of Ali-Ebne Abitaleb Hospital. The samples were cultured in Blood agar, EMB and MacConkey agar for detecting of the bacteria and also TSI, SIM, Urea, Simon Citrate, catalase and coagulase test for differentiation of the bacteria. Results: The results revealed that 78 (98.8%) out of 80 samples were contaminated with bacteria. The most isolated bacteria were E.coli. The samples isolated from women mobile phone were more contaminated than men. The contamination was higher in the cell phone of the personnel who have not used gloves in comparison with personnel who used gloves. The contamination has a positive correlation with the age of the personnel. The touch screen phone has lower contamination in comparison to keyed screen mobile phones. Conclusion: Based on the results, it appears that the cell phones are a main source of Nosocomial infection, hence, the personnel, needs to be educated to not use the cell phone during patient’s care. Additionally, it is significantly proposed to washing hands repeatedly in entrance and exit from hospital and also at the time of patient’s care. Also, for decreasing the contamination using touch screen phones instead of keyed screen cell phones.
Keywords: Mobile Phone, Contamination, Nosocomial Infection
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 189 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P155
Bacteria Isolated from Nosocomial Infections and Antibiotic Resistance Pattern in Yahyanejad Hospital, Babol
Mojtaba Mehdipourmir 1 *, Zohreh Eslamdost 1, Norozali Nori 1, Reza Razghnia 2, Parvin Hasanjanzadeh 3
1- Master of Science in Microbiology, Martyr Yahya Nejad Hospital, University of Medical Sciences, Babol 2- Laboratory, Department of Medical Sciences, Babol, 3- Midwifery, Department of Health, University of Medical Sciences, Babol [email protected]
Introduction: Nosocomial infections have caused great damage to hospitalized patients and the economic losses are enormous. Resistance of antibiotic agents exists in a large variety of pathogens that cause problems in treatment and increase in death and mortality. This study is about determining the frequency of osocomial infections and biological factors. Methods: This cross-sectional was executed from August till the end of October 2016 the Yahyanejad hospital in babol. The samples tested include ulcers, lung secretions, urine and blood. Identifying bacteria based on microbiological methods, such as staining, differential environment and producing ESBL screening and confirmatory tests were performed. The data were analyzed by software SPSS. Findings: Out of the total 1486 samples tested 132 positive samples obtained. The detected microorganisms in order of prevelance includes: 34% E. coli, 11.4% Pseudomonas, 10.6% Citrobacter, 9.8% Klebsiella, 9.8% Enterococcus, 6.8% Enterobacter, 3% staphylococcus epidermidis, 3.8% Acinetobacter, 3% Staphylococcus aureus, 2.3% Staphylococcus Saprophyticus, Morksla, Proteus, Serratia were each 0.8% found. And ESBL was seen in 24% of gram-negative bacteria. Discuss: Most bacteria which isolated were Escherichia coli and Pseudomonas. That’s probably due to the use of broad-spectrum cephalosporins generally makes antibiotics for multidrug-resistant and Gram-negative organisms, especially antibiotic resistance among microorganisms is more common. Because of antibiotic resistance patterndepends on the type of antibiotics which are used in each location changed, it is recommended that the study continues on an ongoing basis.
Keywords: 43/5000 Nosocomial Infections, Antibiotic Resistance, Babol
P156
Determining Genotype HTLV-I Virus Using Tax-1 Gene in Co-Infected Patients with HIV- 1/ HTLV-1
Saeedeh Soleimani 1 *, Zohreh Sharifi 1, Ghasem Hasannejad 1
1- Blood Transfusion Research Center, High Institute for Research and Education in Transfusion Medicine (IBTO) [email protected], [email protected], [email protected]
Background and objectives: The HTLV-1 virus is the one of the first human retrovirus, which causes only 1-5 percent of infection in the people after long period (20 -30 years) to disease Human T lymph tropic virus type I (HTLV-I) associated myelopathy and Adult T-cell leukemia/lymphoma (ATLL). The aim of this study was to determine the genotype HTLV-I virus with use of tax-1 gene in co-infected patients with HIV-1/ HTLV-1.Materials and Methods: In this study, we extracted the DNA of the HTLV-1 virus from 100 infected samples to HIV by genomic DNA extraction Kit. Then complete gene of tax-1 gene was amplified with specific primer by nested–PCR method. The PCR products was purified and sequenced for detection of genotype. Findings: The Tax-1 gene PCR product was electrophored on agarose gel and was shown the fragmentation with the length of the 890 base pairs. 5% of samples were positive for the tax gene. Also, the results of nested - PCR was confirmed with sequencing. Conclusion: The results of the sequencing revealed that HTLV-1 virus genotype in all co-infected patients with HIV-1/HTLV-1 was a subtype.
Keywords: HTLV-1, tax-1, Concurrent Infection, HTLV-1/HIV
190 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P157
Evaluation of Antibiotic Resistance Pattern and Presence of TEM Genes in Escherichia Coli Strains Isolated from Clinical Samples of Patients Admitted to Babul Hospitals in (June 2014 – December 2015)
Zohreh Eslamdoost 1*, Fatemeh Zabooli 1, Esmeil Fattahi1
1-Islamic Azad University [email protected], [email protected], [email protected]
The purpose and importance of research: E.coli is one of the most common causes of clinical infections. Its antibiotic resistance too many common antibiotics due to production of plasmid-mediated Extended Spectrum Beta Lactamase (ESBL) in this bacteria causes many therapeutic problems. The purpose of this article is evaluation of mean abundance of TEM gene in E.coli strains isolated from clinical samples of patients admitted to babul hospitals. Research method: In this descriptive cross-sectional study, from 22 June 2014 until 21 December 2014, 525 E.coli strains were determined by culturing clinical samples in the suitable mediums and related biochemical test. Also Antibiogram test by disk diffusion method were applied on this strains. Phenotypic identification of producing ESBL strains were accomplished by disk diffusion method using Cefotaxime disk and Cefotaxime clavulanic acid. Subsequently, the strains with TEM gene were identified by SYBR Green Real-Time PCR. Results: Form 525 separated E.coli, 200 strains (38.9%) were positive for ESBL and 160 (80%) of them contained TEM gene. Maximum and minimum of strain resistance were against Ceftriaxone (43.8 %) and Piperacillin-tazobactam (1.4%), respectively. Discussion and conclusion: Due to high abundance of producing ESBL bacteria in this study, adoption of appropriate measures in prescription drugs seem critical. Moreover, it is suggested to use routine ESBL Phenotypic identification method in clinical labs.
Keywords: Escherichia Coli, Antibiotic Resistance, Beta-Lactamase, ESBL, TEM
P158
Study Antibiotic Pathern Resistance against ESBL or Producing Pseudomonas Aeriginosa Isolated from Clinical Samples of Babol Hospitals Patients by PCR Method in 1393
Fatemeh Zaboli1, Esmaeel Fattahi1, Fahimeh Jafari1*
1-Islamic Azad University [email protected], [email protected], [email protected]
The purpose and importance of research: Pseudomonas aeruginosa is the most common bacteria. This plasmid that encodes beta-lactamase bacteria due to the acquisition of broad-spectrum (ESBL), a beta-lactam antibiotics resistant, so due to the lack of CTX-M genes in the region to identify the purpose of this study was performed in terms of phenotypic and genotypic. Research method: This cross-sectional study for six months in all cases referred to hospitals and strains was performed using double-disk-diffusion for the presence of beta-lactamase enzymes were studied and finally, using a wide variety of genes Real Time PCR CTX- M-ESBL-producing strains were determined and the data were analyzed with software SPSS. Results: In this study of 230 clinical samples, 50 isolates of P. aeruginosa was detected. The highest and lowest rates of antibiotic resistance as compared to cefotaxime (68%), piperacillin-tazobactam (10%) was observed. Also using Real Time PCR genotyping of 6 (12%) were ESBL-producing isolates the study, 5 strains (83.3%) CTX-M gene was identified. Discussion and conclusion: The results showed that clinical isolates of Pseudomonas aeruginosa resistance to beta-lactam antibiotics because of the high prevalence of CTX-M gene of Pseudomonas aeruginosa Drsvyh the area thereby controlling the use of antibiotics is essential.
Keywords: Pseudomonas Aeruginosa, Antibiotic Resistance, Beta-Lactamase (ESBL), Gene CTX-M, Real Time PCR
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 191 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P159
Taqman Real Time PCR Assays as a Rapid Diagnostic Technique for the Detection of Yersinia Pestis
Khatereh Kabiri
Introduction: Yersinia pestis is a gram-negative coccobacillus responsible for causing plague. Taqman Real Time PCR assays provide greater specificity, and they require less time and labor to complete than traditional diagnostic methods. However, a common problem of Taqman Real Time PCR assay is false negative results due to the presence of inhibitory matters in the samples. So, the purpose of this study was expansion of a quantitative internal control Taqman Real time PCR assay based on pla gene of Yersinia pestis. Materials and Methods: Composite primers and probe were designed in accord with the pla gene. Taqman Real Time PCR experiments were adjusted using the Y.pestis genome. Specificity of the PCR tests was determined using reactions containing various bacterial negative control genomes. Sensitivity of the internal control Taqman Real Time PCR assay was determined by preparing a serial tenfold dilutions of the internal control plasmid with starting concentration of 10ng/ml. Result: in this study, No amplification curve observed in Taqman Real time PCR of various bacterial negative control genomes accompanied by specific Y.pestis primers and probe. The lowest concentration of the internal control showing fluorescent signal was 1fg/ ml of the target gene. Also, the dynamic range of the quantitative internal control TaqMan Real Time PCR assay was between 10ng/ml and 1fg/ ml of pla gene. Conclusion: The results of this study showed that the Taqman Real time PCR assay is a rapid, repeatable, sensitive and specific Technique for detection of Y.pesti.
Keywords: Yersinia Pestis, Taqman Real Time PCR, Detection
P160
Pro-Inflammatory Gene Expression in Experimental Models Leishmania Wounds in BALB/C Mice
Hossein Rezvan 1 *, Sahar Hamoonnavard 1
1- Department of Pathobiology School of Veterinary Science Bu-Ali Sina University Hamedan, Iran [email protected], [email protected]
Background: Leishmaniasis is an extensive lesion. Laboratory studies in this field could help improve diagnosis and treatment. This study focuses on pro-inflammatory gene expression in mice infected with Leishmania wound and infected mice without wound. Methods: The specific primers were designed for four pro-inflammatory genes including IL-1α, IL- 1β, IL-12P35, IL-12P40, TNF- α and IFN- γ. Expression of these genes was analyzed using by RT-PCR in the wound and spleen in Leishmania infected with and without wound in BALB/c mice. Results: Pro-inflammatory genes were expressed in mice infected with the wound contains (TNF-α in spleen & TNF- α and IL-1β in wound) and in infected mice without wound contains (TNF-α in spleen & IL-1β in the injection position). Conclusion: Study on inflammatory gene expression in vitro model of leishmaniasis wounds can help improving this complication in vitro and vivo studies and is important for diagnostic strategies.
Keywords: Leishmania Wounds, Experimental Models, BALB/C Mice
192 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P161
Differentiation and Antimicrobial Susceptibility Pattern in Bacterial Isolated of Biological Fluids from ICU Unit Patients of Bou Ali Sina Hospital,Sari,Mazandaran, Iran
Parvaneh Afshar 1 , Ebrahim Nemati 2 * , Hatef Moghadami 3 , Lale Vahedi 4
1- Research and Development Unit of Referral Laboratory, Deputy of Health Management, Mazandaran University of Medical Sciences, Sari, Iran,2- Bou Ali Sina Hospital, Mazandaran University of Medical Sciences, Sari, Iran, 3- Department of Pharmacology, Faculty of Pharmacy, Mazandaran University of Medical Sciences, Sari, Iran, 4- Department of Pathology, School of Medicine, Mazandaran University of Medical Sciences, Sari, Iran [email protected], [email protected], [email protected], [email protected]
Antimicrobial (AM) resistance is an emerging clinical problem for Gram-negative (GNB) and Gram-positive bacteria (GPB) detected in intensive care units (ICUs). The objective of the present retrospective study was done to differentiation and antimicrobial susceptibility pattern in bacterial isolated from biological fluids (sputum, wound, Ascites fluid, tracheal tube wound secretion) from ICU unit Patients of Bou Ali Sina Hospital, Sari, Mazandaran, Iran in 2016. Specimens were assessed by standard bacteriological techniques and AM sensitivity testing was performed by the modified Kirby Baur method as recommended by clinical and laboratory standard institute (CLSI). Internal and external quality was performed. Among the 1423 patients, 8.8% (82males and 39females) were confirmed through traditional bacteriological examination. The peak incidence was in the 30-90 years age group. The most commonly isolated organisms were Klebsiella pneumonia (36) and then Acinetobacter 26, Pseudomonas aeruginosa 15 Serratia, Streptococcus, Citrobacter, E.coi1 8,7,4,3 cases, Respectively. the most antibiotics Susceptibility, in general, were to Amikacin and Imipenem. No significant relation observed between sex and age. GNIs were the predominant cause of infection in ICUs. Third generation cephalosporin resistant GNIs were the predominant resistant organisms.
Keywords: Biological Fluid, Bacterial Culture, Antibiotic Susceptibility, ICU, Mazandaran, Iran
P162
Survey of Nosocomial Infections Prevalence in Shahid Beheshti HospitaL in Kashan
Mahzad Erami 1 *, Hasan Kosha 1, Ali Mohamadi 1, Tayebeh Taghipoor 1, Sedigheh Heydarimoghadam 1
1- Kashan Shahid Beheshti Hospital, Kashan University of Medical Sciences, Kashan, Iran [email protected]
Introduction: Nosocomial infections occure worldwide. This is a major cause of death and increased morbidity in hospitalized patients. In this retrospective study, we survived Hospital-Acquired Infections during 2013. Material & methods: Microbiology diagnosis and antibiogram tests were done in the first and then the results of data were analyzed by the IBM SPSS statistics. Results: The four most nosocomial infections respectively were pneumonia (65.15%), surgical site infection (18.87%), urinary infections (8.73%) and bacteremia (7.06%). The most frequent bacterial isolation respectively were acintobactera, klebsiella, Coagulase-neg staphylococci, and Pseudomonas and Escherichia coli. Conclusion: Effective infection control programs includes a core of the infection control committee, infection control practitioner, and individual employee actions are essential to control and prevent nosocomial infections. Thus, it is important that we seek continually improving the existing infection control policies and programs.
