DOCSLIB.ORG

Supporting Information

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supporting Information Supporting Information Markmiller et al. 10.1073/pnas.1305536111 SI Methods WIK, used in positional cloning as a polymorphic reference Primer and Probe Sequences. Primer sequences are as follows (5′–3′): strain to Tü/TL. The following transgenic lines of zebrafish s854 s854 Full-length rnpc3 [RNA-binding region (RNP1, RRM) containing 3] were used: Tg(gutGFP) , also known as Tg(Xla.Eef1a1:GFP) , coding sequence: forward ATGGCGGAGACGGACGAG and expressing GFP in the endoderm-derived tissues of the developing gz12 reverse CACTTCAGTGTTTTCTCCCTCCTTTC; clbns846 gen- gut, liver, and pancreas. Tg(fabp10:dsRed, ela3l:GFP) ,also otyping: forward AGCAAAGGATACCACCACCA and reverse known as 2CLIP (2-color liver pancreas), expressing dsRed in AAGGCGAGCTCTTTATGAACG; clbnZM genotyping: forward the liver and GFP in the exocrine pancreas. GACGCAGGCGCATAAAATCAGTC and reverse AGGCGTT- Microinjections of Embryos. Fertilized one- to two-cell stage embryos CGTAATGTTCAGG; whole-mount in situ hybridization (WISH) ∼ probe 1 (599 bp): forward TAATACGACTCACTATAGGGTA- were injected under a Leica MZ6 stereomicroscope with 2nLof CGAACCCGGAGAACCAAC and reverse AATTAACCCTCA- injection solution at the indicated concentrations using a mi- CTAAAGGGAACCAGGGCAGTCTGCAATAA (boldface letters croinjection apparatus (Narishige) and a micromanipulator correspond to T7 and T3 binding sequences, respectively); WISH (Narishige). For mRNA and minigene injections, the needle was probe 2 (790 bp): forward AATTAACCCTCACTAAAGGGCTG- positioned in the area of embryonic streaming from the yolk cell CCGTAGCCGAAA and reverse TAATACGACTCACTATAGG- to the fertilized blastocyst. Trace amounts of Phenol red were GGACCTGAGCGCTTG (boldface letters correspond to T3 and added to injection solutions as a visible tracer and rhodamine T7 binding sequences, respectively); sms U12in6_7: forward dextran was added to nonfluorescent injection solutions as a GCAGCGGCAAAGAGCACTATGCTG and reverse AATC- fluorescent tracer. CTTACCTCGTAACAATCTCC; mapk3 U12in2_3: forward Genotyping. Genomic DNA from single zebrafish embryos or adult AGACCTACTGCCAGCGCACCCTG and reverse AGCCCT- fin clips was extracted by incubation at 95 °C for 20 min in 100 μL CGCAGGATCTGATACAG; mapk12 U12in8_9: forward GA- of 50 mM sodium hydroxide (NaOH) using a thermocycler, CATCTGGTCAGTCGGGTGCATC and reverse TCTTCAG- followed by neutralization with 10 μLof1MTris·HCl (pH ACTGTAGCTTGGCTGTG; mapk12 U2in3_4: forward GTT- ZM 8.0). For clbn genotyping, 35 PCR cycles of 30 s at 95 °C, ATCGGACTTGTGGATGTGTTC and reverse CATCTGAT- s846 30 s at 58 °C, and 1 min at 72 °C were performed. For clbn , AGACCAGATACTGCAC; snrpe U12in1_2: forward CGTCA- allele-specific PCR was performed using the same conditions TTCTGTTTCCGGATT and reverse CAACCCTCTATCCG- as previously described (1). CATGTT; ppp2r2a U12in7_8: forward CCTATGGATCTCA- TGGTGGAG and reverse TGCTTGTCACAAAGTGCTGA; Histology. Larvae for histology or immunohistochemistry were fkbp3 U12in2_3: forward AGGGTCTGCTGACGATGAGT and fixedinBouin’s fixative overnight at 4 °C. After fixation, larvae reverse CAGGGTTTGTCTTATTTATTGTCG; U11 snRNA were rinsed three times with PBS containing 0.1% (vol/vol) northern: forward GCATCTGCTGTGAATAGCGTA and reverse Tween 20 (PBST) to remove residual fixative, and stored at 4 °C GAGGCACCAAGATAACAGATCA; U12 snRNA northern: for no more than 48 h. Larvae were aligned and embedded in forward TGCCTTAAACTGATGAGTAAGGAAAA and re- disposable plastic Tissue-Tek cryomolds (ProSciTech) in 1% low verse CGCGGCATCTCGCTAAAGTA; U5 snRNA northern: melting temperature agarose (SeaKem LE Agarose, Lonza) and forward TGTTTCTCTTCATATCGAATAAGTC and reverse stored in 70% (vol/vol) ethanol (EtOH). The blocks of larvae