Fork Stalling and Template Switching As a Mechanism for Polyalanine Tract Expansion Affecting the DYC Mutant of HOXD13, a New Murine Model of Synpolydactyly

Olivier Cocquempot,*,†,1 Ve´ronique Brault,*,† Charles Babinet‡ and Yann Herault*,†,§,2 *Universite´ d’Orleáns, UMR6218, Molecular Immunology and Embryology, 45071 Orleáns, France †Centre National de la Recherche Scientifique (CNRS), UMR6218, MIE, 3B rue de la Fe´rollerie, 45071 Orleans Cedex 2, France, ‡Unite´ de Biologie du De´veloppement, URA 1960, CNRS, Institut Pasteur, 25 rue du Docteur Roux 75015 Paris, France and §CNRS, UPS44, TAAM, Institut de Transgenose, 45071 Orleáns, France Manuscript received May 5, 2009 Accepted for publication June 15, 2009

ABSTRACT Polyalanine expansion diseases are proposed to result from unequal crossover of sister chromatids that increases the number of repeats. In this report we suggest an alternative mechanism we put forward while we investigated a new spontaneous mutant that we named ‘‘Dyc’’ for ‘‘Digit in Y and Carpe’’ phenotype. Phenotypic analysis revealed an abnormal limb patterning similar to that of the human inherited congenital disease synpolydactyly (SPD) and to the mouse mutant model Spdh. Both human SPD and mouse Spdh mutations affect the Hoxd13 gene within a 15-residue polyalanine-encoding repeat in the ﬁrst exon of the gene, leading to a dominant negative HOXD13. Genetic analysis of the Dyc mutant revealed a trinucleotide expansion in the polyalanine-encoding region of the Hoxd13 gene resulting in a 7-alanine expansion. However, unlike the Spdh mutation, this expansion cannot result from a simple duplication of a short segment. Instead, we propose the fork stalling and template switching (FosTeS) described for generation of nonrecurrent genomic rearrangements as a possible mechanism for the Dyc polyalanine extension, as well as for other polyalanine expansions described in the literature and that could not be explained by unequal crossing over.

IGHLY conserved Hox genes encode transcription mutations in HOX genes are rare and have only mild H factors containing a homeobox and forming effects (for review see Goodman 2002). Mutations in multimeric complexes with other specific DNA-binding HOX genes have been mostly associated with some partners to regulate the transcription of specific genes human congenital malformation syndromes of the devel- (Moens and Selleri 2006). They play key roles in the oping limbs. Whereas mutations in HOXA13 cause hand- control of positional information during body axis foot-genitalia syndrome (HFGS, OMIM no. 140000), specification and limb patterning. In mammals, Hox characterized by short thumbs and halluces, and clino- genes are organized in four clusters A to D in which brachydactyly of the second and fifth fingers (Warot they are expressed with a precise spatial and temporal et al. 1997; Goodman et al. 2000), mutations in HOXD13 pattern that reflects their genomic organization, with give rise to a wide spectrum of limb malformations with 59genes expressed late and in more posterior and distal variable penetrance and expressivity. Missense mutations mita uboule eschamps regions (K and D 2003; D and within the homeodomain of HOXD13 result in a loss of an es V N 2005). In the appendices, only the more 59 function that leads to brachydactyly type D (BDD, MIM located genes (9–13) are expressed, with a predomi- 113200) or to brachydactyly type E (BDE, MIM 113300). nant role of A- and D-cluster genes. Duplications and Expansion (Akarsu et al. 1996; Muragaki et al. 1996; deletions analyses (Herault et al. 1998; Kmita et al. Goodman et al. 1997) and, in few cases, frameshift 2005) have revealed a complex network of interactions deletions (Goodman et al. 1998; Calabrese et al. 2000) among Hox genes from the different clusters as well as of the polyalanine tract in exon 1 of HOXD13 trigger a global regulation of genes within a cluster. synpolydactyly (SPD, MIM 186000), a semidominant Despite their central role in vertebrate body pattern- limb malformation syndrome characterized by digit ing, human congenital abnormalities attributable to duplication and fusion in heterozygotes and a combina- Supporting information is available online at http://www.genetics.org/ tion of syndactyly, polydactyly, and shortening of the cgi/content/full/genetics.109.104695/DC1. hands and feet in homozygotes (Caronia et al. 2003; 1 Present address: Universite´ de Limoges, 87060 Limoges, France. Yucel et al. 2005). 2Corresponding author: UMR6218, IEM, Uni Orleáns, CNRS, UPS44, TAAM, Institut de Transgeńose,3BruedelaFe´rollerie, 45071 Orleáns A spontaneous mouse mutant of Hoxd13 was isolated Cedex 2 France. E-mail: [email protected] by Johnson and collaborators (1998) that, in its homo-

