Northwestern University Dynamic Transcription Factor-Mediated

Northwestern University

Dynamic Transcription Factor-Mediated Recruitment of Genes to the Nuclear Pore Complex in

Saccharomyces cerevisiae.

A dissertation

SUBMITTED TO THE GRADUATE SCHOOL IN PARTIAL FULFILLMENT OF THE

REQUIREMENTS

For the degree

DOCTOR OF PHILOSOPHY

Field of Biological Sciences

Carlo Randise-Hinchliff

EVANSTON, ILLINOIS

March 2017 2

3 ABSTRACT

Dynamic Transcription Factor-Mediated Recruitment of Genes to the Nuclear Pore

Complex in Saccharomyces cerevisiae.

Carlo Randise-Hinchliff

In yeast, inducible genes such as INO1, PRM1 and HIS4 reposition from the nucleoplasm to nuclear periphery upon activation. This leads to a physical interaction with nuclear pore complex (NPC), interchromosomal clustering, and stronger transcription. Repositioning to the nuclear periphery is controlled by cis-acting transcription factor (TF) binding sites located within the promoters of these genes and the TFs that bind to them. Such elements are both necessary and sufficient to control positioning of genes to the nuclear periphery. We have identified four

TFs capable of controlling the regulated positioning of genes to the nuclear periphery in budding yeast under different conditions: Put3, Cbf1, Gcn4 and Ste12. Gcn4 and Ste12 are also sufficient when tethered to an ectopic site to recruit chromatin to the nuclear periphery. For each TF, we have defined the molecular basis of regulated relocalization to the nuclear periphery. Put3- and

Cbf1-mediated targeting to nuclear periphery is regulated through local recruitment of Rpd3(L) histone deacetylase complex by transcriptional repressors. Rpd3(L), through its histone deacetylase activity, prevents TF-mediated gene positioning by blocking TF binding. Yeast transcriptional repressors were capable of blocking Put3-mediated recruitment; 11 of these required Rpd3. Thus, it is a general function of transcription repressors to regulate TF-mediated recruitment. However, Ste12 and Gcn4-mediated recruitment is regulated independently of

4 Rpd3(L) and transcriptional repressors. Ste12-mediated recruitment is regulated by phosphorylation of an inhibitor called Dig2, and Gcn4-mediated gene targeting is up-regulated by increasing Gcn4 protein levels. Gcn4-mediated gene targeting genetically requires NPC

(Nup2), SAGA (Gcn5 & Spt20), Mediator (Med31), Mex67, however of these only the NPC is directly involved in recruitment of HIS4 to the nuclear periphery. Finally, by iterative deletion from amino and carboxyl termini, a 27 aa Positioning Domain (PD) of Gcn4 was identified. The

PD of Gcn4 is sufficient to reposition and cluster chromatin at the nuclear periphery. The ability of transcription factors to mediate recruitment to the NPC and interchromosomal clustering of genes represents a novel function. This ability allows cells to alter the organization of the genome in a directed and regulated manner.

5 Acknowledgments

I would like to express my deepest gratitude to my advisor and mentor, Dr. Jason

Brickner. He has been truly inspirational as both a mentor and a scientist. Like many, I believe graduate school is not only about results. It is about developing and honing skills that will translate into a successful career in science. These skills are complex and diverse, which make them hard to obtain. Jason’s extraordinary mentoring capacity has given students like me the optimal chance to succeed in both graduate school and in our careers moving forward.

Reflecting back on the last 6 years, I have seen growth in multiple areas including formatting and presentation techniques as well as my scientific writing. In lab, he has taught me how to develop and test a hypothesis in the strictest but most efficient ways. Also he has also taught me how to resolve technical issues using the correct controls or alternative approaches. Jason has always shown genuine interest in my progress and has offered consistent encouragement. He has made me the scientist I am today. All I can say is thank you.

I would like to thank my committee, Dr. Curt Horvath, Dr. Richard Morimoto, and Dr.

Sadie Wignall for helpful discussions and feedback during my yearly review meetings. I am very fortunate to have an exemplary group of scientists supporting my progression through graduate school. Curt, you were an excellent committee chair. Our meetings together has provided me with important and encouraging feedback. I will cherish our interactions together as well as my interactions with the rest of my committee members.

I would also like to thank Dr. Donna Brickner for being a wonderful lab manager and colleague. Donna has provided support on many of my projects and has provided numerous

6 yeast strains. I also want to thank you for persuading Jason to accept me into the lab. I know that without you I would have not had the opportunity to be part of the Bricknerds. Thank you.

Varun, you were an amazing colleague and friend over the years. You are a wonderful person with a brilliant mind. Graduate school would have been a completely different experience without you. You answered so many of my questions, and I have always felt like I could come to you for advice and support not only in science but also in life. You are the hardest worker I know and I see a great future in science for you. I will miss our scientific discussions, your delicious snacks you offered me, and the constant support. Good luck in all your endeavors.

Agustina, you are inspirational. Whether it is in science or personal health you devote yourself completely and whole-heartedly, and I admire that. The last six years together has been a great experience for me, and I will miss you a lot. I would say good luck moving forward, but you don’t need it, you have passion, intellect, and skill.

Finally, I want to thank all of the current and former Bricknerds, I want to specifically thank Rob Coukos, Michael Sumner, Stefan Zdraljevic, Lauren Meldi, Sara Ahmed, and Heidi

Schmit for their countless hours of hard work and scientific discussions.

7 Dedication

I would like to dedicate my dissertation to my grandmother, Joanne Davis Hinchliff.

From a young age she believed in me, inspired me, and instilled in me a love of knowledge and a desire to explore the world. Every summer we traveled the United States and immersed ourselves in history and geography. We traced along the 3,700 mile Lewis and Clark trail, from the banks of the woods river in Illinois all the way to the coast of Oregon. By helicopter, we flew over the forest of Alaska landing on glaciers and staring down the deep crevasses. We also shared countless memories tent camping in beautiful landscapes of state and national parks.

These adventures were memorable, but my grandma meant so much more. She believed in me when others did not and I would not be in graduate school without her. I will always love her and miss her. This is for you, Joanne.

8 Table of Contents

Abstract 3

Acknowledgements 5

Dedication 7

Table of Contents 8

List of Figures and Tables 12

Chapter 1. Introduction 16

1.A. Introduction 16

1.B. Spatial organization of the yeast genome 18

1.C. Composition of NPC 19

1.D. Nuclear pore complex interacts with the genome 21

1.E. Nups influence transcription 25

1.F. Interchromosomal clustering at the NPC 28

1.G. Gene recruitment and clustering through the cell cycle 29

1.H. Transcription Memory 30

1.I. Molecular mechanism of INO1 transcriptional memory 34

Chapter 2: Transcription factor-mediated gene recruitment to the NPC 37

2.A. Introduction 37

2.B. Transcription factor-dependent and stimulus-specific recruitment of INO1, 38

PRM1 and HIS4 to the nuclear periphery.

2.C. Transcription factor binding sites function as DNA zip codes 4543

2.D. TF-mediated gene recruitment occur under specific stimuli. 4543

2.E. Conclusion 4646

Chapter 3: Rpd3(L) histone deacetylase regulates zip-code dependent 4848 recruitment to the nuclear periphery and interchromosomal clustering

3.A. Introduction 4848

3.B. Upstream Repressing and Upstream activing sequences regulate INO1 4848

gene recruitment to the nuclear periphery

3.C. Trans-acting factors regulate INO1 gene recruitment to the nuclear 5050

periphery

3.D. Rpd3(L) histone deacetylase regulates INO1 gene recruitment to the 5151

nuclear periphery

3.E. Rpd3(L) histone deacetylase regulates Put3 binding through local histone 5353

acetylation

3.F. Rpd3 (L) regulates interchromosomal clustering of INO1 5252

3.G. Conclusion 5555

Chapter 4: A general role of transcriptional repressors in regulating zip-code 5757 function.

4.A. Introduction 5757

4.B. Opi1 and Ume6 are sufficient to block GRS I and GRS II function 5757

4.C. A survey of transcriptional repressors in regulating zip code-mediated 6060

targeting to the nuclear periphery

4.D. Artificially tethering Mig1 and Sfl1 to the URA3 locus is sufficient to 6464

cause URA3 to reposition to the nuclear periphery

4.E. Conclusion 6464

Chapter 5: Identifying multiple mechanisms involved in regulating zip-code 6666 activity

5.A Introduction 6666

5.B. Regulation of Ste12-mediated gene positioning by MAP kinase signaling 6868

5.C. Independent of DNA binding, Ste12 is sufficient to induce peripheral 6969

positioning

5.D. Increased peripheral gene positioning through regulated TF synthesis 7070

5.E. Different regulatory strategies provide dynamic control of the yeast 7171

genome through different time scales

5.F. Conclusion 7676

Chapter 6: Identifying factors directly mediating zip-code dependent 7979 requirement

6.A. Introduction 7979

6.B. Mediator and SAGA complexes function in INO1, PRM1 and HIS4 8181

recruitment to the nuclear periphery

6.C. Genetic epistasis analysis of factor’s function downstream of Gcn4 to 8282

mediate targeting to the nuclear periphery

6.D. Conditional inactivation of factors by anchor away 8484

6.E Tethered Gcn4 leads to a physical association of Nup2 and Gcn5 at URA3 8888

6.F. Minimal Positioning Domain of Gcn4 9089

6.G. Position domain is sufficient to induce interchromosomal clustering of 92

URA3:LexA BS

6.H. Conclusion 93

Chapter 7: Discussion and Future Directions 96

7.A. Introduction 96

7.B. Transcription factor-mediated gene recruitment to the NPC 97

7.C. The molecular mechanism of TF-mediated gene recruitment 99

Chapter 8: Materials and Methods 102101

8.A. Chemicals and media 102101

8.B. Yeast strains 102101

8.C. Molecular biology 103102

8.D. Microscopy 105104

8.E. Clustering analysis 106105

8.F. FRB-GFP depletion analysis. 107106

References 108107

Appendices 128127

Appendix 1. Yeast strains used in the dissertation 128127

12 List of Tables and Figures

Figure 1.1. Overall structure of the yeast nuclear pore complex (NPC).

Table 1.2. Summary of nucleoporins in genome-related functions in yeast.

Figure 1.3. Cell cycle regulation of gene recruitment and interchromosomal clustering at the

NPC.

Figure 1.4. Model of INO1 transcriptional memory at the NPC.

Figure 2.1. Chromatin localization assay in live cells.

Figure 2.2. Loss of both cbf1 and put3 and not cbf1 alone block targeting of INO1 to the nuclear periphery.

Figure 2.3. Identifying transcription factors that mediate targeting to the nuclear periphery.

Figure 2.4. Periphery localization of HIS4 requires specific Nups and ILV2 and HIS3 require specific stimuli.

Figure 2.5. TF BSs function as DNA zip codes.

Figure 2.6. Transcription factor-dependent and stimulus-specific recruitment of INO1, PRM1 and

HIS4 to the nuclear periphery.

Figure 3.1. The Rpd3 (L) histone deacetylase regulates INO1 gene recruitment to the nuclear periphery.

Figure 3.2. Trans and cis mutant effects on INO1 transcription.

Figure 3.3. Opi1 regulates both GRS I and GRS II-dependent recruitment to the nuclear periphery.

Figure 3.4. The Rpd3 (L) deacetylates INO1 promoter regulating Put3 binding.

Figure 3.5. A schematic of Interchromosomal clustering of INO1 alleles.

13 Figure 3.6. Interchromosomal clustering of INO1 alleles is regulated by URS element.

Figure 3.7. Interchromosomal clustering of INO1 alleles is regulated by Rpd3 (L).

Figure 4.1. Opi1 and Ume6 are sufficient to block GRS I and GRS II zip code function at INO1.

Figure 4.2. Opi1 and Ume6 are sufficient to block ectopic GRS I and GRS II zip code function, but not PRE zip code function.

Figure 4.3. Opi1 is sufficient to block Interchromosomal clustering of ectopic GRS I with INO1.

Figure 4.4. A general role for repressors in regulating zip code-mediated targeting to the nuclear periphery.

Figure 4.5. Effect of untethered repressors on GRS I-dependent recruitment to the nuclear periphery.

Figure 4.6. Transcriptional repression of INO1 and expression of LexA-repressor fusions.

Table 4.7. Table of phenotypes for each repressor.

Figure 4.8. Sufficiency test for targeting of URA3 to the nuclear periphery.

Figure 5.2. MAPK phosphorylation of Dig2 regulates Ste12-mediated peripheral targeting.

Figure 5.3. Ste12 is sufficient to target URA3:LexA(BS) to the nuclear periphery when fused to

LexA.

Figure 5.4. MAPK phosphorylation of Dig2 regulates Ste12-mediated peripheral targeting and interchromosomal clustering.

Figure 5.5. Schematic model for the mechanism of regulation of Ste12-dependent recruitment to the nuclear periphery.

Figure 5.6. Translational control of Gcn4-mediated peripheral targeting and interchromosomal clustering.

14 Figure 5.7. Gcn4 is sufficient to target URA3:LexA(BS) to the nuclear periphery when fused to

LexA.

Figure 5.8. Translational control of Gcn4-mediated interchromosomal clustering.

Figure 5.9. Different regulatory strategies lead to large scale changes in nuclear organization over different time scales.

Figure 5.10. Model for transcription factor (TF)-mediated recruitment to the nuclear periphery over different time scales.

Figure 6.1. Alternative models for TF-mediated gene recruitment to the NPC.

Figure 6.2. The requirement of mediator and SAGA complex components on INO1, PRM1 and

HIS4 gene recruitment.

Figure 6.3. The requirement of mediator and SAGA complex components on recruitment of TF binding sites inserted at URA3.

Figure 6.4. Distinguishing direct from indirect effects of mutations of Gcn4-mediated targeting by genetic epistasis analysis.

Figure 6.5. Schematic model for conditional inactivation by anchor away.

Figure 6.6. Rapamycin time course of RB-GFP-tagged alleles of indicated genes.

Figure 6.7. Depletion analysis of rapamycin time course of RB-GFP-tagged alleles of indicated genes.

Figure 6.8. The effect of nuclear depletion of Nup2 and Gcn4 on HIS4 peripheral localization.

Figure 6.9. The effect of nuclear depletion of FRB-tagged alleles of indicated genes on HIS4 peripheral localization.

Figure 6.10. The effect of long term nuclear depletion of FRB-tagged alleles of indicated genes on HIS4 peripheral localization.

15 Figure 6.11. NPC and SAGA are bound to URA3:LexA(BS) with tethered Gcn4-LexA.

Figure 6.12. Identification of the Gcn4 Positioning Domain.

Figure 6.13. Functional domains of Gcn4 and conservation of the Positioning Domain among

Saccharomyces species.

Figure 6.14. Recruitment to the nuclear periphery mediated by Gcn4 and its Positioning Domain genetically requires NUP2.

Figure 6.15. GCN4-LexA and PD-LexA is sufficient to mediated interchromosomal clustering of

URA3:LexA BS LacO.

16 Chapter 1: Introduction

1.A. Introduction

A membrane-bounded nucleus is a defining feature of all eukaryotic cells. The nucleus contains the majority of the genetic material in the cell and isolates nuclear from cytoplasmic functions. The nucleus is delimited by a double lipid bilayer membrane called the nuclear envelope (NE) and communication between the cytoplasm and nucleus is mediated by the nuclear pore complex (NPC). The NPC regulates the bidirectional exchange of macromolecules, export of specific RNA molecules, and selective transport of regulatory factors. Thus, the NPC is a critical mediator of cellular processes between the nucleus and the rest of the cell.

Within the nucleus, eukaryotic genomes are organized spatially and some nuclear functions are compartmentalized. Each chromosome occupies a distinct “territory” and can position its chromatin into subnuclear compartments where loci can cluster with co-regulated regions or interact with stable nuclear structures.1 The spatial position of individual genes often reflects their transcriptional states.2 In metazoans, chromosomes fold back onto themselves forming distinct non-overlapping globular territories.3 Transcriptionally active regions tend to position at the edges of the territories in the inter-territorial space. Soluble factors such as transcriptional regulators and RNA polymerase II are non-uniformly distributed within the nucleus.4 The nucleolus, for example, is a subnuclear compartment that serves as the site for ribosome biogenesis.5 The nucleolus concentrates factors involved in rRNA production and ribosomal biogenesis.6 Thus, both chromatin and soluble factors are spatially organized within the nucleus.

17 The organization of chromatin is also dynamic; developmental and physiological signals that alter gene expression also alter chromatin organization.7,8 This suggests that the spatial organization of the genome within the nucleus contributes to gene regulation. However, the mechanisms and functional significance of the nuclear organization are not fully understood.

What is clear is that stable nuclear structures bind to certain chromosomal regions, imparting organization and influencing transcriptional regulation.9,10 For example, in metazoans, the nuclear lamina, a filamentous network of lamins and lamin-associated proteins at the nuclear periphery, associates with large, transcriptional repressed regions of the genome.11 Because the nuclear lamina associates with chromatin modifying proteins and transcriptional repressors, it has been proposed that it is a transcriptional repressive environment.12

However, the nuclear periphery is not exclusively associated with transcriptionally silent heterochromatin. Electron microscopy shows decondensed euchromatin positioned adjacent to

NPCs.13 In yeast, repressive regions and NPCs form distinct, non-overlapping foci.14 This suggests that beyond its vital role in nucleo-cytoplasmic transport, the NPC may interact with active regions of the genome. Indeed, in yeast, flies, worms and mammals, NPC components interact with hundreds to thousands of active genes.15-20 In yeast, these interactions occur at the nuclear periphery.20 However, in flies and mammals, such interactions can occur at both the

NPC and with soluble nuclear pore proteins, in the nucleoplasm.18,21 Interaction with nuclear pore proteins promotes stronger transcription, alters chromatin structure and limits the spread of silencing.18,20,22-26 In yeast, interaction with the NPC can also lead to interchromosomal clustering of co-regulated genes.8,27,28 Additionally, recently repressed genes bound at the NPC are poised for faster reactivation.25,29-32 Thus the NPC plays an important role in both the spatial organization of the nucleus and transcriptional regulation.

18 Here I review our current understanding of the mechanism and functional significance of the interaction of the NPC with the budding yeast genome. Research in yeast has provided significant conceptual and mechanistic insight into chromosomal organization and its effects on gene regulation. These discoveries have stimulated work in metazoan systems, which has revealed that these mechanisms are largely conserved.

1.B. Spatial organization of the yeast genome

Budding yeast, Saccharomyces cerevisiae, has served as an outstanding model for understanding fundamental cell and molecular biology of eukaryotic cells.32,33 However, budding yeast has several nuclear features that contribute to chromatin organization that are distinct from higher eukaryotes.33,34 The primary difference is that budding yeast undergoes a closed mitosis; the nuclear envelope does not break down during mitosis. During interphase, the centromeres of the 16 relatively small chromosomes (230-1,500kb) remain tethered to the spindle pole body (SPB). The SPB, functionally analogous to the microtubule organizing center, is embedded in the nuclear envelope and is positioned opposite the nucleolus.35 Chromosome arms emanate away from the SPB towards the opposite pole of the nucleus, where telomeres cluster as well. The 32 telomeres form a small number of foci at the nuclear envelope by FISH, reflecting their inter-chromosomal clustering.36 Since centromeres remain tethered through interphase, is a strong determinant for the spatial position of chromosomal regions.34,37 In other words, short chromosome arms are unable to explore the same nuclear volume as longer arms.

Consistent with this notion, telomeres of chromosomes having short arms (< 300 kb) cluster together near the SPB and telomeres of chromosomes having longer arms cluster together near the nucleolus.37 This organization is known as the Rabl configuration and is not specific to yeast. It was first observed by Carl Rabl in 1885 in epithelial salamander larvae and later in

19 Drosophila melanogaster embryos and in many cereal species.38,39 Despite yeast possessing unique features, the morphology and mechanisms that influence the spatial arrangement of yeast chromosomes have been important to understanding genomic organization in all eukaryotes.

1.C. Composition of NPC

The yeast NPC is one of largest and most complex proteinaceous assemblies in the cell, consisting of approximately 400 proteins with a mass of 66 million Daltons.40 The NPC is composed of approximately 30 nucleoporins (Nups), each of which are present in multiple copies

(usually 8 or 16), reflecting the eight-fold symmetry of the structure. Specific groups of Nups contribute to repetitive subcomplexes that form the NPC.40 Based on structure, motifs, and locations, Nups can be classified into distinct groups (Figure 1.1). Furthermore, many Nups bind dynamically to the NPC, cycling on or off or associating only during certain phases of the cell cycle.41-43 Thus, the exact number and definition of Nups is uncertain.

20 The NPC is a highly conserved structure and the majority of Nups have structural conservation that has been extrapolated to the last common eukaryotic ancestor.44,45 However, due to a recent whole-genome duplication during Saccharomyces evolution, followed by gene divergence and loss, several Nups that are encoded by single genes in vertebrates exist as paralogous pairs in S. cerevisiae such as Nup116/Nup100 (Nup98 in vertebrates),

Nup157/Nup170 (Nup155 in vertebrates), and Nup53/Nup59 (Nup3 in vertebrates).40 Also, the metazoan cytoplasmic filament Nups, Nup358 and Aladdin, are absent in yeast and the nucleoplasmic yeast Nup60 is absent in vertebrates.46-48

The yeast NPC, compared to the vertebrate NPC, is also both significantly smaller

(66MDa compared to 125MDa) and less abundant in the nuclear envelope (200 compared to

2,500-5,000).49-51 In metazoan organisms, NPCs are disassembled and reassembled during mitosis while in yeast, due to a closed mitosis, the NPC remains assembled through the life cycle of the cell. Besides these differences, the core structure and function of the NPC is conserved between yeast and metazoans.

The cylindrical structure of the NPC is organized with eight-fold symmetry around a central transport channel and pseudo two fold symmetry between the cytoplasm and the nucleoplasm (Figure 1.1).48 The NPC is composed of two main functional regions; a central core and peripheral structures. The NPC core consists of coaxial inner, outer, and transmembrane rings surrounding a central channel, approximately 40 nm in diameter.48 The core is built from scaffold Nups (outer ring Nups, linker Nups and inner ring Nup), membrane-embedded ring

Nups, and central FG-Nups. The core scaffold defines the shape and dimensions of the NPC.52

These Nups are structurally related to vesicular coat proteins and have been proposed to catalyze the formation of the sharply curved pore membrane.53 The pore membrane domain harbors three

21 transmembrane proteins, Ndc1, Pom152 and Pom34, that interact with the core proteins and anchor the NPC within a pore in the NE. Finally, 11 Nups rich in phenylalanine-glycine (FG) repeats, natively unstructured domains that form the permeability barrier of the NPC channel and serve as docking sites for transport receptors.54 The peripheral structures are made up of asymmetrical filaments that extend into either the cytoplasm and nucleoplasm. The cytoplasmic filaments are composed of Nup159, Nup42, Gle2 and Dbp5 and function in mRNP remodeling.55

The nuclear basket forms the peripheral structure within the nucleus. It consists of filaments of

FG Nups: Nup60, Nup1, Nup2, Mlp1, and Mlp2.48 The nuclear basket functions in transport but an accumulating body of evidence also connects the nucleoplasmic basket to transcriptional regulation, modulating chromatin structure and organization of the genome.

