Epimutations in Developmental Genes Underlie the Onset of Domestication in Farmed European Sea Bass

SUPPLEMENTARY MATERIAL ONLINE

Epimutations in developmental genes underlie the onset of domestication in farmed European sea bass

Dafni Anastasiadi, Francesc Piferrer*

Institute of Marine Sciences, Spanish National Research Council (CSIC)

Passeig Marítim , 37 -49, 08003, Barcelona, Spain

1 Supplementary Figures

Supplementary figure 1. Examples of the domestication syndrome in fish. a) Overall morpholo gical differences between wild (W) and farmed (F) European sea bass (Dicentrarchus labrax ) in Greece (GR) and Spain (SP) as assessed by principal component analysis. Figure redrawn from Arechavala -López et al. (2012) . b) Lower jaw deformity in farmed Europ ean sea bass. Top fish: normal jaw; bottom fish: prognathism . Photo by Dr. Dafni Anastasiadi. c) Skin depigmentation in turbot ( Scophthalmus maximus ). Photo courtesy of Dr. Josep Rotllant. d) Number of differentially expressed genes in the brain, liver and muscle of domesticated vs. wild rainbow trout ( Oncorhynchus mykiss ) reared under the same environment. Figure redrawn from Tymchuk et al. (2009) . e) Gonadosomatic index of wild and captive -reared greater amberjack ( Seriola dumerili ) individuals at the sta ges of advanced gametogenesis. Figure redrawn from Zupa et al. (2017) . f) Number of aggression acts per 10 minutes of wild and farmed Atlantic salmon ( Salmo salar ) individuals. Figure redrawn from (Huntingford 2004) , in turn based on Fleming et al. (1996) . Supplementary figure 2. Genes under positive selection in the European sea bass after 25 years of selective breeding and in mammalian and avian domesticates. The genes with signatures of selection in the sea bass were identified in a previous, unrelated study (Bertolini et al. 2016) . They represent the consensus of genes under selection in two independent sea bass hatcheries towards the same direction. The gene s localized in the virtual chromosome “UN”, which contains 96,939,502 bp out of the total 675,917,103 bp of the sea bass genome (Tine et al. 2014 ) were excluded from the analysis. The presence of similar genes in other species was based on previous published studies in dog (Pendleton et al. 2018) , cat (Montague et al. 2014) , horse (Schubert et al. 2014) , rabbit (Carneiro et al. 2014) , fox (Kukekova et al. 2018) and duck (Zhang et al. 2018) . The top 10 genes are shown as ranked according to the number of species (shown in the last column) in which they are under positive selection. Genes related to the neural crest were identified based on two published studies (Martinez -Morales et al. 2007; Dooley et al. 2019) and are shaded in grey. The numbers under the species symbol represent the total number of annotated genes under positive selection. Supplementary figure 3. Experimental design, showing wild and early domesticate sea bass used in this study, sampling and analysis. Supplementary figure 4. Robustness of the DNA methylation data obtained by RRBS in a total of 24 samples from four tissues o f adult European sea bass. Pairwise comparisons of values (0 to 1 in the X and Y axes) in a) brain, b) muscle, c) testis and d) liver between wild (w) and early domesticate (f) fish. DNA methylation is shown as pairwise scatterplots in the lower left part of each figure and as histograms for each sample on the diagonal. In the upper right part of each figure, pairwise Pearson’s correlation scores are indicated. The mean Pearson’s correlation scores for brain, muscle, testis and liver were 0.93, 0.89, 0.96 a nd 0.94, respectively. Each sample represents an independent replicate. Supplementary figure 5. Distribution of differentially methylated regions (DMRs) in genes and genomic features. a) Numbers of DMRs inside first exons (orange), first introns (light blue), rest of exons (purple), rest of introns (mustard), 5 kb upstream the transcription start site (dark blue), 5 kb downstream the transcription termination site (dark purple) and in intergenic regions (red). b) Numbers of DMRs inside CpG islands (must ard), CpG shores ± 2 kb around the islands (blue) and outside CpG islands and shores (red). c) Percentage of genes with hypo - (green) and hyper -methylated (red) DMRs inside the gene bodies or ± 5000 bp flanking regions. n=3 independent replicates per group and per tissue. Supplementary figure 6. Validation of DNA methylation results (DNA me) obtained by reduced representation bisulfite sequencing (RRBS) with multiplex bisulfite sequencing (MBS). Each datapoint corresponds to an individual CpG pertaini ng to one of the following genes: gria4a and phld in brain, mapk8a and adamsts9 in muscle, foxc1 in testis, and pcdh γ - a11 -like in liver. Pearson’s correlation (rho) and significance ( p) values are indicated. Percentage data are shown as means of n = 6 (RR BS) and n = 16 (MBS) values per datapoint. Supplementary figure 7. Evaluation of the quality of the RNA -seq data for the 42 samples analysed in this study. Relationships of gene expression counts in replicate samples from liver (L; n = 10), brain (BR, n= 10), muscle (M; n = 10) and testis (T; n= 12) from adult wild (W) and early domesticate farmed (F) European sea bass. Pairwise dissimilarities between samples were calculated using the Poisson distance metric from the CRAN package PoiClaClu on raw coun ts and lower values indicate higher resemblance between samples. Samples BR.W2 and M.W5 were considered outliers and were discarded. n=5 independent replicates in all cases, except for farmed fish testis where n=7. The Poisson distance takes into account t he variance structure of counts when calculating distances. This is specifically designed for representing RNA -seq data as reported by Witten (2011) . Supplementary figure 8. Overview of gene expression differences in tissues of adult early domesticate vs. wild European sea bass. Volcano plots for genes expressed in a) brain, b) muscle, c) testis and d) liver, with the shrunk log 2 fold change shown on the X -axis and the - log 10 -transformed p-value on the Y -axis. Genes with p-adjusted <0.05 (red), log 2 Fol d Change > 1 or < -1 (orange) and those fulfilling both conditions (green) are shown. Independent replicates were as follows: n=5, wild liver; n=5, farmed liver; n=4, wild brain; n=5, farmed brain; n=4, wild muscle; n=5, farmed muscle; n=5, wild testis; n= 7, farmed testis. Supplementary figure 9. Validation of gene expression results obtained by RNA -seq with qPCR. Each datapoint corresponds to an individual fish and one of the following genes: adamts9 , mapk8a , ppargc1a and hspb11 in the muscle. Pearson’ s correlation (rho) and significance ( p) values are indicated. Independent replicates were n=5 for farmed and n=4 for wild fish, except for adamts9 where n=3 for wild fish. Supplementary figure 10. Differentially expressed genes (DEGs) in adult early d omesticate European sea bass. a) Gene Ontology (GO) term enrichment of DEGs with the most significantly altered GO terms ranked according to 1) whether they are under - or over - represented and 2) the decreasing order of -log 10 -transformed p-value of the enr ichment based on Fisher’s exact test. Colo rs indicate the percentage of DEGs that are members of each GO term category . Venn diagrams of genes containing differentially methylated regions (DMRs) inside their gene bodies or within a flanking distance of ±5 kb (blue) and DEGs (mustard) in b) brain, c) muscle, d) testis and e) liver. Independent replicates for gene expression estimation were as follows: n=5, wild liver; n=5, farmed liver; n=4, wild brain; n=5, farmed brain; n=4, wild muscle; n=5, farmed muscle ; n=5, wild testis; n=7, farmed testis and for DNA methylation n=3 per group. The number of DEGs that also contain DMRs is low, as in other studies (Kamstra et al. 2018; Uren Webster et al. 2018) . Supplementary figure 11. Principal Component Analysis of the DNA methylation data as measured by Reduced Representation Bisulfite Sequencing. The first two components explain 31.8 of the variance. Three replicates for brain, muscle, testis and liver were used and are plotted for wild (triangles) and farmed (c ircles) adult fish, as well as for the three pools of five eggs each obtained after natural spawning of captive fish. Supplementary figure 12. Effects of farming on the DNA methylation of genes in European sea bass adult tissues discussed in this study . DNA methylation (mean ± SE) of individual CpGs (arbitrarily numbered) around the differentially methylated regions (DMRs, shaded in grey) between wild (red) and early domesticate (blue) sea bass. Examples include a) col14a1a in brain, b) pcdh γ -a11 -like in liver, c) phldb1 in brain, d) foxc1 in testis and e) mapk8a in muscle. Supplementary table 1. Reduced representation bisulfite sequencing (RRBS) statistics 1