Keywords: Nosocomial Infections
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 193 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P163
Survey of Onichomycosis Prevalence in Shahid Beheshti Hospital in Kashan
Mahzad Erami 1 *, Alireza Ghanbari 1, Akbar Masjedi Arani 1, Hasan Kosha 1, Tayebeh Taghipoor 1, Ali Mohamadi 1
1- Kashan Shahid Beheshti Hospital, Kashan University of Medical Sciences, Kashan, Iran [email protected]
Introduction: Onychomycosis is one of the most common nail disorders. It affects 10-30% of the world population and is caused by dermatophytes, non-dermatophytes, molds, and yeasts. The aim of this study is the survey of onichomycosis prevalence in Kashan Shahid Beheshti Hospital. Material & methods: In this retrospective study, samples were taken from 110 patients. Direct microscopic examination by 20% KOH solution and culture of samples in SC and SCC was done. Results were reported after 21 days. Results: Fungal examination showed that 80 cases were positive, 80% of them were female and 20% were male and the mean age of them was 48. 60% of cases were diabetic patients. Fungal agent isolation respectively was candida (95%), dermatophytes (3%) and non-dermatophytes molds (2%). Conclusion: In this study Candida was the most frequent fungal agent and the major group of infected cases was diabetic. Thus, we recommend that fungal examination and surveying the prevalence of onycomycosis in diabetic patients in the other study.
Keywords: Onycomycosis
P164
Antibacterial Effects of Probiotics Isolated from Dairy Products against Staphylococcus Aureus and Streptococcus Mutans
Somaye Imanparast 1 *, Tina Noorbakhsh 2, Nika Blaghirad 2, Fatemeh Salimi 1
1- Microbial Biotechnology Laboratory, College of Science, University of Tehran, Iran, 2- Farzanegan 1 High Schools, Tehran, Iran [email protected], [email protected], [email protected], [email protected]
Probiotics are defined as non-pathogenic microorganisms, which when ingested, exert a positive influence on the host health or physiology. A number of studies have found probiotic consumption to be useful in the treatment of many diseases. Dairy products are a potential source of probiotic. The aim of this study was to determine the presence of antibacterial effects among the probiotics isolated from different dairy products against Staphylococcus aureus and Streptococcus mutans. In this study, 10 dairy products were collected from rural area in North of Iran. Immediately after collection, the samples were stored aseptically in low temperature refrigerator to protect from contamination and deterioration. Samples were cultured in MRS broth medium in anaerobic condition at 37°C for 24 h. The probiotic isolates were purified by repeated sub-culturing on MRS agar followed by the pure cultures were subjected to produce of antibacterial metabolites by fermentation in anaerobic condition for one week at 37°C. The modified agar overlay method was used for determination of the presence of antibacterial effects among the isolated probiotics and the mixed culture of probiotic against Staphylococcus aureus and Streptococcus mutans. Results showed the presence of antibacterial effects among the probiotics that were isolated from dairy products. The spectrum of their antibacterial effects varied against the selected pathogen. Antibacterial effects are one of the most important selection criteria for probiotics, and the verified antibacterial activity of the probiotics supports the development of these functional foods as a key to improve the human health.
Keywords: Probiotics, Antibacterial Effects, Agar Overlay Method
194 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P165
Effects of Extract of Ethanol, Methanol and Ethyl Acetate Teucrium Polium and Citrullus Colocynthis aganist Candida Albicans
Somayeh Jahani 1 *
1- Infectious Diseases and Tropical Medicine Research Center, Zahedan University of Medical Sciences, Zahedan, IR Iran [email protected]
Background and Purpose: In recent years, Systemic fungal infections caused by pathogenic yeast, the most important causes of morbidity and mortality, especially in hospitalized patients is a common and anti-fungal treatments with conventional drugs have not completely effective. Research shows the ratio Mydhdk·hashkal variety of antifungal compounds tested against some pathogenic fungi show good synergistic effects. Material and Method: The extracts of the Teucrium polium and Citrullus colocynthis were prepared using a rotary device. The inhibitory concentration against Candida albicans was determined using incubation in media. Result: Overall, the results showed that the leaf extracts of C.colocynthis and T.polium had strong antimicrobial activities. Also, based on the findings, C.colocynthis extracts exhibited higher antimicrobial activity. The ethyl acetat extracts of C.colocynthis and T.polium showed good antimicrobial activity against C. albicans strain. Discussion: The results of this study showed that the extract wind cheese antifungal activity against Candida albicans is good, so it can be used as a drug to treat infections caused by Candida albicans bid.
Keywords: Extract Plant, Citrullus Colocynthis, Teucrium Polium, Candia Albicans
P166
Comparison of Chicago Sky Blue with Potassium Hydroxide and Calcofluor White Mount in Direct Diagnosis of Dermatomycoses
Parvaneh Afshar 1 *, Mohammad Shokrzadeh 2
1- Research and Development Unit of Referral Laboratory, Deputy of Health Management, Mazandaran University of Medical Sciences, Sari, Iran, 2- Research and Development Unit of Referral Laboratory, Deputy of Health Management, Mazandaran University of Medical Sciences, Sari, Iran & Department Toxicology of Pharmacology, Faculty of Pharmacy, Mazandaran University of Medical Sciences, Sari, Iran [email protected], [email protected]
Background: The Rapid mycological study of dermatomycoses is usually done by potassium hydroxide (KOH) mount and occasionally calcofluor white (CFW) stain. KOH mount lacks a color contrast and requires a trained eye to interpret, while CFW stain is high sensitivity and specificity method but a fluorescent microscope with a UV light sourceis necessary, therefore, it is not particularly suitable for the office-based diagnostic dermatology. Chicago Sky Blue 6B (CSB) is a new contrast stain that highlights the fungal hyphae and spores, blue against a purplish background. The aim of this study was to compare 3 different diagnostic methods utility of a novel contrast stain CSB with KOH and CFW in the evaluation of dermatomycoses and to determine their sensitivity, specificity, positive predictive value, and negative predictive value in Research and Development Unit of Referral Laboratory, Deputy of Health Management, Mazandaran University of Medical Sciences. Materials and Methods: Skin scrapings from the lesions of 164 clinically suspected cases of dermatomycoses were evaluated to KOH mount and CSB stain and CFW stain with the direct microscopic examination. Results: Direct microscopy with CFW stain, CSB stain, and KOH mount showed positive results in patients, respectively. In addition to CSB staining of skin scrapings is the most sensitive method which was matched almost with CFW staining method. Conclusion: We recommended a simple practical tip of adding Chicago Sky Blue (CSB) stain to KOH to highlight fungal elements and provide a color contrast that makes reading and interpretation simple, even for the novice.
Keywords: Direct Diagnosis, Fungi, Potassium Hydroxide, Calcofluor White, Chicago Sky Blue
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 195 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P167
Detection of TEM Gene in Pseudomonas Aeruginosa Isolated from Urinary Tract Infection in Iran
Mohammad Mehdi Attarpour Yazdi 1 *
1- Department of Microbiology, Faculty of Medicine, Shahed University, Tehran, Iran [email protected]
Background & Aim: Due to the high mortality of Urinary Tract Infection (UTI) caused by gram negative bacteria such as Pseudomonas aeruginosa and increasing of prevalence of resistance, the aim of this study is the detection of antibiotics susceptibility pattern (study of phenotypic) of the P. aeruginosa in the UTI and incidence of TEM gene. Methods: 95 clinical isolates of P.aeruginosa collected from different hospitals in 2016. Phenotypic detection of ESBLs was used for screening of isolates by agar diffusion (Kirby-Bauer) method (according to CLSI advised). Screen positive isolates were then subjected to PCR for detection of TEM gene. Results: Primary phenotypic and confirmation tests revealed that 84.21 percent (80 isolated) of P.aeruginosa produced ESBLs. TEM gene was found in 26.25% (21 out of 80) by PCR method. Signification relation between phenotypic and genotypic resistance was found by using the SPSS program and chi-square test. (P<0.05) Discussion & Conclusions: Due to the high level of resistance there would be the production of ESBLs in P.aeruginosa and signification relation with the TEM gene, it is important to control the way in taking as a national study to determine the pattern of phenotypic and genotypic resistance in Iran seems to be necessary.
Keywords: Pseudomonas Aeruginosa, TEM Gene, Urinary Tract Infection, Iran
P168
Usage of Boric Acid for Transferring of Urine Samples with a Duration of More than 24 Hours
Giti Omidvari 1 *
1- Medical University of Tehran [email protected]
Background: Validity of specimen affects the quality of Microbiological Laboratory tests and its quality directly depends on the quality of collection, as well as the time between collections to transfer to the laboratory. Especially if the specimen is sent for culture, the medium for transferring must be very precise. Methods and Materials: In this cross-sectional before and after study, urine samples were collected in sterile containers by patients and were cultured immediately. In addition, 1 ml of 20% boric acid per 10 ml urine was added to samples and then they were incubated at 24 and 48 hours later. Analysis was done by SPSS ver. 18 software by using T-Test and Chi2 test. Results: 83 urine samples in two groups of 34 samples with sterile urine and 49 samples with positive urine in initial culture were studied. The most common infectious agents were E coli, entrobacter, staphylococci, respectively. No statistically significant difference in colony counts was observed in the first 48 hours and 72 hours later (p<0.05). Also, no differences were seen regarding to type of agents at first and 48 hours and 72 hours later. None of the sterile samples cultures were positive after 48 to 72 hours. Conclusion: Based on the study findings, it seems that boric acid is a suitable material to transfer urine samples for culture more than 24 hours in health care system.
Keywords: Boric Acid, Culture, Urine Sample, Delay Transfer
196 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P169
Characterization of Prominent Micrornas in Toxocara Canis
Mohammad Zibaei 1 *, Parviz Fallah 2, Saeed Bahadory 1, Farzaneh Firoozeh 3, Leila Beikzadeh 2
1- Department of Parasitology, Alborz University of Medical Sciences, Karaj, Iran, 2- Department of Laboratory Medicine, Alborz University of Medical Sciences, Karaj, Iran, 3- Microbiology, Alborz University of Medical Department of Sciences, Karaj, Iran [email protected], [email protected], [email protected], [email protected], [email protected]
Background: Human Toxocariasis exteraintestinal-migration of Toxocara species, is a worldwide helminthic zoonosis in many places of undeveloped world. In this helminthes different developmental stages and remarkable changes occurs which make a complicated life cycle MicroRNAs are small (18-22 nucleotides) noncoding RNAs that have critical role in post-transcriptional gene regulation Characterization of small RNAs in Toxocara canis (in three developmental stages; egg, larvae and mature worm) will be a fundamental step in understanding of the parasite biology and parasite-host interactions. The aim of this study is evaluation of miRNA expression and they potential function in the development and maybe pathogenesis of Toxocara canis. Methodology and Principal Findings: Using the Real Time- PCR approach, we identified 10 predicted and 10 conserved miRNAs for Toxocara canis (eggs, larva and adult worms). The analysis of the data revealed differences in the expression level of conserved miRNAs among the three developmental stages of Toxocara Canis.
Keywords: Toxocara Canis, MicroRNAs (miRNAs), Real Time PCR
P170
The Frequency of Erythrasma in Outpatients in Khuzestan Province, Over a Period of Seven Years (2006-2012)
Abdollah Rafiei 1, Sharif Maraghi1, Nasrin Amirrajab 2 *, Mehdi Barajeeh 3, Sadegh Tehrani 3
1- Department of Medical Parasitology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran/ Health Research Institute, Infectious and Tropical Diseases Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran, 2- Department of Medical Laboratory Sciences, School of Paramedicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran /Health Research Institute, Infectious and Tropical Diseases Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran, 3- Student Research Committee, School of Paramedicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran [email protected], [email protected], [email protected], [email protected]
Background: Erythrasma, caused by Corynebacterium minutissimum, is an intertriginous infection usually found in individuals with susceptible factors such as diabetes, obesity, and darker skin. It has more prevalent frequency rate of infection in tropical or subtropical regions due to humidity and moisture. Current study was conducted for evaluation frequency of erythrasma in outpatients attending to Ahvaz Iran-Zamin diagnostic laboratory, during seven years (2006- 2012). Materials and Method: From 13531 cases were referred to Iran Zamin Medical laboratory diagnosis from different parts of Khuzestan providence during 2006 to 2012. Age distribution was 1-67 years old. The skin of inguinal, inframammary, interdigital and axillary areas of all the patients were scraped and examined by direct examination with 20% potassium hydroxide (KOH). In addition smears stained with 2.5% methylene blue. Results: Among suspected patients, 677 (4.93%) had erytherasma infection. Regarding age distribution, 377 (55.7%) were male and 300 (44.3%) were female. Erythrasma was detected in interdigital regions 40 (6.0%) and in other regions such as inguinal, inframammary and axillary areas examination was positive in 637 (94%) of these patients. Conclusion: Our results indicated existence of erythrasam infection in the Khuzestan province. Regarding site of infection, groin area had more frequency rate (80%) of infection, which is in agreement with previous researches.
Keywords: Erythrasma, Frequency, Corynebacterium Minutissimum, Superficial Mycoses
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 197 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P171
Monoclonal Antibody against Visceral Leishmaniasis: Production by Application Techniques
Ezzat Nourizadeh 1 *
1- Biology College of Science University of Mohaghegh Ardabili, Ardabil, Iran [email protected]
Background and Aim: Visceral Leishmaniasis (VL) caused by the Leishmania infantum complex is the most serious form of the disease and is frequently fatal if left untreated. In humans, parasites from the Leishmania infantum complex cause visceral leishmaniasis or Kala-azar. Leishmaniasis is one of the important contagious diseases caused by parasites of the genus Leishmania in which is common throught the world and Iran. Taking all above mentioned issues into consideration the aim of this study was to designing applicable technics for production of monoclonal antibodies (mAbs) against visceral leishmaniasis. Methods: At first, standard strains were cultured and L. infantum obtained. After that, immunization of mice and determining of antibody titer were performed. For hybridoma cell formation cell merging was done and limiting dilution method was applied for monoclone determining. Results: In this study achieved Anti- Amastigotes leishmania infantum monoclonal antibodies(a ALimAbs) including the (4B4 F III,1A4 F III, 4G1 F III and 8E4 F III)-producing hybridomas, previously obtained by fusing myeloma cells with L. infantum- infected mouse splen. Conclusion: Production of mAbs may be useful for the development of a diagnostic method based on antigen detection, of visceral leishmaniasis in humans. The benefit of using mAbs as follows high sensitivity, specificity, low cost, and easy portability, based on the detection of leishmania products, may constitute an important achievement to improve the clinical management of suspected leishmaniasis cases.