1.D. Nuclear pore complex interacts with the genome

In addition to its role in regulating nucleo-cytoplasmic transport, the NPC also contributes to transcription and the spatial organization of the genome within the nucleus.

Nuclear pore components directly interact with transcriptional regulators, mRNA export factors and chromatin (Table 1.2).56 The interactions with chromatin provide anchor points along the nuclear periphery to spatially organize and compartmentalize the genome. Using chromatin immunoprecipitation (ChIP) coupled to DNA microarray analysis (ChIP-chip), the interactions of Nups and NPC-associated factors were mapped genome-wide in yeast.16,57 For a majority of the NPC components, genomic occupancy strongly correlated with transcriptional activity.16

This included the nuclear basket components Nup2, Nup60, Mlp1 and Mlp2, the scaffold components Nic96 and Nup116, and the karyopherins Xpo1 and Cse1. These Nups also preferentially bound to genes involved in glycolysis and protein biosynthesis.16 Thus, certain active chromatin regions position and physically interact with the NPC (Table 1.2).

23 Interaction with Nups does not always correlate with transcription. The genomic occupancy of Nsp1, Nup84, Nup145 and Nup100 had no correlation with expression.16 Thus, the NPC interacts with both active and inactive regions of the genome. The differences in the observed binding profiles for nuclear pore components may reflect functional either distinct molecular interactions with NPC or distinct NPC molecular composition. In support of the idea that different NPCs might be compositionally distinct, Mlp1, Mlp2, Ulp1 and Pml39 are associated with only a subset of NPCs.58,59

Many inducible genes reposition from the nucleoplasm to the nuclear periphery and physically interact with the NPC in response to different environmental stimuli. For example, the GAL genes (GAL1, GAL2, GAL7 and GAL10) in glucose are transcriptionally repressed and are localized in the nucleoplasm with sub-diffusive constrained movement.16,60 In contrast, in galactose, the GAL genes become transcriptionally induced and reposition to the nuclear periphery with more constrained diffusion.29,60 At the nuclear periphery, GAL genes physically interact with Nup116, Mlp1, Nup60, Nup2, Cse1, XpoI and Nup100.16 This interaction depends on gene activity and the transcriptional activator Gal4 and occurs in the gene promoter.61 In strains lacking Nup2, Nup1, Nup60 or Mlp2, GAL1 remains nucleoplasmic in galactose media.28,29 Furthermore, the Gal genes are not the only region of the genome that is recruited to the NPC in galactose. When media is shifted to galactose, large scale rearrangements occur, repositioning many chromosomal regions to the nuclear periphery through multiple anchor points.62

Gene recruitment to the NPC has been observed in many environmental stimuli such as nutrient shifts (INO1, HIS4, HXK1, SUC2), osmotic stress (CTT1, STL1), heat shock

(TSA2, HSP104) and mating pheromone treatment (PRM1, FIG1, FUS1).8,15,20,57,63-67 The INO1

24 gene (encoding inositol 1-phoshate synthase) repositions to the nuclear periphery upon activation during inositol starvation. The repositioning of INO1 requires many Nups including Nup1,

Nup2, Nup60, Nup157, Nup42, Gle2, and Mlp2.20 Interaction of INO1 and GAL1 promotes stronger transcription by increasing the fraction of cells that respond to the inducing signal.28,29,68

The interaction of the genome with the NPC is regulated through the cell cycle. Active genes such as GAL1, INO1 and HSP104 relocalize from the nuclear periphery to the nucleoplasm during S-phase.27,69 This regulation of peripheral localization is due to oscillating Cdk-mediated phosphorylation of Nup1. Targeting of these genes to the NPC requires Cdk activity and either of two Cdk phosphorylation sites on Nup1. However, substitution of phosphomimetic aspartates in place of the phosphoacceptor residues at either position leads to localization at the periphery throughout the cell cycle and bypasses the requirement for Cdk activity.69 Likewise, although tDNA genes encoding tRNAs are generally clustered in the nucleolus, during M phase, they reposition to the NPC.70 This coincides with the peak of tDNA expression. Loss of either

Nup60 and Nup2 blocks recruitment to the NPC and leads to reduced transcription of tDNA genes during M-phase.70 Thus, in response to different environmental stimuli or cell cycle signals regions of the genome reposition to the NPC, enhancing transcription.

NPC-DNA interactions also play an important role in chronological aging in yeast, the process by which cells cease to divide after producing a fixed number of daughter cells.71,72

Aging is asymmetrically inherited; each generation the mother ages, but the daughter cell is born with full longevity.72 Extrachromosomal rDNA circles (ERCs) form spontaneously by homologous recombination within the rDNA locus and accumulate in older cells 72 and these

ERCs have been proposed to serve as aging factors for several reasons.73 ERCs are asymmetrically inherited, accumulating and being retained in the mother cells. Artificially

25 introducing ERC in daughter cells, or enhancing ERC formation in mother cells, shortens longevity.72 Conversely, reducing the rate of ERC formation increases lifespan.74 Attachment of

ERCs to NPC confine the DNA circles to the mother cell and preventing their inheritance.71

Likewise, ERC association affects NPC inheritance to the daughter: ERC-bound NPCs are concentrated as an “NPC cap” in the mother cell and are retained, whereas unbound NPCs freely move into the daughter cell. The mechanism for this retention is not completely understood, however the SAGA complex is involved. Loss of SAGA complex components, such as Gcn5 and Spt3, cause DNA circles to dissociate from the NPC, spread into the daughter cells and lead to shorter lifespan.71

The NPC interacts with both active and repressed regions of the yeast genome, influencing its spatial organization, transcription and chronological aging. The role for Nups in regulating transcription may be evolutionarily conserved. In flies, mice and humans, expression of certain genes is enhanced by interaction with Nups.15-20 However, many inactive or poised genes also interact with Nups, so interaction with Nups or NPCs does not always correlate with transcription.16,24,29 Below we discuss our current understanding of the impact of the NPC on transcriptional regulation, the molecular mechanisms that target genes to the NPC, how the interaction with the NPC leads to interchromosomal interactions and the role of the NPC in promoting epigenetic transcriptional memory in budding yeast.

1.E. Nups influence transcription

In 1985, Günter Blobel put forth an attractive “gene gating hypothesis”, postulating that the interactions of active genes with NPCs might coordinate transcription with mRNA biogenesis and export out of the nucleus to limit mRNA diffusion rates.75 Indeed, interaction with NPC promotes stronger expression for inducible genes such as INO1 and GAL1.20,28,29 Single

26 molecule mRNA FISH suggests that this is due to an increase in the fraction of cells that induce these genes, rather than an increase in the amount of mRNA produced per transcription event.28

It remains unclear if mRNA export is affected by this interaction. Promoter mutations that block interaction of genes with the yeast NPC do not lead to nuclear accumulation of those mRNAs.20,28 The yeast nucleus is small and mRNA export is rapid.76 Live cell imaging of mRNAs does not support the model in which mRNAs are directed to particular NPCs.76 Thus, although the transcription of genes is impacted by the interaction with the NPC, it is still unclear if post-transcriptional events are affected.

NPCs may anchor and concentrate transcriptional regulators to promote expression, functioning as a transcriptionally active subnuclear compartment. Consistent with this notion, the kinetics of GAL1 expression is enhanced by Ulp1 anchored at the NPC.68 Ulp1 is a SUMO protease that is maintained at the NPC by association with Mlp1 and Mlp2.59 Ulp1 enhances the rate of GAL1 mRNA production by catalyzing the desumoylation and attenuation of two repressors, Tup1 and Ssn6.68 Furthermore, many transcriptional activators and mRNA export factors bind directly to the NPC. For example, the multiprotein complex TREX-2, which is necessary for mRNA export, interacts with Nup1 and localizes to inner nuclear basket of the

NPC.77,78 The SAGA complex, a transcriptional co-activator, is linked to TREX-2 through a common component, Sus1, and binds to the NPC directly through Mlp1.79,80 Finally, the

Mediator complex, another transcriptional coactivator, also binds to TREX-2.81 Therefore, interaction of transcriptional regulators with the NPC might enhance expression of active genes at the NPC.

NPC components may also promote transcriptional repression. Loss of members of the

Nup84 subcomplex (Nup84, Nup120, Nup133, and Nup145) detaches telomeres from the nuclear

27 periphery and leads to loss of silencing of a subtelomeric reporter gene.82 Likewise, the Nup84 subcomplex participates in glucose-responsive repression of SUC2 by physically interacting with

Mig1.83 Finally, Nup170 is required for peripheral tethering and silencing of many ribosomal and subtelomeric genes through cooperation with chromatin remodeler RSC and Sir4.84 These findings suggest NPC components can influence silencing.

One complication in understanding the effects of gene-NPC interactions on transcription is that null mutations can disrupt the spatial organization that is normally being exploited in a wild type cell. For example, the Ulp1 SUMO protease is maintained at the NPC by Mlp1 and

Mlp2 and is normally important for promoting GAL1 derepression.68 However, mutants lacking

NPC basket components both block targeting of GAL1 to the nuclear periphery and release Ulp1 into the nucleoplasm. This results in more rapid GAL1 depression, which has been interpreted as a role for the NPC in negatively regulating GAL1.85 However, in a strain lacking Mlp1 and

Mlp2, normal regulation of GAL1 is restored when Ulp1 is artificially anchored to the NPC.68

Thus, interpreting the effects of null mutations of NPC components can be complicated by the change in the spatial organization of NPC-associated factors. For that reason, mutations in cis- acting DNA elements that perturb the positioning of a gene in an otherwise normal nucleus can provide important information about the function of NPC interactions.20,25,28,86 One caveat to this statement is that, in cases where the cis-acting DNA elements that control gene positioning are the same as the elements that control transcription, the effects of interaction with the NPC on gene expression have not been distinguishable from the effects on targeting.87

Finally, another function of the interaction of NPCs with chromatin may be to alter chromatin structure to insulate active and silent regions. Studies using a “boundary trap” identified several NPC components capable of inducing boundary activity.23,26 A boundary

28 factor blocks the spread of heterochromatin without inducing transcription. Tethering of the nuclear pore protein Nup2, Exportins Cse1, Mex67 and Los1 and the RAN GEF Prp20 beside a reporter gene prevented the spread of silencing from the HML locus without activating an adjacent gene.23,26 Also Nup2 physically interacts with chromatin-modifying proteins and histone variant H2A.Z and binds to intergenic regions near telomeres.26

1.F. Interchromosomal clustering at the NPC

Zip code-mediated targeting to the NPC leads to interchromosomal clustering of genes.

This can be observed by comparing the position of two loci that are targeted to the nuclear periphery in either haploid or diploid yeast cells.27 Active INO1 clusters at the NPC with another

GRS I-containing gene, TSA2 and with ectopic GRS I inserted at the URA3 locus, but does not cluster with these loci in the nucleoplasm when repressed.86 In diploid cells, two active alleles of

INO1 also cluster together. GRS I-mediated clustering requires the Put3 transcription factor, which binds to GRS I. In contrast, INO1 does not cluster with genes recruited to the nuclear periphery by different zip codes such as the HSP104 gene (targeted by a different zip code called

GRS3). Importantly, GRS3 inserted at URA3 is sufficient to induce clustering with HSP104.

Thus, clustering is zip code-specific. Interchromosomal clustering at the NPC has been observed for many genes such as INO1, GAL1, HIS4, PRM1 and HSP104.8,28,86 Therefore, zip code- mediated targeting to the NPC leads to interchromosomal interactions and likely impacts the spatial organization of the yeast genome

Targeting to the NPC is a prerequisite for zip-code mediated clustering. However, the molecular mechanisms controlling targeting to the NPC and interchromosomal clustering are distinct. For example, the recruitment of GAL1 to the NPC, like INO1, is controlled by two redundant zip codes GRS4 and GRS5 28. Although both GRS4 and GRS5 are sufficient to target

29 URA3 locus to the nuclear periphery, GRS4 alone controls GAL1 clustering.28 Likewise, GRS I is both necessary and sufficient for INO1 clustering whereas GRS II is not.86 Therefore, not all zip codes that are sufficient to target URA3 to the nuclear periphery are sufficient to induce interchromosomal clustering. Clustering, unlike gene targeting, requires both transcription and transcriptional activators such as Gal4.28 Finally, the set of NPC components required for clustering are overlapping, but distinct, from the set required for targeting. Loss of Nup1, Nup60 and Mlp2 block both targeting to the nuclear periphery and clustering of GAL1, whereas loss of

Mlp1 specifically blocks GAL1 clustering without affecting peripheral targeting.28

1.G. Gene recruitment and clustering through the cell cycle

The recruitment of inducible genes to the NPC is regulated through the cell cycle. For active INO1, GAL1 and HSP104 genes, recruitment to the nuclear periphery occurs during G1 and G2/M, but not in S-phase when the genes localize in the nucleoplasm (Figure 1.3).69

Importantly, the loss of peripheral localization is not a nonspecific effect of DNA replication, but rather due to phosphorylation of Nup1 by the cyclin-dependent kinase Cdk1.69 Phosphorylation of Nup1 is required for normal targeting to the nuclear periphery; inactivation of Cdk or mutations that block phosphorylation of Nup1 also block targeting of INO1 and GAL1 to the periphery. Conversely, mutations in Nup1 that mimic phosphorylation at either of two sites or loss of the Cdk1 inhibitor, Sic1, led to INO1 and GAL1 remaining at the nuclear periphery during

S-phase. The phosphomimetic mutations bypass the requirement of Cdk1, suggesting that Nup1 is the only protein whose phosphorylation affects peripheral targeting of these genes.

Interchromosomal clustering is also regulated through the cell cycle, but is out of phase with gene recruitment. GAL1 clustering is maintained in the nucleoplasm through S-phase, but is lost upon repositioning to the periphery during G2/M (Figure 1.3).28 Interestingly, the regulation of peripheral targeting and clustering are interdependent. Loss of phosphorylation of Nup1 leads to loss of interchromosomal clustering and phosphomimetic Nup1 both maintains GAL1 at the

NPC during S-phase and leads to clustering during G2/M. Therefore, Cdk phosphorylation of the NPC coordinates the positioning of individual genes and the organization of chromosomes with respect to each other through the cell cycle.

1.H. Transcriptional Memory.

Several inducible genes such as INO1 and GAL1 that are recruited to the NPC upon activation remain anchored to the pore for several generations after repression.88 Such epigenetic retention leads to an altered chromatin structure and primes genes for rapid transcriptional

31 reactivation. This phenomenon is called transcriptional memory and represents a mitotically heritable state. Furthermore, transcriptional memory leads to a faster or stronger response when cells are confronted with an environmental challenge previously experienced, presumably impacting cellular fitness and survival.88 Nuclear pore components play important roles in transcriptional memory, but not all genes that interact with the NPC when active exhibit memory. Understanding the mechanisms and specific NPC components involved in transcriptional memory can further elucidate the functions of the NPC.

A well-established model for transcriptional memory is GAL1 29,31,89. After being repressed, GAL1 is retained at the nuclear periphery, primed for faster reactivation for up to seven generations.29 During the first few hours, GAL1 is anchored to the NPC as an intragenic loop between its promoter and 3’ end; called a memory gene loop (MGL).30 MGLs are stabilized at the NPC by Mlp1 and are thought to prime genes for reactivation by retaining transcription initiation factors, such as TBP. Indeed, destabilizing GAL1 MGL, through loss of

Mlp1, significantly reduces both TBP binding and the rate of reactivation.30 However, this is not the sole mechanism of GAL1 transcriptional memory, since the GAL1 MGL does not persist as long as memory.29,30 It is possible that MGLs initiate memory and downstream mechanisms maintain transcriptional memory. Consistent with this notion, the chromatin remodeling complex, SWI/SNF1, is required for GAL1 memory, but not for loop formation.89 Interestingly, the inheritance of GAL1 memory is not perpetuated by chromatin alone, but through trans-acting

Gal1 protein itself, which is necessary for epigenetic memory.90 Ectopic expression of GAL1 is sufficient to induce faster induction of the other GAL genes.90 Thus, the rapid reactivation of

GAL genes involves multiple mechanisms including the formation of gene loops, chromatin- based mechanisms and GAL1 protein itself.

32 Loss of the histone variant H2A.Z both blocks periphery localization of INO1 and GAL1 and causes a dramatic decrease in the reactivation after repression29(our unpublished results).

This suggests that peripheral localization is coupled to reactivation. Indeed, H2A.Z incorporation after repression depends on the nuclear pore protein Nup100. H2A.Z also physically associates with Nup2 26. However, it is unclear how H2A.Z perpetuates memory.

Loss of H2A.Z and Nup100 leads to a strong and specific defect in the rate of reactivation of

INO1 25, but loss of H2A.Z affects both the rate of activation and reactivation of GAL1 91.

Similar to Nup2, H2A.Z functions to insulate euchromatin from the spread of heterochromatin.92

It is found in most inducible promoters and facilitates faster induction.93-95 H2A.Z-containing nucleosomes are also less stable and flank nucleosome-free regions in promoters.95 Therefore, perhaps chromatin changes like H2A.Z incorporation generally enhance the rate of transcriptional induction and such changes can be influenced by interactions with the NPC during memory.

INO1 gene remains associated with the nuclear periphery for up to four generations after repression, dependent on H2A.Z incorporation and Nup100.25,29 After repression, the INO1 promoter is marked with another chromatin mark, dimethylated histone H3 lysine 4 (H3K4me2).

Memory leads to binding of poised RNA polymerase II (RNAPII) preinitiation complex (PIC), which enhances the rate of future reactivation (Figure 1.4).22,24,25 Many of the NPC components required for active recruitment were also required in memory such as Nup1, Nup2 and Nup60.

However, five Nups are specifically required for retention at the nuclear periphery during transcriptional memory: Nup100 and Nup84 subcomplex components Nup84, Nup120, Nup133, and Nup145C.25 In contrast to GAL1, INO1 does not require Mlp1 and MGLs do neither form nor are required for INO1 memory.25,30 By ChIP, Nup2 binds to the INO1 promoter both in

active and recently repressed conditions, whereas, Nup100 binds specifically during memory.25

In strains lacking Nup100, the INO1 promoter loses H2A.Z incorporation, H3K4me2 and poised

RNA polymerase II PIC, leading to slower reactivation.24,25

Targeting of active and recently repressed INO1 to the NPC is mediated by distinct mechanisms and different zip codes.25 Recruitment of recently repressed INO1 to the nuclear periphery does not require GRS I and GRS II. Instead, after repression a zip code called the

34 Memory Recruitment Sequence (MRS) is both necessary and sufficient to recruit INO1 to the

NPC. A mutation in the MRS sequence specifically blocks INO1 peripheral positioning after repression, but not in active conditions.25 Finally unlike the GRS, MRS-mediated recruitment is not regulated throughout the cell cycle.69

Transcriptional memory also leads to interchromosomal clustering of INO1.96 During memory, two alleles INO1 remain clustered in diploid cells, which requires the MRS and

Nup100. Unlike recruitment during memory, INO1 clustering during memory also requires GRS

I and GRS II zip codes.96 Furthermore, neither GRS I or MRS inserted at URA3 is sufficient to cause clustering with INO1 during memory. In contrast, the ectopic GRS I clusters with INO1 in active conditions.27 This suggests clustering during memory requires previous clustering of

INO1 during activation. Therefore, the MRS zip code is necessary, but not sufficient, to induce clustering. Clustering of INO1 during transcriptional memory is regulated through the cell cycle.

In G2/M phase, INO1 clustering is lost.96 Therefore, MRS- and GRS- mediated recruitment and clustering of INO1 share some similarities, but function by distinct mechanisms.

1.I. Molecular mechanism of INO1 transcriptional memory

INO1 transcriptional memory is initiated by binding of a transcription factor to the MRS zip code. The transcription factor Sfl1 binds to the MRS upon shifting cells from activating to repressing conditions (Figure 1.4).22 Sfl1 has a genetic interaction with the Nup84 subcomplex component, Nup120, and is both necessary and sufficient to recruit chromatin to the nuclear periphery.22,97 Sfl1 and the MRS, like Nup100, are essential for all aspects of transcriptional memory.22 This suggests that binding of Sfl1 to the MRS initiates INO1 transcriptional memory and may determine the duration of memory.

35 INO1 transcriptional memory is associated with histone modifications. When INO1 is repressed, H3K4 is hypoacetylated and unmethylated whereas during activation, H3K4 is hyperacetylated and both di- and trimethylated (Figure 1.4).22 However, upon repression, INO1 loses histone acetylation and trimethylation, but remains dimethylated (H3K4me2).22 H3K4me2 is necessary for memory and is established by remodeling of the Set1/COMPASS methyltransferase complex, ejecting the Spp1 subunit (Figure 1.4).22 The Spp1- complex is capable of dimethylation, but not trimethylation of H3K4.98,99 H3K4me2 recruits the SET3C histone deacetylase, which is also required for memory.22 Set3 is the eponymous member of

SET3C and binds to H3K4me2 through its PHD domain.100 SET3C binding to H3K4me2 is required both to recruit RNAPII and to maintain H3K4me2 during memory.22 Conditional inactivation of SET3C leads to rapid loss of both H3K4me2 and poised RNAPII from the INO1 promoter.22 Thus, SET3C has a direct and continuous role in memory. The maintenance of

H3K4me2 may provide a chromatin state that allows recruitment of RNAPII and rapid reactivation.

Changes in chromatin composition (H2A.Z) and histone modifications (H3K4me2) are necessary for transcriptional memory. These changes presumably allow RNAPII PIC to remain bound; poising genes for transcriptional reactivation.88 PIC assembly during memory also requires Cdk8+ form of Mediator (Figure 3C). Mediator binds to the INO1 promoter both under activating and memory condition.88 However, the Cdk8 module only binds during memory.

Inactivation of Cdk8 specifically disrupts RNAPII binding during memory and slows reactivation without affecting INO1 activation.88 Interestingly, Cdk8+ Mediator physically interacts with both Sfl1 and the NPC-associates TREX-2 complex, both of which are required for memory.81,101 The poised PIC complex during memory is partially assembled, missing both

36 Ctk1 and Kin28, which phosphorylate serine 2 and 5 on the carboxyl-terminal domain, respectively.25 Unlike Cdk8, Kin28 is also not required for memory and the poised RNAPII is unphosphorylated on Ser2 and 5. It is conceivable that Cdk8 and Kin28 are mutually exclusive and that Cdk8+ Mediator promotes transcriptional poising by blocking Kin28 association with the PIC (Figure 1.4). Further experiments will discern this mechanism.