AAAATTAGTAAATACTCAAGGTGTTCC; U6atac snRNA were dehydrated through an ethanol series to 100%, embedded northern: forward CTGTTGTTTGAGAGGAGAGAAGGT and in paraffin and cut into 5-μm-thin sections, which were then reverse AAACCACCCCGATCATGG. U11 snRNA quantitative stainedwithH&E. RT-PCR (RT-qPCR): forward GCTGTGGAAGGGATTCTCT- GA and reverse TGGGGCGCCAAGACCAAC; U12 snRNA Microscopy. Brightfield and epifluorescence images were captured RT-qPCR: forward TGCCTTAAACTGATGAGTAAGGAAAA using a Leica MZ FLIII fluorescence microscope equipped with and reverse CGCGGCATCTCGCTAAAGTA; U2 snRNA an Olympus DP70 camera and Olympus DP controller software. RT-qPCR: forward CTCGGCCTTTTGGCTAAGAT and re- Live or fixed larvae were placed in 2% methyl cellulose to prevent verse TACTGCAATACCGGGTCGAT; U4atac snRNA RT- them from moving during image acquisition. Images were im- qPCR: forward CTTCCTTGTCTGGGGGTGGTT and reverse ported into ImageJ (National Institutes of Health) for image pro- GGTGTTAGCAGGGATGTTCTCAGTTA; elongation factor α cessing and CorelDRAW for figure preparation. For two-photon [elfa]: forward CTTCTCAGGCTGACTGTGC and reverse CC- microscopy, WT and clbns846 mutant larvae on the Tg(gutGFP)s854 GCTAGCATTACCCTCC; cyclin G1: forward GTGCGGAGA- background were fixed briefly in 2% (wt/vol) PFA/PBST to CGTTTTCTTT and reverse AAGACAGATGCTTGGGCTGA; preserve endogenous GFP fluorescence. Whole larvae were p53: forward TCCACTCTCCCACCAACATC and reverse GGG- embedded in 2% (wt/vol) low-melting temperature agarose AACCTGAGCCTAAATCC; Δ113p53: forward ATATCCTGGC- for imaging. Imaging was performed on an Olympus FV1000 GAACATTTGG and reverse ACGTCCACCACCATTTGAAC. Confocal Microscope (BX61W upright) using a 20× XLUM- PlanFL NA0.95 objective and Olympus FV-10ASW v1.7c software. Zebrafish Husbandry and Strains. Animals were maintained at 28 °C Multiphoton excitation was provided by a Spectra Physics MaiTai on a 12 h-light/dark cycle under the standard zebrafish hus- DeepSee LD Ti:Sapphire Laser. Excitation wavelengths used bandry procedures of the Ludwig Institute for Cancer Research/ were 920 nm for GFP and 750 for autofluorescence of internal Walter and Eliza Hall Institute of Medical Research Zebrafish structures of zebrafish larvae, both were detected with a 490- to Facility. A commercial strain harboring an independent mutation 540-nm band-pass filter (Olympus Model FV10MPMG/R). in rnpc3 (clbnZM) was purchased from Znomics (this company terminated operations in 2009). The following WT strains of WISH. Zebrafish embryos and larvae were processed for WISH, as zebrafish were used: Tübingen/Tübingen long fin (Tü/TL), used described previously (2). To generate rnpc3 riboprobes, a cDNA to propogate the clbns846 mutant strain and for positional cloning; template was amplified by RT-PCR. For primer sequences see Markmiller et al. www.pnas.org/cgi/content/short/1305536111 1of12 Primer and Probe Sequences above. Antisense and sense probes TL software was used to quantify full-length signals for U11 or were then transcribed using the digoxigenin DNA Labeling Kit U12. Background was subtracted manually for each lane, and in (Roche Diagnostics) according to the manufacturer’s instruc- those lanes with >2× signal, background was expressed as a per- tions. Hybridized riboprobes were detected using an anti-DIG centage of the lane with the greatest signal intensity in a single antibody conjugated to alkaline phosphatase according to the gradient. Normalized intensities of bands across 24 fractions manufacturer’s instructions (Roche Diagnostics). Larvae were (fraction nos. 4–27) were plotted in Excel vs. fraction number. imaged on a Nikon SMZ 1500 microscope. Experimental Design for Microarray and RNAseq. Gene-expression Minigene Assay. A minigene spanning the U2-type intron 13, the data were obtained from two