Keywords: Monoclonal Antibody, Visceral Leishmaniasis, Production by Application Techniques
P172
Detection of Giardia Lamblia and Cryptosporidium Parvum Infections among 1-10 Year-Old Children Using Floatation, Sedimentation and Modified Ziehl-Neelsen Methods
Samira Mirzavand 1, Mohammad Taghi Ahady 1 *, Amir Arasteh 1
1- Department of Biology, Rasht Branch, Islamic Azad University, Rasht, Iran [email protected], [email protected], [email protected]
Introduction: Giardia lamblia and Cryptosporidium parvum infections are prevalent among children, and these infections can lead to serious outcomes such as hypovitaminosis of fat soluble vitamins, decrease of electrolytes, body growth retardation and mortality. Therefore, timely and precise diagnosis of these infections using non-invasive techniques is very important. The aim of this study was to detect the infection of Giardia spp. and Cryptosporidium spp. among 1-10 year-old children in Ardabil (northwest of Iran), by floatation, sedimentation and modified ziehl-neelsen methods, and to evaluate diagnostic power of these methods. Materials and Methods: 377 children (1-10 year-old) were selected for the study. Stool sampling and assays were done in Bu-Ali hospital and Parasitology Laboratory of Ardabil Branch, Islamic Azad University, between August 2016 and November 2016. Sheather`s sugar floatation, formalin-detergent sedimentation and modified ziehl-neelsen methods were performed to detect the infection of Giardia lamblia and Cryptosporidium parvum. Results: Overall prevalence of Giardia spp. and Cryptosporidium spp. infections were 3.18% and 1.32%, respectively. The prevalence of Giardia infection among the boys was significantly more than the girls (sig. =0.000, p<0.05). The diagnostic power of modified ziehl-neelsen (for detection of Cryptosporidium) and sheather`s sugar floatation (for detection of Giardia) methods was better than formalin-detergent sedimentation method (sig. =0.048, p<0.05). Conclusion: From the results of this study, we concluded that sheather`s sugar floatation method is an appropriate, inexpensive and non-invasive technique for diagnosis of Giardia lamblia infection. We also recommend the modified ziehl-neelsen method for detection of Cryptosporidium parvum infection.
Keywords: Giardia Lamblia, Cryptosporidium Parvum, 1-10 Year-Old Children, Sheather`s Sugar Floatation, Formalin- Detergent Sedimentation, Modified Ziehl-Neelsen
198 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P173
Antibacterial Effects of Bio-Nano Structures on Clinical and Standard Strains of Methicillin-Resistant Staphylococcus Aureus
Marziyeh Askarinia 1 *, Abdolmajid Khosravani 1, Farideh Abbasloo 1, Asghar Sharifi 1
1- Faculty of Medicine, Department of Microbiology, Yasuj University of Medical Sciences [email protected], [email protected], [email protected], [email protected]
Introduction: Methicillin-resistant Staphylococcus aureus is one of the most common nosocomial pathogens. This bacterium is due to innate ability and acquired resistance to antibiotics used in treatment, has become one of the major concerns of human health. So it is essential to study new approaches to identify anti-bacterial materials. The aim of this study is to determine the antibacterial effects of bio-nano structures on standard and clinical strains of the bacteria. Materials and Methods: To determine the antibacterial effect of bio nano structures microdilution methods were used. Concentrations of bio-nano structures in the range of 0.4 to 1 mg / ml were used. MIC and MBC were determined by ELISA and cultivation on solid medium, respectively. Finally, cell viability was assessed using MTT assay. Results: Bio- nano structures at the concentration of 0.6 mg/ml showed the highest inhibitory effect on the growth of Methicillin- resistant Staphylococcus aureus, whereas, at the concentration of 0.7 and 0.9 mg/ml the most lethal effect were observed. Conclusion: Overall, the results of the study showed that the bio-nano structures have antimicrobial properties against Methicillin-resistant Staphylococcus aureus. Therefore, using them in the treatment of infections caused by these bacteria is useful and also be used as disinfectant.
Keywords: Antibacterial, Bio-Nano Structures, Methicillin-Resistant Staphylococcus Aureus
P174
In Vitro Antifungal Activity of Alcoholic and Aqueous Extracts of Shallot Mountain in Comparison with the Terbinafine
Iman Bahrami Abdehgah 1 *, Fardin Sadeghfar 2
1- Department of Microbiology, Yasouj Branch, Islamic Azad University, Yasouj, Iran, 2- Department of Chemistry at the Researcher, Nanoscience and Nanotechnology –Nanophyssics, University of Yasouj, Yasouj,Iran [email protected], [email protected]
Objective: Infections caused by the opportunistic yeast Candida albicans has been increased dramatically in recent decades. Currently, the antifungal agents derived from plants have attracted considerable attention. Shallot is an herb that has antimicrobial and antifungal properties. The aim of this study was to determine antifungal activity of Alcoholic and aqueous extracts of Shallot Mountain against isolates of candida albicans. Methods: Twenty clinical isolates of C. albicans were identified from the immunocompromised patients and C. albicans ATCC 10231 as a reference quality-control strain was employed. Alcoholic and aqueous extracts of Shallot Mountain were tested for in vitro antifungal activities against isolates of candida albicans. Antifungal susceptibilities were performed using the CLSI standard reference method (M27-A3). The effects extracts of Shallot Mountain were also compared with those of terbinafine. Results: Shallot Mountain showed antifungal activity against all the isolates tested with MIC values ranging from 0.195 to 3.125 mg/ ml for alcoholic extract and 0.78 to 12.5 mg/ml for aqueous extract. The minimum bactriocidal concentration (MBC) of alcoholic and aqueous extracts ranged from 0.39 to 6.25 mg/ml and 1.56 to 25 mg/ml, respectively. Conclusions: The results indicate that extracts of Shallot Mountain has antifungal activity and might be promising, at least, in treatment of fungal-associated diseases from mentioned fungi.
Keywords: Shallot Mountain, Terbinafine, Candida Albicans
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 199 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P175
Prevalence of Bacterial Otitis Externa in Patients from Yasouj
Maral Gharaghani 1, Marzieh Taheripour Sisakht 1 *, Gholamabas Sabz 1, Fateme Tavakoli 1, Haniye Mohammadi 1, Khadije Gheysarpour 1
1- Department of Yasouj University of Medical Science, Yasouj, Iran [email protected], [email protected], [email protected], [email protected], [email protected], [email protected]
Introdaction and Aim: Otitis externa is defined as the inflammation of the external ear canal and it is a common clinical issue in general medicine. This study aimed to determine the prevalence of bacterial otitis externa in patients from Yasouj. Materials and Methods: In this study 219 patients with bacterial otitis externa (123 females and 96 males) were sampled. The discharge samples were removed from the ear canal by using speculum put on the slide and cultured on appropriate media. All isolated bacteria were identified based on traditional methods. Results: Our study shows that 76(34.7%) of cases were yielded the different species of bacteria. Inaddition, 45(59.2%) and 31(40.8%) of positive cases were females and males respectively. The most frequent agent was Staphylococcus aurous (33%), followed by coagulase negative Staphylococcus (22.4%), Pseudomonas aeruginosa (20%), Klebsiella spp. (13.1%), Proteus spp. (6.6%) and Escherichia coli (5.3%). Conclusions: Our results indicate that S.aurous was the most abundant bacteria isolated from patients with otitis externa. Thus, it is recommended these organisms should be considered as etiologic agents in protocols for treatment of otitis externa.
Keywords: Bacterial Otitis, Etiology, Yasouj
P176
Studying the Prevalence of Campylobacter Jejuni in Adults with Gastroenteritis from Northwest of Iran
Ahmadreza Mobaien 1 , Farzaneh Moghaddam 2 , Samaneh Talebi 1 , Afsaneh Karami 1 , Hamidreza Amirmoghaddami 1, Ali Ramazani 2 *
1- Infectious Diseases Unit, Vali-e-Asr Hospital, Zanjan University of Medical Sciences, Zanjan, Iran, 2- Department of Biotechnology, School of Pharmacy, Zanjan University of Medical Sciences, Zanjan, Iran [email protected], [email protected], [email protected], [email protected], [email protected] [email protected]
Objective: Considering the increased rate of global incidence of campylobacteriosis and since there is no sufficient data in this field in the developing countries such as Zanjan province in the Northwest of Iran, this study was designed to investigate the prevalence of these organisms in the patients with gastroenteritis. Methods: This descriptive- analytical study included all adult patients with acute diarrhea admitted to the University Hospital of Zanjan province were enrolled in a one-year period 2013- 2014. Stool samples was checked for white blood cells and lactoferrin and then samples with WBC ≤ 5 and positive for lactoferrin selected for amplification of mapA gene of Campylobacter jejuni by Real-time PCR assay. Results: In this study, 864 patients (410 men and 454 women) with acute diarrhea were enrolled; of which about 718 patients had WBS less than 5 and 146 patients had the WBS more than 5 in the stool exam. All Inflammatory diarrhea samples were test for lactoferrin and 111 cases of the samples tests were positive for lactferrin. Forty samples out of 111 were positive for C. jejuni by real-time. Conclusion: The finding of this study showed that the prevalence of inflammatory diarrhea caused by campylobacter is high in this study. The need for education and awareness in this area, as well as appropriate treatment, is so important.
Keywords: Campylobacter Jejuni, Real-Time PCR, Gastroenteritis
200 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P177
Frequency and Antibacterial Resistance Patterns of Bacteria Isolated from Bloodstream Infections, Use of a Bactec Method, Tehran, Iran
Fatemeh Fallah 1, Seyedeh Mahsan Hoseini-Alfatemi 1 *, Saeid Maham 1, Zari Gholinejad 1
1- Pediatric Infections Research Center, Mofid Children’s Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran [email protected], [email protected], [email protected], [email protected]
Infectious diseases are now the world’s biggest killer of children and young adults, it is also the basis of debilitating illness all through the year keeping children away from school and preventing adults from working. This study was conducted to determine the prevalence of bacteria recovered from bloodstream samples by Bactec at different hospital wards and to evaluate their antibacterial resistant patterns. During September 2014 to September 2015, referred blood samples in Bactec bottles from admitted patients at Mofid children and Shahid Rajaee hospital, affiliated to shahid Beheshti University of medical science, Tehran, Iran. Positive cultures were purified and identified according to standard methods. Resistance of bacteria to different antibiotics was determined by Kirby-Bauer disk diffusion method. In this study 202 bacterial pathogens isolated from hospitalized patient, 89(44.1%) were gram-positive and 113(55.9%) were gram-negative.The common isolates were: pseudomonas aeruginosa57 (28.2%), coagulase-negative Staphylococci37 (18.3%), Staphylococcus aureus27 (13.3%), Escherichia coli18 (8.9%), Klebsiella pneumonia15 (7.4%), Enterococcus and Entrobacter14 (6.9%). The highest resistance rate of gram negative bacteria was against cefotaxime(68.1%) followed by ceftazidime(63.7%), gentamicin(48.6%) and amikacin(59.5%).The highest resistance rate of gram positive bacteria was against erythromycin(65.1%) followed by clindamycin(60.6%), penicillin(57.3%) and oxacillin(56.1%). Bloodstream infections are important causes of morbidity and mortality in patients, especially among children. Use of the BACTEC method allows early confirmation in patients with clinically symptom. It can guide clinicians in the rational use of antimicrobial treatment by confirming diagnosis and identifying drug- resistance.
Keywords: Bloodstream Infections, Antibacterial Resistance, Iran
P178 A 7-Year Period (2010–2016) Retrospective Study of Human Cutaneous Leishmaniasis in Ahvaz County, Southwest of Iran
Masoumeh Mardani Kataki 1 *, Mehdi Tavalla 2, Elham Eskanndari 3
1- Member of Student Research Committee, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran Email Address, 2- Department of Parasitology, Medicine Faculty, Ahvaz Jundishapour University of Medical Science, Ahvaz, Iran, 3-Eastern Hygiene center of Ahvaz, Ahvaz Jundishapour University, Ahvaz, Iran [email protected], [email protected], [email protected]
Objective: Cutaneous Leishmaniases is one of the greatest hygiene problems in Eastern Mediterranean and Iran is one of this six country which in it Aleppo boil is one the most prevalent kind of infectious disease. (Iran, Iraq, Saudi Arabia, Sudan, Tunisia, Syria). This study is performed to determine the prevalent of Aleppo boil in year, season, location, urban or rural people. To evaluate the epidemiology of cutaneous leishmaniasis in Ahvaz County, capital of Khuzestan Province, and southwest of Iran over a 7-year period. Since Khuzestan Province is endemic for this disease. Methods: This is a retrospective study of cutaneous leishmaniasis cases from 2010 to 2016 referred to health care centers of Ahvaz County. Results: A total of 360 cases were studied. Out of which 58.6% were males and 41.4% were females. About 79.8% of patients resided in urban areas and 20.2% resided in rural areas.Frequencies during the years 2010, 2011, 2012, 2013 , 2014 ,2015 and 2016 were 21(5.8%),81( 22.5%), 30(8.3%), 24(6.6% ) ,86(23.8%), 61(16.9%) and 57(15.8%) respectively. The maximum number of cutaneous leishmaniasis patients was observed in winter. About 47.1% of lesions were on hands, 18.2% on feet, 11.6% on face, 21.5% on two organs and 1.7% on more than two organs. Conclusions: In this study 58.6% of patients were males and this may due to their job, more contact with Leishmania vectors and wearing fewer cloths.
Keywords: Aleppo Boil, Ahvaz, Season, Gender
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 201 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P179
Demonstration of Polymorphism among Brucella Isolates by Pulsed-Field Gel Electrophoresis Technique
Nasrin Bahmani 1 *, MohammadYousef Alikhani 1, Aazam Elahi 2, Mohammad Reza Arabestani 2, Reza Mirnejad 3
1-Brucellosis Research Center, Hamadan University of Medical Sciences, Hamadan, Iran- Hamadan University of Medical Sciences, 2-Department of Microbiology, Kermanshah University of Medical Sciences, Kermanshah, Iran- Kermanshah University of Medical Sciences, 3-Molecular Biology Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran- Baqiyatallah University of Medical Sciences [email protected], [email protected], [email protected], [email protected], [email protected]
Introduction: Brucellosis is a worldwide bacterial disease and infects human and variety of animals and caused by Brucella species which are facultative and intracellular bacteria that genetically have a high degree of homology.Thus, the typing of Brucella spp and biovars for epidemiological purposes by molecular method is necessary. Background and Aims: The aim of this study is identification and molecular typing Brucella spp by biochemical tests, PCR and PFGE techniques. Materials and Methods: A collection of 27 positive Brucella strains including 13 patients and 14 animal samples were isolated from 2 regions of Tehran and Hamadan in Iran. Phenotypic and biochemical tests to distinguish Brucella spp were done and confirmed by PCR method using primers omp2a (1100bp). Then PFGE analysis by xbaI for typing strains was done. Genetic similarity and difference among strains and groups calculated with BioNumeric total lab software. Results: The results were positive for all of Brucella strains by phenotypic, biochemical tests and PCR method. According to PFGE analysis results classified into 11 distinct groups and 17 genotypes, seperately. Genetic similarity in some of human or animal groups was 100% and animal strains showed a comparatively less degree of homology than the clinical strains. Conclusion: These findings have shown that PFGE method is a powerful epidemiological technique for Brucella outbreak. Investigation and differentiation of Brucella isolates from geographically widespread locations.PFGE is capable of showing genetic similarity and difference among groups and Brucella strains well.