The mechanism of INO1 memory is related to the mechanism of stress-induced memory in yeast and IFNγ-induced memory in human cells.22 In both systems, genes that display memory are marked with H3K4me2, bound by RNAPII and Cdk8. In yeast, 77 of the genes induced by oxidative stress are primed for activation in response to previously experienced salt stress.102 This effect persists for four generations. However, unlike INO1, salt stress-induced memory does not require Sfl1 or Nup100 and requires a different NPC component, Nup42, for faster reactivation.102 In human cells, genes that exhibit IFNγ-induced memory physically interact with Nup98, a homologue of Nup100, and require Nup98 for memory.24 Unlike in yeast,

IFNγ-induced genes interact with Nup98 in the nucleoplasm. Despite these differences, the core mechanism revealed by studies of INO1 transcriptional memory is both general and conserved.22.

Note:

This chapter was adapted from “Randise-Hinchliff, C. et al. Nuclear pore complexes in genome organization and gene expression in yeast. In Nuclear Transport. Maximilliano D’Angelo, editor,

Springer Publshing Company, New York. Submitted.

37 Chapter 2: Transcription factor-mediated gene recruitment to the NPC

2.A. Introduction

The eukaryotic genome is functionally and spatially organized. During interphase, chromosomes fold into topologically associated domains (TADs) and divide into heterochromatin and euchromatin. Also, chromosomes associate with nuclear structures and occupy distinct territories within the nucleus.103 Within these territories, individual genes are positioned with respect to each other and with respect to stable nuclear structures. For example, in metazoa large transcriptionally repressed Lamina Associate Domains (LADs) position along the nuclear periphery and interact with the nuclear lamina.104 Importantly, the spatial organization of the genome is dynamic and the position of individual genes often changes upon activation or repression.105 For example, during development, LADs can be remodeled to accommodate the repositioning of genes; the β-globin and MyoD genes move away from the nuclear lamina upon transcriptional activation.106,107 Many active genes also interact with nuclear pore proteins (Nups) in diverse organisms including yeast, flies, worms, and mammalian cells.8,15,16,18,19 In both yeast and metazoa these interactions positively correlate with transcription.15,18,20,21,29,65 In yeast these interactions occur at the nuclear periphery, presumably in contact with the nuclear pore complex (NPC)20, whereas in higher eukaryotes these interactions often occur in the nucleoplasm with soluble Nups.18,21 Finally, coregulated loci throughout the genome can cluster.

Active genes colocalize with RNAP II foci in subnuclear compartments called transcription factories.108,109 In flies, Polycomb-repressed sites cluster together.110,111 Likewise, in yeast, tRNA genes, silenced telomeres and NPC-associated loci each exhibit specific

38 interchromosomal clustering.86,112,113 These observations support the idea that the spatial organization of the eukaryotic genome compartmentalizes the nucleus into functionally distinct subnuclear environments and that the spatial positioning of a gene both impacts and reflects its transcriptional state.

As a model for these phenomena, we have studied the spatial repositioning of inducible yeast genes from the nucleoplasm to the nuclear periphery. Inducible genes such as INO1,

PRM1 and HIS4 are recruited from the nucleoplasm to the nuclear periphery upon activation.8

These genes are inducible under very different conditions (INO1 is activated by inositol starvation, PRM1 is induced by mating pheromone and HIS4 is induced by amino acid starvation) and they are targeted to the periphery only under the conditions that lead to their expression. This recruitment leads to a physical interaction with the nuclear pore complex

(NPC) and promotes stronger expression.20,114

This chapter focuses on the identification of TFs that bind to promoters of inducible genes. We have identified four TFs capable of controlling the regulated positioning of genes to the nuclear periphery in budding yeast under different conditions: Put3, Cbf1, Gcn4 and Ste12.

2.B. Transcription factor-dependent and stimulus-specific recruitment of INO1, PRM1 and

HIS4 to the nuclear periphery

To monitor spatial positioning within the yeast nucleus, we inserted an array of 128 Lac repressor binding sites at a specific locus of interest (Figure 2.1). Into these strains, GFP-tagged

Lac repressor (GFP-LacI) and an mCherry ER/nuclear envelope marker were introduced.115

Live cells were imaged by confocal microscopy and the fraction of the cells in which the GFP-

LacI focus was unresolvable from the nuclear envelope was scored under uninducing or inducing conditions (Figure 2.1).

INO1 targeting to the nuclear periphery requires either one of two cis-acting DNA elements, GRS I and GRS II.20 The Put3 TF binds to the GRS I zip code and is necessary for

GRS I-dependent positioning but is not required for GRS II-mediated positioning.86 Because the

TF Cbf1 binds near the GRS II upon INO1 induction, we tested if Cbf1 is required for GRS II function.116 Indeed, whereas loss of Put3 alone or Cbf1 alone does not block targeting of INO1 to the nuclear periphery, strains lacking both Put3 and Cbf1 fail to target INO1 to the nuclear

40 periphery (Figure 2.2).86 Importantly, these TFs are not the factors that control INO1 transcription. INO1 transcription is regulated by the Ino2/Ino4 TFs, which bind to the UASINO elements in the promoter.117 Such a separation between the elements controlling transcription and gene positioning is also seen in other promoters (our unpublished results). Thus, although gene positioning and transcription are coupled, they can be mediated by distinct elements and factors.

Since the TF Put3 and Cbf1 and their binding sites are necessary and sufficient to reposition chromatin to the nuclear periphery, we hypothesized that other TF may also possess this function. To test this, we conducted an in-silico comparison of TF binding with promoters bound by the nuclear pore components Cse1, Nup2, and Prp20.16,118 Confirmed through ChIP- chip, Cse1 and Nup2 associates with active genes whereas Prp20 is associates with repressed genes.16 Therefore, we identified the subset of TFs bound to promoters with a significant

41 overlap promoters bound by Cse1 and Nup2 and not Prp20 (Figure 2.3). We hypothesized that the TFs identified in this subset either control spatial positioning or are important transcriptional regulators of genes that are targeted to the NPC, such as Ino2/Ino4 mentioned above. To distinguish TFs that function as targeting factors, we inserted their corresponding TF consensus binding sites at URA3. Of the bind sites tested, Fkh1, Gcr1, and Gcn4 binding sites significantly repositioned URA3 to the nuclear periphery (Figure 2.3).

From this in-silico approach, we identified Gcn4 binding as a potential DNA zip code.

To test if genes bound by Gcn4 are recruited to the nuclear periphery, we inserted an LacO downstream of HIS4. HIS4 is a multifunctional histidine biosynthetic enzyme induced by

42 histidine starvation. HIS4 promoter contains multiple Gcn4 binding sites (5’-TGACTC-3’) and requires binding of the Gcn4 TF for proper expression.119 In inducing conditions, 1hr of histidine starvation, HIS4 is recruited to the nuclear periphery. Similar to INO1, the recruitment of HIS4 the nuclear periphery requires Nup60 but not Nup100 (Figure 2.4).20,25

ILV2 (encodes acetolactose synthase, which catalyses the first common step in the valine and isoleucine biosynthesis) and HIS3 (encodes imidazoleglycerol-phosphate dehydratase, which catalyzes the sixth step in histinde biosynthesis) both contain Gcn4 binding sites in their respective promoters.120-123 To test if these genes are also recruited to the nuclear periphery, we inserted an LacO downstream of these genes. Unexpectedly, these genes were not recruited to the nuclear periphery under general amino acid starvation. ILV2 was specifically recruited under leucine starvation and conversely HIS3 was specifically recruited under histidine starvation

(Figure 2.4). This suggests that Gcn4 recruitment is regulated by different stimuli.

PRM1 (a cell surface transmembrane protein induced by mating pheromone) is also recruited to the nuclear periphery in a TF-dependent fashion. PRM1 is among a large set of genes previously shown to physically interact with the NPC in the presence of pheromone.57

45 Like HIS4, PRM1 positioning is controlled by the same TF that regulates its expression, Ste12

(Figure 2.5 & Figure 2.6).

2.C. Transcription factor binding sites function as DNA zip codes

We next asked if the TFs that are required for peripheral localization mediate peripheral localization. Each binding site was inserted beside URA3 to test their sufficiency to promote peripheral localization.20 As we have shown previously, both GRS I and GRS II are sufficient to reposition URA3 to the nuclear periphery (Figure 2.6). Put3 was required for GRS I-mediated gene positioning, Cbf1 was required for GRS II-mediated gene positioning (Figure 2.6).

Insertion of 3xPRE and the Gcn4 BS at URA3 was also sufficient to promote peripheral localization and these zip codes required Ste12 and Gcn4, respectively (Figure 2.7).

2.D. TF-mediated gene recruitment occur under specific stimuli

Although repositioning of INO1, PRM1 and HIS4 to the nuclear periphery was mediated by TFs, the regulation of these three TF-dependent repositioning events was different. Under uninducing conditions (synthetic complete medium), recruitment of INO1 and PRM1 to the nuclear periphery are near base-line levels. INO1 and PRM1 colocalize with the nuclear periphery in ~30% of the cells counted (Figure 2.7), similar to the fraction of the nucleus that is unresolvable from the nuclear envelope by light microscopy (baseline, blue hatched line in

Figure 1B and throughout).15 In contrast, HIS4, which is modestly expressed in the presence of histidine colocalize with the nuclear envelope in ~45% of cells, significantly higher than either

URA3 recruitment or in the gcn4∆ strain (Figure 2.6).124 Under all inducing conditions, URA3 remained nucleoplasmic. In contrast, specifically under their respective inducing condition, peripheral localization INO1, PRM1, and HIS4 increased significantly to ~60% of the cells

(Figure 2.6).

46 Repositioning of INO1, HIS4 and PRM1 to the nuclear periphery is conditional and occurs under specific environmental stimuli. This reflects how each zip code is regulated, which is revealed when the zip code is inserted at an ectopic site. GRS I and GRS II are regulated through a context-dependent mechanism: when inserted at an ectopic site, these elements lead to constitutive targeting to the nuclear periphery (Figure 2.6). In other words, they are negatively regulated in the context of the INO1 promoter and only permitted to function when INO1 is induced. Cells use different strategies to regulate Gcn4- and Ste12-mediated gene positioning.

Unlike Put3 and Cbf1, regulation of Ste12- and Gcn4-mediated repositioning is context- independent; inserting the Gcn4BS or the 3xPRE at URA3 led to repositioning to the nuclear periphery upon histidine starvation or pheromone treatment, respectively (Figure 2.6).

2.E. Conclusion

Put3, Cbf1, Gcn4 and Set12 represent four different families of transcription factors that mediate spatial repositioning and clustering of these genes. This suggests this ability is a common function of transcription factors. Indeed, in erythroid cells, the transcription factor Klf1 is necessary for clustering of its target genes into specialized transcription factories and in flies, interactions of genes with Nup98 is mediated by the MBD-R2 DNA binding factor.109,125

However, not all transcription factors possess this function. As mentioned above, Ino2/Ino4 binding to the UASINO element within the INO1 promoter is neither necessary nor sufficient to recruit chromatin to the nuclear periphery. Transcription is also separable from gene positioning.

The activation domain of Put3 and Gcn4 is dispensable for targeting to the nuclear periphery

(our unpublished results). Furthermore, inactivating RNA polymerase II or promoter mutations that block INO1 transcription does not block zip code-dependent recruitment to the nuclear periphery.8,29 Thus, TFs can control gene positioning, separable from their effects on

47 transcription. One important, unaddressed question is how these changes in gene positioning are dynamically regulated. The next three chapters explore this question.

Note:

Some of this chapter was adapted with permission from “Randise-Hinchliff, C. et al. Strategies to regulate transcription factor-mediated gene positioning and interchromosomal clustering at the nuclear periphery. J Cell Biol 212, 633-646, doi:10.1083/jcb.201508068 (2016)” and Randise-

Hinchliff, C. & Brickner, J. H. Transcription factors dynamically control the spatial organization of the yeast genome. Nucleus 7, 369-374, doi:10.1080/19491034.2016.1212797 (2016).” Some of the experiments that are presented in this chapter were done in collaboration with former and current graduate and undergraduate students in Jason Brickners lab, which are listed as follows:

Lauren Watchmaker (Figure 2.2).

48 Chapter 3: Rpd3(L) histone deacetylase regulates zip-code dependent recruitment to the

nuclear periphery and interchromosomal clustering

3.A. Introduction

Gene recruitment to the NPC of many genes are conditional and occur under specific environmental stimuli.8,16,57 This reflects how each zip code and the TF that binds to them are regulated. Put3-, Cbf1-, Ste12-, and Gcn4- mediated recruitment are regulated through different strategies. Put3 and Cbf1 are regulated by a context-dependent mechanism. While Put3 and

Cbf1 conditionally recruit INO1 upon inositol starvation, when the GRS I and GRS II are inserted at an ectopic site, recruitment to the nuclear periphery is constitutive. This suggests that

Put3 and Cbf1 have the capacity to recruit chromatin under repressing conditions, but are negatively regulated in the context of the INO1 promoter. This chapter will focus on the strategy yeast utilized to regulated INO1 spatial positioning by Put3 and Cbf1.

3.B. Upstream Repressing and Upstream activating sequences regulate INO1 gene recruitment to the nuclear periphery

To understand how GRS I and GRS II are regulated by their promoter context, we identified the cis- and trans-acting factors that block their function in the context of the INO1 promoter. Deletion of 100bp of the INO1 promoter (Δ4; Figure 3.1) led to constitutive

20 localization to the nuclear periphery. This part of the promoter contains two UASINO elements as well as an Upstream Repressing Sequence that regulate the transcription of INO1 (Figure

126,127 3.1). Mutations that disrupt these UASINO elements prevent expression of INO1 and mutation of the URS element leads to constitutive expression of INO1.126,128 Therefore, we hypothesized that the URS element might both repress transcription and prevent peripheral

50 targeting in the presence of inositol. Indeed, mutation of the URS element led to constitutive targeting of INO1 to the nuclear periphery (Figure 3.1). However, mutations that disrupted the

UASINO elements also led to constitutive localization at the nuclear periphery (Figure 3.1).

Therefore, INO1 targeting to the nuclear periphery under uninducing conditions is blocked by a mechanism that requires both the URS element and the UASINO elements.

3.C. Trans-acting factors regulate INO1 gene recruitment to the nuclear periphery

Transcriptional repression of INO1 is mediated by two mutually-dependent repressors

(Figure 3.1). In the presence of inositol, the Ume6 repressor binds to the URS and the Opi1

126,129-131 repressor interacts with the Ino2/Ino4 activator bound to the UASINO. Neither mechanism is sufficient because loss of either Ume6 or Opi1 leads to constitutive, high-level expression of INO1 (Figure 3.2). Loss of Ume6, Opi1, Ino2 or Ino4 led to constitutive targeting of INO1 to the nuclear periphery (Figure 3.1). Furthermore, a mutation in Ino2 (L118A) that disrupts binding of Opi1 had the same effect (Figure 3.1).131 This is not related to derepression

51 of INO1 transcription because strains lacking Ino2 and Ino4, or the UASINO element, show no expression of INO1.117 Furthermore, a strain lacking Isw2, a chromatin-remodeling factor required for INO1 repression, showed normal, regulated peripheral targeting (Figure 3.1).116

Therefore, this suggests that recruitment of Opi1 and Ume6 to the INO1 promoter blocks GRS I and GRS II function. Consistent with this idea, the peripheral targeting of INO1 in the opi1∆ mutant was lost when both GRS I and GRS II were mutated (Figure 3.3).

3.D. Rpd3(L) histone deacetylase regulates INO1 gene recruitment to the nuclear periphery

Both Ume6 and Opi1 recruit the Sin3/Rpd3 histone deacetylase, which is essential for

INO1 repression, so we tested if this complex prevents repositioning of INO1 to the nuclear periphery under repressing conditions.130,132 Indeed, loss of Sin3 or Rpd3 or a catalytically

52 inactive form of Rpd3 (His188A) led to constitutive targeting of INO1 (Figure 3.1).133 The peripheral targeting of INO1 in the rpd3∆ mutant was lost when GRS I and GRS II were mutated

(Figure 3.1). Therefore, local recruitment of Rpd3 deacetylase activity blocks GRS I and GRS II zip code activity.

Rpd3 is the catalytic subunit of two distinct complexes, Rpd3(L) and Rpd3(S), that have distinct protein components, interact with distinct genomic sites and have distinct effects on gene expression.134 Whereas Rpd3(L) is associated with promoters and functions as a co-repressor,

Rpd3(S) is recruited co-transcriptionally to gene bodies to prevent cryptic transcriptional initiation.130,135 We tested mutants lacking complex-specific subunits. Loss of Rdp3(L) components Pho23 or Sap30 led to unregulated targeting of INO1 to the nuclear periphery, whereas loss of the Rpd3(S) component Rco1 did not (Figure 3.1). Thus, Rpd3(L) blocks peripheral targeting of INO1.

3.E. Rpd3(L) histone deacetylase regulates Put3 binding through local histone acetylation

To test if Rpd3 affects local histone acetylation and Put3 binding to the GRS I, we performed chromatin immunoprecipitation (ChIP). Acetylation over the INO1 promoter increased under inositol starvation and was constitutively high in the absence of Rpd3 (Figure 3.4). Likewise, unlike the wild type strain, in which Put3 binds to the GRS I only under inducing conditions, in in the rpd3∆ mutant Put3 binding to the INO1 promoter was constitutive (Figure 3.4).86 This suggests that Rpd3 deacetylase activity regulates Put3 binding to the GRS I in the INO1 promoter.

3.F. Rpd3 (L) regulates interchromosomal clustering of INO1

Zip code-mediated targeting to the nuclear periphery also leads to interchromosomal clustering of genes that share the same zip codes.86 For example, upon inositol starvation, the

55 two alleles of INO1 reposition to the nuclear periphery and cluster.86 This requires the zip codes, the TFs that bind to the zip codes and nuclear pore proteins.86 In haploid cells, this can be observed by comparing the position of two loci that are targeted to the nuclear periphery by the same zip code. For example, active INO1 clusters with both URA3:GRS I and with another GRS

I-containing gene, TSA2.86

To test if Rpd3 (L) also regulates clustering of INO1 alleles in diploid cells, we measured the distribution of distances between the alleles of INO1 in a population of cells grown under both uninducing and inducing conditions (Figure 3.5). Upon inositol starvation, the distribution of distances between alleles of INO1 shifts to significantly shorter distances (Figure 3.6; P = 2 x

-4 86 10 , Wilcoxon Rank Sum test). The fraction of cells in which the two alleles are ≤ 0.55µm apart, an alternative metric for clustering, was 24% in uninducing conditions and 49% under inositol starvation (Figure 3.7; P = 6 x 10-5, Fisher Exact test).86

In contrast to wild type INO1, two alleles with mutated URS elements clustered constitutively, independent of inositol starvation (Figure 3.6, P = 0.173). These alleles were ≤

0.55µm apart in 45.9% (uninduced) and 52.6% (induced) of cells (Figure 3.7, P = 0.31).

Likewise, in the rpd3 H188A mutant strain, the alleles of INO1 were constitutively clustered, and this was dependent on GRS I and GRS II (Figure 3.7). Thus, Rpd3 (L) recruitment regulates both INO1 positioning and interchromosomal clustering.

3.G. Conclusion

Using systematic mutagenesis of cis and trans acting regulators, we find that targeting of

INO1 to the nuclear periphery by Put3 and Cbf1 is regulated through local recruitment of

Rpd3(L) histone deacetylase complex (Figure 5.10).8 Rpd3(L) is recruited to the INO1 promoter under repressing conditions by the transcriptional repressors Opi1 and Ume6.129,131 Rpd3(L)

56 regulates zip code activity by blocking transcription factor binding through its histone deacetylase activity.8 This regulation was abolished by either perturbing the recruitment of Rpd3 or inactivating its catalytic activity (rpd3 H188A), resulting in constitutive targeting of INO1 to the nuclear periphery.

Note:

Hinchliff, C. & Brickner, J. H. Transcription factors dynamically control the spatial organization of the yeast genome. Nucleus 7, 369-374, doi:10.1080/19491034.2016.1212797 (2016).”

Some of the experiments that are presented in this chapter were done in collaboration with former and current graduate and undergraduate students in Jason Brickners lab, which are listed as follows: Robert Coukos (Figure. 3.6, 3.7 )

57 Chapter 4: A general role of transcriptional repressors in regulating zip-code

function

4.A. Introduction

In the context of the INO1 promoter, recruitment of Rpd3(L) by the transcriptional repressors Opi1 and Ume6 is necessary to regulated GRS I and GRS II zip code activities. Loss of either repressor leads to constitutive targeting and interchromosomal clustering at the NPC.

This suggests that both repressors are required for proper regulation of GRSI and GRSII.

However, is either repressor sufficient to block recruitment at INO1 locus or capable to recapitulated the regulation at the ectopic URA3? Also are other transcriptional repressors capable of regulating zip codes? Another GRS I-target, TSA2, is induced by protein folding stresses and is not regulated by Ume6 or Opi1.20,86 TSA2 is also induced and it is recruitment to the nuclear periphery is much more rapidly than INO1.20 This suggests that Put3-mediated recruitment can be regulated by other mechanisms possibly by other transcriptional repressors.

4.B. Opi1 and Ume6 are sufficient to block GRS I and GRS II function

To test if Opi1 and Ume6 are sufficient to regulate GRS I and GRS II-mediated gene positioning, we inserted a LexA binding site (LexA BS) into the endogenous INO1 promoter

50bp from the middle of the GRS I and 395bp from the middle of GRS II (Figure 4.1). This experiment utilized the Ino2 L118A mutant strain, which bocks binding of Opi1, leading to constitutive targeting to the nuclear periphery (Figure 4.1). LexA-Ume6 or LexA-Opi1 were expressed in these strains, as confirmed by immunoblotting against LexA, and both proteins repressed INO1 transcription (Figure 4.6 & 4.7). LexA-Ume6 and LexA-Opi1, but not LexA

59 alone, blocked recruitment of INO1 to the nuclear periphery (Figure 4.1). Therefore, Opi1 and

Ume6 are sufficient to block GRS I and GRS II function in the context of the INO1 promoter.

We also reconstituted Opi1- and Ume6-mediated regulation of each zip code separately at the ectopic site by tethering LexA-Ume6 and LexA-Opi1 beside URA3:GRS I, URA3:GRS II or

URA3:3xPRE (Figure 4.2). Tethering the repressors beside the GRS I or the GRS II blocked peripheral localization (Figure 4.2). However, this effect was specific: neither repressor blocked

Ste12-mediated targeting (Figure 4.2). This suggests that Ste12 targeting must be regulated by a different mechanism and that repressors like Ume6 and Opi1 can regulate peripheral targeting by some, but not all, TFs.