independent platforms, using DNA U12-type intron 14, and flanking exons, was amplified from WT microarrays as well as RNA sequencing of poly-A enriched RNA and clbns846 genomic DNA using primers carrying 5′ tails (23 bp) from clbns846 whole larvae. This approach combines advantages to allow specific amplification of the exogenous transgene after of both technologies (i.e., well-established experimental and injection into zebrafish embryos. WT and mutant minigenes were analysis procedures for microarrays and the independence of confirmed by sequencing to differ only in the T→Amutation RNAseq from a priori knowledge of the zebrafish transcriptome) observed in clbns846. but takes into account the cost of RNAseq experiments as well as limitations on microarray content imposed by incomplete Preparation of Larval Extracts for snRNP Analyses. Mutants were annotation of the zebrafish genome. For microarrays, three in- sorted based on phenotype at 150 h postfertilization (hpf) and ∼100 dependent biological replicates consisting of ∼20 pooled genotyped + + larvae each of WT and clbnZM were used per glycerol gradient ex- clbns846/s846 and clbn / larvae each were analyzed on the Agilent periment. Larvae were killed in benzocaine, rinsed several times in Zebrafish V2 gene expression platform. Biological replicates ice cold buffer G, and transferred into 1.5-mL microcentrifuge tubes. were then pooled and one single sequencing library each was Tubes were centrifuged for 1 min at 16,000 × g at 4 °C and buffer constructed for mutant and WT samples, respectively, allowing G removed completely, leaving a larval pellet. Larvae were then them to be sequenced on a single slide in the same sequencing resuspended in 4 volumes (microliter per larva) of buffer G con- run. Although the lack of technical or biological replicates in taining 8% (vol/vol) glycerol, 1 mM DTT, 0.5 mM PMSF, and 0.02% RNAseq data limits the statistical power of the analysis, the Nonidet P-40. Larvae were homogenized using a 1-mL dounce ho- experimental design still allows
Load more

Recommended publications
  • The Function and Evolution of C2H2 Zinc Finger Proteins and Transposons
    The function and evolution of C2H2 zinc finger proteins and transposons by Laura Francesca Campitelli A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Molecular Genetics University of Toronto © Copyright by Laura Francesca Campitelli 2020 The function and evolution of C2H2 zinc finger proteins and transposons Laura Francesca Campitelli Doctor of Philosophy Department of Molecular Genetics University of Toronto 2020 Abstract Transcription factors (TFs) confer specificity to transcriptional regulation by binding specific DNA sequences and ultimately affecting the ability of RNA polymerase to transcribe a locus. The C2H2 zinc finger proteins (C2H2 ZFPs) are a TF class with the unique ability to diversify their DNA-binding specificities in a short evolutionary time. C2H2 ZFPs comprise the largest class of TFs in Mammalian genomes, including nearly half of all Human TFs (747/1,639). Positive selection on the DNA-binding specificities of C2H2 ZFPs is explained by an evolutionary arms race with endogenous retroelements (EREs; copy-and-paste transposable elements), where the C2H2 ZFPs containing a KRAB repressor domain (KZFPs; 344/747 Human C2H2 ZFPs) are thought to diversify to bind new EREs and repress deleterious transposition events. However, evidence of the gain and loss of KZFP binding sites on the ERE sequence is sparse due to poor resolution of ERE sequence evolution, despite the recent publication of binding preferences for 242/344 Human KZFPs. The goal of my doctoral work has been to characterize the Human C2H2 ZFPs, with specific interest in their evolutionary history, functional diversity, and coevolution with LINE EREs.