Keywords: Brucella, PFGE, Molecular Typing
P180
Study of Dermatophytic Fungal Species in Covered Swimming Pools in Yazd, Iran
Hossein Jafari Nadoshan 1 *, Mohammad Hassan Ehrampoush 2, Mohammad Taghi Ghaneian 2, Somayeh Rahimi2, Farzaneh Khabiri
1- College Pharmacy, Shahid Sadoghi University of Medical Sciences, Yazd, 2- School of Public Health, Shahid Sadoghi University of Medical Sciences, Yazd [email protected]
Background: Superficial and cutaneous fungal infections can be transmitted through using covered swimming pools. This study was conducted in order to assess the dermatophyte fungi, pH and residual chlorine levels in covered pools of Yazd, Iran in 2009. Methods: In the current descriptive cross-sectional study, carpet sampling was used to collect 100 samples from different areas of 4 randomly selected covered swimming pools in Yazd. Mycosel agar plates were cultured in order to separate and identify dermatophytic fungal species. The pH and residual chlorine levels of the water were also measured in this study. Findings: Seven out of 100 samples had positive culture of pathogenic dermatophyte fungi. Dressing rooms, sauna and foot-bath parts were contaminated. Anthropophilic Trichophyton mentagrophytes (6cases) and Epidermophyton floccosum (1 case) were isolated especially in summer. Water pH ranged from 7.8 to 8.2 and residual chlorine levels varied from 0.4 to 0.7 mg/l. Conclusion: Since anthropophilic dermatophytes were identified in the studied swimming pools, pathogenic fungi can be transmitted from swimmers to the environment of the pool. Therefore, paying attention to personal hygiene by swimmers, preventing the entrance of infected people, and maintaining good sanitation conditions in the water and environment of the swimming pools are necessary Keywords: Swimming Pools, Contamination, Dermatophyte, Residual Chlorine.
202 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P181
Evaluation of Drug Resistance Pattern of Escherichia Coli Starins Isolated from Gachsaran Shahid Rajaei Hospital Patients
Iman Bahrami Abdehgah 1 *, Fardin Sadeghfar 2
1- Department of Microbiology, Yasouj Branch, Islamic Azad University, Yasouj, Iran, 2- Department of Chemistry at the Researcher,Nanoscience and Nanotechnology –Nanophyssics,University of Yasouj, Yasouj,Iran [email protected], [email protected]
Background & Objectives: Urinary tract infections are the second most common type of body infection. Escherichia coli is the most common cause of urinary tract. Antibiotic resistance due to the widespread use of antibiotics is one of the major causes of failure in antibiotic treatment. The aim of this study was to investigate the rates of antibiotic resistance among isolates of Escherichia coli from Gachsaran Shahid Rajaei Hospital patients. Materials & Methods: In this cross- sectional study, 126 isolates of Escherichia coli, obtained from inpatients and outpatients, were studied. The identity of the isolated was confirmed by bacteriologic methods. In the following, drug sensitivity definition test to 10 antibiotics was done via the disk diffusion method. Subsequently, Minimum inhibitory concentration (MIC) of the resistant isolates to Ciprofloxacin and Imipenem was measured using the microdilution broth method according to the CLSI standards. Escherichia coli ATCC 25922 as a reference quality-control strain was employed. Results: The resistance rates of the isolates to Ciprofloxacin and Imipenem by disk diffusion method were 36.50% and 21.42% and by microdilution broth method were 30.95 % and 15.87% of all the isolates, respectively. Conclusion: These results show higher resistance of Escherichia coli to Ciprofloxacin and Imipenem as compared to the results in previous studies. Further investigation will shed light on how to more effectively battle antibiotic resistance of virulent microorganisms.
Keywords: Escherichia Coli, Antibiotic Resistance, Minimum Inhibitory Concentration
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 203 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Personalized Medicine P182
P182
Personalized Medicine and its Role in Prevention and Treatment (Review)
Mohsen Farhang Zargar 1 *, Hadi Rezaei Yazdi 2, Bahareh Razeghi Haghighi 2, Bahareh Rezaei 2
1- Student of Laboratory Sciences, Student Research Committee, Jahrom University of Medical Sciences, Jahrom, Iran 2- Assistant Professor of Medical Bacteriology, Department of Microbiology, School of Medicine, Jahrom University of Medical Sciences, Jahrom, Iran [email protected], [email protected], [email protected]
Introduction: Personalized medicine (PM) refers to targeted therapy with individual characteristics of each patient. Patients who have the same respond to treatment are grouped and treated by using (PM). The main advantages of (PM) included: decrease of diseases and complications, increase of healing, finding proper treatment and medicine and best dosage of that. Material & Methods: This study is prepared by using PubMed and Google scholar browsers and reviewing 20 articles from 2012 to 2016 with “personalized medicine, treatment, prognosis, prevention and infectious disease” key words. All of articles are pointed according to type of study, methodology, indices, impact factor and top articles are chosen.Results: (PM) using risk factor of disease, can diagnosis disease before clinical symptoms. Studies show there is a relationship between different responses to medicine and differences in genes. So, physician can choose best and effective treatment by molecular screening. Many of the drug complications caused by changes in drug metabolism enzyme genes, thereby in some persons drugs eliminate before reaching to targets. In (PM), suitable drugs are prescribed and possibility of disorders and complications are decreased. Today, widespread consumption of antibiotics has led to resistance. (PM) can be helpful for choosing proper medicine and dosage of that according to patient`s genetic information.Conclusion: (PM), with emphasis and change in medicine from treatment to prevention, direct choose of proper treatment, optimum treatment and reduce trial-and-errors, decrease of drug complications is important. This science is very new in our country and needs more clinical and laboratory researches.
Keywords: Personalized Medicine, Treatment, Prevention, Infectious Diseases Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Prenatal Screening: New Methods and Challenges P183 – P189
P183
The Need to Establish Gene Banks in the Prevention of Some Diseases
Shirin Fakhri Moradi Azami 1 *, Kaivan Khassi 1, Firuz Ebrahimi 2, Roknodin Mehdizad 1
1- Health Department-Kermanshah University of Medical Sciences-Kermansha, Iran 2- Imam Hossein University [email protected], [email protected]
Introduction a wide variety of genetic diseases in different countries and regions, and in our country due to family marriages, disabilities resulting from genetic illness from a variety of relatively Method This paper describes a method of analysis and prevention of some diseases is examined with a view to the creation of gene banks. Results Iran despite the many ethnic and genetic diversity of a country called heterogeneous. Half of the deaths of infants and children due to genetic problems There is also a family marriages in different ethnicities, disabilities resulting from genetic diseases, lack of genetic counseling before marriage and non-genetic examination of the fetus during pregnancy Conclusion Ethnicity can quickly create gene banks to separate us from certain diseases such as cancer and mapping of diseases and prevention of cardiovascular disease and other diseases that have a genetic predisposition, drug development, treatment, research, deal with biological threats and applications scientific and technical assistance and to improve health and future generations have an important effect.
Keywords: Genetics, Prevention Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P184
Next Generation Sequencing in Diagnosis of Genetic Diseases, Potentials and Limitations
Sadeq Vallian 1 *
1- University of Isfahan [email protected]
With the introduction of the next generation sequencing technology, a new widows has been opened to the diagnosis of genetic diseases. Using this technology, which is growing very fast, the sequencing of the whole genome for each individual has become possible in a very reasonably short time. Therefore, the screening of the whole genome for polymorphic and pathogenic variations has become possible. In the present article, I will introduce the concept of the technology and my laboratory experience in the successful application of the technology in the diagnosis of 120 different genetic diseases in the past two years, and the limitation and potentials of the technology will be discussed.
Keywords: Next Generation Sequencing, Genome Screening, Genetic Diseases
P185
Evaluation Serum Malondialdehyde as a Biomarker for Oxidative Stress by Measuring Level &TG, Cho, HDL and LDL in Pregnant Women and its Relationship with Miscarriage
Mina Hemati 1, Mohammad Arezoumandan 2*
1- Biochemistry, Birjand University of Medical Scienses, 2- Ghaenat Health and Care, Birjand University of Medical Scienses [email protected], [email protected]
Despite improvements in prenatal care, still 5-10% of all pregnancies end prematurely. The preterm birth are leading causes of infant mortalityin developed countries.Pregnancy causes biochemical changes in the body.Increased energy demand and absorb oxygen, leads to oxidative stress by free oxygen species. Various factors can predispose mothers to oxidative stress in pregnancy. this study aimed to assess the relationship between premature birth and serum MDA (a marker of oxidative stress) during pregnancy. Research Methodology: This study was conducted on pregnant women in Qaen.Base on health records, the blood sample of individuals with history of abortion, stillbirth or preterm were taken. The level of MDA was measure byELISA. Results: In this study, lipid profile and the level of MDA of 43 pregnant women were compared with 28 non-pregnant women The mean age of pregnant women 27/02±6/02 and in non-pregnant was 33/14±8/4. Pregnant women were divided into group: pregnancy with risk factors(n= 20) without risk factors(n= 23). In pregnant women, eight(18/6%) cases hadpreterm delivery and 35(81/39%)cases had term delivery. MDA levelwas significantly higherin pregnant women.Triglyceride, cholesterol andLDL levels was significantly higher in pregnant women in comparison with non-pregnant women (p<0/05).The mean MDA was significantly higher in womanwith preterm delivery compared to women with timely delivery. In addition, the level of MDA in woman with a history of abortion and preterm delivery was higher in comparison with cases without history. Conclusion: These results show that level of MDA can be consider as a risk factor for preterm delivery.
Keywords: Oxidative Stress, Malondialdehyde, Preterm Delivery
206 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P186
Incidence of Neonatal Hyperphenylalaninemia Based on HPLC ConfirmatoryTechnique in Mazandaran Province, Northern Iran (2007-2015)
Parvaneh Afshar 1 *, Daniel Zamanfar 2, Mohammad Shokrzadeh 2, Hamed Rouhanizadeh 1, Einollah Asadpoor 1
1- Research and Development Unit of Referral Laboratory, Deputy of Health Management, Mazandaran University of Medical Sciences, Sari, Iran, 2- Department of pediatrics, School of Medicine, Mazandaran University of Medical Sciences, Sari, Iran [email protected], [email protected], [email protected], [email protected] [email protected]
Classic phenylketonuria (PKU) is a metabolic disorder. The purpose of this study was to assess about epidemiological factors of PKU phenotypes in a neonatal screening program for Mazandaran, Iran. Neonates screening for PKU were conducted by Serum Phenylalanine level based on a biochemical technique by ELISA and then HPLC methods. Of the screened newborns 407,244 (48.7% girls and 51.3%boys) 14girls and 13 boys neonates were diagnosed definitely as having 465 cases suspicious phenylketonuria .The incidence of phenylketonuria was 0.66in10,000 which assessed in different severity; Severe PKU 1:67,874, Mild PKU 1:45,249 and HPA 1:33,937 at the living births. In addition, don’t detect any cases of NonClassic PKU.Although the consanguineous marriage is a major cause of that pattern particular in Iranian, but this difference in the present study not very significant. Now screening should be executed for all of the family that they have the familial history of PKU in Iran. According to varies actual of prevalence and incidence rate of PKU reported a real patient and taking PKU with Mild Phenylketonuria and Hyperphenylalaninemia, it is recommended, the will provide the Phenylketonuria reports based on the severity of the disease.
Keywords: Neonatal Screening, Phenylketonuria, Blood Spots, ELISA, HPLC, Mazandaran, Iran
P187
Factors Related to the Birth of Children with Thalassemia Major
Hossien Babaei 1 *, Zeinab Rabee 2, Fatemeh Malcgi 2
1-Salman Farsi Hospital- Social Security, 2-School of Nursing and Midwifery- Bushehr University of Medical Sciences [email protected], [email protected], [email protected]
The purpose and importance of research: thalassemia major one of the most common genetic diseases in Iran. Thalassemia major patients with regular blood transfusions are needed for survival. And their specific effects of repeated blood transfusions and costly to the individual and society. This review study aimed to assess factors associated with children born with thalassemia major Method: This study was a systematic review of SID, google scholar and pubmed search is done Result: Several studies showed that married parents to get married before the screening program, reported normal screening result, married couples with a diagnosis of thalassemia minor, false negative results prenatal diagnostic tests, the lack of action by parents diagnosed with thalassemia major for fetus, lack of prenatal diagnostic tests are related with the birth of children with thalassemia major. Discuss and Conclusion: The results show that premarital screening, screening for couples that are married before the screening program, counseling and continuing education, especially for couples carriers of thalassemia are major role in decreasing the number of children born with thalassemia major.
Keywords: Thalassemia Major, Children, Risk Factor
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 207 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P188
Seroprevalence of Cytomegalovirus, Rubella and Toxoplasma in Women and its Association with Recurrent Pregnancy Loss
Alireza Isazadeh 1 *, Saba Hajazimian 1, Nasrin Kazemipour 2, Mehdi Majidpour 3, Taha Bagheri 3
1- Department of Genetic, Tabriz Branch, Islamic Azad University, Tabriz, Iran, 2- Department of Physiology, Science and Research Branch, Islamic Azad University, Tehran, Iran, 3- Department of Veterinary Medicine, Tabriz Branch, Islamic Azad University, Tabriz, Iran [email protected], [email protected], [email protected], [email protected], [email protected] Background and Aim: Recurrent pregnancy loss (RPL) is a multifactorial disorder with three or more successive miscarriage before 20th weeks of pregnancy. Congenital infections are the most important factors in threatening of the fetus health in humans. The aim of this study was to investigate seroprevalence of Cytomegalovirus, Rubella and Toxoplasma infection and its association with recurrent pregnancy loss in women with recurrent spontaneous abortion and healthy women.Materials and Methods: This is a case- control study. A total of 320 patients and 320 healthy controls took part in this retrospective study. The subjects were women aged 20-35 years who had experienced at least three consecutive abortions before 20th week of gestation. Blood samples (5ml) were taken and the serum was separated. Antigen test (IgG) was performed for rubella, cytomegalovirus and toxoplasma using direct ELISA. Ultimately, the obtained results were analyzed by SPSS statistical software (version 23). Results: The results showed that 27 person in the case group and 9 person in the control group were positive for presence of Toxoplasma IgG antibodies (P=0.003). On other hand 41 women the in patients group and 19 women in the healthy group were positive for presence of Cytomegalovirus IgG antibodies (P=0.0006). Also 39 person in the case group and 14 person in the control group were positive for presence of Rubella IgG antibodies (P=0.0014). Conclusion: In this study was observed significant difference between prevalence of rubella, cytomegalovirus and toxoplasma antibodies in women with recurrent pregnancy loss and healthy women with successful deliveries.