Genetics 183: 23–30 (September 2009) 24 O. Cocquempot et al. zygous state, phenotypically and molecularly modeled MATERIALS AND METHODS human SPD. The Spdh (synpolydactyly homolog) muta- Mouse lines and complementation test: The Dyc spontane- tion is a 21-bp in-frame duplication within the poly- ous mutation was isolated during the intercross of a mutant alanine stretch of exon 1, expanding the number of line backcrossed at N10 on the BALB/c genetic background. alanines from 15 to 22, and it corresponds to the major C57BL/6J HoxD,Del3. (Zakany and Duboule 1996) mice type of expansion found in human SPD. Spdh heterozy- were obtained from D. Duboule through the European Mouse gous mice have only a slight shortening of digits 2 and 5, Mutant Archive (EMMA; www.emmanet.org). The lines were maintained in specific pathogen-free conditions and all the whereas homozygotes present a severe shortening of all experiments were carried out in accordance with the Euro- fingers from both forelimbs and hindlimbs, associated pean and French regulations. Complementation testing was with a combination of syndactyly and polydactyly due to done in a B6C hybrid background. a substantial delay in the ossification of the limb bony Skeletal preparations: Preparations of skeletons were realized for adults, newborns, and embryos, according to elements. In addition, homozygous mice lack preputial ohnson runeau J et al. (1998). Briefly, the adults and newborns are glands and males are not fertile (B et al. 2001; eviscerated, skinned, and fixed in ethanol. Staining of the Albrecht et al. 2002). bones is obtained with alizarin red and of the cartilage We identified a new spontaneous mutant originated (newborns) with alcian blue. The flesh is clarified in glycerol. in the BALB/c line that presented an alteration of the The embryos are fixed in Bouin solution, stained with alcian distal part of the limbs and was hence named Dyc for blue, and the flesh is clarified in methyl salicylate. In situ hybridization: Whole-mount in situ hybridization was ‘‘Digit in Y shape and Carpe.’’ This mutation appeared performed using digoxigenin-labeled probes for Hoxd13, spontaneously in the last backcross of a transgenic line Hoxd12, Hoxd11, and Hoxd10 genes as described previously on the BALB/c genetic background, during the final (Herault et al. 1998) and embryos of stages 12.5 days intercross to generate mice homozygous for the trans- postcoitum (dpc) obtained by time matings from Dyc/13 1 gene. The phenotype was similar to human synpolydac- Dyc/ . Embryos were collected, fixed in 4% paraformalde- hyde at 4°, dehydrated, and stored in methanol at 20° until tyly and to phenotypes observed in mutations affecting use. After rehydratation, bleaching with H2O2 and a pre- Hox genes. Phenotypic and genetic characterization of treatment with proteinase K (10 mg/ml), the embryos were Dyc mice demonstrated that Dyc is a new allele of Hoxd13 incubated over night at 70° with the probes (1 mg/ml). They affecting the polyalanine cluster. Even though the were then washed several times, incubated with anti-DIG resulting mutant allele contains, like the Spdh mutant, alkaline phosphatase antibody (Roche Biochemicals) at the dilution of 1:5000 overnight at 4°. After washing of the a 7-alanine expansion, sequencing analysis revealed that antibody, staining was performed with BM purple (Roche). the nucleotide expansion in the Dyc mutant is different Exon sequencing of Hoxd13 to Hoxd10 genes: To screen for from that of the Spdh. Spdh polyalanine expansion is a mutation in the coding sequence of Hoxd10-13 genes, specific straightforward reduplication of a short segment of the primers were designed with the DsGene program for ampli- ohnson imperfect trinucleotide repeat, whereas the Dyc expan- fication of the exons of those genes by PCR ( J et al. 1998). Exons were amplified by classical PCR. Then, both sion seems to result from two smaller duplications. strands of the PCR fragments were sequenced using the Big Unlike classical long unstable trinucleotide repeat Dye Terminator reaction mix (Applera, France) on an ABI310 expansions that have been described to result from sequencer. The sequence was analyzed with the DSGene polymerase slippage during DNA replication (see software (Acceleris, UK). Kovtun et al. 2004 for review), polyalanine expansions are short, imperfect, and stable when transmitted from RESULTS generation to generation and hence have been proposed to result from an unequal crossing over between Dyc mutants show digit malformations and agenesis two mispaired wild-type alleles (Warren 1997). How- of preputial glands: Mice with abnormal digits in fore- ever, the Dyc expansion, like a few other alanine tract and hindlimb feet were discovered in the BALB/c line expansions reported in the literature do not all fit with during a backcross of a transgene to generate homozy- the model of unequal crossing over (Goodman et al. gous animals. In the progeny of this intercross, 71% of 1997; De Baere et al. 2003; Robinson et al. 2005; the animals (n ¼ 109 produced progeny) had a digit Trochet et al. 2005). Until now, no mechanism other alteration, with 48% having a slight phenotype affecting than replication slippage, which does not fit with the digits 2 and 5, and 23% having a stronger phenotype ‘‘nature’’ of the polyalanine repeats, was proposed with shortening of all the fingers. This was indicative of (Trochet et al. 2007). In the article, we describe the the appearance of a semidominant mutation with the phenotype and mutation of the Dyc allele of Hoxd13, group of animals bearing the mild phenotype being apply the mechanism of fork stalling and template heterozygous and the group with the strong phenotype switching (FosTeS) (Lee et al. 2007), on the basis of being homozygous and suggested that the parents were the switching forward or backward of the replication heterozygotes. Looking back at the parents, they were fork along the DNA template using microhomology indeed found to have the mild digit phenotype. sequences to generate the Dyc expansion, and pro- In heterozygous adult animals, skeletal analysis pose FosTeS as a new mechanism for polyalanine (Figure 1a) revealed a shortening of digits 2 and 5. extensions. Homozygous animals exhibited a complete alteration of FosTeS Mechanism Leading to Polyalanine Expansion Mutation 25