    [Show full text]
  • Investigation of Differentially Expressed Genes in Nasopharyngeal Carcinoma by Integrated Bioinformatics Analysis
    916 ONCOLOGY LETTERS 18: 916-926, 2019 Investigation of differentially expressed genes in nasopharyngeal carcinoma by integrated bioinformatics analysis ZhENNING ZOU1*, SIYUAN GAN1*, ShUGUANG LIU2, RUjIA LI1 and jIAN hUANG1 1Department of Pathology, Guangdong Medical University, Zhanjiang, Guangdong 524023; 2Department of Pathology, The Eighth Affiliated hospital of Sun Yat‑sen University, Shenzhen, Guangdong 518033, P.R. China Received October 9, 2018; Accepted April 10, 2019 DOI: 10.3892/ol.2019.10382 Abstract. Nasopharyngeal carcinoma (NPC) is a common topoisomerase 2α and TPX2 microtubule nucleation factor), malignancy of the head and neck. The aim of the present study 8 modules, and 14 TFs were identified. Modules analysis was to conduct an integrated bioinformatics analysis of differ- revealed that cyclin-dependent kinase 1 and exportin 1 were entially expressed genes (DEGs) and to explore the molecular involved in the pathway of Epstein‑Barr virus infection. In mechanisms of NPC. Two profiling datasets, GSE12452 and summary, the hub genes, key modules and TFs identified in GSE34573, were downloaded from the Gene Expression this study may promote our understanding of the pathogenesis Omnibus database and included 44 NPC specimens and of NPC and require further in-depth investigation. 13 normal nasopharyngeal tissues. R software was used to identify the DEGs between NPC and normal nasopharyngeal Introduction tissues. Distributions of DEGs in chromosomes were explored based on the annotation file and the CYTOBAND database Nasopharyngeal carcinoma (NPC) is a common malignancy of DAVID. Gene ontology (GO) and Kyoto Encyclopedia of occurring in the head and neck. It is prevalent in the eastern Genes and Genomes (KEGG) pathway enrichment analysis and southeastern parts of Asia, especially in southern China, were applied.
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]
  • Based on Network Pharmacology and RNA Sequencing Techniques to Explore the Molecular Mechanism of Huatan Jiangzhuo Decoction for Treating Hyperlipidemia
    Hindawi Evidence-Based Complementary and Alternative Medicine Volume 2021, Article ID 9863714, 16 pages https://doi.org/10.1155/2021/9863714 Research Article Based on Network Pharmacology and RNA Sequencing Techniques to Explore the Molecular Mechanism of Huatan Jiangzhuo Decoction for Treating Hyperlipidemia XiaowenZhou ,1 ZhenqianYan ,1 YaxinWang ,1 QiRen ,1 XiaoqiLiu ,2 GeFang ,3 Bin Wang ,4 and Xiantao Li 1 1Laboratory of TCM Syndrome Essence and Objectification, School of Basic Medical Sciences, Guangzhou University of Chinese Medicine, Guangzhou 510006, China 2Guangzhou Sagene Tech Co., Ltd., Guangzhou 510006, China 3College of Traditional Chinese Medicine, Hunan University of Chinese Medicine, Changsha 410208, China 4Shenzhen Traditional Chinese Medicine Hospital, Shenzhen 518000, China Correspondence should be addressed to Xiantao Li; [email protected] Received 22 May 2020; Revised 12 March 2021; Accepted 18 March 2021; Published 12 April 2021 Academic Editor: Jianbo Wan Copyright © 2021 Xiaowen Zhou et al. +is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Background. Hyperlipidemia, due to the practice of unhealthy lifestyles of modern people, has been a disturbance to a large portion of population worldwide. Recently, several scholars have turned their attention to Chinese medicine (CM) to seek out a lipid-lowering approach with high efficiency and low toxicity. +is study aimed to explore the mechanism of Huatan Jiangzhuo decoction (HTJZD, a prescription of CM) in the treatment of hyperlipidemia and to determine the major regulation pathways and potential key targets involved in the treatment process.