Keywords: Cytomegalovirus, Rubella, Toxoplasma, RPL
P189 Noninvasive Prenatal Diagnosis by Fetal Cells and Fetal Nucleic Acids in Maternal Blood
Sara Hesami 1 *, Miganoosh Simonian 2, Meysam Mosallayi 1 1- Genetics Research Center, University of Social Welfare and Rehabilitation Sciences, Tehran, Iran, 2- Isfahan, Uuniversity of Medical Science [email protected], [email protected], [email protected]
Invasive techniques of prenatal diagnosis such as amniocentesis and chorionic villus sampling (CVS) are expensive and associated with risks to the mother and the fetus. This has led to the effort by many groups to develop methods to recover fetal cells and cell-free nucleic acids by non-invasive means. Fetal NRBCs have been the most commonly studied cell type, for this reason: The frequency of NRBCs in the fetus early in gestation is relatively high; These cells are also fairly well differentiated and likely to have a limited life span in the maternal circulation and finally, there are specific markers for the enrichment of these cells. However, the fetal cells in maternal blood are rare and a sophisticate technique is required for their enrichment; currently, the most commonly employed techniques are fluorescent activated cell sorting (FACS), magnetic cell sorting (MACS), and charge flow separation. The important point of using cell-free nucleic acids in maternal plasma for prenatal diagnosis is quality of the recovered DNA and messenger RNA (mRNA) fragments in conjunction with presence of maternal nucleic acids. Using the fetal-specific markers includes epigenetic differences between the placenta and maternal blood cells that could be used as a fetal-specific marker and also fetal-specific mRNA in maternal plasma that provides another source of fetal specific biomarkers. Techniques such as fluorescence in-situ hybridization (FISH), bisulfite sequencing, digital polymerase chain reaction (Digital PCR) and reverse transcriptase-multiplex ligation-dependent probe amplification (RT- MLPA) are used in Noninvasive Prenatal Diagnosis (NIPD) by fetal cells and Fetal Nucleic Acids.
Keywords: Fetal Cells, Non-Invasive, Maternal Blood, Fetal Nucleic Acids
208 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Scientific Management in Laboratory P190 – P192
P190
Investigation the Standards of a Military Hospital Diagnostic Laboratory Based on National Accreditation Standards in 2015
Seyed Ali Mousavi Jazayeri 1 *, Ali AliakbarEsfahani 1, Manaf Abdi 1
1-Medicine Sea Research Center- Baqiyatallah University of Medical Sciences [email protected], [email protected], [email protected]
Introduction: Accreditation means the systematic investigation or assessment of health service centers with specific standards. The standards that emphasis on constantly improving the quality, centering of patients, increasing patients and staff security. To obtain the acceptable and satisfying results, it is essential to minimize laboratory errors, to run properly programs including assurance quality, control quality, continuous improvement of quality, and total quality management. Laboratory is one of the important hospital units that plays an important role in providing health care and also operating laboratory standard can provide high quality service in a hospital. In this study, it was tried to investigate accreditation of laboratory standards as well as the quality of services in the laboratory of a military hospital. Research Method: This study is a cross sectional research. It was based on the accreditation standard check list of a hospital laboratory through interview, observation and analyzing documents and it was conducted in this field. Results: This hospital obtained grade 80 for the “management of laboratory samples with considering the principles of quality as planned and performed”. And also it gained 72 percent for “Management of reference experiments that was conducted in the scheduled way”. Discussion and conclusion: In a study titled evaluation of the quality of hospital laboratories affiliated to University of Medical Sciences, Isfahan, Iran in 2013. Some of the hospitals, in this study, obtained the average rating 60 between 70, and some gained favorable rating above 70.
Keywords: Quality, Hospital, Accreditation, Laboratory Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P191
A Survey of the Laboratory Staffs’ Knowledge about Hepatitis B and C in Shiraz University of Medical Sciences, 2015
Fariba Ghahramani 1 *, Mohammad Mahboubi 2
1-School of Health, Shiraz University of Medical Sciences, Shiraz, Iran- Shiraz University of Medical Sciences,2-Faculty of Medical, Abadabn University of Medical Sciences- Abadan University Of Medical Sciences [email protected], [email protected]
Background and aims: Viral hepatitis is one of the most important infectious causes of premature death in the world. Because of the importance of hepatitis and the prevalence of contamination with hepatitis virus, a survey of the Laboratory staffs’ Knowledge about viral hepatitis was conducted in Shiraz University of Medical Sciences. Methods: This is a study performed in cross-sectional method (descriptive and analytic).The study included 300 employees of the medical labs of Shiraz University of Medical Sciences.A structured questionnaire was designed to obtain information about their knowledge of hepatitis. Results: in this study it was observed that 80% of laboratory staff had well knowledge about symptoms and treatment of hepatitis. Overall, 93% of employees were well aware about this disease transmission and 99.5% were well aware of the agent of Hepatitis. The employees’ awareness about the high risk persons and ways to prevent were 60% and 55% respectively. Conclusions: Due to the low level of staff knowledge in the field of prevention of hepatitis and so these individuals are at risk for this disease, in-service training is essential for all laboratory personnel.
Keywords: Viral Hepatitis, Knowledge, Shiraz University of Medical Sciences, Laboratory, Hepatitis B
P192
Epidemiological Investigation of HIV Patients Referred to Shiraz Behavioral Counseling Center, 2014
Fariba Ghahramani 1 *, Najmeh Haseli 2
1- School of Health, Shiraz University of Medical Sciences, Shiraz, Iran, 2- Vice Chancellor for Research, Shiraz University of Medical Sciences, Shiraz, Iran [email protected], [email protected]
Background: AIDS is a fatal disease that can affect human immune system and makes patients vulnerable to opportunistic infections. HIV/AIDS is known to affect an individual not only physically but also mentally, socially, and financially. The present study aimed to epidemiological investigates in HIV patients referred to Shiraz Behavioral Counseling Center. Methods: The present descriptive cross-sectional study was conducted on 129 HIV patients in Shiraz Behavioral Counseling Center who were selected through convenience sampling. The study data were collected through the questionnaire included the demographic information, such as age, sex, marital status, employment status, length of disease, level of education and history of drug abuse. Results: In this study, 61.1%, 20.6%, and 18.3% patients were single, married, and widowed or divorced, respectively. In addition, 21.3% employed, while 78.7% were unemployed. Finally, 85.2% of the patients had a history of drug abuse, while 14.8% did not. 61.8%, 21.1% and 17.1% of the patients were infected through needle use, sexual and other route of transmission, respectively. Of these patients 89.8% were male and 10.2% were female. The patients age ranged of 25-58 years (mean ± SD = 38.9 ± 6.7).The highest frequency of disease related to 35-44 years age group. Conclusion: In fact, employment are the most important concerns of HIV patients; therefore, a large number of financial and, consequently, psychological problems of the patients could be resolved by providing job opportunities. These findings show such patients’ needs for psychological support, more psychological interventions, and creation of appropriate job opportunities.
Keywords: HIV, AIDS, Behavioral Counseling Center. Epidemiology
210 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis
Iranian Association of Clinical Laboratory Doctors
Standardization and Harmonization of Clinical Laboratory Tests Results P193 – P195
P193
Comparison of Measured Values of Bilirubin in Three Methods; Manual (Diazo), Devices, and Transcutaneous Bilirubinometery. Can Reduce the Need for Blood?
Fatemeh Hosseinpour Soleimani 1 *, Eisa Safavi 2, Masoume Hemmat Zadeh 3
1- Master Student of Hematology,Student Research Committee, Bushehr University of Medical Sciences, Bushehr, Iran, 2- PhD of Social Health, School of Paramedicine, Bushehr University of Medical Sciences, Bushehr, Iran, 3- Laboratory Expert, Bushehr Persian Gulf Hospital, Bushehr, Iran [email protected], [email protected], [email protected]
Background: Neonatal jaundice is often benign but in high doses, is neurotoxic and cause brain damage (kernicterus). Bilirubin is measured in three methods: Manual (Diazo test), devices, and Transcutaneous Bilirubinometery (bilicheck). Device method as manual, need blood from the vein. In bilicheck due to the capillary tube, infant’s capillaries can be used. This is non-invasive and can prevent pain, skin damage and infection. This research aimed to compare between three methods, in order to ensure the accuracy of Transcutaneous Bilirubinometery. Materials and Methods: This cross- sectional analytical study was conducted Bushehr. Newborns’s Bilirubin within six months, by three manual methods, devices (by autoanalyzer) and BiliCheck, were measured. The Data from 230 children by the use of Spss21, and descriptive statistics (frequency, mean and standard deviation) and inferential statistics (Pearson correlation coefficient test, paired t-test and ANOVA with repeated measures) were evaluated. Results: The average age of population was 1 month and 38 days. Average levels of bilirubin by manual method, device and Bilicheck was 14/99±3/97, 14/19±3/94, 13/79±3/92 respectively. There was a significant correlation between the three methods (pvalue<0/05). Confidence interval for the difference between manual and device was 0/74-0/84, manual and bilicheck was 1/23-1/35 and device and bilicheck was 0/44-0/54. Conclusion: There is a significant correlation between the three methods. Although significant difference was obtained using the average spot, but according to the average distance is calculated with 95% confidence, there is no difference between the three groups.Thus bilicheck is accurate as assessment tools and a suitable alternative for measuring serum bilirubin.
Keywords: Bilirubin, Bilirubinometer, Jaundice, Kernicterus, Neurotoxic Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
P194
Make an Autoclave Instrument Which Is Able to Measure the Amount of Liquid That Exit
Aghileh Ebrahimi 1 *, Autos Eftekgar 2, Nazgol Alan 2
1- University of Kashan, 2- Farzanegan 1 [email protected]
In this project we have made a laboratory device based on Pascal law. This plate will work by the mechanic energy and it is possible to autoclave and contains the several vents have been prepared in order to measure the liquid which pour in the plates. Usually in cells culture process the sterilized liquid will be poured in the plates by hand which increase the risk of Microbial contamination, but in this plate number of tubes that are connected to a main container have been organized to guarantee a hygienic process and also because of it’s accurate calibration (mL) the measurements will be more precise. Its first sample has been made by plastic, but finally we used a kind of glass that could handle the pressure and temperature that autoclave cause.
Keywords: Autoclave, Pascal Principle, Pressure
P195
A Safety Syringe, to Reduce the User Infecting Risk
Saeideh Sadeghi Neshat 1 *, Nasim Aliabadi 2, Zahra Omid 2
1- Department of Biology, Science and Research Branch, Islamic Azad University, Tehran, Iran, 2-Farzanegan3.tehran, Iran [email protected], [email protected], [email protected]
Introduction: Medical syringes are widely used for injection, Venipuncture and also some different lab tests. In case of non-compliance with safety standards, injection can be dangerous and even life threatening for both sides. Annually, about 16 billion injections are done in developing countries that at least 50 percent of them are unsafe. About 200 types of infections, including HIV-HBV-HCV, can be transmitted through the blood. Health clinical or hospital staffs and who are in contact with infected blood and body fluids like Doctors-nurses-technicians of laboratories-hemodialysis workers- blood banks and blood transfusion service-dentists and their assistants are considered as high risk individuals. Although the range of using syringes is very large and injection is carried out even in houses. Here, to increase the speed of injections, syringes with costly, Manufacturable and safety door were made. Material and methods: In the aim of reducing infection, a trumpet like needle cap was designed. The cap also has a part to conserve the user finger. The designed cap was constructed and tested on 50 people for being more safety and useful than common caps. Results: the new needle cap was so safe and significantly could reduce the Risk of infection. The cap could increase the user Security. Discussion: According to reports, the common needle caps are so unsafety. Annually, a large number of people are being infected by needle stick. The new design cap was more manufacturable than its similar device. This needle cap could reduce the user error and its consequent treatment costs.
Keywords: Syringe, Injection, Venipuncture, Infection, Needle Stick
212 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 WorkShops Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
W1
Personalized Medicine is the Combination of Genomics Medicine and Traditional Medicine Which Will Shape the Future Medicine
Mohammad Ali Saremi *, Masoud Houshmand
[email protected], [email protected]
Progress of biotechnology and molecular science and finding biological process in illnesses is opening new windows in health develop in the society. Our knowledge of molecular and cellular mechanism is leading the medicine toward true pathways. The Omics era which is including genomics, proteomics, transcriptomics and metabolomics has started to prepare us for exploration of different illnesses reason and to find the best new way to treat them. However these days the most of diagnostics and treatments are based on clinical signs of the patient, In Iranian traditional medicine more signs were important that some of them were different in each patient which is truly like the personalized medicine. In future medicine, each patient will be treated based on his/her genomic data. Which is the reason of the people difference and the need to have different therapeutic plan for each patient what we call individualized medicine.
Keywords: Personalized Medicine, Traditional Medicine, and Genomic Medicine
W2
Blood Group Determination Test and Finding Non
Mostafa Moghaddam 1 *
1- Head of Immunohematology Reference Laboratory Iranian Blood Transfusion Organization [email protected]
ABO & Rh (D) discrepancies can be divided in to two groups. Those related to red cell testing and those that are related to the ABO serum testing. In the daily testing of the patients/ donors blood samples the technologist should answer the questions arising from problem associated with the red cells or serum with unexpected or missing antibodies. In this workshop some interesting real life commonly encountered ABO& Rh (D) hospital blood bank laboratory cases will be presented and logical scientific and technical approach are utilized to resolve the problems. Participants of the workshop are encouraged to utilize their working knowledge to give their suggestions to help to potentially resolve any discrepancies observed in the presented cases. Finally the best decision for transfusion recommendations of blood products will be discussed.