Fish origin Tissue Replicate Raw Reads Trimming (%) Alignment (%) CpGs CpGs > 10 reads Fold coverage Bisulfite conversion Farmed Eggs 1 25363386 99.64 86.40 1130220 859529 48.57 99.50 2 22514885 99.66 87.20 1106048 809291 44.51 99.50 3 22482506 99.61 86.50 1089627 780229 44.48 99.50 Mean 23453592 99.64 86.70 1108632 816350 45.85 99.50 Farmed Brain 1 20726415 99.61 87.50 1138697 771616 38.68 99.40 2 15629731 99.61 89.30 1092378 706289 30.59 99.36 3 12180912 99.59 86.80 991853 624057 27.66 99.42 Mean 16179019 99.60 87.87 1074309 700654 32.31 99.39 Farmed Muscle 1 59799884 82.48 82.20 1107093 828147 98.23 99.19 2 56155743 76.26 82.98 1190269 848329 74.15 99.37 3 36701374 84.48 79.71 1044515 773392 60.80 99.15 Mean 50885667 81.07 81.63 1113959 816623 77.73 99.23 Farmed Tes tis 1 40816847 84.53 81.65 1234046 873071 55.44 99.23 2 61733136 77.37 82.15 1325786 932495 72.07 99.30 3 34703397 85.70 78.24 1209916 846013 47.18 99.32 Mean 45751126 82.54 80.68 1256583 883860 58.23 99.28 Farmed Liver 1 11698117 99.20 87.50 945615 631123 27.79 99.49 2 11781342 70.06 54.45 699703 340129 19.94 99.41 3 19511724 99.27 88.10 1084261 802249 39.84 99.49 Mean 14330394 89.51 76.68 909860 591167 29.19 99.46 Wild Brain 1 20106912 98.98 87.80 1083 726 738035 40.94 99.46 2 10782730 99.50 88.20 954782 613687 26.62 99.35 3 17978742 99.51 87.80 1096580 734467 35.23 99.42 Mean 16289461 99.33 87.93 1045029 695396 34.26 99.41 Wild Muscle 1 27489883 83.64 78.83 989067 705397 46.51 99.04 2 61592313 78.87 81.59 1149190 839766 90.51 98.86 3 24648427 84.43 82.10 961701 693993 45.53 99.26 Mean 37910207 82.32 80.84 1033319 746385 60.85 99.05

14 Wild Testis 1 34346041 84.57 81.23 1188239 820741 49.37 99.24 2 526 40885 79.94 81.89 1266962 888504 68.02 99.17 3 41336228 85.34 81.93 1179765 815042 61.00 99.15 Mean 42774384 83.28 81.68 1211655 841429 59.46 99.18 Wild Liver 1 8152344 96.54 70.90 878072 469492 18.12 99.48 2 7984541 59.38 75.84 625667 306891 17.89 99.30 3 20159936 98.08 80.00 1004253 718375 43.88 99.49 Mean 12098940 84.67 75.58 835997 498253 26.63 99.42 Overall mean 28852532 89.11 82.18 1065483 732235 47.17 99.33

Note: 1 A total of 27 RRBS libraries were made (24 from tissues and 3 from eggs). The RRBS libraries of muscle and testis of wild fish were also used in an unrelated study (Anastasiadi, Esteve -Codina, et al. 2018) . Supplementary table 2. RNA -seq statistics 1

Origin Tissue Raw Reads Trimming (%) Alignment (%) Assigned features Unassigned features Alignment insert size Early domesticate Brain 42032123 94.39 88.78 25547814 3810239 153 Muscle 40517347 97.23 94.21 15974845 1545903 184 Testis 41267175 96.74 93.17 16477642 17423 86 173 Liver 43764522 94.22 93.48 33013148 2132945 151 Wild Brain 46903965 91.79 89.56 30025692 3855391 148 Muscle 46411648 96.98 93.29 20328631 2574044 179 Testis 43378147 96.75 92.89 17552280 1929586 177 Liver 40873368 95.12 93.40 30019923 3596283 155 Mean 43143537 95.40 92.34 23617497 2648347 165