Figure 1.—Alizarin skeletal preparations of adult distal forelimbs and hindlimbs of (a) wild- type (1/1), heterozygous (Dyc/1), and homozygous (Dyc/Dyc) mutants and (b) heterozygous Del3, homozygous Del3, and transheter- ozygous Dyc/Del3 mice. Fingers are numbered from 1 to 5, from the thumb to the little finger and shortening of fingers is shown by arrows. Dyc/1 and Del3/1 autopods have shortening of fingers 2 and 5. Dyc/Dyc have shortening and malformation of all fingers and appearance of a supernumerary finger, noted 6, in postaxial position. Syndactily between fingers 3 and 4 with fusion at the metacarpus or metatarsus level is also present. In hindlimbs, the hallux is shortened with the metatarsus having a characteristic form. Del3/Del3 have shortening of all fingers and high deformation of toe 1, syndactily of toes 4 and 5 (arrow), and supernumerary toe 6 in the hindlimb. Transheterozygote Dyc/Del3 animals show shortening of all fingers with a higher deformation of toe 1 (arrow). the distal part of the five digits and malformation of all and cartilage formation in the Dyc/Dyc autopod. Super- the bones from the ankle (metacarpal, carpal, meta- numerary fingers are present. At 15.5 dpc, deformation tarsal, and tarsal bones). These alterations were asso- at the level of the metatarsus and metacarpus are visible. ciated with a syndactyly for digits 4 and 5 and the At birth (0.5 days postpartum or dpp), ossification appearance of an extra sixth postaxial digit (polydac- centers are detected in all wild-type digits but not in tyly). The hindlimbs had an additional strong deformity Dyc/Dyc mutant forelimbs. Polydactily is accompanied of the metatarsal bone of digit 1. This new mutant was by syndactily. At 4.5 dpp, while ossification of the called Dyc for Digit in Y and Carpe (Y-shaped finger and phalanx is completed in wild-type autopods, in Dyc/Dyc carpe). No other alteration of the axial skeleton was autopods, the ossification center’s location is not clearly found (n ¼ 10 wt and 10 Dyc/Dyc; 12 weeks old). defined and there are defects in segmentation of the Necropsy analyses (n ¼ 3 wt and 4 Dyc/Dyc) did not finger elements, making it hard to distinguish meta- reveal any other drastic organ malformation and a carpus and phalanx. hematological analysis (n ¼ 3 wt and 4 Dyc/Dyc;12 Dyc mutation is an allele of Hoxd genes: Limb weeks old) indicated a normal globular numeration. phenotypes associated with the Dyc mutation are more Homozygous Dyc males are not fertile. Analysis of the severe than those found in the Hoxd13 mutation urogenital apparatus of these males revealed that pre- obtained by genetic inactivation, but similar to the putial glands were absent. Hence, the Dyc mutation alterations found in mutants of the posterior Hoxd produces two major alterations: a severe malformation genes, controlling limb patterning (Zakany et al. of the autopod and the lack of preputial glands in males. 1997; Kmita et al. 2002a,b). Heterozygote HoxDDel3/1 These two phenotypes were similar to those of the Spdh mutant mice (Zakany and Duboule 1996) bearing a mutant mouse, a model for human synpolydactyly deletion that inactivates the expression of Hoxd11, characterized by an expansion of unstable repeats Hoxd12, and Hoxd13 genes simultaneously have a within the 59 end of the Hoxd13 gene (Johnson et al. shortening of digits 2 and 5 like Dyc heterozygous 1998). animals (Figure 1, b vs. a). HoxDDel3/Del3 homozygous for Effect of the Dyc mutation on the ossification: We this deficiency showed reduction in the length of all the went further to check whether the origin of the digits (ectrodactyly) with a rougher and stiffer aspect of phenotype of the Dyc mutant during bone and cartilage the digits and polydactyly/syndactyly in the hindlimbs development was similar to the Spdh mutant. Alcian (Figure 1b). The Dyc mutation in its homozygous form blue/alizarin red staining of the skeleton was per- seems hence to be less severe than the Del3 one. We formed at several time points during embryonic and carried out a complementation test by crossing Dyc postnatal development to compare cartilage and bone animals with HoxDDel3 mutant mice. HoxDDel3/Dyc trans- development between Dyc/Dyc mutants and wild-type heterozygous mice displayed digit alteration similar to littermates (supporting information, Figure S1). Alcian the ones present in HoxDDel3/Del3 homozygotes (Figure blue staining of autopods at E14.5 dpc reveals a de- 1b). Both have a shortening of all fingers with a mal- velopmental delay in individualization of the fingers formation of toe 1 and polydactyly in the hindlimbs. 26 O. Cocquempot et al.

Figure 2.—Analysis of the Dyc mutation. (a) Alignment between BALB/c (sequence of reference) and Dyc/Dyc showing the ampliﬁcation in 59 of Hoxd13 exon 1. (b) Alignment between the BALB/c, C57BL/6J, Spdh, and Dyc sequences. The duplicated nucleotides in the two mutants are shown in red and purple and the corresponding fragments in the normal sequence are underlined in the same color. The arrows show the straightforward tandem duplication in the Spdh mutant and the imperfect ampli- ﬁcation in Dyc where the unequal allelic homologous recombination model is at fault. (c) Multiple alignments of the BALB/c sequence to the Dyc (yellow) at microhomologies (red letters) that are boxed. The extended sequence in the Dyc mutant is underlined. Aligned sequences are in blue, green, and purple; nonaligned ones in gray.