    [Show full text]
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
    [Show full text]
  • Identification of Proteins Involved in the Maintenance of Genome Stability
    Identification of Proteins Involved in the Maintenance of Genome Stability by Edith Hang Yu Cheng A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Biochemistry University of Toronto ©Copyright by Edith Cheng2015 Identification of Proteins Involved in the Maintenance of Genome Stability Edith Cheng Doctor of Philosophy Department of Biochemistry University of Toronto 2015 Abstract Aberrant changes to the genome structure underlie numerous human diseases such as cancers. The functional characterization ofgenesand proteins that maintain chromosome stability will be important in understanding disease etiology and developing therapeutics. I took a multi-faceted approach to identify and characterize genes involved in the maintenance of genome stability. As biological pathways involved in genome maintenance are highly conserved in evolution, results from model organisms can greatly facilitate functional discovery in humans. In S. cerevisiae, I identified 47 essential gene depletions with elevated levels of spontaneous DNA damage foci and 92 depletions that caused elevated levels of chromosome rearrangements. Of these, a core subset of 15 DNA replication genes demonstrated both phenotypes when depleted. Analysis of rearrangement breakpoints revealed enrichment at yeast fragile sites, Ty retrotransposons, early origins of replication and replication termination sites. Together, thishighlighted the integral role of DNA replicationin genome maintenance. In light of my findings in S. cerevisiae, I identified a list of 153 human proteins that interact with the nascentDNA at replication forks, using a DNA pull down strategy (iPOND) in human cell lines. As a complementary approach for identifying human proteins involved in genome ii maintenance, I usedthe BioID techniqueto discernin vivo proteins proximal to the human BLM- TOP3A-RMI1-RMI2 genome stability complex, which has an emerging role in DNA replication progression.
    [Show full text]
  • Human Transcription Factors Responsive to Initial Reprogramming Predominantly Undergo Legitimate Reprogramming During Fbroblast Conversion to Ipscs Ricardo R
    www.nature.com/scientificreports OPEN Human transcription factors responsive to initial reprogramming predominantly undergo legitimate reprogramming during fbroblast conversion to iPSCs Ricardo R. Cevallos1, Yvonne J. K. Edwards1,2, John M. Parant3, Bradley K. Yoder2 & Kejin Hu1* The four transcription factors OCT4, SOX2, KLF4, and MYC (OSKM) together can convert human fbroblasts to induced pluripotent stem cells (iPSCs). It is, however, perplexing that they can do so only for a rare population of the starting cells with a long latency. Transcription factors (TFs) defne identities of both the starting fbroblasts and the end product, iPSCs, and are also of paramount importance for the reprogramming process. It is critical to upregulate or activate the iPSC-enriched TFs while downregulate or silence the fbroblast-enriched TFs. This report explores the initial TF responses to OSKM as the molecular underpinnings for both the potency aspects and the limitation sides of the OSKM reprogramming. The authors frst defned the TF reprogramome, i.e., the full complement of TFs to be reprogrammed. Most TFs were resistant to OSKM reprogramming at the initial stages, an observation consistent with the inefciency and long latency of iPSC reprogramming. Surprisingly, the current analyses also revealed that most of the TFs (at least 83 genes) that did respond to OSKM induction underwent legitimate reprogramming. The initial legitimate transcriptional responses of TFs to OSKM reprogramming were also observed in the reprogramming fbroblasts from a diferent individual. Such early biased legitimate reprogramming of the responsive TFs aligns well with the robustness aspect of the otherwise inefcient and stochastic OSKM reprogramming. OCT4, SOX2, KLF4, and MYC (collectively OSKM) can convert human fbroblasts into induced pluripotent stem cells (iPSCs), which are the man-made version of embryonic stem cells (ESCs)1–3.