Note: 1 A total of 42 RNA -seq libraries were made. Each one of the 8 combinations of fish of origin and tissue is the mean of five libraries, except fo r the tes tis of early domesticate sea bass where seven libraries were sequenced. RNA -seq libraries of muscle and testis of wild fish were also used in an unrelated study (Anastasiadi, Esteve -Codina, et al. 2018) . Supplementary table 3. Reactome pathways in which genes with DMRs established during early development participate

Term Overlap p-value Adj p-value z-score Combined Score Genes Degradation of the extracellular matrix 6/106 0.001 0.215 -1,974 13,123 col18a1 ,mmp15, col14a1, lamc1, nid1, adamts9 Extrace llular matrix organization 10/283 0.001 0.215 -2,095 13,654 col18a1, mmp15, col14a1, dag1, dmd, lamc1, agrn, nid1, bmp7, adamts9 Non -integrin membrane -ECM interactions 4/42 0.001 0.215 -2,067 13,788 dag1, dmd, lamc1, agrn Laminin interactions 3/23 0.002 0.233 -1,889 11,617 col18a1, lamc1, nid1 Adrenoceptors 2/9 0.004 0.316 -1,779 9,677 adra1a, adra2a Glutamate Binding, Activation of AMPA Receptors 3/31 0.005 0.316 -1,978 10,454 myo6, ap2b1, cacng4 and Synaptic Plasticity Trafficking of AMPA receptors 3/31 0.005 0.316 -1,960 10,360 myo6, ap2b1, cacng4 Synthesis of IP2, IP, and Ins in the cytosol 2/11 0.007 0.356 -1,761 8,858 inpp5b, inpp5a Tandem pore domain potassium channels 2/12 0.008 0.377 -1,426 6,922 kcnk6, kcnk13 Collagen degradation 3/39 0.010 0.421 -2,029 9,415 col18a1, mmp15, col14a1 Inositol phosphate metabolism 3/44 0.013 0.532 -1,963 8,464 inpp5b, inpp5a, inppl1 EPH -ephrin mediated repulsion of cells 3/48 0.017 0.597 -1,939 7,904 efnb1, ap2b1, efna5 HDL -mediated lipid transport 2/19 0.0 19 0.597 -1,944 7,688 abca1, scarb1 Phase 4 - resting membrane potential 2/19 0.019 0.597 -1,419 5,612 kcnk6, kcnk13 ECM proteoglycans 3/55 0.024 0.706 -1,732 6,439 dag1, lamc1, agrn Cytosolic tRNA aminoacylation 2/24 0.030 0.812 -1,804 6,337 cars, aimp 2 Synthesis of IP3 and IP4 in the cytosol 2/25 0.032 0.818 -1,912 6,573 inpp5b, inppl1 Integrin cell surface interactions 3/67 0.040 0.818 -1,831 5,882 col18a1, dag1, agrn Abbreviations: Adj, Adjusted. Supplementary table 4. Tissues where genes with DM Rs established during early development are expressed