Interestingly synpolydactily is rarely observed in trans- The Dyc mutation affects the Hoxd13 protein heterozygote animals. These results indicate that the Dyc sequence: After having checked that expression pat- mutation is an allele of one of the genes from the HoxD terns of the posterior genes from the HoxD complex complex. were not perturbed, we looked for the presence of Posterior genes from the HoxD do not have their mutations within the coding sequences of those genes. expression perturbed by the Dyc mutation: We checked Sequencing analysis of Hoxd10, Hoxd11, and Hoxd12 did whether the Dyc mutation affected the transcriptional not show any mutation within those genes in Dyc control of posterior genes from the HoxD complex in mutants. However, PCR amplification of the 59 part of the limb bud. Only the more 59 located genes (9–13) are exon 1 of Hoxd13 indicated an increase in the size of expressed in the limbs. They are expressed in over- the amplified segment compared to BALB/c and lapping domains in more or less anterior-to-posterior C57BL/6J controls (data not shown). Sequencing of gradients, are involved in the proper patterning of this fragment revealed a duplicated region responsible proximodistal elements, and impact the development for the increased size (Figure 2a). This amplification of the anteroposterior axis of the limbs. Comparing the corresponds to 21 bp containing mainly trinucleotide expression patterns of Hoxd13, Hoxd12, Hoxd11, and repeats, coding for a series of 15 alanine residues in the Hoxd10 genes in the limb buds of wild-type controls and wild-type control and for 22 alanine residues in the Dyc Dyc/Dyc mutant embryos at 12.5 dpc using whole-mount mutant. Hence, the Dyc mutation corresponds to poly- in situ hybridization revealed identical patterns of ex- alanine expansion similar to the Hoxd13Spdh mutation pression between mutant and control animals in the that creates a gain of function of HOXD13 protein. distal part of the autopod (Figure S2). Additional However, alignment between Spdh and Dyc polyalanine hybridization of Hoxd13 at 11.5 dpc and 13.5 dpc and stretches (Figure 2b) indicates that the nature of the of Hoxa13 at 13.5 dpc did not reveal any abnormal expansion is different between the two allelic mutants. expression of these markers whereas physical alteration Whereas the Spdh expansion appears to be a straightfor- is already visible (data not shown). ward reduplication of the nucleotide repeats corre- FosTeS Mechanism Leading to Polyalanine Expansion Mutation 27 sponding to alanines 1–7, the Dyc expansion is more and the genetic background does not seem to influence complex, with a duplication of nucleotide repeats the severity of the phenotype that is influenced by the coding for alanines 1–5 and the two first nucleotides length of the alanine expansion (Goodman et al. 1997). of alanine 7, whereas a small duplication corresponding But human and mouse differ in their heterozygous and to the sequence AGCA shifted in front of the first homozygous states. Whereas digit fusions and duplica- duplication instead of being after as in the wild-type tions are present in human heterozygotes, this pheno- sequence. type is only visible in mouse homozygotes indicating a difference in molecular interplay between human and mouse. DISCUSSION Polyalanine tract expansions are found in at least nine The Dyc mutation is a semidominant mutation caus- disorders (Amiel et al. 2004; Brown and Brown 2004), ing severe limb malformations that are strikingly similar mostly in genes that are coding for transcription factors to those of the Spdh mutant, a 21-bp in-frame duplica- involved in developmental processes (Karlin et al. 2002; tion within the polyalanine-encoding region of the Lavoie et al. 2003). Unlike classical long unstable tri- Hoxd13 gene (Johnson et al. 1998). Like Spdh/Spdh nucleotide repeat expansions found in genes impli- mutants, homozygous Dyc mice have delayed distal limb cated in hereditary neurodegenerative diseases, the development and altered chondrogenesis resulting polyalanine expansions are imperfect, short, and stable in reduced size of all the fingers associated with poly- through meiosis and mitosis. This suggests a different dactyly and syndactyly. Heterozygous animals are less mechanism of mutation from strand slippage occurring affected, with only a slight shortening of fingers 2 and 5, during DNA replication, repair, or recombination in the indicating that the Hoxd13 wild-type allele is able to other diseases of unstable repeat expansion (Sinden partly compensate for the effect of the Dyc allele. Like in et al. 2002; Pearson et al. 2005; Kaplan et al. 2007; the Spdh mutant, alterations found in Dyc homozygous Kovtun and McMurray 2008). Indeed, the expanded mice are more severe than those of null mutants of polyalanine tract in SPD is quite stable (no increase in Hoxd13 (Dolle et al. 1993; Davis and Capecchi 1996) mutation size) when transmitted from one generation but are similar to those found in the loss of function of to another. In addition, polyalanine tracts are short, the three most posterior genes of the HoxD complex with the longest nonpathogenic tract being of 20 (Hoxd13, Hoxd12, and Hoxd11)(Zakany and Duboule residues (Lavoie et al. 2003), whereas tracts of 35 1996). However, normal pattern expression of those perfect trinucleotide repeats are required for instability genes during limb development of Dyc/Dyc embryos and expansion (Eichler et al. 1994; Kunst and Warren indicates that inactivation does not occur at the level of 1994). Warren (1997) suggested that polyalanine the transcription as it could have been expected from expansion found in the mouse Spdh allele and human the transcriptional control loops between Hox genes SPD may have resulted from unequal crossing over in that have been described in the literature (Gavalas the HOXD13 gene during meiosis due to misalignment et al. 2003). between triplet repeats. This mechanism could also Mapping of the Dyc mutation revealed an expansion explain expansions found in other polyalanine disor- of the trinucleotide repeat in the upstream exon of ders (Robinson et al. 2005; Arai et al. 2007). However, Hoxd13 similar to that found in the Spdh spontaneous unlike the Spdh mutation, the complex duplication mutant that was discovered in a mouse colony with found in the Dyc mutant is not a straightforward re- the B6C3Fe genetic background. Both Dyc and Spdh duplication and cannot be explained by unequal alleles give an additional 7 alanines at the 15-alanines crossing over. Looking at the 7-alanine expansion tract stretch, conferring a dominant-negative property to the (Figure 2b), the additional six last alanines can corre- HOXD13 protein, probably by interfering with the spond to a reduplication of alanines 1–6, but there is activity of the wild-type HOXD13 and other HOX an additional GCA codon in front of those 6 alanines proteins. This suggests that the polyalanine tract is im- whose origin cannot be explained. We checked for portant either for interaction with other partners or for codon polymorphism in the B6C3Fe and BALB/c lines formation of a functionally important structure of the that could explain this atypical insertion, but could not protein and that whatever the genetic background, find any. In addition, even if this additional GCA codon there is a threshold length of polyalanine extension is ignored, the 6-alanine expansion cannot result from above which the extension becomes pathologic and simple unequal allelic homologous recombination. digital anomalies appear. Polyalanine tract expansion is Other mutations have been reported in the literature also the common mutation found in the typical form of (Goodman et al. 1997; De Baere et al. 2003; Robinson human SPD (Akarsu et al. 1996; Muragaki et al. 1996; et al. 2005; Trochet et al. 2007), which do not fit the Horsnell et al. 2006), with additional alanine residues unequal allelic recombination model for mutational varying from 7 to 14 (Goodman et al. 1997). Like in the mechanism described by Warren (1997). Trochet mouse, a minimum of 7 additional alanine residues is and collaborators (2007) already refuted the unequal needed in human HOXD13 for a phenotype to appear crossing-over mechanism as the explanation of poly- 28 O. Cocquempot et al.