60 Finally, we asked if tethered LexA-Opi1 was also sufficient to regulate clustering of

INO1 with URA3:GRS I LexA BS. In cells expressing LexA alone, URA3:GRS I LexA BS clustered with INO1 under inositol starvation (Figure 4.3). Expression of Lex-Opi1 disrupted this clustering (Figure 4.3, P = 0.002; 5D, P = 0.003). Thus LexA-Opi1 was sufficient to regulate both peripheral localization and interchromosomal clustering mediated by GRS I.

4.C. A survey of transcriptional repressors in regulating zip code-mediated targeting to the nuclear periphery

We next asked whether the ability to repress zip code function is a general function of transcriptional repressors by creating LexA fusions to an additional 19 transcriptional repressors.

These 24 fusion proteins were tested for expression (Figure 4.6; immunoblot), ability to repress

INO1 transcription (by tethering to the LexA binding site used in (Figure 4.6) and ability to block recruitment of URA3:GRS I LexA BS to the nuclear periphery (Figure 4.4). Three repressor fusions (Leu3, Rpd3 and Pho23) failed all three of these tests and were excluded (Table

4.8). Measuring the peripheral localization of URA3:GRS I LexA BS in strains expressing the remaining 21 LexA-repressor fusions, we found that 16 blocked GRS I-mediated targeting to the nuclear periphery in a LexA BS-dependent manner (Figure 4.4 & 4.5). There was no correlation between the ability to block GRS I function and size of repressors, their expression level, or their ability to repress INO1 transcription (Table 4.7). Finally, 11 of the 16 repressors that blocked

GRS I function required Rpd3; in the rpd3 H188A mutant, GRS I-mediated peripheral localization was restored. The remaining five repressors were Rpd3-independent (Figure 4.4).

Therefore, many repressors are capable of regulating DNA zip codes, both through Rpd3 recruitment and by other mechanisms.

64 4.D. Artificially tethering Mig1 and Sfl1 to the URA3 locus is sufficient to cause URA3 to reposition to the nuclear periphery

Rim101, Mig1, Sfl1, and Spt2 did not block GRS I dependent recruitment to the nuclear periphery. One hypothesis for this, is that, like Put3 and Cbf1, these TF may recruit chromatin to the nuclear periphery instead of blocking GRS I function. To test this we measured peripheral localization of URA3:LexA BS in strains expressing lexA fusions of Rim101, Mig1, Sfl1, and

Spt2. We found that Mig1 and Sfl1 was sufficient to position URA3:LexA to the nuclear periphery. However, expression of Rim101 and Spt2 did not significantly alter URA3:LexA BS spatial positioning (Figure 4.8). Therefore, these TF neither regulate or recruit chromatin to the nuclear periphery. Also, Sfl1 was later found to be the MRS binding protein and is required for all aspect of INO1 transcriptional memory.22 Mig1 is a transcription factor involved in glucose repression. Since GAL genes are also recruited to the nuclear periphery in galactose, it is possible Mig1 may play a role in this recruitment. Although, loss of Mig1 has no effect of

GAL1 localization (Data not shown).

4.E. Conclusion

Regulation of GRS I-mediated targeting represents a novel assay for Rpd3 function.

Although loss of Rpd3 affects the expression of hundreds of genes, in most cases the mechanism of repression has not been defined. Our data provide new insight into Rpd3 function. For example, despite the fact Rpd3 shows physical interactions with Whi5 and Tup1 and genetic interaction with Gal80, none of these factors require Rpd3 catalytic activity to block GRS I targeting. Furthermore, of the eleven that are Rpd3-dependent, only three (Cup9, Oaf3 and

Xbp1) have been shown to interact with Rpd3. Our results suggest that the rest may also repress transcription and gene recruitment to the nuclear periphery through local recruitment of Rdp3(L).

65 We have found that many transcriptional repressors are capable of blocking Put3-dependent recruitment of an ectopic site to the nuclear periphery. These repressors regulate gene targeting by more than one mechanism: eleven repressors require Rpd3 deacetylase activity and five do not. Therefore, the same targeting mechanism can be regulated by different, context-specific regulatory strategies, depending on the environmental stimulus, which may explain the regulated recruitment of TSA2.

Note:

Robert Coukos (Figure 4.3).

66 Chapter 5: Identifying multiple mechanisms involved in regulating zip-code activity.

5.A Introduction

Unlike Put3 and Cbf1, regulation of Ste12- and Gcn4-mediated repositioning is context- independent. Like the endogenous loci, reposition of inserted Gcn4BS or the 3xPRE at URA3 locus led to repositioning to the nuclear periphery upon histidine starvation or pheromone treatment, respectively (Figure 2.6). Furthermore, tethering Opi1 and Ume6 beside the 3xPRE failed to block targeting to the periphery (Figure 4.2). This suggests yeast use different strategies to regulate TF-mediated gene positioning.

Ste12 binds to the promoters of genes like PRM1 constitutively, but transcriptional activation and targeting to the nuclear periphery constitutively only occur in the presence of mating pheromone (Figure 5.1).136,137 In absence of mating pheromone, Ste12 binds to two

67 inhibitors, Dig1 and Dig2 that independently inhibit Ste12 by different mechanisms.138

Stimulation of the MAP kinase pathway by pheromone leads to phosphorylation of Dig1 and

Dig2, causing them to dissociate from Ste12 (Figure 5.1).

Gcn4-mediated targeting to the nuclear periphery occurs at a lower level under uninducing conditions and at a maximal level under inducing conditions (Figure 2.6). Thus,

Gcn4-mediated gene positioning is quantitatively regulated. It is well-established that Gcn4- mediated transcription is regulated through the abundance of Gcn4. Translation of several short upstream open reading frames (uORFs) in the 5’ end of the GCN4 mRNA compete with the

GCN4 coding sequence for translation and, in the presence of amino acids, Gcn4 is poorly translated.124,139 Amino acid starvation leads to an accumulation of uncharged tRNAs, stimulating the Gcn2 kinase to phosphorylate eIF2α, and leading to a global decrease in translation initiation rates.140 This both reduces the global utilization of amino acids and, by decreasing translation initiation of the GCN4 uORFs, leads to increased translation of Gcn4 protein.

This chapter focuses on the role of Dig1 and Dig2 and GCN4’s own abundance in regulating Ste12 and Gcn4-dependent recruitment to the nuclear periphery and interchromosomal clustering, respectively. Additionally, how these regulatory strategies may allow cells to dynamically alter the spatial reorganization of their genomes over different time scales.

5.B. Regulation of Ste12-mediated gene positioning by MAP kinase signaling

We tested if Dig1 and/or Dig2 block Ste12-mediated positioning of PRM1 at the nuclear periphery. Mutants lacking Dig1 showed normal, conditional targeting to the nuclear periphery

(Figure 5.2). However, mutants lacking Dig2 showed constitutive targeting of PRM1 to the periphery (Figure 5.2). Targeting of PRM1 to the periphery in the dig2∆ mutant required Ste12

(Figure 5.2). Therefore, although both Dig1 and Dig2 regulate Ste12-mediated transcription,

Dig2 alone blocks Ste12-mediated gene positioning.

We next tested if MAPK signaling relieves Dig2 repression to allow PRM1 targeting to the nuclear periphery. A phosphoproteomic study identified Ser34 of Dig2 as a pheromone- stimulated MAPK phosphorylation site.141 Ser34 was replaced with either an alanine (to block phosphorylation) or an aspartate (to mimic phosphorylation) in the chromosomal DIG2 gene.

The Ser34Ala mutation blocked PRM1 targeting to the nuclear periphery (Figure 5.2).

Mimicking phosphorylation with the Ser34Asp mutation constitutive peripheral localization, like the dig2∆ mutant (Figure 5.2). This suggests that MAPK phosphorylation of Dig2 Ser34 relieves inhibition of Ste12-mediated targeting to the nuclear periphery.

69 5.C. Independent of DNA binding, Ste12 is sufficient to induce peripheral positioning

Ste12 is necessary and its binding site is sufficient to control spatial positioning. To confirm that Ste12 is responsible for targeting, LexA-Ste12 was tethered to URA3:LexA BS

(Figure 5.3). Under uninducing conditions, URA3:LexA BS was nucleoplasmic (Figure 5.3).

However, in presence of mating pheromone, or in the dig2∆ mutant strain, LexA-Ste12 is sufficient to induce peripheral positioning and its regulation by Dig2 is independent of DNA binding.

To test if Ste12-mediated targeting to the nuclear periphery leads to interchromosomal clustering, we created a MATa haploid yeast strain having LacO arrays both at PRM1 and at

URA3:3xPRE. In the absence of mating pheromone, the distances between PRM1 and

URA3:3xPRE were broadly distributed, with 23% of the cells with distances ≤ 0.55µm (Figure

005.4). In the presence of mating pheromone, PRM1 and URA3:3xPRE clustered together, with a decrease in the mean distance (P = 0.0017; Figure 5.4) and an increase to 43% of the cells with distances ≤ 0.55µm (P = 0.0006; Figure 5.4). Loss of Dig2 led to even higher levels of clustering in the absence of mating pheromone (Figure 5.4). Therefore, Ste12-mediated positioning and interchromosomal clustering are regulated by MAPK signaling through Dig2 phosphorylation.

5.D. Increased peripheral gene positioning through regulated TF synthesis

Mutant strains lacking Gcn4 fail to target both HIS4 (Figure 2.6) and URA3:Gcn4BS

(Figure 2.5) to the nuclear periphery. Therefore, we hypothesized that Gcn4 abundance, not

DNA binding or activity, regulates Gcn4-mediated gene positioning. To test the idea that Gcn4- mediated gene positioning is controlled by Gcn4 protein concentrations, we mutated the

71 initiation codon of the 3rd and 4th uORF in the 5’ end of the GCN4 mRNA in the endogenous

GCN4 gene, which leads to constitutive translation of Gcn4 at levels comparable to those observed during histidine starvation (Figure 5.5).124 These uORF mutations led to constitutive, high level localization of both HIS4 (~65%) and URA3:Gcn4 BS (~60%;) at the nuclear periphery (Figure 5.6). LexA-Gcn4 is also sufficient to position URA3:LexA BS to the nuclear periphery, even under uninducing conditions (Figure 5.7) These results suggests that the occupancy of Gcn4 on the DNA is regulated by the efficiency of Gcn4 translation and that the increase in occupancy leads to an increase in the targeting to the nuclear periphery.

Gcn4-mediated targeting of HIS4 to the nuclear periphery also leads to interchromosomal clustering of HIS4 alleles in a diploid cell (Figure 5.8). In the presence of histidine, the HIS4 alleles were partially clustered and, upon histidine starvation, this clustering increased (Figure

5.9). Clustering requires Gcn4; in strains lacking Gcn4, clustering was completely lost under both uninducing and inducing conditions (Figure 5.8). In a strain having the uORF mutations,

HIS4 clustering was high and unregulated (Figure 5.8). Thus, interchromosomal clustering of

HIS4 is quantitatively controlled by Gcn4 protein levels.

5.E. Different regulatory strategies provide dynamic control of the yeast genome through different time scales

To compare the kinetics of spatial reorganization regulated by these three mechanisms, we analyzed the gene positioning and interchromosomal clustering of INO1, HIS4 or PRM1 after shifting cells from uninducing to inducing conditions (Figure 5.9). In each case, interchromosomal clustering occurred more slowly than targeting to the nuclear periphery, consistent with the fact that interaction with the NPC is a prerequisite for clustering.86

Dissociation of a histone deacetylase from the INO1 promoter led to peripheral localization

74 within 1h and interchromosomal clustering after 3h (Figure 5.9). MAPK phosphorylation of

Dig2 led to relocalization of PRM1 to the nuclear periphery within 15 min and interchromosomal clustering within 30 minutes (Figure 5.9). Relief of Gcn4 translational attenuation led to a statistically significant increase in peripheral localization within 30 minutes and interchromosomal clustering after 60 minutes (Figure 5.9). Thus, these different mechanisms of regulation allow cells to change the spatial positioning of genes with respect to each other over different time scales.

5.F. Conclusion

Cells use different strategies to regulate Gcn4- and Ste12-mediated gene positioning

(Figure 5.10). Unlike Put3, regulation of Ste12- and Gcn4-mediated repositioning is context-‘ independent; inserting the Gcn4BS or the 3xPRE at URA3 led to repositioning to the nuclear periphery upon histidine starvation or pheromone treatment, respectively.8 Furthermore, loss of

Rpd3 had no effect on recruitment of PRM1 or HIS4 to the nuclear periphery and the 3xPRE was

77 completely resistant to tethering of Opi1 or Ume6.8 Instead, Ste12-mediated gene positioning is regulated downstream of DNA binding. At PRM1, Ste12 is constitutively bound and Ste12- dependent transcription is inhibited by two repressors, Dig1 and Dig2.137 Upon mating pheromone stimulation, Dig1 and Dig2 are phosphorylated by the MAPK Fus3, causing them to dissociate from Ste12.142 Dissociation of both Dig1 and Dig2 is required for PRM1 transcriptional activation, but loss of Dig2 alone led to constitutive Ste12-mediated peripheral localization and interchromosomal clustering.8,138 Furthermore, mutation of serine 34 to alanine in Dig2 - blocking phosphorylation - also blocked targeting to the nuclear periphery. Likewise, mutation of serine 34 to aspartate - mimicking phosphorylation - led to constitutive targeting to the nuclear periphery. Thus, Ste12-mediated gene positioning is regulated through post- translational modification of an inhibitor

These results highlight the critical role of TFs in controlling gene positioning and interchromosomal interactions. TF-mediated gene positioning can be regulated through at least four different mechanisms: regulation of TF binding by the Rpd3(L) HDAC, regulation of TF binding (or function) by repressors independent of Rpd3(L), regulation of TF occupancy through changes in TF abundance and regulation of TF function through post-translational modification of an inhibitor. These different strategies operate over different time scales to alter the positioning of individual genes and the arrangement of chromosomes with respect to each other.

Note:

Hinchliff, C. & Brickner, J. H. Transcription factors dynamically control the spatial organization

78 of the yeast genome. Nucleus 7, 369-374, doi:10.1080/19491034.2016.1212797 (2016).” Some of the experiments that are presented in this chapter were done in collaboration with former and current graduate and undergraduate students in Jason Brickners lab, which are listed as follows:

Robert Coukos (Figure 5.4, 5.8, 5.9), Varun Soon (Figure 5.2).

79 Chapter 6: Identifying factors directly mediating zip-code dependent requirement

6.A. Introduction

The transcription factors Put3, Cbf1, Ste12, and Gcn4 are necessary and sufficient to recruit chromatin to the nuclear periphery. Recruitment leads to a physical interaction with nuclear pore components and genetically requires nucleoplasmic basket components such as

Nup2, Nup60, and Mlp1. This suggests that TFs and some nuclear pore components are most likely directly involved in the spatial repositioning of chromatin to the nuclear periphery.

Besides these factors, the molecular mechanism underlying TF-mediated recruitment to the nuclear periphery and interactions with NPC remain mostly unknown. We hypothesized that there are two models for TF-mediated recruitment (Figure 6.1). Either TFs directly associate with nuclear pore components, tethering chromatin at the nuclear periphery or TFs bind to additional factors to mediate recruitment.

80 Consistent with multiple factors mediating recruitment, many factors involved in early transcription and mRNA export are required for recruitment of genes to the NPC. For example, peripheral localization of INO1 requires components of both SAGA (Gcn5, Spt7 or Spt20) and

TREX-2 (Sac3, Thp1, Sus1).20 Likewise, recruitment of GAL genes to the NPC is blocked in strains lacking components of SAGA, Mediator (Med31, Cdk8), TREX-2 and the mRNA export receptor Mex67.28,79,81 Mediator is required for transcriptional of nearly all RNA PoIII- dependent promoters. In yeast, genes are classified as either SAGA dependent or TFIID dependent. The majority of genes including housekeeping genes are TFIID-dependent, whereas the minority are SAGA-dependent genes, which are involved in environmental stress.143

Mediator stabilizes TFIID and its tail module is specifically recruitment and is genetically required for activation of SAGA-dependent genes.144,145 It is conceivable that TREX-2 and

Mex67 are recruited to active genes, acting as a bridge that anchors genes to the nuclear periphery by interacting with components of the SAGA or mediator complexes bound to the genes. However, several observations are not consistent with this model. For example, recruitment of both INO1 and GAL1 to the nuclear periphery is independent of either the transcriptional activator or RNA polymerase II, suggesting that transcription is not required for repositioning to the NPC.28,29,61 Thus, although the requirement for these factors is clear, the interpretation of their role is not.

We aimed to clarify the role of early transcription and mRNA export factors in mediating

TF-mediated recruitment as well as to establish techniques to determine the mechanism of recruitment.

81 6.B. Mediator and SAGA complexes function in INO1, PRM1 and HIS4 recruitment to the nuclear periphery

The transcriptional coactivators SAGA and Mediator are required for recruitment of genes like GAL1-10 and INO1 to the NPC.20,79-81,146 SAGA is also required for the interaction of extrachromosomal circles with the NPC in yeast 71. To test if these complexes are required for recruitment of INO1, HIS4 and PRM1 to the nuclear periphery, we deleted SPT20 (required for the structural integrity SAGA) and MED31(directly associates with Sac3 of the TREX-2 complex).81,147 Loss of Spt20 and Med31 blocked recruitment of both INO1 and HIS4 to the nuclear periphery (Figure 6.2). However, PRM1 repositioning to the nuclear periphery was independent of both (Figure 6.2). The dependency of Spt20 was also observed for the TF binding sites inserted at URA3 (Figure 6.3). Thus, SAGA and Mediator are necessary for recruitment of some, but not all, genes to the nuclear periphery.

6.C. Genetic epistasis analysis of Gcn4-mediated recruitment to the nuclear periphery.

Since the TFs that require SAGA and Mediator are regulated at the level of TF occupancy, we hypothesized that the role of these complexes in recruitment may be indirect and upstream of TF binding. To distinguish direct from indirect loss of function alleles we performed a genetic epistasis analysis using the recruitment of HIS4 to the nuclear periphery.

HIS4 recruitment is mediated by Gcn4 and regulated by Gcn4 own abundance (Figure 5.6).

Therefore, we predicted that increasing Gcn4 abundance would rescue the loss of function alleles of factors that function upstream of DNA binding (indirect factors), and not of factors that function downstream, epistatic to Gcn4, in mediating HIS4 recruitment. To test this, an empty vector or a vector containing ectopic GCN4 expressed constitutively under the ADH1 promoter

(GAL1p-GCN4) was transformed into WT and mutant strains. In the absence of endogenous

Gcn4, HIS4 peripheral localization was rescued with the addition GAL1p-GCN4. Thus the addition of ectopic GCN4 was sufficient to increase the abundance of Gcn4 protein and rescue recruitment of HIS4 to the nuclear periphery. Nup2 is genetically required and physically binds to genes recruited to the nuclear periphery.20 Thus, we predicted that Nup2 functions downstream of Gcn4 in mediating recruitment to the nuclear periphery. Indeed, the addition of

GAL1p-GCN4 did not rescue the loss of function of the nup2∆. Like nup2Δ, in strains containing the empty vector, loss of Spt20, Med31, and GCN5 (catalytic subunit of SAGA) blocked HIS4 peripheral localization, whereas med1Δ (subunit of Mediator essential for transcriptional regulation) did not have a significant effect on peripheral localization (Figure

6.4).148,149 However, unlike Nup2, the addition of GAL1p-GCN4 restored HIS4 peripheral localization in these null allele mutant strains. Thus, NUP2 is downstream of Gcn4 binding and epistatic to Gcn4 binding whereas GCN5, SPT20 and MED31 are not epistatic to Gcn4 binding

84 6.D. Conditional inactivation of factors by anchor away

To confirm the results from the genetic epistasis analysis as well as analyze mRNA export factors Mex67, an essential factor, and the TREX-2 components (Thp1 & Sac3), we exploited conditional inactivation by Anchor Away.150-152 The TREX-2 components are not essential however loss of these factors affected the fluorescence intensity of the membrane marker ERO4 membrane, therefore peripheral localization could not be scored (unpublished result). The Anchor Away system rapidly depletes nuclear proteins tagged with the FKBP12- rapamycin binding domain (FRB). Upon addition of rapamycin, the tagged nuclear protein dimerizes with the ribosomal protein Rpl13A fused to the FK506 binding protein (FKBP12).

Because ribosomes traffic out of the nucleus during their biosynthesis, the targeted proteins are depleted from the nucleus (Figure 6.5).150-152

We hypothesized that conditional inactivation of factors that have a direct role in mediating recruitment to the nuclear periphery should lead to rapid loss of HIS4 peripheral localization. Gcn4, Nup2, Mediator (Med31 & Med1), SAGA (Gcn5 & Spt20) and TREX-2

(Thp1 & Sac3) were tagged with FRB-GFP. Within 1 to 2 hours of adding rapamycin the conditional alleles were depleted from the nucleus (Figure 6.6 & Figure 6.7). Nuclear depletion of Nup2-FRB and Gcn4-FRB resulted in rapid loss of HIS4 peripheral localization, within 15 to

30 minutes (Figure 6.8). However, depletion of SAGA, Mediator, TREX-2, and Mex67 did not rapidly alter HIS4 peripheral localization (Figure 6.9). Instead, only after 5 hours of rapamycin treatment, depletion of these factors significantly blocked HIS4 peripheral localization (Figure

6.10). Therefore, HIS4 localization defects associated with the null mutant of these factors were recruitment to the nuclear periphery whereas SAGA, Mediator, Mex67 and TREX-2 function indirectly, perhaps by influencing Gcn4 DNA binding or abundance.

6.E Tethered Gcn4 leads to a physical association of Nup2 and Gcn5 at URA3

We hypothesized that if Mediator, SAGA, TREX-2, or Mex67 directly bridge the interaction between Gcn4 and the NPC, then they should be recruited by tethered Gcn4. To test this, we performed ChIP at URA3:LexA BS against: Gcn4, Nup2, Med31, Gcn5, Sac3, and

Mex67 in strains expressing LexA-Gcn4 (Figure 6.11) The nucleoplasmic repressed PRM1 gene

served as a negative control and the active promoter of GAL1, which is localized at the nuclear periphery served as a positive control. Nup2, Med31, Gcn4, and Sac3 bound to GAL1, but not to

PRM1 whereas Mex67 did not bind to either. At the LexA-BS locus, only Gcn4, Nup2, and

Gcn5 bound. Thus, TREX-2 and Mediator is not recruited by LexA-Gcn4 to an ectopic site, and likely not involved in recruitment.