    [Show full text]
  • Seh1 Targets GATOR2 and Nup153 to Mitotic Chromosomes Melpomeni Platani1,*, Itaru Samejima1, Kumiko Samejima1, Masato T
    © 2018. Published by The Company of Biologists Ltd | Journal of Cell Science (2018) 131, jcs213140. doi:10.1242/jcs.213140 RESEARCH ARTICLE Seh1 targets GATOR2 and Nup153 to mitotic chromosomes Melpomeni Platani1,*, Itaru Samejima1, Kumiko Samejima1, Masato T. Kanemaki2 and William C. Earnshaw1,* ABSTRACT Nup107 complex (also known as the Y complex), a core structural In metazoa, the Nup107 complex (also known as the nucleoporin scaffold of nuclear pores in interphase located on both faces of the Y-complex) plays a major role in formation of the nuclear pore NPC. In vertebrates, the Nup107 complex is composed of ten complex in interphase and is localised to kinetochores in mitosis. The different nucleoporins: Nup160, Nup133, Nup107, Nup96, Nup85, Nup107 complex shares a single highly conserved subunit, Seh1 Nup43, Nup37, Sec13, Seh1 (also known as SEH1L) and Elys (also (also known as SEH1L in mammals) with the GATOR2 complex, an known as AHCTF1) (Knockenhauer and Schwartz, 2016). The essential activator of mTORC1 kinase. mTORC1/GATOR2 has a Nup107 complex plays a crucial role in NPC assembly, mRNA central role in the coordination of cell growth and proliferation. Here, export and cell differentiation (González-Aguilera and Askjaer, 2012; we use chemical genetics and quantitative chromosome proteomics Harel et al., 2003; Vasu et al., 2001; Walther et al., 2003). Nup107 to study the role of the Seh1 protein in mitosis. Surprisingly, Seh1 is complex components remain associated together throughout mitosis not required for the association of the Nup107 complex with mitotic and are among the earliest nucleoporins recruited onto chromatin chromosomes, but it is essential for the association of both during nuclear envelope reformation at the end of cell division the GATOR2 complex and nucleoporin Nup153 with mitotic (Belgareh et al., 2001).
    [Show full text]
  • Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors
    University of Cincinnati Date: 12/20/2010 I, Arturo R Maldonado , hereby submit this original work as part of the requirements for the degree of Doctor of Philosophy in Developmental Biology. It is entitled: Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors Student's name: Arturo R Maldonado This work and its defense approved by: Committee chair: Jeffrey Whitsett Committee member: Timothy Crombleholme, MD Committee member: Dan Wiginton, PhD Committee member: Rhonda Cardin, PhD Committee member: Tim Cripe 1297 Last Printed:1/11/2011 Document Of Defense Form Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors A dissertation submitted to the Graduate School of the University of Cincinnati College of Medicine in partial fulfillment of the requirements for the degree of DOCTORATE OF PHILOSOPHY (PH.D.) in the Division of Molecular & Developmental Biology 2010 By Arturo Rafael Maldonado B.A., University of Miami, Coral Gables, Florida June 1993 M.D., New Jersey Medical School, Newark, New Jersey June 1999 Committee Chair: Jeffrey A. Whitsett, M.D. Advisor: Timothy M. Crombleholme, M.D. Timothy P. Cripe, M.D. Ph.D. Dan Wiginton, Ph.D. Rhonda D. Cardin, Ph.D. ABSTRACT Since 1999, cancer has surpassed heart disease as the number one cause of death in the US for people under the age of 85. Malignant Peripheral Nerve Sheath Tumor (MPNST), a common malignancy in patients with Neurofibromatosis, and colorectal cancer are midkine- producing tumors with high mortality rates. In vitro and preclinical xenograft models of MPNST were utilized in this dissertation to study the role of midkine (MDK), a tumor-specific gene over- expressed in these tumors and to test the efficacy of a MDK-transcriptionally targeted oncolytic HSV-1 (oHSV).