TABLE 1 List of the alanine track expansions that cannot be explained by the unequal recombination mechanism

Gene Repeat Name Reference Sequence HOXD13 15 ala Normal allele GCGGCGGCGGCGGCAGCGGCGGCTGCGGCGGCGGC GGCGGCAGCC HOXD13 19 ala Pedigree P Goodman et al. GCGGCGGCGGCGGCAGCGGCGGCTGCGGCGGCGG (1997) CGGCGGCAGCGGCGGCGGCGGCGGCGGCGGCGGCAGCC PHOX2B 20 ala Normal allele GCAGCAGCAGCGGCGGCGGCCGCGGCAGCGGCGGCGGCG GCAGCGGCAGCGGCGGCAGCT PHOX2B 15 ala Trochet et al. GCAGCAGCAGCGGCGGCGGCCGCGGCAGCGGCGGCGG (2005, 2007) CGGCAGCGGCAGCGGCGGCGGCGGCAGCGGCAGCGGCT PHOX2B 16 ala Trochet et al. GCAGCAGCAGCGGCGGCGGCCGCGGCAGCGGCGGCGGCGG (2005, 2007) CAGCGGCGGCGGCCGCGGCAGCGGCGGCGGCGGCAGCT PHOX2B 17 ala Trochet et al. GCAGCAGCAGCGGCGGCGGCGGCAGCAGCAGCGGCGGCGG (2005, 2007) CCGCGGCAGCGGCGGCGGCGGCAGCGGCAGCGGCGGCAGCT FOXL2 14 ala Normal allele GCGGCAGCCGCAGCGGCTGCAGCAGCTGCGGCTGCAGCCGCG FOXL2 115 ala 921935 De Baere et al. GCGGCAGCCGCAGCGGCTGCAGCAGCTGCGGCTGCAGCAGCTGC trip15 (2003) GGCTGCAGCAGCTGCGGCTGCAGCAGCTGCGGCTGCAGCCGCG PABPN1 10 ala Normal allele GCGGCGGCGGCGGCGGCGGCAGCAGCAGCG PABPN1 17 ala (GCG) 13 Robinson et al. GCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG (2005) GCGGCAGCAGCAGCG These expansions were all found in human pedigrees. alanine expansions. However, they only suggested that polyalanine extensions via short-range template skip- the replication slippage mechanism proposed for dis- ping. We made multiple alignment of the wild-type eases with unstable triplet expansions was also applying Hoxd13 polyalanine tract sequence to the Dyc sequence to polyalanine extensions. at microhomologies to try to reconstitute the Dyc We therefore tried to find another mechanism that expansion (Figure 2c). We could identify two micro- could lead to the Dyc expansion. Among the mecha- homology regions of 5 bp each that could have made the nisms that have kept our attention is the FosTeS replication fork skip two times forward along the wild- described by Lee et al. (2007). FosTeS was proposed to type polyalanine sequence to create the Dyc extension. explain some nonrecurrent chromosomal rearrange- We then listed the polyalanine expansions referenced in ments (duplications, deletions) causing genomic disor- the literature that could not be explained by unequal ders and that could not be explained by the usual crossing over (Table 1) and we tried the same micro- nonallelic homologous recombination (NAHR) and homology alignment method between the expanded nonhomologous end joining (NHEJ) (Shaw and alleles and their normal control alleles to determine the Lupski 2004; see Gu et al. 2008 for review of the three process of nucleotide amplification. We encounter the mechanisms). Performing a breakpoint sequence anal- same problem as Goodman et al. (1997) to interpret ysis of nonrecurrent duplications, they uncovered the 9-alanine expansion of pedigree P. This one can be complex arrays of normal, duplicated, and triplicated interpreted as either a simple reduplication of alanines sequences at the junctions of the duplications and 1–9 via the mechanism of unequal crossing over or of identified few base-pair microhomologies that could FosTeS (Figure 3) only if there is a polymorphism or a act as ‘‘bridges’’ for the DNA replication fork to skip mutation in the triplet coding for alanine 8 (GCT– along the chromosome to create these complex arrays. GCG). Both the 15-bp (15 alanines) and 18-bp (16 They proposed that the DNA fork could skip forward or alanines) insertions found in PHOX2B can be inter- backward along the chromosome using these short preted as a skipping ‘‘backward’’ of the replication fork sequence homologies when encountering a complex followed by a skipping ‘‘forward.’’ The 21-bp insertion genomic architecture or a DNA lesion. Since the prop- (17 alanines) could be interpreted as a single skipping osition of FosTeS as a mechanism to explain the non- ‘‘backward.’’However, the microhomology found is only recurrent rearrangements in PMD patients, another of a single nucleotide. The 15-alanine extension in genomic disorder has been analyzed for submicroscopic FOXL2 can be recovered by three skipping backward of rearrangements, revealing the potential role of FosTeS the replication fork along the normal polyalanine tract. in an increasing number of complex pathologic rear- Finally, the 17 alanine extension in the PABPN1 rangements (Carvalho et al. 2009). We checked if this polyalanine can be the result of a first skipping back- long-range template switching mechanism could be ward at a 2-bp homology followed directly by a second applied to the Dyc mutation and more generally to skipping backward of three nucleotides. FosTeS Mechanism Leading to Polyalanine Expansion Mutation 29