6.F. Identification of the minimal Positioning Domain of Gcn4

The transcriptional coactivators SAGA and Mediator and the mRNA export factor

TREX-2 are likely not directly involved in TF-mediator gene recruitment. Therefore, we aimed to identified the direct factors that mediate recruitment, through complementary genetic and biochemical approaches. Tethering LexA-Gcn4 at URA3:LexA BS leads to targeting to the

nuclear periphery (Figure 5.7). Using this system, we mapped the minimal domain of Gcn4 that is sufficient to recruitment chromatin to the nuclear periphery. Gcn4 is segmented into four domains: Activation domain, Central activation domain, Central domain, and bZIP DNA binding domain. Through iterative deletion from the amino and carboxyl termini, the central domain

(141-241) was sufficient to recruit URA3:LexA BS to the nuclear periphery (Figure 6.12). The central domain was further segmented and two overlapping 27 aa domains of Gcn4 were identified to be sufficient (Figure 6.12). These domains overlap each other by ten amino acids.

Since the second domain repositioned URA3:LexA BS to the nuclear periphery in more cells counted, I decided to use that domain moving forward. This domain will be referred as the

Positioning Domain “PD”. The PD domain is highly conserved among Saccharomyces species

(Figure 6.13).153 Like the full length Gcn4-lexA, targeting of PD-LexA requires Nup2 and not

Nup100(Figure 6.14). Thus, both the activation and DNA binding domains are dispensable in mediating recruitment to the nuclear periphery.

6.G. The Gcn4 Positioning Domain is sufficient to induce interchromosomal clustering.

The Positioning Domain of Gcn4 is sufficient to recruit URA3:LexA to the nuclear periphery. To test if PD also is sufficient to induce clustering URA3:lexA alleles in diploid cells, we measured the distribution of distances between the alleles of URA3:LexA in a population of cells expressing LexA only, LexA-Gcn4, or LexA-PD. In cells expressing LexA-Gcn4 or LexA-

PD, the distribution of distances between alleles of URA3:LexA shifts to significantly shorter distances compared to LexA alone (Figure 6.15; P = 1 x 10-3 and 9 x 10-5 respectively, Wilcoxon

93 Rank Sum test). The fraction of cells in which the two alleles are ≤ 0.55µm apart was 25% for

LexA and 48% and 51% respectively for LexA-Gcn4 or LexA-PD (Figure 6.15; P = 1 x 10-4,

Fisher Exact test).86 Thus, full length Gcn4 and its position domain are sufficient to cluster

URA3:LexA

6.H. Conclusion

Using multiple approaches, we have determined that early transcription and mRNA export factors are genetically required, but are likely indirectly involved in TF-mediated recruitment to the nuclear periphery. Genetic epistasis analysis confirmed that the genetic

94 requirement of Mediator (Med31) and SAGA (Gcn5 & Spt20) was not epistatic to Gcn4 binding at HIS4. Conditional inactivation of Mediator, SAGA, TREX-2 and Mex67 by anchor away system did not lead to rapid loss of peripheral localization of HIS4. Finally, tethered LexA-Gcn4 at URA3:LexA was bound by SAGA and Nup2 not Med31, Mex67, or Sac3. Since Gcn4 is a transcription factor, the recruitment of SAGA may be required for transcriptional activation and not recruitment, which would be consistent with the conditional inactivation and genetic epistatic analysis of SAGA components. Similar to Put3, recruitment by Gcn4 does not require its activation domain. Thus, transcription as well as Mediator, SAGA, and TREX-2 are independent of recruitment.

Gcn4-mediated recruitment and clustering is controlled by a small 27 amino acid positioning in its central domain. The next step is to confirm that the Positioning Domain leads to a specific molecular interaction to mediate recruitment. Individual residues from the peptide will be systematically mutated in the LexA-PD, and expression and recruitment of URA3:LexA

BS will be assessed. The identification of a specific mutation in the Positioning Domain will be confirmed at endogenous GCN4 locus monitored by recruitment of HIS4. The PD and PDmut will be used in complementary biochemical and genetics approaches to understand the molecular mechanism of gene positioning. Although I did not have the time to complete this project, my hopes are to continue this work in my remaining time in the lab.

Note:

Some of this chapter was adapted with permission from “Randise-Hinchliff, C. et al. Nuclear pore complexes in genome organization and gene expression in yeast. In Nuclear Transport.

Maximilliano D’Angelo, editor, Springer Publshing Company, New York. Submitted. Some of

95 the experiments that are presented in this chapter were done in collaboration with former and current graduate and undergraduate students in Jason Brickners lab, which are listed as follows:

Robert Coukos (Figure 6.6, 6.7), Micheal Sumner (Figure 6.3), Heidi Schmit (Figure 6.4), and

Agustina Durso (Figure 6.11)

96 Chapter 7: Discussion and future directions

7.A. Introduction

In diverse organisms including yeast, flies, worms, and mammals hundreds to thousands of active genes interact with nuclear pore proteins (Nups).15,18,20,21,29,65 In yeast these interactions occur at the nuclear periphery, presumably in contact with the nuclear pore complex (NPC) and can also lead to interchromosomal clustering of co-regulated genes.8,20,27,28 As a model for these phenomena, we have studied the spatial repositioning of inducible yeast genes from the nucleoplasm to the nuclear periphery. Prior to my thesis, it was known that cis-acting gene recruitment sequences (GRSs) control the spatial positioning of inducible genes such as INO1.

These DNA elements function as DNA zip codes: they are necessary to recruit genes from the nucleoplasm to the nuclear periphery and promote stronger transcription, and they are sufficient to target ectopic sites to the NPC. Furthermore, targeting to the nuclear periphery leads to interchromosomal clustering of genes that share zip codes (Brickner et al., 2012). For example, inserting a DNA zip code called gene recruitment sequence I (GRS I) from the promoter of the

INO1 gene besides the nucleoplasmic locus URA3 leds to targeting of URA3 to the nuclear periphery and clustering of URA3:GRS I with the endogenous INO1 gene (Ahmed et al., 2010;

Brickner et al., 2012). It was also known that the transcription factor Put3 directly bound to the

GRSI and was necessary for GRS I-mediated targeting to the nuclear periphery.8 This suggested that TFs have a role in mediating recruitment to the NPC and interchromosomal clustering of inducible genes.

My thesis aimed to gain insight into TF-mediated gene recruitment. Like INO1, I found that PRM1 and HIS4 are recruited from the nucleoplasm to the nuclear periphery upon activation

97 by the TFs Ste12 and Gcn4.8 Also that INO1, PRM1 and HIS4 use three different regulatory strategies to dynamically control gene positioning and interchromosomal clustering. Targeting of the INO1 promoter to the nuclear periphery by Put3 and Cbf1 is regulated through local recruitment of the Rpd3(L) histone deacetylase complex by transcriptional repressors. I found that the majority of repressors are capable of blocking zip code function through Rpd3- dependent and -independent mechanisms. Ste12-mediated gene positioning is not affected by

Rpd3 but is regulated downstream of DNA binding by MAPK phosphorylation of the inhibitor

Dig2. Finally, Gcn4-mediated gene positioning is controlled by Gcn4 abundance. Each mechanism provides distinct advantages: repressor regulation leads to a slow switch, whereas

MAPK signaling leads to a rapid switch. Furthermore, for Gcn4-mediated recruitment I developed approaches to identify factors that are directly involved in gene recruitment. I also found the minimal Positioning Domain of Gcn4, which was sufficient in target and cluster

URA3. Thus, my thesis broadens our understanding of TF-mediated gene recruitment.

7.B. Transcription factor-mediated gene recruitment to the NPC

Transcription factors play a critical role in controlling the spatial organization of the yeast genome and their function can be regulated to allow this spatial organization to be dynamically altered. Put3, Cbf1, Ste12, and Gcn4 mediate inducible repositioning of target genes from nucleoplasm to the nuclear periphery.8 Furthermore, artificial tethering of Gcn4, Ste12, Mig1, and Sfl1 to the URA3 locus via a LexA DNA binding domain is sufficient to cause URA3 to reposition to the nuclear periphery. This suggests that one of the functions of TFs is to control the spatial organization of the genome. However, it remains unclear how many TFs possess this function and what differentiates them from other TFs. Our work so far suggests that targeting to the periphery is a common function of TFs. For example, using the LexA tethering assay, Dr.

98 Donna Brickner has screened 78 candidates and found 36 (46%) repositioned URA3 to the nuclear periphery in 50% or more of the cells counted. Due the limitations of the LexA tethering assay, the number of positive TFs may actually be underestimated. These limitations include the

TFs being regulated (e.g. Ste12, Figure 5.4) or the C-terminal LexA tag possibly creates a nonfunctional protein. Thus one of the functions of many TFs is to control the spatial organization of the genome.

Since not all active genes are positioned at the nuclear periphery it is unlikely that all TFs possess the ability to control the spatial organization. A number of transcription factors bind to the promoters of genes that interact with the NPC (Figure 2.3). However, many of these binding sites are not sufficient to confer targeting to the nuclear periphery (Figure 2.3). Such TFs may be important transcriptional regulators of genes that are targeted to the NPC by different mechanisms. For example, although the Ino2/Ino4 binding site is enriched among genes that interact with the NPC, these factors are neither necessary nor sufficient to promote peripheral localization (Figure 2.2 & 2.3). It will be important to understand what distinguishes the TFs that control spatial positioning from those that do not. It is conceivable that the TFs that function in repositioning share a common structural motif that is absent or repressed in other TFs. To identify a structural motif, we used the LexA tethering assay and mapped the minimal domain of

Gcn4 that causes peripheral targeting through iterative deletion from the carboxyl and amino termini. We identified a 27 aa Positioning Domain (PD) in Gcn4 that is sufficient to reposition

URA3:LexA BS to nuclear periphery and to cluster two alleles of URA3:LexA BS in diploid cells

(Figure 6.15 & 6.16). The PD of Gcn4 is highly conserved among Saccharomyces species that have diverged over 20 million years (Figure 6.14).153 The PD of Gcn4 is positioned near the bZIP DNA binding domain, and does not overlap with the two activation domains of Gcn4,

99 which is similar to PD identified in Put3 and Ste12, (unpublished). Unfortunately, the PD of the three TFs share no obvious similarity in protein sequence except for being enriched in positively charged resides with an isoelectric point between 8-10. Since the PD of Put3 and Ste12 are less defined and include the DNA binding domains, these positive residues may be important in binding and not in positioning. Further work will be needed in characterizing the PD of the TFs to determine if diverse families of transcription factors, like Put3, Ste12, and Gcn4 share a commonality in their Positioning Domains.

7.C. The molecular mechanism of TF-mediated gene recruitment

A goal of my dissertation was to define the direct factors involved in TF-mediated gene recruitment to the nuclear periphery. However, many of the factors that are genetically required for repositioning are likely not directly involved in gene recruitment. For example, components of SAGA and Mediator are genetically required for GAL1, INO1, and HIS4.20,79-81,146 However, conditional inactivation and genetic epistasis analysis suggest that the requirement of these factors are likely indirect for HIS4 repositioning. Additionally, conditional inactivation of mRNA export factors, TREX-2 and Mex67 also did not lead to rapid loss in HIS4 peripheral localization (Figure 6.9). Therefore, the mechanism of gene recruitment still remains elusive.

We hypothesized the factors that directly bridge the interaction between Gcn4 and the

NPC should directly bind to Gcn4. BioGRID, an interaction repository, 131 factors that physically interacts with Gcn4.154 Many of these factors, however, are transcriptional regulators.

Since the activation domain of Gcn4 is dispensable for gene recruitment, these factors may not be directly involved. To narrow the interaction partners we identified the minimal Positioning

Domain of Gcn4.

100 Using biochemical and genetic approaches we will identify the interaction partners of PD of GCN4. Because many nuclear pore proteins are highly labile during native immunoprecipitation we aim to identify label proteins that interaction with PD with biotin using

BioID. The technique exploits a mutant form of BirA, which releases a highly reactive bioAMP intermediated and biotinylates nearby proteins.155 Therefore, proteins that interact with the PD of Gcn4 in-vivo will be labeled and subsequently identified by tandem mass spectrometry. Using the approaches described in chapter 6, the factors identified from the screen will then be tested for a direct role in Gcn4 mediated recruitment to the nuclear periphery.

Once the molecular mechanism of TF-mediate recruitment is defined many questions can be answered. For example, do TFs mediate gene recruitment through unique mechanisms or share a common mechanism? So far, the molecular requirements identified have been the same between the different TFs. Active recruitment of many genes genetically requires NUP2 but not

NUP100, and leads to a physical association of Nup2, but not of Nup100.20 Also when unregulated, Put3, Cbf1, Gcn4, and Ste13 is capable of targeting chromatin to the NPC constitutively, suggesting the molecular components downstream of the TF are unregulated and present variable conditions.8 Therefore we hypothesized TFs share a common mechanism to mediate recruitment. To test this, we will compare factors that have a direct role in Gcn4- mediated recruitment in recruitment mediated by other TFs such as Put3, Cbf1, and Ste12.

We can also determine if the molecular mechanism(s) of gene recruitment is conserved in metazoans. In flies, worms, and mammalian cells hundreds of genes interact with the nuclear pore proteins.15-20 Also similar to yeast, many mammalian TFs bindings sites such as GAGA factor, YY1, and AP-2 correlate with nuclear pore proteins binding.16,108,156 In Drosophila, the transcription factor MDB-R2 physically interacts with Nup98 and is required from recruitment of

101 Nup98 to many genomic target sites.125 This suggests that TFs role in spatial positioning may be conserved throughout eukaryotes. It is conceivable that the mechanism(s) of repositioning is also conserved.

Finally, tethering the Positioning Domain of Gcn4 to two alleles of URA3:LexA also leads to interchromosomal clustering. Since the molecular mechanism controlling TF-mediated recruitment is distinct from the mechanism controlling clustering, we may identity factors that interact with the Positioning Domain of Gcn4 that are specific required for clustering and not recruitment or vice versa.28 For example, GAL1 clustering requires Mlp1 whereas recruitment does not.

Characterizing the distinct mechanism of recruitment and clustering will hopefully clarify past results. For example, the insertion of DNA zip codes leads to recruitment of URA3 to the nuclear periphery and in diploid leads to clustering of the two URA3 alleles with the same zip code.86 However, two URA3 alleles containing different zip codes do not cluster even though both zip codes recruit URA3 to the nuclear periphery. This suggests that even at the same locus with the same physical restraints, TFs mediate recruit of chromatin to different NPCs and presumably different spatial positions within the nucleus. Alternatively, recruitment by TFs is not precise and occurs at multiple NPCs. Once two loci containing the same DNA zip code are recruited to the same NPC, these loci become associated with each other. If the mechanism of clustering is similar between TFs, what leads to TF specific clustering? If the mechanism of clustering is different between TFs, then what factors are different between the mechanisms? If the mechanism of clustering and recruitment are distinct for different TFs, why do all TFs that mediate recruitment, except for Cbf1, lead to clustering? These questions remain unanswered and are excellent for the next graduate to fill my shoes.

102 Chapter 8: Materials and Methods

8.A. Chemicals and media

All chemicals were from Sigma Aldrich (St. Louis, MO), unless otherwise noted. Yeast media were from Sunrise Science Products (San Diego, CA). Alpha factor was from Zymo

Research (Orange, CA). Yeast and bacteria were grown with standard media as described.157 For experiments involving inositol starvation, cells were grown in SDC-inositol ± 100µM of myo- inositol. Experiments involving alpha factor, 100µM (final concentration) was added to yeast suspended in 100µL of SDC media. For experiment involving rapamycin, 1µg/ml (final concentration) was added to 1-2mL of SDC media.

8.B. Yeast strains

Yeast were transformed with plasmids described in.115 All yeast strains were derived from W303 (ade2-1 URA3-1 trp1-1 his3-11,15 leu2-3,112 can1-100) strains CRY1 (MATa) or

CRY2 (MAT α) and are listed in Appendix 1.

The following INO1 promoter mutants: Δ4, GRS IΔ, GRS IIΔ, and GRS IΔGRS IIΔ were created by transforming INO1promoterΔ strains with PCR of the INO1 promoter containing the desirable mutation(s) and selecting on minimal medium without inositol. The following mutations were introduced at the endogenous loci by a different approach: UASmut INO1pro,

URSmut INO1pro, ino2-L188A, rpd3-H188A, GCN4-uORF, and the dig2-S34A and DIG2-S34D were created by integrating URA3 and SUP4-o ochre suppressor 158 to replace the endogenous locus surrounding the mutation. Mutated versions of the endogenous loci were then integrated in place of the URA3-SUP4-o cassette by counter selection with 5-fluorooroitic acid (against

URA3) or canavanine (against SUP4-o). UASmut INO1pro: two UASINO elements at -178 (5’-

103 CACATG-3’) -172 and -243 (5’-CATGTG-3’) -237 were mutated to (5’-CACTTC-3’) and (5’-

GAAGTG-3’) respectively. URSmut INO1pro: -260 (5’-TCGGCGGCT-3’) -251 mutated to (5’-

GATTATTAG-3’). GCN4 5’ 3rd uORF ATG mutated to AGG and 4th uORF ATG mutated to

AUC. rpd3-H188A: HIS188 5’-CAT-3’ was mutated Ala 5’-GCT-‘3. Dig2-S34A 5’-TCT-3’ was mutated Ala 5’-GCT-‘3 and DIG2-S34D mutated to 5’-GAT-‘3.

8.C. Molecular biology

The plasmids p6LacO128 and p6LacO128-INO1 have been described.15 The plasmids pmCh-ER03, pmCh-ER04, and pmCh-ER05 were derived from pAC08-mCh-L-TM.159 The

GAL1-10 promoter of pAC08-mCh-L-TM was replaced with the GPD1 promoter as a SacI-SpeI fragment to produced pGPD-mCh-ER16. The promoter, mCherry fusion and 3’UTR was than inserted into shuttle vectors pRS303 (HIS3), pRS304 (TRP1), pRS305 (LEU2) 160 to generate pmCh-ER03, pmCh-ER04 and pmCh-ER05. These plasmids were digested with BstXI and integrated at HIS3, TRP1 or LEU2, respectively.

Plasmid pADH-LexA was derived from p414-ADH1 161. LexA was inserted into p414-

ADH1 as a NotI-PstI fragment. Repressors were PCR amplified from W303 genomic DNA and cloned into a pADH-LexA plasmid as either a BamHI C-terminal LexA fusion or a XhoI, or PstI fragment creating an N-terminal LexA fusion (Fig. S3c). Ste12 and Gcn4 was cloned into p414-

ADH1 as a XhoI and BamHI fragment respectively.

Plasmid pGAL1-LexA was derived from pRSII402 (a gift to addgene from Steven Haase

(Addgene plasmid # 35434).162 pGAL1-LexA was inserted as a KpnI XbaI fragment gBLOCK. pGAL1 is the (-1 to -606) of GAL1-10 promoter. To insert for a C-terminal lexA fusion digest with HindIII/XhoI. For N-terminal lexA fusion PstI/SpeI. All Gcn4 fragments were inserted in pGAL1-LexA as HindIII/XhoI fragments creating a C-terminal lexA tag.

104 Plasmid pADH1-GCN4 was derived from pXRA2 (a gift to addgene from Marc

Gartenberg (Addgene plasmid # 63144).163 pAdh1-GCN4 was created as an overhanging PCR from the minimal pADH promoter from pADH-LexA plasmid using

AAGCTTTAATAGGCGCATGCAACTTC and CTTGTCATCGTCGTCCTTGTAGTCCAT primers with the CDS and 410bp of UTR of GCN4 CDS from CRY3 genomic DNA. The overlapping PCR was inserted into pXRA2 as a HindIII/XhoI fragment.

The following plasmids were derived from p6LacO128: p6LacO128-GRS I, p6LacO128-

GRS I-LexA, p6LacO128-GRS II-LexA, p6LacO128-3XPRE-LexA, p6LacO128-PRM1, p6LacO128-HIS4, p6LacO128-GCN4. They were created as follows. Plasmid p6LacO128-GRS

I: -266 to -366 of INO1 promoter was amplified and inserted into p6LacO128 as a SpeI-SacI fragment. For integration at URA3, p6LacO128-GRS I was linearized by digestion with StuI.

Plasmid p6LacO128-GRS I-LexA: The LexA BS was inserted into p6LacO128-GRS I as a SacI fragment with the sequence 5’-AAG GTT GGG AAG CCC TGC AAA CTC ATA TAC TGT

ATA TAT ATA CAG TAT ACA AGC T-3’. Plasmid p6LacO128-GRS II-LexA and p6LacO128-3xPRE-LexA were created by inserting the zip code along with LexA binding site as a BamHI fragments into the p6LacO128 plasmid. GRS II LexA fragment sequence is 5’-GAT

CCT TCC TAC TGT TAT TCT TCC CAG CAA TCA TTC ACG CTT GCT ACG TTG TAT

ATG AAA CGA GTA GTG ATA CTG TAT ATA TAT ACA GTA-3’. 3xPRE LexA fragment sequence is 5’-GAT CGA GTC CGG GTA ATA CAT ATG TTT CAA TAC TGT TTC AAT

ACT GTT TCA GAA GTG CGT CAC ATA TTA TAC TGT ATA TAT ATA CAG TA-3’.

Plasmid p6LacO128-PRM1: 1500 to 3067 of the PRM1 CDS and 3’ UTR was amplified and inserted as a BamHI-NotI fragment into p6LacO128. This plasmid was linearized by digestion with SnaBI to integrate at PRM1 locus. Plasmid p6LacO128-HIS4: 3171 to 3577 HIS4 CDS and

105 3’ UTR was amplified and inserted as a BamHI-SphI fragment into p6LacO128. p6LacO128-

HIS4 was linearized by HindIII and integrated at HIS4. p6LacO128-GCN4: The GCN4 bind site

5’-CAT GCA CAG TGA CTC ACG TTT TTT T-3’ from the HIS4 promoter (-228 to -253) was inserted into p6LacO128 as a HindIII fragment. Plasmid p6LacO128-GCN4 was linearized by

StuI and integrated at URA3. To create the URA3:3xPRE LacO strain, the sequence 5’-TAC

ATA TGT TTC AAT ACT GTT TCA ATA CTG TTT CAG AAG TGC GTC ACA TAT TAA-

3’ was cloned into an integration cassette within the plasmid pZipKan using flanking StuI sites.