214 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
W3
First Report of Immunohematology External Quality Assessment Scheme (EQAS) in Iran
Mostafa Moghaddam 1 *, Shadi Voghufi 2 , Parastou Peihani 2
1- Head of Immunohematology Reference Laboratory Iranian Blood Transfusion Organization, 2- Immunohematology Reference Laboratory Iranian Blood transfusion Organization [email protected], [email protected]
The blood transfusion laboratory plays a key role in transfusion chain and quality failures in testing or other laboratory procedures can have serious implications for the recipients of blood and blood products.Continuous quality improvement requires ongoing assessment and review of the effectiveness of all elements of the quality system, using both internal and external mechanisms, to ensure that the defined quality standards are being met consistently.An important component of a quality system for blood transfusion services is a program called EQA that plays a vital role in making provision of blood safer.Testing samples of known but undisclosed content, raise standards of performance in blood transfusion services, hospital blood banks and other laboratories undertaking blood group serology testing for diagnostic purposes. This will ensure the provision of appropriate, compatible blood and blood products for transfusion External Quality Assessment Scheme (EQAS)EQAS is a recognized scheme for organizing EQA.This can be a local scheme or may be organized at national, regional or international level. An effective way of identifying process problems within the Laboratory that provides the laboratory with an objective view of its performance relative to other laboratories. An identical set of samples which should be processed in the same way as routine clinical samples and a comparison of the participating laboratory performance results with other centers.Information generated by the scheme helps to improve the overall quality of the blood transfusion laboratory and the safety of the blood and blood products it issues for transfusion.In this workshop for the first time we will report and discuss the results and analysis of the results obtained from more than 700 hospital blood bank laboratories and other medical centers that participated in the National EQAS program within two years.
W4
Accreditation of Med Labs Based on ISO-15189
Parveen Sharma 1 *
1- Professor and Head, Department of Biochemistry, All India Institute of Medical Sciences, Jodhpur, India [email protected]
Accreditation is a third party attestation procedure that provides feedback to applicant laboratories regarding their performance relative to International standards for technical competence. ISO 15189 is the present standard for assessment of laboratory competence and is based on ISO 17025 and ISO 9001. Accreditation to ISO 15189 involves the independent assessment of a laboratory to determine competence, impartiality and consistency. It also checks the qualifications and on-going competency of personnel involved in medical laboratory examinations, the laboratory accommodation, equipment, reagents and supplies, factors in different testing phases (pre-analytical, analytical and post-analytical), and quality assurance considerations etc. ISO 15189 requirements consist of two parts, management requirements and technical requirements. Management requirements deals with the requirements of all parts of ISO 9001, moreover it includes the requirement of conformity assessment body (impartiality and independence from any other party). Technical requirements deals with the requirements of laboratory competence (e.g. personnel, facility, instrument, and examination methods). It also requires laboratories to participate in proficiency testing(s) and ensure that examination results have traceability of measurements along with necessary implementation of uncertainty of measurement. Implementation of ISO 15189 will result in a significant improvement in medical laboratories management system and their technical competence. Accreditation of medical laboratories will improve laboratory service and be useful for patients. Besides getting international recognition and acceptance, accreditation gives confidence to both the laboratory and referring physician that the test report is reliable to diagnose an individual patient and also for empirical management by generating reliable epidemiological data
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 215 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
W5 Point of Care Testing in Pediatrics: Challenges and Recent Advantages
Khosrow Adeli 1 *
1- Postdoc, Clinical Biochemistry, University of Toronto, PhD, Biochemistry, University of Ottawa [email protected]
There is little question of the importance of an accurate and timely laboratory result in the treatment and management of patients in acute settings, i.e. emergency department (ED) and neonatal intensive care unit (NICU). Often time is of essence, and delays in either sample transportation and/or the laboratory reporting of results compromise the health of the affected individual. These problems become more prominent in cases where the sample is hard to obtain, since there is reluctance to unnecessarily expose these patients to repeated blood sampling. An example being a newborn, where blood volume is a concern, specifically in the acutely ill and/or premature neonate. The effect of sample volume becomes much more significant in the case of premature neonates (gestational age < 28 weeks at birth) where 1 mL of blood taken from a 0.5 kg premature neonate would represent approximately 2.5% of the neonate's total blood volume. Therefore, the ideal situation in these patients would be bedside testing with minimal blood required to determine the physiological state of the patient. This concept is referred to as Point-of-Care Testing (POCT), and in general some advantages for POCT devices are rapid turnaround time (TAT) and convenience, with the most prominent device being the glucose meter, originally developed for the adult diabetic patient population.Over the past 18 years, we have established an extensive pediatric point of care testing program at the Hospital for Sick Children in Toronto and have implemented the use of glucose meters, iSTATs, Blood Gas instruments, ACT systems, Urinalysis, and Fecal Occult Blood in the NICU, ER, Operating Room, Cardiology, IGT and several other areas. As part of our continued quality control and monitoring quality care programs, we have analyzed data from the NICU glucose meters, the laboratory, and other departments to identify problems encountered with the POCT program in the NICU after their introduction.Along with the implementation of a more precise and accurate meter, Toronto Hospital for Sick Children has made a fundamental shift in the provision of point of care testing by implementation of complete eConnectivity. Previously, meters, results, quality control, and operators were all managed on paper. With the implementation of the Nova Statstrip glucosemeter, vendor supplied middleware was implemented which allowed electronic management of the meters, quality control and operators but still required the manual (paper) reporting of glucose results. The final step to full connectivity occurred with the implementation of vendor neutral middleware (AegisPOC) that allowed for all of the earlier middleware functionality, and the addition of automatic glucose meter resulting to the patient electronic medical record (EMR). The combination of improved quality management via the mitigation and/or elimination of pre- and post-analytical sources of error and the ability of clinicians to have access to immediate centralized data as is offered with full connectivity was found to provide additional improvements to clinical outcomes and lead to improved test utilization and less need for duplicate testing in the central laboratory.In my presentation, I will focus on a recent clinical study of Nova glucose meter implementation in the NICU setting. The objective of this study was to evaluate the analytical and clinical performance of new glucose point of care testing (POCT) devices implemented into the intensive care unit (NICU). Within-run imprecision, correlation with a plasma hexokinase assay, and interferences with hematocrit were studied on the Nova StatStrip and SureStep Flexx meters. For the clinical evaluation, glucose meter and lab results were analyzed (600 admissions) over a two year period in the NICU. Outcomes measured were the rate of hypoglycemia, frequency of critical results, average length of stay (LOS), clinical sensitivity/specificity for detecting hypoglycemia, and accuracy of the meters in the clinical setting. Nova demonstrated superior precision and accuracy compared to the SureStep meter. Improved analytical performance translated into improved detection of critical glucose results, and demonstrates the importance of implementation of accurate meters in the NICU. Hospital-wide eConnectivity solutions also enhance the benefits of bedside glucose monitoring and significantly reduce the rates of patient error including pre-analytical and post-analytical errors.
W6
Laboratory Diagnosis of Campylobacter
Homa Forouhash Tehrani 1 *
1-Retired Faculty Member of Iran University of Medical Sciences homf_27 @yahoo.com
Compylorbacter is one of the factors of diarrhea in developing countries especially in children. As its diagnosis in laboratories is less in attention. In this workshop it tries introducing this bacterium and its diagnostic methods as a stride in identification in laboratories of country.
216 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
W7
Six Sigma and Interpretation of Internal Quality Control Results
Reza Mohammadi *
Clinical laboratories with a long background in the use of internal quality control (IQC) have statistics as a tool for revealing error test before the reported results of patients. However, IQC has not reached its maturity and still is in change for reaching a congenial function. Nowadays, it is recommended in order to increase IQC efficiency first, measuring function method base on six sigma methodology defined and then, according to each method implementation of IQC program, including some control samples and vestegaard code of conduct in use is defined.
W8
Anti- Mullerian Hormone Diagnostic Values and Measuring Methods
Reza Salman Yazdi 1 *
1- Department of Andrology Reproductive Biomedicine Research Center Royan Institute for Reproductive Biomedicine ACECR Tehran, Iran [email protected]
Anti- mullerian hormone (AMH) is a glycoprotein from TGF- β family which secrets in male gender by sertoli cells in testicular tissue and in female gender by granulosa cells, ovarian follicle. Measuring MH serum level provides very efficacious index for analyzing procreation status in both female and male gender in which its abnormal volume in broad spectrum of disorders is observed. And determining its serum level in evaluating and gonads functional status and bound disorders are important.At the moment AMH measuring especially in analysis of female ovaries status, diagnostic and proceedings of polycystic ovary syndrome treatment and granulosa cell tumor are used.As a sample, measuring ovarian reserves is one of the important indexes of viable pregnancy in females which nowadays is measured by AMH. This estimate not only helps the level of achievement infertility, but also by the medium of results examination can speculate the requirement of an individual to ovarian stimulation drugs. Accurate and opportune recognition of ovarian reserves are important discussions which with the use of it prevents dawdling of referred patient and therefore the patient has possibility to schedule the process of treatment.These hormones at the moment and commonly with the use of methods such as enzyme immunoassay (ELISA), immunofluorescence, chemiluminescence and electrochemiluminescence can be measured which in our country most of the centers use the method. In this workshop will be held with the aim of expressing clinical importance and ELISA value, diagnostic AMH, evaluation and comparison of measuring methods existed together.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 217 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
W9
Quality Assurance Workshop in ELISA
Seyyed Mehdi Boutorabi 1 *, Ali Mir Jalili 1
1- Pishtaz Teb Zaman Co [email protected]
One of the important tests that have been implemented in diagnostic medical laboratories is ELISA test which is used in variety of domain. In many hormonal, cancerous markers, infectious diagnosis and suchlike tests with the use of this method through the laboratories in the country is being used and its results can play a significant role in clinical decisions. The employment of a proper ELISA test and reassured acquired results of it entails knowing of diverse effective factors and prevention of errors from each one of them. The regarded framework for prevention of errors and problems of ELISA is known as quality assurance in ELISA. At the outset of quality assurance workshop, quality plan in hormonology and the use of statistical indexes in quality control and quality assurance will be explained. The participants in this discussion with the use of each statistical parameter will be acquainted. In continuation, the participants will be familiarized in regard to the used samples and their problems and errors which can occur occasionally before the test. This issue will be presented with other effective factors prior to the tests and effects of them on varied aspects before the analysis and existing disorders in ELISA evaluation will be discussed. In continuation of an appropriate method of ELISA and effect of personnel, material and equipment will be assessed on accuracy of results and errors during the analysis and mentioned by examples. Participants will be acquainted with internal and external quality control methods in ELISA method and expressed the process of implementation from quality control results in obviation of problems and measuring adjustments. Standardized methods in endorsement of an ELISA kit with practicality as a segment of quality assurance program will be expressed. In conclusion, one of the other most practical parts of the workshop is presented as solving problems and quality assurance which and operator might confront problems in doing ELISA test will be discussed and assessed.
W10
Laboratorial Challenges in Diagnostic Rheumatologic Diseases
Ali Reza Palangi *
Rheumatologic diseases is the most chronic prevalence with world widespread and increasing incidents in our country. Systemic Lupus Erythema Erythematosus, Rheumatoid Arthritis, Sjogren’s Syndrome, Polymyositis and Dermatomyositis can be mentioned as types of rheumatologic diseases.According to important diagnostic effects and proper managing and opportune to these diseases on quality of afflicted patients’ lives, variety of laboratorial tests in this domain have developed and used by laboratories. But according to nature of diseases and existing laboratorial tests, there are plenty of challenges in this field in the face of laboratories which the most paramount ones are:1- Medication effects, physiological and pathological situations on laboratorial tests (pre-analytic cases),2- Recognition of existing tests types and proper usage of each individually 3- Recognition of method types and laboratorial implementation tests 4- Choice of proper method and implementation tests by laboratories 5- Approach method with incongruous result tests 6- Clinical diagnostic criteria of rheumatologic diseases and their connection with laboratorial tests.
218 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
W11
Flow- Cytometry Principles and Applications
Azam Kazemi *
1- Orientation with fundamental and primary rudiments of flow-cytometry 2- Recognition and perception of different parts of a flow-cytometry apparatus 3- Perception and accurate recognition from different apparatus setting suchas Voltage, Gain, Threshold, Compensation 4- A glance at quality control in flow-cytometry 5-Utilization flow-cytometry apparatus software accurately and academically such as Back gating, Gating and recognizing different charts related to results analysis 6- Flow-cytometry applications in researches and diagnosis 7- A glimpse to flow-cytometry appliable discussions in researches such as analytic discussions of cell cycle, analysis of apoptosis and counting primary stem- cells. 8- A glimpse to diagnostic flow-cytometry applications 9- Academic workshop including sample preparation, work with flow-cytometry apparatus mindray and reading analysis of functional sample with flow-cytometry apparatus.
W12
Utilization of Western Blot in Laboratory Diagnoses
Satar Gorgani Firozjaey *
Western blotting is one of the blotting methods which is used for diagnosing and analyzing of proteins. Western blotting which also known as immunoblotting or protein blotting is one of the key techniques in molecular cell biology and used usually for special protein presence recognition in group of cellular proteins. Western blot procedures are: 1-Protein extraction from cell or tissue 2- All protein separation based on measure with the use of protein electrophoresis on SDS- PAGE gel 3- Transmission of separated proteins to a membrane (blotting) 4-Dedicated recognition of target protein with primary and secondary dedicated antibody (probing) 5-Manifestation of protein band in membrane surface and band stabilization 6-Analysis of stabilized bands by “Image J” software
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 219 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
W13
Evaluation of Operation of Software in the Field of Invitro Diagnostic Medical Devices (IVD)
Fariba Sabzavi *
Assessment indexes of a software contains the evaluation of life circulation of the software, designing, formation, accreditation, quality, expression and variability, usability, the internal consistency, and the functional evaluation of a product will evaluate in basis of user satisfaction and increasing in efficiency. Also, usability principles which contain effective effectiveness, efficiency, immunity, facilities, educability and the ease of use will play a special role. The main purpose of this workshop is introducing tools and assessment indexes and estimating of usability amount of software in IVD area and evaluating the probable level of risk in them. Due to the consideration, could say confidently that evaluating the respective software according to introduced indexes, could follow appropriate results in increasing quality and software efficiency and its use zone.
W14
Non- Invasive Technique Analysis in Fetal Aneuploidy NIPD
Mohammad Taghi Akbari *
In regard to the importance of usage of free DNA in blood circulation in screening and diagnosing diseases and especially its application in fetal aneuploidy analysis which recently are confirmed and verified in approved studies (validation) in some centers by academic institutions.