Figure 3.—Application of FosTeS to atypical polyalanine extensions. Multiple alignments of the normal human sequences of HOXD13, PHOX2B, FOXL2, and PABPN1 to the sequences with atypical polyalanine extensions (yellow) at microhomologies (red letters) that are boxed. The extended sequence in the mutants is underlined. Aligned sequences are in blue, green, and purple; nonaligned ones in gray.

Hence, FosTeS was tested on seven atypical poly- FosTeS could also be implicated in monogenic traits via alanine extensions and allowed to reconstitute the patho- very short stretches of sequence duplications reveals logic expansion for at least five of them. We therefore that a variety of genomic rearrangements ranging from propose FosTeS as an alternative mutational mechanism gross DNA changes of several kilobases or megabases to to unequal crossing over in the generation of polyala- rearrangements involving only few nucleotide expan- nine expansions. Our hypothesis is further supported by sions within single genes could originate from the same the fact that FosTeS is supposed to be engendered, or at molecular mechanism. least facilitated, by a surrounding high-order genomic architecture that contains cruciform or other non-B ee structures (L et al. 2007). Such alternative DNA LITERATURE CITED structures are facilitated by specific sequence motifs Akarsu, A. N., I. Stoilov,E.Yilmaz,B.S.Sayli and M. Sarfarazi, such as low-copy repeats (LCR), symmetrical features, 1996 Genomic structure of HOXD13 gene: a nine polyalanine and short, direct, or inverted repeats, and the poly- duplication causes synpolydactyly in two unrelated families. alanine trinucleotide repeat sequence possesses such Hum. Mol. Genet. 5: 945–952. lbrecht chwabe tricker oddrich sequence motifs and symmetry elements. Looking for A , A. N., G. C. S ,S.S ,A.B , E. E. Wanker et al., 2002 The synpolydactyly homolog (spdh) specific features flanking the breakpoints of complex mutation in the mouse: a defect in patterning and growth of limb rearrangements occurring in the MECP2 region and cartilage elements. Mech. Dev. 112: 53–67. proposed to result from FosTeS, researchers found Amiel, J., D. Trochet,M.Clement-Ziza,A.Munnich and yonnet 9 9 9 S. L , 2004 Polyalanine expansions in human. Hum. increased frequency of the sequences 5 -CTG-3 /5 - Mol. Genet. 13: R235–R243. CAG-39 (Carvalho et al. 2009). They suggest that these Arai, H., T. Otagiri,A.Sasaki,T.Hashimoto,K.Umetsu et al., motifs might represent a cis-acting sequence that may be 2007 De novo polyalanine expansion of PHOX2B in congenital a recognition site for proteins involved in priming DNA central hypoventilation syndrome: unequal sister chromatid exchange during paternal gametogenesis. J. Hum. Genet. 52: replication in eukaryotes. Interestingly, 59-CTG-39/59- 921–925. CAG-39 are motifs that are also found around the Brown, L. Y., and S. A. Brown, 2004 Alanine tracts: the expanding breakpoints in the polyalanine expansion tracts (see story of human illness and trinucleotide repeats. Trends Genet. Figures 2c and 3). 20: 51–58. Bruneau, S., K. R. Johnson,M.Yamamoto,A.Kuroiwa and Hence, after having been described as a mechanism D. Duboule, 2001 The mouse Hoxd13(spdh) mutation, a poly- for large genomic rearrangements, our findings that alanine expansion similar to human type II synpolydactyly (SPD), 30 O. Cocquempot et al.