Term Overlap p-value Adj p-value z-score Combined Score Genes Mesoderm 9/86 6,00 E-07 0.000 -3.570 51.429 efnb1, lmx1a, srf, hoxb3, axin2, hoxa7, pitx2, gata2, isl1 Neural crest 8/138 0.000 0.026 -4.2 18 36.443 efnb1, hoxb3, pax3, ap2b1, pitx2, isl1, gli3, phox2a Ectoderm 8/136 0.000 0.026 -4.121 36.022 lmx1a, pax3, pitx2, gata2, isl1, bmp7, meis2, gli3 Neural tube 6/119 0.001 0.097 -2.958 20.855 nkx6 -2, lmx1a, hoxb3, pax3, isl1, gli3 Notochord 4/38 0.002 0.165 -2.118 13.328 pax3, pitx2, isl1, gli3 Bud 5/103 0.002 0.174 -3.772 22.849 lmx1a, pax3, axin2, pitx2, bmp7 Mesenchyme 7/264 0.006 0.351 -3.546 17.967 anpep, pax3, nid1, bmp7, gli3, pthlh, smad7 Myotube 5/103 0.006 0.351 -3.283 16.636 srf, dag 1, pax3, dmd, agrn Adult 16/918 0.031 0.356 -4.871 16.946 nkx6 -2, srf, pax3, gata2, nid1, isl1, bmp7, pthlh, gli3, hhex, anpep, man1c1, nhs, dag1, dmd, agrn Muscle stem cell 2/15 0.057 0.356 -5.603 16.009 pax3, dmd Floral primordium 2/6 0.012 0.356 -3.4 79 15.353 abi3, axin2 Endoderm 4/90 0.019 0.356 -3.350 13.268 hhex, nkx6 -2, nid1, isl1 Gametophyte 2/14 0.011 0.356 -2.699 12.278 abi3, agps Gill arch 2/19 0.019 0.356 -2.989 11.822 pax3, phox2a Cancellous bone 3/42 0.012 0.356 -2.554 11.334 slc9a3r1, bmp7, pthlh Meristem 3/48 0.017 0.356 -2.773 11.306 abi3, pradc1, axin2 Seedling 4/108 0.034 0.356 -3.162 10.670 slc9a3r1, col18a1, abi3, agps Knee 4/110 0.036 0.356 -3.212 10.654 prg4, phb2, bmp7, srcin1 Embryoid body 3/55 0.024 0.356 -2.860 10.633 la mc1, gata2, isl1 BTO:0000449 2/25 0.032 0.356 -2.826 9.713 ccl13, adamts9 Pollen tube 2/20 0.021 0.356 -2.361 9.108 tpst1, agps Somatic embryo 2/24 0.030 0.356 -2.578 9.058 abi3, agps Femur 3/63 0.034 0.356 -2.674 9.008 slc9a3r1, bmp7, pthlh Incisor 3/63 0.034 0.356 -2.611 8.794 slc9a3r1, bcor, pitx2 Megagametophyte 2/22 0.025 0.356 -2.278 8.374 tpst1, asz1 Electric organ 2/27 0.037 0.356 -2.495 8.220 dmd, agrn Phloem 2/20 0.021 0.356 -2.126 8.200 slc10a3, skap2 Perichondrium 2/28 0.040 0.356 -2.53 5 8.183 bmp7, pthlh Alveolar bone 3/70 0.045 0.356 -2.585 8.024 pitx2, bmp7, pthlh Dentin 3/72 0.048 0.356 -2.611 7.924 slc9a3r1, phf20, bmp7 Neurula 2/24 0.030 0.356 -2.176 7.644 pax3, pitx2 Tibia 3/71 0.046 0.356 -2.345 7.198 bmp7, srcin1, pthlh Bra nchial arch 3/75 0.053 0.356 -2.280 6.690 pax3, hoxb3, pitx2 Vascular tissue 2/30 0.045 0.356 -2.139 6.636 slc9a3r1, agps Shoot tip 2/31 0.048 0.356 -2.159 6.569 pradc1, axin2 U2 -OS cell 2/34 0.056 0.356 -2.255 6.489 cdk6, chek1 Endochondral bone 2/31 0.048 0.356 -2.086 6.349 bmp7, pthlh Choanomastigote 2/31 0.048 0.356 -2.078 6.324 aimp2, nav2 Abbreviations: Adj, Adjusted. Supplementary table 5. qPCR primers used in this study

Gene Primer sequence (5’→3’) Efficiency (E) Slope R2 Tm Product size (bp) adamts9 (F) TCTGCAGAGCAAGGGATAAGTG 2.05 -3.21 0.96 60.1 128 (R) TTCATGGGCGATGGTGAATG 58.6 mapk8a (F) GTGGATGCACAGAGAGCAGT 2.14 -3.03 0.97 60.0 221 (R) TGAAATGGCCGACTCAGCTT 60.0 ppargc1a (F) AGATGGGGACGTGACCAATG 2.11 -3.08 0.96 59.7 137 (R) TATAGCTGAGCTGGGAGTTTGC 60.2 hspb11 (F) TCTTCAAGCCCATCGCCTTC 1.91 -3.60 0.99 60.4 103 (R) TGTTTGACCGACAGCTCCTC 60.0 l13a (F) TCTGGAGGACTGTCAGGGGCATGC 2.00 -3.31 1.00 68.1 148 (R) AGACGCACAATCTTGAGAGCAG 60.9 ef -1a (F) AAATGCGGAGGAATCGA CAA 2.11 -3.08 0.99 62.4 71 (R) GAGCCCTTGCCCATCTCAG 60.2 Supplementary table 6. Multiplex bisulfite sequencing (MBS) primers