220 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
W15
Modern Approaches to Fetal Health Screening
Javad Soltani Rezaee , Mohammad Kouhestani
1- History and screening definitions 2- Screening terminology including Analyte, DR, FPR, LR, OAPR, PPV, IPR, Sensitivity and Specificity 3- Difference between screening and medical diagnosis, positive and negative screening results concept 4- MOM and Cut Off definition 5- Medical ultrasound and its effect on screening 6- Diagnostic methods in pregnancy age and its effect on screening 7- Medical ultrasound new markers and its effect on screening 8- Biochemical markers and its effect on screening 9- First and second three-month screening and pregnancy weeks 10- Comprehensive examination 11- Screening interpretation 12- Screening quality control 13- Laboratorial quality control 14- Software quality control 15-Cell free DNA (Reflex DNA)
W16
Selection, Evaluation and Control of Laboratory Diagnostic Kits
Mohammad Reza Malek 1 *
1- Technology Laboratory
The usage of new medical diagnostic kits is common and ordinary in most of the country laboratories. It is evident that each laboratory has to have necessary information for primary evaluation before choosing the new kit. Also, in regard to different effect of factors on laboratorial function approach, it must evaluate new kit capability in laboratory with the use of academic method. The next important issue is the choice of appropriate quality control with regard to new kit capability in order to monitor the perfect function during the use. In this workshop we attempt to represent in a very appropriate and practical with laboratories requirements, different stages of confirmation and endorsement, the type of quality control program and dealing in case of results being out control.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 221 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
W17
Introduction to Immunix Device Specification, Advantages, Errors and Operational Concept of an ELISA Processor
Morteza Falah 1 *
1- Measurement Equipment Co. Isfahan
Immunix device is a fully automated Elisa Processor with plenty of special features which in this workshop we are about to explain its features and capabilities and compare its functional features to other systems. In this workshop we attempt to analyze function, assets, features and probable errors on an Elisa processor and also compare different systems and advantages and disadvantages of each one.
W18
Customer Relationship Management in Clinical Laboratory
Mehrdad Vanaki 1 *
1- PhD in Medical Sciences, Tehran University of Medical Sciences [email protected]
1- Fundamental foundations in the field of customer relationship management (laboratory clientele, new and loyal client, influence on client’s emotion)2-Enquiry complaints procedures in clinical laboratory base on ISO 10002 and15189 3-Evaluation and provision of real demands of client in clinical laboratory (doctor, patient, employees, nursery, equipment and good supplying organizations, etc.) 4- Evaluation of satisfaction and dissatisfaction methods in clinical laboratory (questionnaire form, daily enquiry complaint form, face-to-face interview, final audit results and reports, etc.) 5- Final information analysis in the field of customer relationship and its role in increasing quality and quantity of laboratory organization.
222 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
W19
Different Way to Set Performance Specifications with Emphasis on Biological Variation
Sverre Sandberg1 *
1- The Norwegian Porphyria Centre (NAPOS),Haukeland University Hospital, NO-5021 Bergen Norway [email protected]
The Organisers and the Scientific Programme Committee (SPC) of the Strategic Conference of the European federation of clinical chemistry and laboratory Medicine (EFLM) on “Defining analytical performance goals 15 years after the Stockholm Conference on Quality Specifications in Laboratory Medicine”, held in Milan (IT) on November 24-25, 2014, are pleased to report on the success of the conference. The primary aim was to revisit the “Consensus Agreement” from the Stockholm Conference investigment to what extent the advocated hierarchy is still valid or if it should be changed. A revision of the original hierarchy established by the Stockholm Conference was presented to the meeting with opportunity for discussion and feedback by conference participants. This revision further underwent modification and explanatory additions by the SPC in an attempt to simply the hierarchy and improve its application by various stakeholders.In this revision, the hierarchy is simplified and represented by three different models to set analytical performance specifications. There is general agreement that some of these are better suited for certain measurands than for others.Model 1. Based on the effect of analytical performance on clinical outcomes,This can, in principle, be done using different types of studies: 1- Direct outcome studies – investigating the impact of analytical performance of the test on clinical outcomes, 2-Indirect outcome studies – investigating the impact of analytical performance of the test on clinical classifications or decisions and thereby on the probability of patient outcomes, e.g., by simulation or decision analysis.
W20
Evaluation of 26-Courses External Quality Assessment Program (EQAP)
Seyed Mohammad Hasan Hashemi Madani *
The 9th annual program and the26th course of EQAP was held until 2017. In order to analyze the function of the program in the previous 9 years and possible evaluation of increasing efficiency in the program and in this respect of increasing aims of laboratory quality activities, a workshop will be held.It is hoped that with the presence of laboratories activists in this workshop, permanent results will be acquired.
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 223 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
W21
Protein Thermal Shift™
Behzad Damavand * 1, Amir Karimi 1
1- Arina Hayat Danesh
The Protein Thermal Shift™ (PTS) research solution, made up of Protein Thermal Shift™ reagents and software, is a new application for our qPCR instruments, whereby the melting functionality is applied to protein thermal melt experiments. The new Protein Thermal Shift™ Analysis Software and Reagents enable high throughput screening of proteins to measure their thermal-stability as well as to identify ligands, mutations, modifications, or buffer conditions that increase a protein’s stability as measured by the melting temperature (Tm). This new capability significantly reduces the time and cost for screening samples for these applications relative to currently available methods.
224 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Authors Index
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 225 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Aarabi, M., P117, 118 Aliabadi, N., P196 Abasi, M., P148 Aliakbar Esfahani, A., P191 Abbasi , Y.A., P149 Aliakbari, F., O57, P124 Abbasi, E., O89 Aliasgharpour, M., P96 Abbasi, M., P151 Alikhani, M.Y., P179 Abbasloo, F., P173 Alimohammadi Asl, H., P88 Abbaszadegan, M.R., O103 Alinezhad, F., P71 Abdi, M., P191 Alizadeh, A., P146 Abdoli, H., P107 Alizadeh, S., O43 Abdollahi, M., P89, 98 Allahkarami, S., O87 Abdollahi, S., O93 Alltaha, H., O23 Abdollahian, E., P137 Almasi, N., O41 Abdul Tehrani, H., O82 Amanzadeh, A., P83 Abdullahi, A., O11 Ameri, M., P149 Abedian, S., P101 Amin Marashi, S.M., P30 Abedimanesh, N., P120 Amin, A., P131 Abedini, M., P56 Amini, A., P84 Abedizadeh, R., P136 Amini, M., P53 Abroun, S., P72 Amini, S., P45 Abtahi, H., O81, 85 Amir Esmaili, M., O115 Adeli, K., O67, W5 Amiri, M., P154 Afrasiabi, A.R., O62 Amirmoghaddami , H., P176 Afrisham, R., P142 Amirrajab, N., P170 Afsar, S., P20 Amri, J., O75, P60 Afshar, P., P59, 161, 166, 187 Amrooni, A., P107 Afshari, M.A., P9 Ansari, M., P58 Agazadeh, S., P144 Ansari, Z.S., O18 Aghaei, A., O84 Arab Rahmatipour, G., P114 Ahadizadeh, A., P100 Arabestani, M.R., P179 Ahadizadeh, M., P100 Arasteh, A., P172 Ahady, M.T., P172 Arezoumandan, M., P186 Ahangar Oskouee, M., P10, 20, 36, 71, 75 Arjmand, M., P83 Ahangarzadeh Rezaee, M., P12 Asadi, M., P85 Ahmadzadeh, Z., P108 Asadi, N., O37 Ahmed, S., P127 Asadpoor, E., P59, 187 Ajami, A., P106 Asadzade Oghadaei, H., P76 Akbari, M.T., O24, W14 Asgarpanah, J., P6 Akbari, S., O33 Ashrafi, M.R., O30 Akbari, Z., P83 Askarian, F., P65, 87 Akbarzadeh Khiavi, T., O120 Askarian, R., P65, 87 Akhi, M.T., P36 Askarinia, M., P173 Alaie, S., P140 Aslanian, R., P2 Alan, N., P195 Asnavandi, S., P53 Alavi, S.M., P55 Atai Kachuai, Z., O80 Alebouyeh, M., O9 Atashi, A., P74 Ali Moghadam, K., O46, 48 Attarpour Yazdi, M.M., P39, 40, 44, 167
226 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Avan, A., P78 Cheraghian, B., P142 Azaad, A., P149 Azadi, M., O82 Dabbagh Bagheri, S., P53 Azami, M., P82 Dadkhah, F., O92 Aziemzadeh, M., O88 Dalimi, A., P128 Azimi, M., P126 Daneshpour, M., O65 Azimi, S., O60 Dankoub, F., P8, 17 Azmakan, R., P133 Damavand, B., W21 Babaei, H., P188 Dargahi, H., O107 Babahajian, W., P51 Darvishvand, R., P108 Babahosini, H., P14, 15 Davoudi Dehaghani, E., P53 Babaki, H., O6 Dehghan Manshadi, M., P130 Badali, H., O94 Dehghan, M., P25 Baghbanian, S.M., O99 Dehghani, M., P49 Bagheri, F., P5,8, 31, 32, 33 Dehghani, R., P107 Bagheri, H., P18 Delavari, A., P116 Bagheri, H., P69 Delfan, M., P93 Bagheri, K.E., O118 Derakhshanfar, E., O43 Bagheri, T., P189 Deyhim, M.R., P125 Bahadory, S., P169 Deylami Khiabani, Z., P80 Bahari, F., P10 Didevara, E., O85 Bahmani, N., P179 Dolatabadi, S., P16, 148 Bahoush, G.R., O27 Bahrami Abdehgah, I., P174, 181 Ebadi, N., P77 Bakhshandehnosrat, S., O57 Ebadollahi Natanzi, A., P114 Bakhtiari, M.R., O32, 64 Ebrahimi, A., P195 Banazadeh Baghi, H., P10, 20, 71 Ebrahimi, A., P4 Barajeeh, M., P170 Ebrahimi, F., P184 Barak, M., P2 Ebrahimi, M., P62 Barani Beyranvand, H., P151 Ebrahimi, R., P111 Barfi Poosalar, A., P14, 15 Edalati, M., P106 Barouni, M., O115 Eftekgar, A., P195 Barzegar, F., P146 Eftekhari, M., P122 Bayat, M., P95 Ehrampoush, M.H., P180 Bayaz, B., O70 Ehsani, Z., P149 Beikmohamadi, A., O101 Eizadi, B., O76 Beikzadeh, L., P169 Elahi, A., P179 Besharati, A., P28, 29 Emamgholipour, S., O71, 72, P58 Bidoki, S.K., P133 Emami, S.A., O25 Birjandi, S., P131 Emdadi, D., P48 Bitaraf, E., O22 Erami, M., P162, 163 Bizhani, B., P116 Erfanian, S., P35 Blaghirad, N., P164 Eskandari, E., P99, 178 Boustani, H., P70 Eskandari, Z., P100 Boutorabi, S.M., O114, W9 Eslamdoust, Z., P22, 155, 157 Eslami, F., P55
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 227 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Eslami, R., P126 Ghaheri, A., O92 Etesanpour, A., O38 Ghahramani, F., P192, 193 Ghahremani, H., P3 Fadaei, R., O72 Ghahremanlou, M., O19 Fakhar, M., P151 Ghanati, F., P72 Fakhri Moradi Azami, S., P184 Ghanbari, A., P163 Falah, M., W17 Ghaneian, M.T., P180 Fallah, F., P177 Gharaghani, M., P175 Fallah, P., P85, 108, 169 Gharamaleki, H., P123 Fallahizadeh, S., P142, 152 Gharemani, M.H., O76 Farahani, H., O75 Ghasemi, F., P62, 78 Farahi, F., P133 Ghavamzadeh, A., O48 Faraji, F., P141 Ghayour Mobarhana, M., O74, P62 Faraji, Z.A., P34, 35 Ghazizade, H., P62 Farhadi, S., P141 Ghaznavi Rad, E., O89 Farhang Zargar, M., P34, 35, 182 Ghelich Vatan, M., P108 Farid, M., P108 Gheysarpour, K., P175 Faridi, R., O76 Ghezelbash, B., P144 Farrokhi, M., P151 Ghiyasi, M., P52 Farshbafei, J., P75 Ghobeiti, I., O21 Farzam, A., P54, 73 Ghods, R., O44 Fasihi, M., O83 Gholami, H., O108 Fathi, M., O86 Gholinejad, Z., P177 Fattahi, E., P157, 158 Ghorbani Aghjo, A., P65 Fazel Tabar Malakshah, A., P104 Ghorbani, R., P119 Feizabadi, M.M., O11 Ghotaslou, A., P70 Feizhadad, M., P152 Gorgani Firozjaey, S., W12, P93 Feizi, F., P151 Gorgij, S., P42 Feizi, I., P88 Ferns, A.G., O74, P62 Habib Khan, A., P127 Firoozeh, F., P169 Hadinedoushan, H., P130 Forouhash Tehrani, H., W6 Hafez Parast, M., O28, 39 Foroutan, S., P129 Hagh Nazari, N., P38 Fouladi, N., P88 Haghani Nasimi, A., P98 Fouladi, S.M., O4 Haghani Nasimi, O., P89 Haghi, M., P92 Garshasbi, M., O97 Hajazimian, S., P79, 189 Gatabi, A., P113 Hakemi Vala, M., O8 Gazizadeh, H., O74 Hallaji, M., O85 Germanos, M., O122 Hamoonnavard, S., P136, 160 Ghaemi, E.A., P18, 147 Hamzavi, S., O70 Ghafari, N., P110, 111 Hamzehloo, Z., O81 Ghafari, S.R., O100 Hamzeloo, G., O123 Ghaffari, P., O48 Hantoushzadeh, S., O106 Ghaffari, S.H., O48 Haratian, K., P85 Ghaffarifar, F., P128 Hasani, A., P12