disrupts the function but not the expression of other Hoxd Kmita, M., B. Tarchini,D.Duboule and Y. Herault, genes. Dev. Biol. 237: 345–353. 2002b Evolutionary conserved sequences are required for the Calabrese, O., S. Bigoni,F.Gualandi,C.Trabanelli,G.Camera insulation of the vertebrate Hoxd complex in neural cells. Devel- et al., 2000 A new mutation in HOXD13 associated with foot opment 129: 5521–5528. pre-postaxial polydactyly. Eur. J. Hum. Genet. 8: 140. Kmita, M., B. Tarchini,J.Zakany,M.Logan,C.J.Tabin et al., Caronia, G., F. R. Goodman,C.M.E.Mckeown,P.J.Scambler and 2005 Early developmental arrest of mammalian limbs lacking V. Zappavigna, 2003 An 147L substitution in the HOXD13 HoxA/HoxD gene function. Nature 435: 1113–1116. homeodomain causes a novel human limb malformation by Kovtun, I. V., and C. T. McMurray, 2008 Features of trinucleotide producing a selective loss of function. Development 130: repeat instability in vivo. Cell Res. 18: 198–213. 1701–1712. Kovtun, I. V., C. Spiro and C. T. McMurray, 2004 Triplet repeats Carvalho, C. M. B., F. Zhang,P.Liu,A.Patel,T.Sahoo et al., and DNA repair: germ cell and somatic cell instability in trans- 2009 Complex rearrangements in patients with duplications genic mice. Methods Mol. Biol. 277: 309–319. of MECP2 can occur by Fork Stalling and Template Switching. Kunst, C. B., and S. T. Warren, 1994 Cryptic and polar variation of Hum. Mol. Genet. 18: 2188–2203. the fragile-X repeat could result in predisposing normal alleles. Davis, A. P., and M. R. Capecchi, 1996 A mutational analysis of the Cell 77: 853–861. 59 HoxD genes: dissection of genetic interactions during limb Lavoie, H., F. Debeane,Q.D.Trinh,J.F.Turcotte,L.P.Corbeil- development in the mouse. Development 122: 1175–1185. Girard et al., 2003 Polymorphism, shared functions and De Baere, E., D. Beysen,C.Oley,B.Lorenz,J.Cocquet et al., convergent evolution of genes with sequences coding for polya- 2003 FOXL2 and BPES: mutational hotspots, phenotypic vari- lanine domains. Hum. Mol. Genet. 12: 2967–2979. ability, and revision of the genotype-phenotype correlation. Am. Lee, J. A., C. M. B. Carvalho and J. R. Lupski, 2007 A DNA repli- J. Hum. Genet. 72: 478–487. cation mechanism for generating nonrecurrent rearrangements Deschamps, J., and J. Van Nes, 2005 Developmental regulation of associated with genomic disorders. Cell 131: 1235–1247. the Hox genes during axial morphogenesis in the mouse. Devel- Moens, C. B., and L. Selleri, 2006 Hox cofactors in vertebrate opment 132: 2931–2942. development. Dev. Biol. 291: 193–206. Dolle, P., A. Dierich,M.Lemeur,T.Schimmang,B.Schuhbaur Muragaki, Y., S. Mundlos,J.Upton and B. R. Olsen, 1996 Altered et al., 1993 Disruption of the Hoxd-13 gene induces localized growth and branching patterns in synpolydactyly caused by heterochrony leading to mice with neotenic limbs. Cell 75: mutations in HOXD13. Science 272: 548–551. 431–441. Pearson, C. E., K. N. Edamura and J. D. C leary, 2005 Repeat Eichler, E. E., J. J. A. Holden,B.W.Popovich,A.L.Reiss,K.Snow instability: mechanisms of dynamic mutations. Nat. Rev. Genet. et al., 1994 Length of Uninterrupted Cgg repeats determines 6: 729–742. instability in the Fmr1 gene. Nat. Genet. 8: 88–94. Robinson, D. O., S. R. Hammans,S.P.Read and J. Sillibourne, Gavalas, A., C. Ruhrberg,J.Livet,C.E.Henderson and 2005 Oculopharyngeal muscular dystrophy (OPMD): analysis R. Krumlauf, 2003 Neuronal defects in the hindbrain of of the PABPN1 gene expansion sequence in 86 patients reveals Hoxa1, Hoxb1 and Hoxb2 mutants reﬂect regulatory interac- 13 different expansion types and further evidence for unequal tions among these Hox genes. Development 130: 5663–5679. recombination as the mutational mechanism. Hum. Genet. Goodman, F., M. L. Giovannucci-Uzielli,C.Hall,W.Reardon, 116: 267–271. R. Winter et al., 1998 Deletions in HOXD13 segregate with Shaw, C. J., and J. R. Lupski, 2004 Implications of human genome an identical, novel foot malformation in two unrelated families. architecture for rearrangement-based disorders: the genomic Am. J. Hum. Genet. 63: 992–1000. basis of disease. Hum. Mol. Genet. 13: R57–R64. Goodman, F. R., 2002 Limb malformations and the human HOX Sinden, R. R., V. N. Potaman,E.A.Oussatcheva,C.E.Pearson, genes. Am. J. Med. Genet. 112: 256–265. Y. L. Lyubchenko et al., 2002 Triplet repeat DNA structures Goodman, F. R., S. Mundlos,Y.Muragaki,D.Donnai,M.L. and human genetic disease: dynamic mutations from dynamic Giovannucciuzielli et al., 1997 Synpolydactyly phenotypes DNA. J. Biosci. 27: 53–65. correlate with size of expansions in HOXD13 polyalanine tract. Trochet, D., S. J. Hong,J.K.Lim,J.F.Brunet,A.Munnich et al., Proc. Natl. Acad. Sci. USA 94: 7458–7463. 2005 Molecular consequences of PHOX2B missense, frame- Goodman, F. R., C. Bacchelli,A.F.Brady,L.A.Brueton, shift and alanine expansion mutations leading to autonomic J. P. Fryns et al., 2000 Novel HOXA13 mutations and the phe- dysfunction. Hum. Mol. Genet. 14: 3697–3708. notypic spectrum of hand-foot-genital syndrome. Am. J. Hum. Trochet, D., L. De Pontual,B.Keren,A.Munnich,M.Vekemans Genet. 67: 197–202. et al., 2007 Polyalanline expansions might not result from Gu, W., F. Zhang and J. R. Lupski, 2008 Mechanisms for human unequal crossing-over. Hum. Mutat. 28: 1043–1044. genomic rearrangements. Pathogenetics 1: 4. Warot, X., C. Fromental-Ramain,V.Fraulob,P.Chambon and Herault, Y., M. Rassoulzadegan,F.Cuzin and D. Duboule, P. Dolle, 1997 Gene dosage-dependent effects of the Hoxa- 1998 Engineering chromosomes in mice through targeted mei- 13 and Hoxd-13 mutations on morphogenesis of the terminal otic recombination (TAMERE). Nat. Genet. 20: 381–384. parts of the digestive and urogenital tracts. Development 124: Horsnell, K., M. Ali,S.Malik,L.Wilson,C.Hall et al., 4781–4791. 2006 Clinical phenotype associated with homozygosity for a Warren, S. T., 1997 Polyalanine expansion in synpolydactyly might HOXD13 7-residue polyalanine tract expansion. Eur. J. Med. result from unequal crossing-over of HOXD13. Science 275: Genet. 49: 396–401. 408–409. Johnson, K. R., H. O. Sweet,L.R.Donahue,P.Ward-Bailey, Yucel, A., I. Kuru,M.E.Bozan,M.Acar and M. Solak, R. T. Bronson et al., 1998 A new spontaneous mouse mutation 2005 Radiographic evaluation and unusual bone formations of Hoxd13 with a polyalanine expansion and phenotype similar in different genetic patterns in synpolydactyly. Skeletol Radiol. to human synpolydactyly. Hum. Mol. Genet. 7: 1033–1038. 34: 468–476. Kaplan, S., S. Itzkovitz and E. Shapiro, 2007 A universal mecha- Zakany, J., and D. Duboule, 1996 Synpolydactyly in mice with a nism ties genotype to phenotype in trinucleotide diseases. PloS targeted deﬁciency in the HoxD complex. Nature 384: 69–71. Comp. Biol. 3: 2291–2298. Zakany, J., C. Fromentalramain,X.Warot and D. Duboule, Karlin, S., L. Brocchieri,A.Bergman,J.Mrazek and A. J. Gentles, 1997 Regulation of number and size of digits by posterior 2002 Amino acid runs in eukaryotic proteomes and disease Hox genes: a dose-dependent mechanism with potential associations. Proc. Natl. Acad. Sci. USA 99: 333–338. evolutionary implications. Proc. Natl. Acad. Sci. USA 94: Kmita, M., and D. Duboule, 2003 Organizing axes in time and 13695–13700. space; 25 years of colinear tinkering. Science 301: 331–333. Kmita, M., N. Fraudeau,Y.Herault and D. Duboule, 2002a Serial deletions and duplications suggest a mechanism for the collin- earity of Hoxd genes in limbs. Nature 420: 145–150. Communicating editor: N. Arnheim