It was then integrated directly into the backbone of the p6LacO128 as described.115

8.D. Microscopy

For all experiments, cells were maintained at OD600 < 0.8. For inositol starvation experiments, strains were grown overnight in SDC-inositol in the presence or absence or 100µM myo-inositol. For histidine starvation experiments, strains were grown overnight in SDC, harvested and resuspended in either SDC or SDC-His media and incubated at 30oC for 45-75 minutes. For alpha factor stimulation experiments, strains were grown overnight in SDC, 100µL of cells was transferred to a 1.5 ml eppendorf tube with 100µM final concentration of alpha factor for 15-25 minutes. For anchor away systems, cells were treated with rapamycin, 1µg/ml

(final concentration) in SDC media for 0 to 5hr. 50 minutes prior to imaging media was switched to SDC – histidine with 1µg/ml (final concentration of rapamycin. For strains containing pGAL1-LexA with GCN4 CDS or fragments of GCN4 (Figure 5.8 & 6.11 – 6.15) cells were grown in YPD overnight and switched to YP-galactose for 3-4 hours.

After the above treatments, cells were concentrated by brief centrifugation and imaged immediately. The images were captured as 0.34um thick z-stacks (the yeast nucleus is ~2µm in diameter) with a Leica SP5 II Line Scanning Confocal Microscope with 100× 1.44NA (oil

106 immersion) objective using an Argon 488 nm and Diode Pumped Solid State 561nm lasers in the Northwestern Biological Imaging Facility as described 115. Cells were scored using LAS AF or LAS AF Lite software. For each individual cell the z stack with the brightest and most focused

LacO dot is score. The slice that is used is not necessarily the same for every cell and, for cells in which the dot is at the top or bottom of the nucleus, localization is not scored. If the center of the dot overlaps with the membrane, the cell is scored as peripheral.

8.E. Clustering analysis

Samples were visualized on a Leica Spinning Disc Advanced Fluorescence confocal microscope in the Northwestern University Biological Imaging Facility. Cells were deposited on double cavity microscope slide (VWR) prepared with 4% low melt agar. Slide covers were sealed with nail polish to prevent drying. Images of the cells consisted of 16 z-slices spaced

0.4μm apart, with eight time points taken at 30 second intervals over 4 minutes. From the first time point of each image, the distance between the two loci was measured using ImageJ. When only a single locus was apparent in a cell but the entire cell was captured in the image, the additional time points were referenced to determine if the spot subsequently later split into two loci. In those cases, a distance value of 0 µm was assigned to these tightly-clustered loci. For images of the PRM1 vs. URA3:3xPRE loci, only a single time point was taken in the interest of more rapid acquisition, and tightly-clustered loci were excluded from our analysis. For each condition, over 100 cells were measured. The distances were binned into 0.15 or 0.2µm classes to generate distributions of distance used in mountain plots and heat plots. For heat plots, the mean fraction of cells and standard deviation for all bins was used. An R script was used to generate the greyscale heat map of the number of standard deviations from the mean for each bin.

107 8.F. FRB-GFP depletion analysis.

Image analysis was performed in ImageJ. Images of cell were taken as a sum projection of 4 z-slices occurring .4 microns apart, to reduce variability resultant from the z position of the nucleus within the cell. For each protein, cells within a square (240x240 pixels or ~21x21 microns) near the center of the image were analyzed, resulting in about 15-20 measured cells per protein and time point. Abundance of the protein was measured by drawing a 2.02 micron (23 pixel) line from the cell starting outside the nucleus and crossing into the nucleus at about the halfway point on the line, then taking the histogram of the fluorescence intensity along the line.

For proteins with diffuse nuclear localization, a single line was used per cell, while the abundance of peripherally localized proteins was taken as the average of four lines taken at 90 degree intervals around the nucleus, to account for variance in protein concentration at different points around the nuclear envelope. The histogram of the population of cells was generated from the average of all cells counted in that condition, and the error bars represent the standard error of the mean for all measurements at that distance along the line. Background was subtracted from the population-average histogram by finding the average fluorescence intensity along three lines drawn within the square but outside of any cells. Protein abundance vs untreated control was then found by comparing the areas under the curve of the background-subtracted histograms for the space on the line corresponding to the nucleus (pixels 13-23).

108 References

1 Sexton, T. & Cavalli, G. The role of chromosome domains in shaping the functional

genome. Cell 160, 1049-1059, doi:10.1016/j.cell.2015.02.040 (2015).

2 Pombo, A. & Dillon, N. Three-dimensional genome architecture: players and

mechanisms. Nat Rev Mol Cell Biol 16, 245-257, doi:10.1038/nrm3965 (2015).

3 Cremer, T. et al. Chromosome territories--a functional nuclear landscape. Curr Opin Cell

Biol 18, 307-316 (2006).

4 Bartlett, J. et al. Specialized transcription factories. Biochem Soc Symp, 67-75 (2006).

5 Boisvert, F. M., van Koningsbruggen, S., Navascues, J. & Lamond, A. I. The

multifunctional nucleolus. Nat Rev Mol Cell Biol 8, 574-585, doi:10.1038/nrm2184

(2007).

6 Andersen, J. S. et al. Nucleolar proteome dynamics. Nature 433, 77-83,

doi:10.1038/nature03207 (2005).

7 Peric-Hupkes, D. et al. Molecular maps of the reorganization of genome-nuclear lamina

interactions during differentiation. Mol Cell 38, 603-613,

doi:10.1016/j.molcel.2010.03.016 (2010).

8 Randise-Hinchliff, C. et al. Strategies to regulate transcription factor-mediated gene

positioning and interchromosomal clustering at the nuclear periphery. J Cell Biol 212,

633-646, doi:10.1083/jcb.201508068 (2016).

9 Meldi, L. & Brickner, J. H. Compartmentalization of the nucleus. Trends Cell Biol 21,

701-708, doi:10.1016/j.tcb.2011.08.001 (2011).

10 Taddei, A. & Gasser, S. M. Structure and function in the budding yeast nucleus. Genetics

192, 107-129, doi:10.1534/genetics.112.140608 (2012).

109 11 Luperchio, T. R., Wong, X. & Reddy, K. L. Genome regulation at the peripheral zone:

lamina associated domains in development and disease. Curr Opin Genet Dev 25, 50-61,

doi:10.1016/j.gde.2013.11.021 (2014).

12 Gruenbaum, Y. & Foisner, R. Lamins: nuclear intermediate filament proteins with

fundamental functions in nuclear mechanics and genome regulation. Annu Rev Biochem

84, 131-164, doi:10.1146/annurev-biochem-060614-034115 (2015).

13 Belmont, A. S., Zhai, Y. & Thilenius, A. Lamin B distribution and association with

peripheral chromatin revealed by optical sectioning and electron microscopy tomography.

J Cell Biol 123, 1671-1685 (1993).

14 Taddei, A., Hediger, F., Neumann, F. R., Bauer, C. & Gasser, S. M. Separation of

silencing from perinuclear anchoring functions in yeast Ku80, Sir4 and Esc1 proteins.

Embo J 23, 1301-1312 (2004).

15 Brickner, J. H. & Walter, P. Gene recruitment of the activated INO1 locus to the nuclear

membrane. PLoS Biol 2, e342, doi:10.1371/journal.pbio.0020342 (2004).

16 Casolari, J. M. et al. Genome-wide localization of the nuclear transport machinery

couples transcriptional status and nuclear organization. Cell 117, 427-439 (2004).

17 Brown, C. R., Kennedy, C. J., Delmar, V. A., Forbes, D. J. & Silver, P. A. Global histone

acetylation induces functional genomic reorganization at mammalian nuclear pore

complexes. Genes Dev 22, 627-639, doi:10.1101/gad.1632708 (2008).

18 Kalverda, B., Pickersgill, H., Shloma, V. V. & Fornerod, M. Nucleoporins directly

stimulate expression of developmental and cell-cycle genes inside the nucleoplasm. Cell

140, 360-371, doi:10.1016/j.cell.2010.01.011 (2010).

110 19 Rohner, S. et al. Promoter- and RNA polymerase II-dependent hsp-16 gene association

with nuclear pores in Caenorhabditis elegans. J Cell Biol 200, 589-604,

doi:10.1083/jcb.201207024 (2013).

20 Ahmed, S. et al. DNA zip codes control an ancient mechanism for gene targeting to the

nuclear periphery. Nat Cell Biol 12, 111-118, doi:10.1038/ncb2011 (2010).

21 Capelson, M. et al. Chromatin-bound nuclear pore components regulate gene expression

in higher eukaryotes. Cell 140, 372-383, doi:10.1016/j.cell.2009.12.054 (2010).

22 D'Urso, A. et al. Set1/COMPASS and Mediator are repurposed to promote epigenetic

transcriptional memory. Elife 5, doi:10.7554/eLife.16691 (2016).

23 Ishii, K., Arib, G., Lin, C., Van Houwe, G. & Laemmli, U. K. Chromatin boundaries in

budding yeast: the nuclear pore connection. Cell 109, 551-562 (2002).

24 Light, W. H. et al. A conserved role for human Nup98 in altering chromatin structure and

promoting epigenetic transcriptional memory. PLoS Biol 11, e1001524,

doi:10.1371/journal.pbio.1001524 (2013).

25 Light, W. H., Brickner, D. G., Brand, V. R. & Brickner, J. H. Interaction of a DNA zip

code with the nuclear pore complex promotes H2A.Z incorporation and INO1

transcriptional memory. Mol Cell 40, 112-125, doi:10.1016/j.molcel.2010.09.007 (2010).

26 Dilworth, D. J. et al. The mobile nucleoporin Nup2p and chromatin-bound Prp20p

function in endogenous NPC-mediated transcriptional control. J Cell Biol 171, 955-965,

doi:10.1083/jcb.200509061 (2005).

27 Brickner, D. G. & Brickner, J. H. Interchromosomal clustering of active genes at the

nuclear pore complex. Nucleus 3, 487-492, doi:10.4161/nucl.22663 (2012).

111 28 Brickner, D. G. et al. Subnuclear positioning and interchromosomal clustering of the

GAL1-10 locus are controlled by separable, interdependent mechanisms. Mol Biol Cell,

doi:10.1091/mbc.E16-03-0174 (2016).

29 Brickner, D. G. et al. H2A.Z-mediated localization of genes at the nuclear periphery

confers epigenetic memory of previous transcriptional state. PLoS Biol 5, e81,

doi:10.1371/journal.pbio.0050081 (2007).

30 Tan-Wong, S. M., Wijayatilake, H. D. & Proudfoot, N. J. Gene loops function to

maintain transcriptional memory through interaction with the nuclear pore complex.

Genes Dev 23, 2610-2624, doi:23/22/2610 [pii]

10.1101/gad.1823209 (2009).

31 Brickner, J. H. Transcriptional memory at the nuclear periphery. Curr Opin Cell Biol 21,

127-133, doi:10.1016/j.ceb.2009.01.007 (2009).

32 Botstein, D. & Fink, G. R. Yeast: an experimental organism for 21st Century biology.

Genetics 189, 695-704, doi:10.1534/genetics.111.130765 (2011).

33 Taddei, A., Schober, H. & Gasser, S. M. The budding yeast nucleus. Cold Spring Harb

Perspect Biol 2, a000612, doi:10.1101/cshperspect.a000612 (2010).

34 Zimmer, C. & Fabre, E. Principles of chromosomal organization: lessons from yeast. J

Cell Biol 192, 723-733, doi:10.1083/jcb.201010058 (2011).

35 McBratney, S. & Winey, M. Mutant membrane protein of the budding yeast spindle pole

body is targeted to the endoplasmic reticulum degradation pathway. Genetics 162, 567-

578 (2002).

112 36 Hediger, F., Neumann, F. R., Van Houwe, G., Dubrana, K. & Gasser, S. M. Live imaging

of telomeres: yKu and Sir proteins define redundant telomere-anchoring pathways in

yeast. Curr Biol 12, 2076-2089 (2002).

37 Duan, Z. et al. A three-dimensional model of the yeast genome. Nature 465, 363-367,

doi:10.1038/nature08973 (2010).

38 Parada, L. & Misteli, T. Chromosome positioning in the interphase nucleus. Trends Cell

Biol 12, 425-432 (2002).

39 Marshall, W. F., Dernburg, A. F., Harmon, B., Agard, D. A. & Sedat, J. W. Specific

interactions of chromatin with the nuclear envelope: positional determination within the

nucleus in Drosophila melanogaster. Mol Biol Cell 7, 825-842 (1996).

40 Aitchison, J. D. & Rout, M. P. The yeast nuclear pore complex and transport through it.

Genetics 190, 855-883, doi:190/3/855 [pii]

10.1534/genetics.111.127803 (2012).

41 Makhnevych, T., Lusk, C. P., Anderson, A. M., Aitchison, J. D. & Wozniak, R. W. Cell

cycle regulated transport controlled by alterations in the nuclear pore complex. Cell 115,

813-823 (2003).

42 Dilworth, D. J. et al. Nup2p dynamically associates with the distal regions of the yeast

nuclear pore complex. J Cell Biol 153, 1465-1478 (2001).

43 Tran, E. J. & Wente, S. R. Dynamic nuclear pore complexes: life on the edge. Cell 125,

1041-1053, doi:10.1016/j.cell.2006.05.027 (2006).

44 Neumann, N., Lundin, D. & Poole, A. M. Comparative genomic evidence for a complete

nuclear pore complex in the last eukaryotic common ancestor. PLoS One 5, e13241,

doi:10.1371/journal.pone.0013241 (2010).

113 45 Brohawn, S. G., Leksa, N. C., Spear, E. D., Rajashankar, K. R. & Schwartz, T. U.

Structural evidence for common ancestry of the nuclear pore complex and vesicle coats.

Science 322, 1369-1373, doi:10.1126/science.1165886 (2008).

46 Cronshaw, J. M., Krutchinsky, A. N., Zhang, W., Chait, B. T. & Matunis, M. J.

Proteomic analysis of the mammalian nuclear pore complex. J Cell Biol 158, 915-927,

doi:10.1083/jcb.200206106 (2002).

47 Wu, J., Matunis, M. J., Kraemer, D., Blobel, G. & Coutavas, E. Nup358, a

cytoplasmically exposed nucleoporin with peptide repeats, Ran-GTP binding sites, zinc

fingers, a cyclophilin A homologous domain, and a leucine-rich region. J Biol Chem 270,

14209-14213 (1995).

48 Hoelz, A., Debler, E. W. & Blobel, G. The structure of the nuclear pore complex. Annu

Rev Biochem 80, 613-643, doi:10.1146/annurev-biochem-060109-151030 (2011).

49 Reichelt, R. et al. Correlation between structure and mass distribution of the nuclear pore

complex and of distinct pore complex components. J Cell Biol 110, 883-894 (1990).

50 Rout, M. P. & Blobel, G. Isolation of the yeast nuclear pore complex. J Cell Biol 123,

771-783 (1993).

51 Grossman, E., Medalia, O. & Zwerger, M. Functional architecture of the nuclear pore

complex. Annu Rev Biophys 41, 557-584, doi:10.1146/annurev-biophys-050511-102328

(2012).

52 Kampmann, M. & Blobel, G. Three-dimensional structure and flexibility of a membrane-

coating module of the nuclear pore complex. Nat Struct Mol Biol 16, 782-788,

doi:10.1038/nsmb.1618 (2009).

114 53 Devos, D. et al. Components of coated vesicles and nuclear pore complexes share a

common molecular architecture. PLoS Biol 2, e380, doi:10.1371/journal.pbio.0020380

(2004).

54 Alber, F. et al. The molecular architecture of the nuclear pore complex. Nature 450, 695-

701, doi:10.1038/nature06405 (2007).

55 Okamura, M., Inose, H. & Masuda, S. RNA Export through the NPC in Eukaryotes.

Genes (Basel) 6, 124-149, doi:10.3390/genes6010124 (2015).

56 Steglich, B., Sazer, S. & Ekwall, K. Transcriptional regulation at the yeast nuclear

envelope. Nucleus 4, 379-389, doi:10.4161/nucl.26394 (2013).

57 Casolari, J. M., Brown, C. R., Drubin, D. A., Rando, O. J. & Silver, P. A.

Developmentally induced changes in transcriptional program alter spatial organization

across chromosomes. Genes Dev 19, 1188-1198, doi:10.1101/gad.1307205 (2005).

58 Palancade, B., Zuccolo, M., Loeillet, S., Nicolas, A. & Doye, V. Pml39, a novel protein

of the nuclear periphery required for nuclear retention of improper messenger

ribonucleoparticles. Mol Biol Cell 16, 5258-5268, doi:10.1091/mbc.E05-06-0527 (2005).

59 Zhao, X., Wu, C. Y. & Blobel, G. Mlp-dependent anchorage and stabilization of a

desumoylating enzyme is required to prevent clonal lethality. J Cell Biol 167, 605-611,

doi:10.1083/jcb.200405168 (2004).

60 Cabal, G. G. et al. SAGA interacting factors confine sub-diffusion of transcribed genes to

the nuclear envelope. Nature 441, 770-773, doi:10.1038/nature04752 (2006).

61 Schmid, M. et al. Nup-PI: the nucleopore-promoter interaction of genes in yeast. Mol

Cell 21, 379-391, doi:10.1016/j.molcel.2005.12.012 (2006).

115 62 Dultz, E. et al. Global reorganization of budding yeast chromosome conformation in

different physiological conditions. J Cell Biol 212, 321-334, doi:10.1083/jcb.201507069

(2016).

63 Regot, S. et al. The Hog1 stress-activated protein kinase targets nucleoporins to control

mRNA export upon stress. J Biol Chem 288, 17384-17398,

doi:10.1074/jbc.M112.444042 (2013).

64 Dieppois, G., Iglesias, N. & Stutz, F. Cotranscriptional recruitment to the mRNA export

receptor Mex67p contributes to nuclear pore anchoring of activated genes. Mol Cell Biol

26, 7858-7870, doi:10.1128/MCB.00870-06 (2006).

65 Taddei, A. et al. Nuclear pore association confers optimal expression levels for an

inducible yeast gene. Nature 441, 774-778, doi:10.1038/nature04845 (2006).

66 Sarma, N. J. et al. Glucose-responsive regulators of gene expression in Saccharomyces

cerevisiae function at the nuclear periphery via a reverse recruitment mechanism.

Genetics 175, 1127-1135, doi:10.1534/genetics.106.068932 (2007).

67 Guet, D. et al. Combining Spinach-tagged RNA and gene localization to image gene

expression in live yeast. Nat Commun 6, 8882, doi:10.1038/ncomms9882 (2015).

68 Texari, L. et al. The nuclear pore regulates GAL1 gene transcription by controlling the

localization of the SUMO protease Ulp1. Mol Cell 51, 807-818,

doi:10.1016/j.molcel.2013.08.047 (2013).

69 Brickner, D. G. & Brickner, J. H. Cdk phosphorylation of a nucleoporin controls

localization of active genes through the cell cycle. Mol Biol Cell 21, 3421-3432,

doi:10.1091/mbc.E10-01-0065 (2010).

116 70 Chen, M. & Gartenberg, M. R. Coordination of tRNA transcription with export at nuclear

pore complexes in budding yeast. Genes Dev 28, 959-970, doi:10.1101/gad.236729.113

(2014).

71 Denoth-Lippuner, A., Krzyzanowski, M. K., Stober, C. & Barral, Y. Role of SAGA in

the asymmetric segregation of DNA circles during yeast ageing. Elife 3,

doi:10.7554/eLife.03790 (2014).

72 Sinclair, D. A. & Guarente, L. Extrachromosomal rDNA circles--a cause of aging in

yeast. Cell 91, 1033-1042 (1997).

73 Denoth Lippuner, A., Julou, T. & Barral, Y. Budding yeast as a model organism to study

the effects of age. FEMS Microbiol Rev 38, 300-325, doi:10.1111/1574-6976.12060

(2014).

74 Defossez, P. A. et al. Elimination of replication block protein Fob1 extends the life span

of yeast mother cells. Mol Cell 3, 447-455 (1999).

75 Blobel, G. Gene gating: a hypothesis. Proc Natl Acad Sci U S A 82, 8527-8529 (1985).

76 Smith, C. et al. In vivo single-particle imaging of nuclear mRNA export in budding yeast

demonstrates an essential role for Mex67p. J Cell Biol 211, 1121-1130,

doi:10.1083/jcb.201503135 (2015).

77 Fischer, T. et al. The mRNA export machinery requires the novel Sac3p-Thp1p complex

to dock at the nucleoplasmic entrance of the nuclear pores. Embo J 21, 5843-5852

(2002).

78 Kohler, A. & Hurt, E. Exporting RNA from the nucleus to the cytoplasm. Nat Rev Mol

Cell Biol 8, 761-773, doi:10.1038/nrm2255 (2007).

117 79 Luthra, R. et al. Actively transcribed GAL genes can be physically linked to the nuclear

pore by the SAGA chromatin modifying complex. J Biol Chem 282, 3042-3049,

doi:10.1074/jbc.M608741200 (2007).

80 Rodriguez-Navarro, S. et al. Sus1, a functional component of the SAGA histone

acetylase complex and the nuclear pore-associated mRNA export machinery. Cell 116,

75-86 (2004).

81 Schneider, M. et al. The Nuclear Pore-Associated TREX-2 Complex Employs Mediator

to Regulate Gene Expression. Cell 162, 1016-1028, doi:10.1016/j.cell.2015.07.059

(2015).

82 Therizols, P. et al. Telomere tethering at the nuclear periphery is essential for efficient

DNA double strand break repair in subtelomeric region. J Cell Biol 172, 189-199,

doi:10.1083/jcb.200505159 (2006).

83 Sarma, N. J. et al. The nuclear pore complex mediates binding of the Mig1 repressor to

target promoters. PLoS One 6, e27117, doi:10.1371/journal.pone.0027117 (2011).

84 Van de Vosse, D. W. et al. A role for the nucleoporin Nup170p in chromatin structure

and gene silencing. Cell 152, 969-983, doi:10.1016/j.cell.2013.01.049 (2013).

85 Green, E. M., Jiang, Y., Joyner, R. & Weis, K. A negative feedback loop at the nuclear

periphery regulates GAL gene expression. Mol Biol Cell 23, 1367-1375,

doi:10.1091/mbc.E11-06-0547 (2012).

86 Brickner, D. G. et al. Transcription factor binding to a DNA zip code controls

interchromosomal clustering at the nuclear periphery. Dev Cell 22, 1234-1246,

doi:10.1016/j.devcel.2012.03.012 (2012).

118 87 Randise-Hinchliff, C. & Brickner, J. H. Transcription factors dynamically control the

spatial organization of the yeast genome. Nucleus, 0,

doi:10.1080/19491034.2016.1212797 (2016).

88 D'Urso, A. & Brickner, J. H. Mechanisms of epigenetic memory. Trends Genet 30, 230-

236, doi:10.1016/j.tig.2014.04.004 (2014).

89 Kundu, S., Horn, P. J. & Peterson, C. L. SWI/SNF is required for transcriptional memory

at the yeast GAL gene cluster. Genes Dev 21, 997-1004, doi:10.1101/gad.1506607

(2007).

90 Zacharioudakis, I., Gligoris, T. & Tzamarias, D. A yeast catabolic enzyme controls

transcriptional memory. Curr Biol 17, 2041-2046, doi:10.1016/j.cub.2007.10.044 (2007).