Gene Forward primer Reverse primer Amplicon width (bp) Tm Transcript ID gria4a AAAATGAGTTAATGGAATAAATTGGAA ACCACTCAAACAA CTCTATCTTTAT 469 59 DLAgn_00046400 phldb1 GGGAGTTAGTGTGTTTTTTG CCCCTACCTACCTTTAAAACTTAT 423 59 DLAgn_00028650 pcdh γ -a11 -like TTAAGTTGGGGGAAGTAGTGAAG TCAAACTTAACTATCTAAAAAAATAAAAAT 265 59 DLAgn_00215800 adamts9 GTGGAGAGAAGGAGATTGGTAGA AAACAAATATCAATCAAATATTTCTAA 451 56 DLAgn_00090160 mapk8a GGGTAGTATTTAGAGGAGATAATGT AAAATATTAAACAAAAATTAAATTACCATA 453 54 DLAgn_00 013090 foxc1 AATAATGATTGATTAATAGAATAAAG TCAAAAAACAACTCTTTCAAAAT 445 51 DLAgn_00145560

Note: For details on the MBS protocol, see (Anastasiadi, Vandeputte, et al. 2018) Supplementary table 7. Multiplex Bisulfite Sequencing ( MBS ) statistics

Fish origin Raw Reads Trimming (%) Alignment (%) Number of Cs Number of CpGs Fold coverage Bisulfite conversion Early domesticate 79983 57.671 94.04 3712043 185764 6512 99.3 Wild 75675 59.900 93.93 3965850 296157 6739 99.4 Mean 77829 58.786 93.98 3838947 240960 6625 99.4 Dataset 1. List of genes under positive selection in European sea bass and different mammalian and avian domesticates.

Dataset 2. List of genes with differentially methylated regions (DMRs) in early domesticate vs. wild European sea bass adult ti ssues and in hatchery -reared vs. wild coho salmon ( Oncorhynchus kisutch ) muscle .

Dataset 3. List of DMRs in genes in early domesticate vs. wild European sea bass adult tissues.

Dataset 4. List of GO -term enrichment of genes containing DMRs in early domesti cate adult European sea bass tissues.

Dataset 5. List of differentially expressed genes (DEGs) in early domesticate adult European sea bass tissues.

Dataset 6. List of GO -term enrichment of DEGs in early domesticate adult European sea bass tissues.

Dataset 7. List of DMRs in genes in early domesticate European sea bass eggs.

Dataset 8. List of GO -term enrichment of genes containing DMRs in early domesticate European sea bass eggs.

23 References

Anastasiadi D, Esteve -Codina A, Piferrer F. 2018. Consistent inv erse correlation between DNA methylation of the first intron and gene expression across tissues and species. Epigenet Chromatin 11(1):37.

Anastasiadi D, Vandeputte M, Sánchez -Baizán N, Allal F, Piferrer F. 2018. Dynamic epimarks in sex -related genes predic t gonad phenotype in the European sea bass, a fish with mixed genetic and environmental sex determination. Epigenetics 13(9):988 –1011.

Arechavala -Lopez P, Sanchez -Jerez P, Bayle -Sempere JT, Sfakianakis DG, Somarakis S. 2012. Morphological differences betw een wild and farmed Mediterranean fish. Hydrobiologia 679(1):217 –231.

Bertolini F, Geraci C, Schiavo G, Sardina MT, Chiofalo V, Fontanesi L. 2016. Whole genome semiconductor based sequencing of farmed European sea bass ( Dicentrarchus labrax ) Mediterranean genetic stocks using a DNA pooling approach. Mar Genomics 28:63 –70.

Carneiro M, Rubin C -J, Di Palma F, Albert FW, Alföldi J, Barrio AM, Pielberg G, Rafati N, Sayyab S, Turner -Maier J. 2014. Rabbit genome analysis reveals a polygenic basis for phenotypic change during domestication. Science 345(6200):1074 –1079.