Supporting Information http://www.genetics.org/cgi/content/full/genetics.109.104695/DC1

Fork Stalling and Template Switching as a Mechanism for Polyalanine Tract Expansion Affecting the DYC Mutant of HOXD13, a New Murine Model of Synpolydactyly

Olivier Cocquempot, Véronique Brault, Charles Babinet and Yann Herault

2 SI O. Cocquempot et al.

FIGURE S1.—Autopod development in wild-type and Dyc/Dyc mutant mice. In each panel, a wild-type paw (left) is compared to Dyc/Dyc one (right). (a ) At 14.5 dpc, wild-type autopods have well individualized fingers with visible cartilaginous elements at the level of the carpus metacarpus, tarsi and metatarsi, whereas Dyc/Dyc autopod development is delayed: cartilaginous blastema have only formed in the first phalanx and are not visible in the more distal parts of the future digits that are shorter. (b)At 15.5 dpc, of the cartilaginous elements are visible in both wild-type and mutant autopods, but the digits in Dyc/Dyc embryos reveals shortened and supernumerary digits (6+7) with deformation at the level of the metatarsus and metacarpus. (c) Alizarin red staining of the skeleton at 0.5 dpp shows ossification centres in all wild-type digits but not in Dyc/Dyc mutant forelimbs. In the anterior limbs polydactily is accompanied by syndactily of digits 2, 3, 4 and 5, 6. In posterior limbs, there is also polydactily with syndactily of digits 2, 3 and 4, 5. At 4.5 dpp, ossification of the phalanx is completed in wild-type autopods. In Dyc/Dyc autopods, some ossification has occurred, but localisation of the ossifications centres is not clearly defined and there are defects in segmentation of the finger elements, making it hard to distinguish metacarpus and phalanx. O. Cocquempot et al. 3 SI

FIGURE S2.—Expression of Hox genes in wild-type and homozygous (Dyc/Dyc) forelimbs at 12.5 dpc. Whole-mount in situ hybridization of Hoxd10, Hoxd11, Hoxd12, Hoxd13 and Hoxa13 probes indicates that there is no difference in expression profiles of theses genes between wild type and homozygote.