    [Show full text]
  • 393LN V 393P 344SQ V 393P Probe Set Entrez Gene
    393LN v 393P 344SQ v 393P Entrez fold fold probe set Gene Gene Symbol Gene cluster Gene Title p-value change p-value change chemokine (C-C motif) ligand 21b /// chemokine (C-C motif) ligand 21a /// chemokine (C-C motif) ligand 21c 1419426_s_at 18829 /// Ccl21b /// Ccl2 1 - up 393 LN only (leucine) 0.0047 9.199837 0.45212 6.847887 nuclear factor of activated T-cells, cytoplasmic, calcineurin- 1447085_s_at 18018 Nfatc1 1 - up 393 LN only dependent 1 0.009048 12.065 0.13718 4.81 RIKEN cDNA 1453647_at 78668 9530059J11Rik1 - up 393 LN only 9530059J11 gene 0.002208 5.482897 0.27642 3.45171 transient receptor potential cation channel, subfamily 1457164_at 277328 Trpa1 1 - up 393 LN only A, member 1 0.000111 9.180344 0.01771 3.048114 regulating synaptic membrane 1422809_at 116838 Rims2 1 - up 393 LN only exocytosis 2 0.001891 8.560424 0.13159 2.980501 glial cell line derived neurotrophic factor family receptor alpha 1433716_x_at 14586 Gfra2 1 - up 393 LN only 2 0.006868 30.88736 0.01066 2.811211 1446936_at --- --- 1 - up 393 LN only --- 0.007695 6.373955 0.11733 2.480287 zinc finger protein 1438742_at 320683 Zfp629 1 - up 393 LN only 629 0.002644 5.231855 0.38124 2.377016 phospholipase A2, 1426019_at 18786 Plaa 1 - up 393 LN only activating protein 0.008657 6.2364 0.12336 2.262117 1445314_at 14009 Etv1 1 - up 393 LN only ets variant gene 1 0.007224 3.643646 0.36434 2.01989 ciliary rootlet coiled- 1427338_at 230872 Crocc 1 - up 393 LN only coil, rootletin 0.002482 7.783242 0.49977 1.794171 expressed sequence 1436585_at 99463 BB182297 1 - up 393
    [Show full text]
  • Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Fall 2010 Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Renuka Nayak University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Computational Biology Commons, and the Genomics Commons Recommended Citation Nayak, Renuka, "Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress" (2010). Publicly Accessible Penn Dissertations. 1559. https://repository.upenn.edu/edissertations/1559 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1559 For more information, please contact [email protected]. Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Abstract Genes interact in networks to orchestrate cellular processes. Here, we used coexpression networks based on natural variation in gene expression to study the functions and interactions of human genes. We asked how these networks change in response to stress. First, we studied human coexpression networks at baseline. We constructed networks by identifying correlations in expression levels of 8.9 million gene pairs in immortalized B cells from 295 individuals comprising three independent samples. The resulting networks allowed us to infer interactions between biological processes. We used the network to predict the functions of poorly-characterized human genes, and provided some experimental support. Examining genes implicated in disease, we found that IFIH1, a diabetes susceptibility gene, interacts with YES1, which affects glucose transport. Genes predisposing to the same diseases are clustered non-randomly in the network, suggesting that the network may be used to identify candidate genes that influence disease susceptibility.
    [Show full text]
  • Identification and Characterization Of
    IDENTIFICATION AND CHARACTERIZATION OF DEAFNESS GENES IN DROSOPHILA MELANOGASTER Dissertation for the award of the degree “Doctor rerum naturalium” Division of Mathematics and Natural Sciences of the Georg-August-Universität Göttingen submitted by Pingkalai Senthilan from Inuvil, Sri Lanka Göttingen 2010 Page 1 Members of the Thesis Committee Prof. Dr. Martin Göpfert (Supervisor) Georg-August-University Göttingen, Cellular Neurobiology Prof. Dr. André Fiala (Reviewer) Georg-August-University Göttingen, Molecular Neurobiology of Behavior Prof. Dr. Ralf Heinrich (Reviewer) Georg-August-University, Neurobiology Oral examination: 24.01.2011 Page 2 I herewith declare that the Ph.D. thesis entitled “Identification and Characterization of Deafness Genes in Drosophila melanogaster” has been written independently and with no other sources and aids than quoted. Pingkalai Senthilan Göttingen, December 2010 Page 3 Page 4 Table of Contents 1 Summary ......................................................................................................................................... 9 2 Introduction ................................................................................................................................... 11 2.1 Hearing impairment .............................................................................................................. 11 2.2 Genes involved in human hearing impairment ..................................................................... 12 2.3 Drosophila as a model organism for the study of hearing ...................................................
    [Show full text]