Dooley CM, Wali N, Sealy IM, White RJ, Stemple DL, Collins JE, Busch -Nentwich EM. 2019. The gene regulatory basis of genetic compensation during neural crest induction. PLOS Genetics 15:e1008213.

Fl eming IA, Jonsson B, Gross MR, Lamberg A. 1996. An Experimental Study of the Reproductive Behaviour and Success of Farmed and Wild Atlantic Salmon ( Salmo salar ). Journal of Applied Ecology 33:893 –905.

Huntingford FA. 2004. Implications of domestication and rearing conditions for the behaviour of cultivated fishes. Journal of Fish Biology 65:122 –142.

Kamstra JH, Hurem S, Martin LM, Lindeman LC, Legler J, Oughton D, Salbu B, Brede DA, Lyche JL, Aleström P. 2018. Ionizing radiation induces transgenerational e ffects of DNA methylation in zebrafish. Sci Rep 8:15373

Kukekova AV, Johnson JL, Xiang X, Feng S, Liu S, Rando HM, Kharlamova AV, Herbeck Y, Serdyukova NA, Xiong Z, et al. 2018. Red fox genome assembly identifies genomic regions associated with tame and ag gressive behaviours. Nat Ecol Evol 2(9):1479 –1491.

Martinez -Morales J -R, Henrich T, Ramialison M, Wittbrodt J. 2007. New genes in the evolution of the neural crest differentiation program. Genome Biology 8(3):R36.

Montague MJ, Li G, Gandolfi B, Khan R, Ak en BL, Searle SMJ, Minx P, Hillier LW, Koboldt DC, Davis BW, et al. 2014. Comparative analysis of the domestic cat genome reveals genetic signatures underlying feline biology and domestication. Proc Natl Acad Sci USA 111(48):17230 –17235. Pendleton AL, She n F, Taravella AM, Emery S, Veeramah KR, Boyko AR, Kidd JM. 2018. Comparison of village dog and wolf genomes highlights the role of the neural crest in dog domestication. BMC Biology 16:64.

Schubert M, Jónsson H, Chang D, Der Sarkissian C, Ermini L, Ginol hac A, Albrechtsen A, Dupanloup I, Foucal A, Petersen B. 2014. Prehistoric genomes reveal the genetic foundation and cost of horse domestication. Proc Natl Acad Sci USA 111 (52) :E5661 –E5669.

Tine M, Kuhl H, Gagnaire P -A, Louro B, Desmarais E,Martins RST, He cht J, Knaust F, Belkhir K, Klages S, et al. 2014. European sea bass genome and its variation provide insights into adaptation to euryhalinity and speciation. Nat Commun. 5(1):5770.

Tymchuk W, Sakhrani D, Devlin R. 2009. Domestication causes large -scale e ffects on gene expression in rainbow trout: Analysis of muscle, liver and brain transcriptomes. General and Comparative Endocrinology 164 (2 -3) :175 –183.

Uren Webster TM, Rodriguez -Barreto D, Martin SAM, van Oosterhout C, Orozco -terWengel P, Cable J, Hamilton A, Garcia de Leaniz C, Consuegra S. 2018. Contrasting effects of acute and chronic stress on the transcriptome, epigenome, and immune response of Atla ntic salmon. Epigenetics 13(12):1191 -1207.

Witten DM. 2011. Classification and clustering of sequencing data using a Poisson model. Ann. Appl. Stat. 5:2493 –2518.

Zhang Z, Jia Y, Almeida P, Mank JE, van Tuinen M, Wang Q, Jiang Z, Chen Y, Zhan K, Hou S. 201 8. Whole -genome resequencing reveals signatures of selection and timing of duck domestication. GigaScience 7 (4) :giy027.

Zupa R, Rodríguez C, Mylonas CC, Rosenfeld H, Fakriadis I, Papadaki M, Pérez JA, Pousis C, Basilone G, Corriero A. 2017. Comparative Stu dy of Reproductive Development in Wild and Captive -Reared Greater Amberjack Seriola dumerili (Risso, 1810). PLOS ONE 12:e0169645.