228 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Hasanjanzadeh, P., P22, 135, 155 Jahedi Zargar, M., P85 Hasannejad, G., P156 Jalalian, M., P104, 146 Hasel Mehri, A., P104 Jalili, A., P38 Haseli, N., P193 Jalilvand, A., P140 Hashemi Madani, S.M.H., O23, W20 Jasemi, S.S., O11 Hassanian, S.M., P78 Javadi, G., P24 Hassanpour, M., O88 Javadi, K., P108 Hassanzadeh, M., O116 Javadzadeh, M., P119 Hatami, N., P11 Javid, N., P147 Hatamipour, H., P149 Jedari Seifi, S., P36 Hazrati, S., P48 Jelowdar, A., P142 Hedari, Z., P82 Hedayati, M., O68, 77 Kabiri, K., P159 Heidari, A.E., P85 Kafami, L., P108 Hejazi, S.H., P66 Kalantari, S., P95 Hemati, M., P186 Kalhor, M., P54, 73 Hemmat Zadeh, M., P194 Karami, A., P176 Hesami, A., P50, 112 Karim Mansour, M., P37 Hesami, S., P190 Karimi, A., W21 Hesari, A.R., P78 Karimi, F., P66, 67 Heydari Moghadam, S., P162 Karimi, F., P67 Hezarkhani, S., P124 Karimi, M., O43, P122 Hojati Far, M., P106 Kariminejad, A., O95 Hoseini Alfatemi, S.M., P177 Karimipoor, M., P103 Hoseini Hamedanpour, F., P31 Karkhaneh, A., P58 Hoseni, F., P13 Kaviani, S., P74 Hoseyni Pour, K., P154 Kazemi, A., W11 Hoshmandi, Z., P68 Kazemi, F., P152 Hossein Zadeh Gan, M., P146 Kazemipour, N., P189 Hosseini, A., O86 Kazempour, S., P154 Hosseini, B., P90 Keller. R. ,O124 Hosseinpour Soleimani, F., P107, 194 Keramatipour, M., O98 Hosseinzadeh Shanjani, B., P27 Keshavarzi, F., P143 Hosseinzadeh, S., P84 Khabiri, F., P180 Houshmand, M., W1 Khalaf Adeli, E., P55 Khalaji, F., P117, 118 Imanparast, S., P21, 37, 164 Khalili, M.R., P46 Irandoost, M., P94 Khalili, S., O77 Isazadeh, A., P79, 189 Khamooshi, S.S., P45 Khansarinejad, B., O81, P81 Jafari Nadoshan, H., P180 Khakifiroz, A.R.,O3 Jafari, F., P158 Khassi, K., P184 Jafari, M., P25, 26, 28, 29 Khazaee, M., P62 Jafari, Z., P117, 118 Khazaei, M., O74 Jafri, L., P127 khodabakhshi, A., P149 Jahani, S., P82, 165 Khodabande, Z., P108
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 229 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Khodavasi, S., O94 Maraghi, S., O83, P170 Khomayezian, M., P32 Mard Soltani, M., O77 Khorshid, A., P72 Mardani Kataki, M., P178 Khoshakhlagh, A., O92 Mardani, A., P151 Khoshdel, A.R., P93 Mardani, M., P99 Khoshi, A., P119 Marvinam, R., P130 Khosravani, A., P173 Masjedi Arani, A., P163 Khosravi, A., O80 Maspi, N., P128 Kiani Ghalesardi, O., P70 Meftahi Molayaghoub, B., P137 Kiani, B., O80 Mehdipourmir, M., P22, 135, 155 Kiani, F., P100 Mehdizad, R., P184 Kohan, L., P41 Mehrabi, S., P77 Kokabian, Z., P122 Mehrali, M., P5 Konjedi, S., P41 Mehravaran, A., O91 Kordafshari, A., P103 Mellati, A., P83 Korourian, A., O49 Meshkani, R., O53 Kosha, H., P162, 163 Meshkani, R., P93 Kouhestani, M., W15 Mikhak, M., O40 Kwon, G.C., O111 Minaei, Z., P14, 15 Mir Jalili, A., W9 Lahoorpour, F., P38 Mirab Samiee, S., O115 Lahourpour, F., P143 Mirahmadi, H., O91 Langari, S., P6 Mirhashemi, M.H., P117, 118 Larki, P., P76 Mirmoini, A., P33 Latifi, S.M., O83 Mirnejad, R., P179 Livani, S., P147 Mirza Babaii, M., P126 Lotfalian, S., P4 Mirzaii, M., P49 Mirzavand, S., P172 M. Ardekani , A., P105 Mobaien, A., P176 Madadi, S., P141 Modarres Sadrani, S.N., P48 Madani, T., P85 Moghadami, H., P161 Maham, S., P177 Moghaddam, F., P176 Mahboubi, M., P192 Moghaddam, M., W2, 3 Mahdavi Omran, S., P150 Mohajeri Shahrebabaki, H., O57, P124 Mahdiun, F., P145 Mohamadi Motamed, S., P23 Mahfouzi, S., O11 Mohamadi, A., P162, 163 Mahmood Doosti, M., O71 Mohammadi Ney, A., P88 Mahmoudi, S., O10 Mohammadi, A., P112 Majidi, M., P104, 146 Mohammadi, H., P175 Majidpour, M., P189 Mohammadi, M., O31 Malcgi, F., P188 Mohammadi, M., P51 Malek, M.R., W16 Mohammadi, P., O42 Mamishi, S., O10 Mohammadi, R., O113, W7 Manaii, A., P5 Mohammadi, S., P143 Mansouri, M., P20 Mohammadi, S., P68 Mansourian, A., O57, P124 Mohammadniya, A., P13
230 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Mohammadzadeh, A., O59 Najafi, M.M., O119, P63 Mohammadzadeh, F., O57 Najar, H., P149 Mohebati, M., O74 Nakhjavani, M., O54 Mohebbi, S., P100 Namdari Moghaddam, H., P13 Mohebbi, S.R., O13 Namvari, K., P107 MohiadinKazemeini, S.M., P95 Nandost, S., P104, 146 Mojab, F., P31, 32, 33 Narimani, B., P92 Mojabi, H., P126 Naseri, S., P97 Molapour, A., P94 Nasiri Goorabi, L., O90 Mollaei, M., P85 Nasiri, R., O5 Mollazade Jelodar, F., P1 Navab Akbar, F.T., O92 Mondanizadeh, M., P81 Nazari, F., P150 Monem, M., P149 Nazari, H., P149 Moosavi Nasab, N., P140 Nazemalhoseini Mojarad, E., P76 Moosavi, A., P105 Nejadbolkheyr, A., P107 Moradi, F., P35 Nemati, E., P161 Moradi, M., P100 Nemati, H., O76 Moradi, N., O72 Nemati, N., O76 Moradi, N., O85, P81 Nematollahi, A., P137 Morovvat, F., O34 Nik Aeen, F., O36 Morovvat, F., P61 Nikfarman, R., P52 Morovvati, A., P52 Niko Goftar, M., O84 Morsaljahan, Z., P56 Noorbakhsh, T., P164 Morshedloo, L., P45 Noormohamadi, Z., P103 Mortazavi, S.M., P154 Nori, N., P22, 135, 155 Mosalaei, M.M., O105, 121 Nour Mohammadi, Z., P43 Mosallayi, M., P190 Nourazarian, A., O70 Mosavibahar, S.J., P45 Nourazarian, S.M., O70 Mosayebi, G., O81 Nourbakhsh, M., O66 Mostafavi, S.G., O17 Nouri, M., O116 Motalleb, G., O91 Nouri, R., P12 Motamedi, M., P14, 15 Nourizadeh, E., P171 Motiee Langroudi, M., P77 Motlagh, B., O73, P120 Obeidi, N., P107 Mouhebati, M., P62 Omid, S., O80 Mousavi Jazayeri, S.A., P191 Omid, Z., P196 Mousavi, F., P108 Omidvari, G., P168 Mousavi, M.J., P107 Osali, A., P95 Mousavi, S.F., O93, P43 Ostadrahimi, A., P120 Mousavi, S.M., P154 Owlia, P., P30 Mouseli, A., O115 Mozaffari, N.A., P140 Pakzad, S., P6 Pakzad, S.R., P31, 32, 33 Nadimi, H., P38 Palangi, A.R., W10 Najafi, A., O88 Palomaki, G.E., P102 Najafi, F., P126 Parhizgar, S., P126
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 231 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Parizadeh, S.M., O74, P62 Rajabnia, R., P7 Parsaei, M., O116 Rakhshani, M., P42 Paryan, M., P81 Ramazani, A., P176 Parzadeh, M., P43 Ramazanzadeh, R., P47 Pashazade, F., P54, 73 Rangriz, F., P23 Peihani, P., W3 Rasaee, M.J., O77 Pilehvar, M., P116 Rashidaei, H., P146 Pirestani, M., O90 Rasouli, K., P51 Pirouzi, A., P25, 26, 28, 29 Razaghi Abyaneh, M., P9 Pishkarieh Asl, R., P141 Razaghi Azar, M., O66 Plebani, M., O35, 112 Razeghi Haghighi, B., P34, 35, 182 Poopak, B., O26, P85 Razghnia, R., P22, 135, 155 Pordeli, H., P134 Razi, F., O52 Pourakbari, B., O10, P8, 11, 17, 23, 24, 41 Razi, R., P37 Pourasghari, B., O70 Razmi, G.R., P137 Pouresmaeil, V., P64 Rezaei Yazdi, H., P182 Pourfarzad, F., O96 Rezaei, B., P182 Pourfarzam, M., P91 Rezaei, K., P138 Pourfathollah, A.A., P55 Rezanezhadi, M., P153 Pourmomen, M., P134 Rezvan, H., P136, 160 Pournajaf, A., P7 Roggenbuck, D., O78 Pourreza, A., P57 Rohamrad, M., P24 Poustchi, H., O71, 72 Rostami, A., P129 Rouhanizadeh, H., P59, 187 Rabee, Z., P188 Rouhi, R., P34, 35 Rabiee, M., P129 Radmehr, R., P46 Saberi Karimianb, M., O74 Rafati, M., O100 Saberi, M., O119, P63 Rafie Mehr, H., O43 Sabz, G., P175 Rafiee, M.H., P58 Sabzavi, F., W13 Rafiei, A., O83, P170 Sabzfrosh Aghdam, R., P74 Rafiei, A., P56 Sadegh, M., P60 Rafiei, M., P81 Sadeghfar, F., P174, 181 Rahbar, M., O12 Sadeghi Neshat, S., P196 Rahbari, A., P45, 139 Sadeghi, A., O85 Rahimbakhsh, S., P45 Sadeghi, M., P91 Rahimi Mofrad, M., O84 Sadeghinia, S., O92 Rahimi, H.R., P16, 148 Sadeghitabar, A., O5, 56 Rahimi, S., P180 Sadegi, J., P75 Rahimifard, N., O7, P5, 6, 8, 11, 17, 23, 24, 27, 31, 32, Saderi, H., P30 33, 41 Sadoogh, S., O85 Rahimirad, S., P69 Saedi, S., P108 Rahmani, F., P86 Saeid Ju, H., P34 Rahmani, S.A., P79 Saeidi, M., P112 Rahnamay Farzami, M., P96 Saeidi, N., P76 Rajab, A., O55 Safari, A., P47
232 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Safari, M., P122 Sharifi, P., P51 Safavi, E., P194 Sharifi, S., P119 Sahebkar, A., O74, P62, 78 Sharifi, Z., P156 Saidi, N., P30 Sharifian, E., P119 Sakhaei, F., O34 Sharifpour, N., P106 Saki, N., O45 Sharma, P., O69, W4 Salari, S., P45 Shayegan, F., O15 Salehi Gatabi, A., P1 Sheikhi, A.K., O77 Salehi, M., P14 Sherafatnia, A., P119 Salehiyan, A.T., P149 Shibaei, N., P79 Salimi, F., P164 Shirin, A., O2 Salman Yazdi, R., O92, W8, P133 Shirzad, R., O45 Salmanian, M., P141 Shirzad, T., P53 Samadiafshar, S., P19 Shoeibi, S., P27 Samavat, A., O60 Shokrzadeh, M., P59, 104, 146, 166, 187 Samieerad, F., P54, 73 Showkati, F., O80 Samiei, S., O80 Siadat, S.D., O93 Samsam Shariat, Z.A., O34, P61 Simonian, M., P190 Samvatian, F., P45 Soleimani, M., P85 Sandberg, S., O79,W19 Soleimani, S., P156 Sarakhs Asbaghi, N., P109 Soleymani, E., P131 Saremi, M.A., W1 Solhju, K., P34 Sarparast, K., P21 Soltani Rezaee, J., W15 Sayady, A., P154 Soltanzadeh, K., O58 Setorki, M., P68 Sun Hoe Koo, O14 Seyed Javadin, S.R., O16 Seyedi, S.H., P38 Tabarraei, A., P134 Sezavar Kamali, M., O102 Tabrizi, A., P104 Shaban, R., P135 Taghavi, M., P131 Shabani, M., O47 Taghikhani, M., O73 Shabani, M., P34 Taghipoor, T., P162, 163 Shabani, P., O71 Taghizadeh, M., P150 Shafiee, A., P21 Taheri Bonakdar, M., O74, P62 Shafiee, E., P149 Taheri, A., P25, 26, 28, 29 Shafighi, T., P3 Taheri, M., P122 Shaghaghi, M., P138 Taheri, Z., P126 Shahini, N., P137 Taheripour Sisakht, M., P175 Shahnami, A., O116 Taherkhani, F. P126 Shaiegan, M., O80 Tahmasian, R., O1 Shaker Hosseini, N., O20 Tajik, H., P16 Shakoori Garakani, A., P77 Talebi, S., P176 Shams Asanjan, K., O80 Taleghani, M., P76 Shams, M., P9 Tara, S.M., O22 Shanaki, M., O72, P93 Tariverdi, N., P80 Shapoury, R., O93 Tashrifi, F., P89, 98 Sharifi, A., P173 Tavakoli Hafshejane, G., P121, 132
The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017 233 Laboratory & Diagnosis Vol. 8, No 34, Supplement Issue
Tavakoli, F., P175 Yarahmadi, M., P100 Tavalla, M., P99, 178 Yari, F., O84 Tavallaie, S., P62 Yavarian, M., O63 Tavasoli, A.R., O29 Yazdanpanah, Z., O87 Tavosidana, G., O76 Tayebi, F., P122 Zabooli, F., P157, 158 Tayefi, M., O74 Zadhoush, F., P91 Tayefi, M., P62 Zahabi, F., P26 Tehrani, S., P170 Zahraee, M.T., O87 Tofighi, A., P140 Zamanfar, D., P59, 187 Tozihi, M., O70 Zamini, K., P3 Zare , F., P130 Vafajoo, A., P129 Zare Zadeh, A., O91 Vahedi, L., P161 Zarei, E., O57, P124 Vahidi Emami, H., P52 Zargar Rahmana, M., O87 Vali, L., O115 Zarghami, N., P109 Valizadeh, A., P116 Zarifian Yeganeh, R., P77 Valizadeh, S., P49 Zarnani, A.H., O51 Vallian, S., P185 Zarrini, G., P144 Vanaki, M., O109, 110, W18 Zehisaadat, M., P20 Vartanoosian, J., O119, P63 Zeinali, S., P53, 103 Velashjerdi, Z., P125 Zeynali, C., O61 Voghufi, S., W3 Zhiani, M., P95 Zia Jahromi, N., P66, 67 Wald, N., O104 Ziaee Ardestani, M., P54, 73 Zibaee, S., P45 Yaghmaei, M., O48, 50 Zibaei, M., P169 Yaghoubi, H., P92 Zolfaghari, M., O81
234 The 10th International & 15th National Congress on Quality Improvement in Clinical Laboratories April 20-23, 2017