91 Halley, J. E., Kaplan, T., Wang, A. Y., Kobor, M. S. & Rine, J. Roles for H2A.Z and its

acetylation in GAL1 transcription and gene induction, but not GAL1-transcriptional

memory. PLoS Biol 8, e1000401, doi:10.1371/journal.pbio.1000401 (2010).

92 Meneghini, M. D., Wu, M. & Madhani, H. D. Conserved histone variant H2A.Z protects

euchromatin from the ectopic spread of silent heterochromatin. Cell 112, 725-736 (2003).

93 Zhang, H., Roberts, D. N. & Cairns, B. R. Genome-wide dynamics of Htz1, a histone

H2A variant that poises repressed/basal promoters for activation through histone loss.

Cell 123, 219-231, doi:10.1016/j.cell.2005.08.036 (2005).

94 Wan, Y. et al. Role of the histone variant H2A.Z/Htz1p in TBP recruitment, chromatin

dynamics, and regulated expression of oleate-responsive genes. Mol Cell Biol 29, 2346-

2358, doi:10.1128/MCB.01233-08 (2009).

119 95 Albert, I. et al. Translational and rotational settings of H2A.Z nucleosomes across the

Saccharomyces cerevisiae genome. Nature 446, 572-576, doi:10.1038/nature05632

(2007).

96 Brickner, D. G., Coukos, R. & Brickner, J. H. INO1 transcriptional memory leads to

DNA zip code-dependent interchromosomal clustering. Microb Cell 2, 481-490,

doi:10.15698/mic2015.12.242 (2015).

97 Robertson, L. S. & Fink, G. R. The three yeast A kinases have specific signaling

functions in pseudohyphal growth. Proc Natl Acad Sci U S A 95, 13783-13787 (1998).

98 Schneider, J. et al. Molecular regulation of histone H3 trimethylation by COMPASS and

the regulation of gene expression. Mol Cell 19, 849-856,

doi:10.1016/j.molcel.2005.07.024 (2005).

99 Takahashi, Y. H. et al. Regulation of H3K4 trimethylation via Cps40 (Spp1) of

COMPASS is monoubiquitination independent: implication for a Phe/Tyr switch by the

catalytic domain of Set1. Mol Cell Biol 29, 3478-3486, doi:10.1128/MCB.00013-09

(2009).

100 Kim, T. & Buratowski, S. Dimethylation of H3K4 by Set1 recruits the Set3 histone

deacetylase complex to 5' transcribed regions. Cell 137, 259-272,

doi:10.1016/j.cell.2009.02.045 (2009).

101 Song, W. & Carlson, M. Srb/mediator proteins interact functionally and physically with

transcriptional repressor Sfl1. EMBO J 17, 5757-5765, doi:10.1093/emboj/17.19.5757

(1998).

120 102 Guan, Q., Haroon, S., Bravo, D. G., Will, J. L. & Gasch, A. P. Cellular memory of

acquired stress resistance in Saccharomyces cerevisiae. Genetics 192, 495-505,

doi:10.1534/genetics.112.143016 (2012).

103 Hubner, M. R., Eckersley-Maslin, M. A. & Spector, D. L. Chromatin organization and

transcriptional regulation. Curr Opin Genet Dev 23, 89-95,

doi:10.1016/j.gde.2012.11.006 (2013).

104 Guelen, L. et al. Domain organization of human chromosomes revealed by mapping of

nuclear lamina interactions. Nature 453, 948-951, doi:10.1038/nature06947 (2008).

105 Egecioglu, D. & Brickner, J. H. Gene positioning and expression. Curr Opin Cell Biol

23, 338-345, doi:10.1016/j.ceb.2011.01.001 (2011).

106 Lee, H. et al. PIAS1 confers DNA-binding specificity on the Msx1 homeoprotein. Genes

Dev 20, 784-794, doi:10.1101/gad.1392006 (2006).

107 Ragoczy, T., Bender, M. A., Telling, A., Byron, R. & Groudine, M. The locus control

region is required for association of the murine beta-globin locus with engaged

transcription factories during erythroid maturation. Genes Dev 20, 1447-1457,

doi:10.1101/gad.1419506 (2006).

108 Brown, J. M. et al. Coregulated human globin genes are frequently in spatial proximity

when active. J Cell Biol 172, 177-187, doi:10.1083/jcb.200507073 (2006).

109 Schoenfelder, S. et al. Preferential associations between co-regulated genes reveal a

transcriptional interactome in erythroid cells. Nat Genet 42, 53-61, doi:10.1038/ng.496

(2010).

110 Tolhuis, B. et al. Interactions among Polycomb domains are guided by chromosome

architecture. PLoS Genet 7, e1001343, doi:10.1371/journal.pgen.1001343 (2011).

121 111 Bantignies, F. et al. Polycomb-dependent regulatory contacts between distant Hox loci in

Drosophila. Cell 144, 214-226, doi:10.1016/j.cell.2010.12.026 (2011).

112 Thompson, M., Haeusler, R. A., Good, P. D. & Engelke, D. R. Nucleolar clustering of

dispersed tRNA genes. Science 302, 1399-1401, doi:10.1126/science.1089814 (2003).

113 Aparicio, O. M., Billington, B. L. & Gottschling, D. E. Modifiers of position effect are

shared between telomeric and silent mating-type loci in S. cerevisiae. Cell 66, 1279-1287

(1991).

114 Ahmed, S. & Brickner, J. H. Regulation and epigenetic control of transcription at the

nuclear periphery. Trends Genet 23, 396-402, doi:10.1016/j.tig.2007.05.009 (2007).

115 Egecioglu, D. E., D'Urso, A., Brickner, D. G., Light, W. H. & Brickner, J. H. Approaches

to studying subnuclear organization and gene-nuclear pore interactions. Methods Cell

Biol 122, 463-485, doi:10.1016/B978-0-12-417160-2.00021-7 (2014).

116 Shetty, A. & Lopes, J. M. Derepression of INO1 transcription requires cooperation

between the Ino2p-Ino4p heterodimer and Cbf1p and recruitment of the ISW2 chromatin-

remodeling complex. Eukaryot Cell 9, 1845-1855, doi:10.1128/EC.00144-10 (2010).

117 Graves, J. A. & Henry, S. A. Regulation of the yeast INO1 gene. The products of the

INO2, INO4 and OPI1 regulatory genes are not required for repression in response to

inositol. Genetics 154, 1485-1495 (2000).

118 Venters, B. J. et al. A comprehensive genomic binding map of gene and chromatin

regulatory proteins in Saccharomyces. Mol Cell 41, 480-492,

doi:10.1016/j.molcel.2011.01.015 (2011).

122 119 Arndt, K. & Fink, G. R. GCN4 protein, a positive transcription factor in yeast, binds

general control promoters at all 5' TGACTC 3' sequences. Proc Natl Acad Sci U S A 83,

8516-8520 (1986).

120 Xiao, W. & Rank, G. H. The yeast ILV2 gene is under general amino acid control.

Genome 30, 984-986 (1988).

121 Falco, S. C., Dumas, K. S. & Livak, K. J. Nucleotide sequence of the yeast ILV2 gene

which encodes acetolactate synthase. Nucleic Acids Res 13, 4011-4027 (1985).

122 Hinnebusch, A. G. The general control of amino acid biosynthetic genes in the yeast

Saccharomyces cerevisiae. CRC Crit Rev Biochem 21, 277-317 (1986).

123 Hope, I. A. & Struhl, K. GCN4 protein, synthesized in vitro, binds HIS3 regulatory

sequences: implications for general control of amino acid biosynthetic genes in yeast.

Cell 43, 177-188 (1985).

124 Mueller, P. P. & Hinnebusch, A. G. Multiple upstream AUG codons mediate translational

control of GCN4. Cell 45, 201-207 (1986).

125 Pascual-Garcia, P., Jeong, J. & Capelson, M. Nucleoporin Nup98 associates with

Trx/MLL and NSL histone-modifying complexes and regulates Hox gene expression.

Cell Rep 9, 433-442, doi:10.1016/j.celrep.2014.09.002 (2014).

126 Lopes, J. M., Schulze, K. L., Yates, J. W., Hirsch, J. P. & Henry, S. A. The INO1

promoter of Saccharomyces cerevisiae includes an upstream repressor sequence (URS1)

common to a diverse set of yeast genes. J Bacteriol 175, 4235-4238 (1993).

127 Nikoloff, D. M. & Henry, S. A. Functional characterization of the INO2 gene of

Saccharomyces cerevisiae. A positive regulator of phospholipid biosynthesis. J Biol

Chem 269, 7402-7411 (1994).

123 128 Bachhawat, N., Ouyang, Q. & Henry, S. A. Functional characterization of an inositol-

sensitive upstream activation sequence in yeast. A cis-regulatory element responsible for

inositol-choline mediated regulation of phospholipid biosynthesis. J Biol Chem 270,

25087-25095 (1995).

129 Rundlett, S. E., Carmen, A. A., Suka, N., Turner, B. M. & Grunstein, M. Transcriptional

repression by UME6 involves deacetylation of lysine 5 of histone H4 by RPD3. Nature

392, 831-835, doi:10.1038/33952 (1998).

130 Kadosh, D. & Struhl, K. Repression by Ume6 involves recruitment of a complex

containing Sin3 corepressor and Rpd3 histone deacetylase to target promoters. Cell 89,

365-371 (1997).

131 Heyken, W. T., Repenning, A., Kumme, J. & Schuller, H. J. Constitutive expression of

yeast phospholipid biosynthetic genes by variants of Ino2 activator defective for

interaction with Opi1 repressor. Mol Microbiol 56, 696-707, doi:10.1111/j.1365-

2958.2004.04499.x (2005).

132 Wagner, C., Dietz, M., Wittmann, J., Albrecht, A. & Schuller, H. J. The negative

regulator Opi1 of phospholipid biosynthesis in yeast contacts the pleiotropic repressor

Sin3 and the transcriptional activator Ino2. Mol Microbiol 41, 155-166 (2001).

133 Kadosh, D. & Struhl, K. Histone deacetylase activity of Rpd3 is important for

transcriptional repression in vivo. Genes Dev 12, 797-805 (1998).

134 Keogh, M. C. et al. Cotranscriptional set2 methylation of histone H3 lysine 36 recruits a

repressive Rpd3 complex. Cell 123, 593-605, doi:10.1016/j.cell.2005.10.025 (2005).

124 135 Carrozza, M. J. et al. Histone H3 methylation by Set2 directs deacetylation of coding

regions by Rpd3S to suppress spurious intragenic transcription. Cell 123, 581-592,

doi:10.1016/j.cell.2005.10.023 (2005).

136 Roberts, C. J. et al. Signaling and circuitry of multiple MAPK pathways revealed by a

matrix of global gene expression profiles. Science 287, 873-880 (2000).

137 Zheng, W., Zhao, H., Mancera, E., Steinmetz, L. M. & Snyder, M. Genetic analysis of

variation in transcription factor binding in yeast. Nature 464, 1187-1191,

doi:10.1038/nature08934 (2010).

138 Olson, K. A. et al. Two regulators of Ste12p inhibit pheromone-responsive transcription

by separate mechanisms. Mol Cell Biol 20, 4199-4209 (2000).

139 Hinnebusch, A. G. Translational regulation of GCN4 and the general amino acid control

of yeast. Annu Rev Microbiol 59, 407-450, doi:10.1146/annurev.micro.59.031805.133833

(2005).

140 Cigan, A. M., Bushman, J. L., Boal, T. R. & Hinnebusch, A. G. A protein complex of

translational regulators of GCN4 mRNA is the guanine nucleotide-exchange factor for

translation initiation factor 2 in yeast. Proc Natl Acad Sci U S A 90, 5350-5354 (1993).

141 Gruhler, A. et al. Quantitative phosphoproteomics applied to the yeast pheromone

signaling pathway. Mol Cell Proteomics 4, 310-327, doi:10.1074/mcp.M400219-

MCP200 (2005).

142 Tedford, K., Kim, S., Sa, D., Stevens, K. & Tyers, M. Regulation of the mating

pheromone and invasive growth responses in yeast by two MAP kinase substrates. Curr

Biol 7, 228-238 (1997).

125 143 Bhaumik, S. R. Distinct regulatory mechanisms of eukaryotic transcriptional activation

by SAGA and TFIID. Biochim Biophys Acta 1809, 97-108,

doi:10.1016/j.bbagrm.2010.08.009 (2011).

144 Ansari, S. A. et al. Distinct role of Mediator tail module in regulation of SAGA-

dependent, TATA-containing genes in yeast. EMBO J 31, 44-57,

doi:10.1038/emboj.2011.362 (2012).

145 Koh, S. S., Ansari, A. Z., Ptashne, M. & Young, R. A. An activator target in the RNA

polymerase II holoenzyme. Mol Cell 1, 895-904 (1998).

146 Strambio-De-Castillia, C., Niepel, M. & Rout, M. P. The nuclear pore complex: bridging

nuclear transport and gene regulation. Nat Rev Mol Cell Biol 11, 490-501,

doi:10.1038/nrm2928 (2010).

147 Roberts, S. M. & Winston, F. Essential functional interactions of SAGA, a

Saccharomyces cerevisiae complex of Spt, Ada, and Gcn5 proteins, with the Snf/Swi and

Srb/mediator complexes. Genetics 147, 451-465 (1997).

148 Kornberg, R. D. Mediator and the mechanism of transcriptional activation. Trends

Biochem Sci 30, 235-239, doi:10.1016/j.tibs.2005.03.011 (2005).

149 Burgess, S. M., Ajimura, M. & Kleckner, N. GCN5-dependent histone H3 acetylation

and RPD3-dependent histone H4 deacetylation have distinct, opposing effects on IME2

transcription, during meiosis and during vegetative growth, in budding yeast. Proc Natl

Acad Sci U S A 96, 6835-6840 (1999).

150 Chen, J., Zheng, X. F., Brown, E. J. & Schreiber, S. L. Identification of an 11-kDa

FKBP12-rapamycin-binding domain within the 289-kDa FKBP12-rapamycin-associated

126 protein and characterization of a critical serine residue. Proc Natl Acad Sci U S A 92,

4947-4951 (1995).

151 Geisberg, J. V., Moqtaderi, Z., Fan, X., Ozsolak, F. & Struhl, K. Global analysis of

mRNA isoform half-lives reveals stabilizing and destabilizing elements in yeast. Cell

156, 812-824, doi:10.1016/j.cell.2013.12.026 (2014).

152 Haruki, H., Nishikawa, J. & Laemmli, U. K. The anchor-away technique: rapid,

conditional establishment of yeast mutant phenotypes. Mol Cell 31, 925-932,

doi:10.1016/j.molcel.2008.07.020 (2008).

153 Sievers, F. et al. Fast, scalable generation of high-quality protein multiple sequence

alignments using Clustal Omega. Mol Syst Biol 7, 539, doi:10.1038/msb.2011.75 (2011).

154 Chatr-Aryamontri, A. et al. The BioGRID interaction database: 2017 update. Nucleic

Acids Res 45, D369-D379, doi:10.1093/nar/gkw1102 (2017).

155 Roux, K. J., Kim, D. I., Raida, M. & Burke, B. A promiscuous biotin ligase fusion

protein identifies proximal and interacting proteins in mammalian cells. J Cell Biol 196,

801-810, doi:10.1083/jcb.201112098 (2012).

156 Liang, Y., Franks, T. M., Marchetto, M. C., Gage, F. H. & Hetzer, M. W. Dynamic

association of NUP98 with the human genome. PLoS Genet 9, e1003308,

doi:10.1371/journal.pgen.1003308 (2013).

157 Maniatis, T., Fritsch, E. F. & Sambrook, J. Molecular cloning : a laboratory manual.

(Cold Spring Harbor Laboratory, 1982).

158 Goodman, H. M., Olson, M. V. & Hall, B. D. Nucleotide sequence of a mutant

eukaryotic gene: the yeast tyrosine-inserting ochre suppressor SUP4-o. Proc Natl Acad

Sci U S A 74, 5453-5457 (1977).

127 159 Meinema, A. C. et al. Long unfolded linkers facilitate membrane protein import through

the nuclear pore complex. Science 333, 90-93, doi:10.1126/science.1205741 (2011).

160 Sikorski, R. S. & Hieter, P. A system of shuttle vectors and yeast host strains designed

for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19-27

(1989).

161 Mumberg, D., Muller, R. & Funk, M. Yeast vectors for the controlled expression of

heterologous proteins in different genetic backgrounds. Gene 156, 119-122 (1995).

162 Chee, M. K. & Haase, S. B. New and Redesigned pRS Plasmid Shuttle Vectors for

Genetic Manipulation of Saccharomycescerevisiae. G3 (Bethesda) 2, 515-526,

doi:10.1534/g3.111.001917 (2012).

163 Chou, C. C., Patel, M. T. & Gartenberg, M. R. A series of conditional shuttle vectors for

targeted genomic integration in budding yeast. FEMS Yeast Res 15,

doi:10.1093/femsyr/fov010 (2015).

128 Appendix 1. Yeast strains used in the dissertation

Strain Genotype Figure

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP NDY007 2.1, 2.6. URA3:p6LacO128GRSI

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP 2.2, 2.7, 3.2, NDY003 INO1:URA3p6LacO128 5.11

TRP:Sec63-myc LEU2:LacI-GFP INO1:p6LacO128 LWY018 2.2 cbf1::HIS3

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY305 2.2, 2.7 INO1:p6LacO128 cbf1::hphnMX put3::KanMX

ICY184 TRP:Sec63-myc LEU2:LacI-GFP URA3:p6LacO128 2.3

SEC63:13myc-KanMX6 HIS3:LacI-GFP SAY061 2.3 URA3:p6LacO128GRSI

TRP:Sec63-myc LEU2:LacI-GFP LMY056 2.3 URA3:p6LacO128ΔAmp::Dig2-KanMX6

TRP:Sec63-myc LEU2:LacI-GFP LMY059 2.3 URA3:p6LacO128ΔAmp::Msn2.6, 6.3S-KanMX6

TRP:Sec63-myc LEU2:LacI-GFP LMY087 2.3 URA3:p6LacO128ΔAmp::Ino2-KanMX6

TRP:Sec63-myc LEU2:LacI-GFP LMY077 2.3 URA3:p6LacO128ΔAmp::Fkh1-KanMX6

129 TRP:Sec63-myc LEU2:LacI-GFP LMY081 2.3 URA3:p6LacO128ΔAmp::Ume6-KanMX6

TRP:Sec63-myc LEU2:LacI-GFP LMY080 2.3 URA3:p6LacO128ΔAmp::Gcr1-KanMX6

TRP:Sec63-myc LEU2:LacI-GFP LMY078 2.3 URA3:p6LacO128ΔAmp::Gcn4-KanMX6

TRP:Sec63-myc LEU2:LacI-GFP LMY056 2.3 URA3:p6LacO128ΔAmp::Rap1-KanMX6

CEY080 TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP ILV2:p6LacO128 2.5

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP CEY081 2.5 HIS3:URA3p6LacO128

TRP:Sec63-13myc HIS3:pGPDmCherry-ER04 HIS3:LacI- CEY295 2.6 GFP URA3:p6LacO128GRSI put3::KanMX6

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY282 2.6, 6.3 URA3:p6LacO128GRSIILexA

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP CEY280 2.6 URA3:p6LacO128GRSIILexA cbf1::HIS3

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP SZY12 2.6, 6.3 URA3:p6LacO128ΔAmp::3XPRE-KanMX6

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY296 2.6 URA3:p6LacO128ΔAmp::3XPRE-KanMX6 ste12::HphNTI

130 TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP CEY147 2.6, 6.3, 5.7 URA3:p6LacO128Gcn4BS

TRP:Sec63-13myc LEU2:LacI-GFP CEY064 2.6 URA3:p6LacO128ΔAmp::Gcn4BS-KanMX6 gcn4::HphNTI

CEY278 TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP URA3:p6LacO 2.6, 6.3, 5.7

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP SZY001 2.7, 5.2, 5.11 PRM1:URA3p6LacO128

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP CEY076 2.7, 5.8, 5.11 HIS4:URA3p6LacO128

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY156 2.7 PRM1:URA3p6LacO128 ste12::KanMX6

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP CEY077 2.7 HIS4:URA3p6LacO128 gcn4::KanMX6

TRP:Sec63-13myc HIS3:LacI-GFP INO1Δ4(-166- SAY023 3.2, 3.5 266):URA3LacO128

HIS3:pGPDmCherry-ER03 LEU2:LacI-GFP INO1- CEY117 3.2 ΔURS:p6LacO128

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP INO1- DBY765 3.2 ΔUAS:p6LacO128 ume6::KanMX6

SAY054 HIS3:LacI-GFP ino2::KanMX66 INO1:URA3p6LacO128 3.2

131 HIS3:LacI-GFP Sec63:13mycKanMX6 ino2::LEU2 JBY401 3.2 INO1:URA3p6LacO128

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY067 3.2 INO1:p6LacO128 ume6::KanMX6

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY075 3.2 INO1:p6LacO128 isw2::KanMX6

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY074 3.2 INO1:URA3p6LacO128 SIN3Δ:KanMX6

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY163 3.2 INO1:URA3p6LacO128 RPD3-H188A

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY094 3.2 INO1:URA3p6LacO128 PHO23Δ:KanMX6

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY092 3.2 INO1:URA3p6LacO128 SAP30Δ:KanMX6

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY093 3.2 INO1:URA3p6LacO128 RCO1Δ:KanMX6

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY318 3.2 INO1GRSIΔGRSIIΔ:URA3p6LacO128 rpd3::KanMX6

opi1::LEU2 HIS3:LacI-GFP TRP1:pGPDmCherry-ER04 DBY500 3.2,3.3 INO1:URA3p6LacO128

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY068 3.2 INO1:URA3p6LacO128 ume6::KanMX6

132 TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY119 3.3 INO1GRSIΔ:URA3p6LacO128 opi1::KanMX6

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY120 3.3 INO1GRSIIΔ:URA3p6LacO128 opi1::KanMX6

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY121 3.3 INO1GRSIΔGRSIIΔ:URA3p6LacO128 opi1::KanMX6

ade2-1 can1-100 his3-11,15 LEU2-3,112 trp1-1 ura3-1 3.4, 3.5, 6.3, CRY1 (Background strain) 3.5, 6.3

CEY168 rpd3::KanMX6 3.4

CEY022 PUT3Δ:KanMX6 [pADH-GST-PUT3] 3.4

CEY297 rpd3::KanMX6 [pADH-GST-PUT3] 3.4

SAY19 INO1Δ4(-166-266) 3.5

CEY116 HIS3:pGPDmCherry-ER03 LEU2:LacI-GFP INO1-ΔURS 3.5

SAY028 INO1ΔUAS(-172-178)ΔUAS(-237-243) 3.5

CEY096 opi1::LEU2 3.5

CEY0168 ume6::KanMX6 3.5

CEY0167 RPD3-H188A 3.5

CEY097 ume6::KanMX6 3.5

JBY366 ino2:HIS5 3.5

JBY395 ino4::LEU2 TRP:Sec63-13myc 3.5

133 MATα/MATa TRP1:pGPDmCherry-ER04 3.7,3.7,3.8, DBY598 TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP Leu3:LacI-GFP 3.9, 5.11 INO1:URA3p6LacO128 INO1:URA3p6LacO128

MATα/MATa HIS3:pGPDmCherry-ER03 LEU2:LacI-GFP CEY159 3.7,3.9, 5.11 INO1-ΔURS:p6LacO128 INO1-ΔURS:p6LacO128

MATα/MATa ADE2:pRS2402 TRP1:pGPDmCherry-ER04

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP LEU2:LacI- CEY295 3.8,3.9 GFP INO1:URA3p6LacO128 INO1:URA3p6LacO128 RPD3-

H188A RPD3-H188A

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP

INO1GRSIΔGRSIIΔ:URA3p6LacO128 rpd3::KanMX6 CEY301 3.8,3.9 LEU2:LacI-GFP RPD3-H188A rpd3::KanMX6

INO1:URA3p6LacO128

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY242 4.1 LexABS:URA3p6LacO128 [pADH-LEXA] INO2-L118A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY243 4.1 LexABS:URA3p6LacO128 [pADH-LEXA-Opi1] INO2-L118A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY244 4.1 LexABS:URA3p6LacO128 [pADH-LEXA-Ume6] INO2-L118A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY173 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.2,4.4

LEXA]

134 LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY182 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.2,4.4

LEXA-OPI1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY190 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.2,4.4

LEXA-UME6]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY289 4.2 URA3:p6LacO128GRSIILexA [pADH-LEXA]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY291 4.2 URA3:p6LacO128GRSIILexA [pADH-LEXA-OPI1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY293 4.2 URA3:p6LacO128GRSIILexA [pADH-LEXA-UME6]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY290 4.2 URA3:p6LacO1283XPRELexA [pADH-LEXA]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY292 4.2 URA3:p6LacO1283XPRELexA [pADH-LEXA-OPI1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY294 4.2 URA3:p6LacO1283XPRELexA [pADH-LEXA-UME6]

MATα/MATa ADE2:pRS2402 LEU@:pGPDmCherry-ER04

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP HIS3:LacI-GFP CEY333 4.3 INO1:URA3p6LacO128 URA3:GRSILexA(BS)p6LacO128

[pADH-LEXA]

135 MATα/MATa ADE2:pRS2402 LEU@:pGPDmCherry-ER04

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP HIS3:LacI-GFP CEY334 4.3 INO1:URA3p6LacO128 URA3:GRSILexA(BS)p6LacO128

[pADH-LEXA-OPI1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY244 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY174 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-ADF1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY245 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-ADF1] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY177 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-WHI5]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY248 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-WHI5] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY253 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-OPI1] RPD3-H188A

136 LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY261 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-UME6] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY183 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-GAL80]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY254 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-GAL80] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY184 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-DIG1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY255 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-DIG1] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY188 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-TUP1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY259 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-TUP1] RPD3-H188A

137 LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY175 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-NRM1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY246 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-NRM1] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY192 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-SUM1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY263 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-SUM1] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY176 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-MCM1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY247 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-MCM1] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY178 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-CUP9]

138 LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY249 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-CUP9] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY181 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-YOX1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY252 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-YOX1] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY187 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-XBP1]

Strain Genotype Figure

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY258 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-XBP1] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY191 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-OAF3]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY262 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-OAF3] RPD3-H188A

139 LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY193 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-HOS4]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY264 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-HOS4] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY194 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-RGT1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY265 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-RGT1] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY186 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-RIM101]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY257 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-RIM101] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY185 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-MIG1]

140 LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY256 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-MIG1] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY179 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-DIG2]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY250 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-DIG2] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY180 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-SPT2]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY251 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-SPT2] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY189 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-SFL1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY260 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-SFL1] RPD3-H188A

141 LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY245 4.5 URA3:p6LacO128GRSI [pADH-LEXA-ADF1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY246 4.5 URA3:p6LacO128GRSI [pADH-LEXA-NRM1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY247 4.5 URA3:p6LacO128GRSI [pADH-LEXA-MCM1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY248 4.5 URA3:p6LacO128GRSI [pADH-LEXA-CUP9]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY249 4.5 URA3:p6LacO128GRSI [pADH-LEXA-WHI5]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY250 4.5 URA3:p6LacO128GRSI [pADH-LEXA-DIG2]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY251 4.5 URA3:p6LacO128GRSI [pADH-LEXA-SPT2]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY252 4.5 URA3:p6LacO128GRSI [pADH-LEXA-YOX1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY253 4.5 URA3:p6LacO128GRSI [pADH-LEXA-OPI1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY254 4.5 URA3:p6LacO128GRSI [pADH-LEXA-GAL80]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY255 4.5 URA3:p6LacO128GRSI [pADH-LEXA-DIG1]

142 LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY256 4.5 URA3:p6LacO128GRSI [pADH-LEXA-MIG1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY257 4.5 URA3:p6LacO128GRSI [pADH-LEXA-RIM101]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY258 4.5 URA3:p6LacO128GRSI [pADH-LEXA-XBP1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY259 4.5 URA3:p6LacO128GRSI [pADH-LEXA-TUP1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY260 4.5 URA3:p6LacO128GRSI [pADH-LEXA-SFL1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY261 4.5 URA3:p6LacO128GRSI [pADH-LEXA-UME6]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY262 4.5 URA3:p6LacO128GRSI [pADH-LEXA-OAF3]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY263 4.5 URA3:p6LacO128GRSI [pADH-LEXA-SUM1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY264 4.5 URA3:p6LacO128GRSI [pADH-LEXA-HOS4]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY265 4.5 URA3:p6LacO128GRSI [pADH-LEXA-RGT1]

143 LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY191 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-OAF3]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY262 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-OAF3] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY193 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-HOS4]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY264 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-HOS4] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY194 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-RGT1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY265 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-RGT1] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY186 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-RIM101]

144 LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY257 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-RIM101] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY185 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-MIG1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY256 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-MIG1] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY179 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-DIG2]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY250 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-DIG2] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY180 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-SPT2]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY251 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-SPT2] RPD3-H188A

145 LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY189 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-SFL1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY260 URA3:p6LacO128ΔAmp::GRSI-LexABS-KanMX6 [pADH- 4.4

LEXA-SFL1] RPD3-H188A

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY245 4.5 URA3:p6LacO128GRSI [pADH-LEXA-ADF1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY246 4.5 URA3:p6LacO128GRSI [pADH-LEXA-NRM1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY247 4.5 URA3:p6LacO128GRSI [pADH-LEXA-MCM1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY248 4.5 URA3:p6LacO128GRSI [pADH-LEXA-CUP9]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY249 4.5 URA3:p6LacO128GRSI [pADH-LEXA-WHI5]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY250 4.5 URA3:p6LacO128GRSI [pADH-LEXA-DIG2]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY251 4.5 URA3:p6LacO128GRSI [pADH-LEXA-SPT2]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY252 4.5 URA3:p6LacO128GRSI [pADH-LEXA-YOX1]

146 LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY253 4.5 URA3:p6LacO128GRSI [pADH-LEXA-OPI1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY254 4.5 URA3:p6LacO128GRSI [pADH-LEXA-GAL80]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY255 4.5 URA3:p6LacO128GRSI [pADH-LEXA-DIG1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY256 4.5 URA3:p6LacO128GRSI [pADH-LEXA-MIG1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY257 4.5 URA3:p6LacO128GRSI [pADH-LEXA-RIM101]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY258 4.5 URA3:p6LacO128GRSI [pADH-LEXA-XBP1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY259 4.5 URA3:p6LacO128GRSI [pADH-LEXA-TUP1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY260 4.5 URA3:p6LacO128GRSI [pADH-LEXA-SFL1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY261 4.5 URA3:p6LacO128GRSI [pADH-LEXA-UME6]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY262 4.5 URA3:p6LacO128GRSI [pADH-LEXA-OAF3]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY263 4.5 URA3:p6LacO128GRSI [pADH-LEXA-SUM1]

147 LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY264 4.5 URA3:p6LacO128GRSI [pADH-LEXA-HOS4]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY265 4.5 URA3:p6LacO128GRSI [pADH-LEXA-RGT1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY255 4.5 URA3:p6LacO128GRSI [pADH-LEXA-DIG1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY195 4.6, 4.7 LexABS [pADH-LEXA]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY196 4.6, 4.7 LexABS [pADH-LEXA-ADF1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY197 4.6, 4.7 LexABS [pADH-LEXA-NRM1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY198 4.6, 4.7 LexABS [pADH-LEXA-MCM1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY199 4.6, 4.7 LexABS [pADH-LEXA-CUP9]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY200 4.6, 4.7 LexABS [pADH-LEXA-WHI5]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY201 4.6, 4.7 LexABS [pADH-LEXA-DIG2]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY202 4.6, 4.7 LexABS [pADH-LEXA-SPT2]

148 LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY203 4.6, 4.7 LexABS [pADH-LEXA-YOX1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY204 4.6, 4.7 LexABS [pADH-LEXA-OPI1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY205 4.6, 4.7 LexABS [pADH-LEXA-GAL80]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY206 4.6, 4.7 LexABS [pADH-LEXA-DIG1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY207 4.6, 4.7 LexABS [pADH-LEXA-MIG1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY208 4.6, 4.7 LexABS [pADH-LEXA-RIM101]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY209 4.6, 4.7 LexABS [pADH-LEXA-XBP1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY210 4.6, 4.7 LexABS [pADH-LEXA-TUP1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY211 4.6, 4.7 LexABS [pADH-LEXA-SFL1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY212 4.6, 4.7 LexABS [pADH-LEXA-UME6]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY213 4.6, 4.7 LexABS [pADH-LEXA-OAF3]

149 LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY214 4.6, 4.7 LexABS [pADH-LEXA-SUM1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY215 4.6, 4.7 LexABS [pADH-LEXA-HOS4]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP ino2 INO1- CEY216 4.6, 4.7 LexABS [pADH-LEXA-RGT1]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP CEY272 4.9 URA3:p6LacO128ΔAmp::LexABS-KanMX6

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY273 URA3:p6LacO128ΔAmp::LexABS-KanMX6 [pADH-LEXA- 4.9

Ste12]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY274 URA3:p6LacO128ΔAmp::LexABS-KanMX6 [pADH-LEXA- 4.9

Rim101]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY275 URA3:p6LacO128ΔAmp::LexABS-KanMX6 [pADH-LEXA- 4.9

SPT2]

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY276 URA3:p6LacO128ΔAmp::LexABS-KanMX6 [pADH-LEXA- 4.9

MIG1]

150 LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY277 URA3:p6LacO128ΔAmp::LexABS-KanMX6 [pADH-LEXA- 4.9

SFL1]

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP MSY002 5.2 PRM1:URA3p6LacO128 rpd3::KanMX6

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY131 5.2 PRM1:URA3p6LacO128 dig1::hphNTI

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY123 5.2 PRM1:URA3p6LacO128 dig2::natNT2

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY157 5.2 PRM1:URA3p6LacO128 dig2::natNT2 STE12::KanMX6

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY152 5.2 PRM1:URA3p6LacO128 DIG2:S34A

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP CEY153 5.2 PRM1:URA3p6LacO128 DIG2-S33.8

LEU2:pGPDmCherry-ER05, HIS3:LacI-GFP CEY272 5.3 URA3:p6LacO128delAMP::LexABS-KanMX [pADH-LexA]

LEU2:pGPDmCherry-ER05, HIS3:LacI-GFP

CEY322 URA3:p6LacO128delAMP::LexABS-KanMX [pADH-LexA] 5.3

dig2::NatNT2

151 LEU2:pGPDmCherry-ER05, HIS3:LacI-GFP

CEY273 URA3:p6LacO128delAMP::LexABS-KanMX [pADH-LexA- 5.3

Ste12]

LEU2:pGPDmCherry-ER05, HIS3:LacI-GFP

CEY321 URA3:p6LacO128delAMP::LexABS-KanMX [pADH-LexA- 5.3

Ste12] dig2::NatNT2

MATα/MATa TRP1:pGPDmCherry-ER04

CEY169 TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP LEU2:LacI-GFP 5.4, 5.11

PRM1:URA3p6LacO128 URA3:prm1promoterp6LacO128

MATα/MATa TRP1:pGPDmCherry-ER04

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP LEU2:LacI-GFP CEY269 5.4, 5.11 PRM1:URA3p6LacO128 URA3:prm1promoterp6LacO128

dig2::KanMX6

MATα/MATa TRP1:pGPDmCherry-ER04

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP LEU2:LacI-GFP CEY160 5.4, 5.11 PRM1:URA3p6LacO128 URA3:prm1promoterp6LacO128

dig2::KanMX6

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP MSY001 5.7 HIS4:URA3p6LacO128 rpd3::KanMX6

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP VSY078 5.7 HIS4:URA3p6LacO128 HIS4-uORF

152 TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP CEY148 5.7 URA3:p6LacO128Gcn4BS HIS4-uORF

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP 5.8, 6.12, 6.13, CEY355 URA3:p6LacO128ΔAmp::LexABS-KanMX6 ADE2:pGAL1- 6.15 LexA

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP 5.8, 6.12, 6.13, CEY366 URA3:p6LacO128ΔAmp::LexABS-KanMX6 ADE2:pGAL1- 6.15 GCN4-LexA

MATα/MATa TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP CEY135 5.9 HIS4:URA3p6LacO128 HIS4:p6LacO128

MATα/MATa TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP

CEY271 HIS4:URA3p6LacO128 HIS4:p6LacO128 GCN4uORFΔ() 5.9

GCN4uORFΔ()

MATα/MATa TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP

CEY270 HIS4:URA3p6LacO128 HIS4:p6LacO128 gcn4::KanMX6 5.9

gcn4::KanMX6

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP MSY017 6.2 INO1:p6LacO128 spt20::HIS3

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP MSY019 6.2 PRM1:p6LacO128 spt20::HIS3

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP MSY018 6.2 HIS4:p6LacO128 spt20::HIS3

153 TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP MSY014 6.2 INO1:p6LacO128 med31::KANMX

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP MSY015 6.2 PRM1:p6LacO128 med31::KANMX

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP MSY016 6.2 HIS4:p6LacO128 med31::KANMX

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP MSY009 6.3 URA3:GRSIp6LacO128 spt20::HIS3

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP MSY010 6.3 URA3:GRSIIp6LacO128 spt20::HIS3

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP URA3:3XPRE- MSY011 6.3 LexA(BS)p6LacO128 spt20::HIS3

TRP1:pGPDmCherry-ER04 HIS3:LacI-GFP MSY012 6.3 URA3:Gcn4(BS)p6LacO128 spt20::HIS3

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP CEY354 6.4 HIS4:URA3p6LacO128 [pADH]

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP CEY355 6.4 HIS4:URA3p6LacO128 [pADH] gcn4::KanMX

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP CEY356 6.4 HIS4:URA3p6LacO128 [pADH] gcn5::KanMX

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP CEY357 6.4 HIS4:URA3p6LacO128 [pADH] nup2::KanMX

154 TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP CEY358 6.4 HIS4:URA3p6LacO128 [pADH] med31::KanMX

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP CEY359 6.4 HIS4:URA3p6LacO128 [pADH-GCN4]

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP CEY360 6.4 HIS4:URA3p6LacO128 [pADH-GCN4] gcn4::KanMX

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP CEY361 6.4 HIS4:URA3p6LacO128 [pADH-GCN4] gcn5::KanMX

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP CEY362 6.4 HIS4:URA3p6LacO128 [pADH-GCN4] nup2::KanMX

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP CEY363 6.4 HIS4:URA3p6LacO128 [pADH-GCN4] med31::KanMX

MEX67-GFP-FRB:HIS5+ fpr1∆::NAT RPL13A- CEY344 6.6, 6.7 2xFKBP12::TRP1

SAC3-GFP-FRB:HIS5+ fpr1∆::NAT RPL13A- CEY345 6.6, 6.7 2xFKBP12::TRP1

NUP2-GFP-FRB:HIS5+ fpr1∆::NAT RPL13A- CEY346 6.6, 6.7 2xFKBP12::TRP1

THP1-GFP-FRB:HIS5+ fpr1∆::NAT RPL13A- CEY347 6.6, 6.7 2xFKBP12::TRP1

GCN5-GFP-FRB:HIS5+ fpr1∆::NAT RPL13A- CEY360 6.6, 6.7 2xFKBP12::TRP1

155 MED31-GFP-FRB:HIS5+ fpr1∆::NAT RPL13A- CEY354 6.6, 6.7 2xFKBP12::TRP1

SPT20-GFP-FRB:HIS5+ fpr1∆::NAT RPL13A- CEY353 6.6, 6.7 2xFKBP12::TRP1

MED1-GFP-FRB:HIS5+ fpr1∆::NAT RPL13A- ADY22 6.6, 6.7 2xFKBP12::TRP1

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP

CEY335 HIS4:URA3p6LacO128 fpr1∆::NAT RPL13A- 6.8, 6.9, 6.10

2xFKBP12::TRP1

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP

CEY336 HIS4:URA3p6LacO128 GCN4-FRB:KANMX fpr1∆::NAT 6.8, 6.9

RPL13A-2xFKBP12::TRP1

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP

CEY337 HIS4:URA3p6LacO128 GCN5-FRB:KANMX fpr1∆::NAT 6.9, 6.10

RPL13A-2xFKBP12::TRP1

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP

CEY338 HIS4:URA3p6LacO128 THP1-FRB:KANMX fpr1∆::NAT 6.9, 6.10

RPL13A-2xFKBP12::TRP1

Strain Genotype Figure

156 TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP

CEY339 HIS4:URA3p6LacO128 MED1-FRB:KANMX fpr1∆::NAT 6.9, 6.10

RPL13A-2xFKBP12::TRP1

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP

CEY340 HIS4:URA3p6LacO128 SPT20-FRB:KANMX fpr1∆::NAT 6.9, 6.10

RPL13A-2xFKBP12::TRP1

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP

CEY341 HIS4:URA3p6LacO128 SAC3-FRB:KANMX fpr1∆::NAT 6.9, 6.10

RPL13A-2xFKBP12::TRP1

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP

CEY342 HIS4:URA3p6LacO128 NUP2-FRB:KANMX fpr1∆::NAT 6.8, 6.9

RPL13A-2xFKBP12::TRP1

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP

CEY343 HIS4:URA3p6LacO128 MEX67-FRB:KANMX fpr1∆::NAT 6.9, 6.10

RPL13A-2xFKBP12::TRP1

TRP1:pGPDmCherry-ER04 LEU2:LacI-GFP

CEY352 HIS4:URA3p6LacO128 MED31-FRB:KANMX fpr1∆::NAT 6.9, 6.10

RPL13A-2xFKBP12::TRP1

MATα/MATa MEX67-GFP-FRB:HIS5+ fpr1∆::NAT CEY384 6.11 RPL13A-2xFKBP12::TRP1 URA3:p6LacO128LexABS

MATα/MATa SAC3-GFP-FRB:HIS5+ fpr1∆::NAT RPL13A- CEY385 6.11 2xFKBP12::TRP1 URA3:p6LacO128LexABS

157 MATα/MATa NUP2-GFP-FRB:HIS5+ fpr1∆::NAT RPL13A- CEY386 6.11 2xFKBP12::TRP1 URA3:p6LacO128LexABS

MATα/MATa GCN5-GFP-FRB:HIS5+ fpr1∆::NAT RPL13A- CEY387 6.11 2xFKBP12::TRP1 URA3:p6LacO128LexABS

MATα/MATa MED31-GFP-FRB:HIS5+ fpr1∆::NAT CEY388 6.11 RPL13A-2xFKBP12::TRP1 URA3:p6LacO128LexABS

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY356 URA3:p6LacO128ΔAmp::LexABS-KanMX6 ADE2:pGAL1- 6.12

GCN4Δ(77aa - 140aa)-LexA

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY357 URA3:p6LacO128ΔAmp::LexABS-KanMX6 ADE2:pGAL1- 6.12

GCN4(77aa - 220aa)-LexA

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY358 URA3:p6LacO128ΔAmp::LexABS-KanMX6 ADE2:pGAL1- 6.12

GCN4(77aa - 140aa)-LexA

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY367 URA3:p6LacO128ΔAmp::LexABS-KanMX6 ADE2:pGAL1- 6.13

GCN4(141aa - 167aa)-LexA

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY368 URA3:p6LacO128ΔAmp::LexABS-KanMX6 ADE2:pGAL1- 6.13

GCN4(157aa - 183aa)-LexA

158 LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY369 URA3:p6LacO128ΔAmp::LexABS-KanMX6 ADE2:pGAL1- 6.13

GCN4(173aa - 199aa)-LexA

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY370 URA3:p6LacO128ΔAmp::LexABS-KanMX6 ADE2:pGAL1- 6.13

GCN4(189aa - 215aa)-LexA

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY371 URA3:p6LacO128ΔAmp::LexABS-KanMX6 ADE2:pGAL1- 6.13, 6.15

GCN4(205aa - 231aa)-LexA

LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

CEY372 URA3:p6LacO128ΔAmp::LexABS-KanMX6 ADE2:pGAL1- 6.13

GCN4(213aa - 239aa)-LexA

MATα/MATa LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

URA3:p6LacO128ΔAmp::LexABS-KanMX6 CEY389 6.16 URA3:p6LacO128ΔAmp::LexABS-KanMX6 ADE2:pGAL1-

LexA

Strain Genotype Figure

MATα/MATa LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

URA3:p6LacO128ΔAmp::LexABS-KanMX6 CEY390 6.16 URA3:p6LacO128ΔAmp::LexABS-KanMX6 ADE2:pGAL1-

GCN4-LexA

159 MATα/MATa LEU2:pGPDmCherry-ER05 HIS3:LacI-GFP

URA3:p6LacO128ΔAmp::LexABS-KanMX6 CEY391 6.16 URA3:p6LacO128ΔAmp::LexABS-KanMX6 ADE2:pGAL1-

GCN4(204.1a - 232.6, 6.3.2)-LexA