Supporting Information Markmiller et al. 10.1073/pnas.1305536111 SI Methods WIK, used in positional cloning as a polymorphic reference Primer and Probe Sequences. Primer sequences are as follows (5′–3′): strain to Tü/TL. The following transgenic lines of zebrafish s854 s854 Full-length rnpc3 [RNA-binding region (RNP1, RRM) containing 3] were used: Tg(gutGFP) , also known as Tg(Xla.Eef1a1:GFP) , coding sequence: forward ATGGCGGAGACGGACGAG and expressing GFP in the endoderm-derived tissues of the developing gz12 reverse CACTTCAGTGTTTTCTCCCTCCTTTC; clbns846 gen- gut, liver, and pancreas. Tg(fabp10:dsRed, ela3l:GFP) ,also otyping: forward AGCAAAGGATACCACCACCA and reverse known as 2CLIP (2-color liver pancreas), expressing dsRed in AAGGCGAGCTCTTTATGAACG; clbnZM genotyping: forward the liver and GFP in the exocrine pancreas. GACGCAGGCGCATAAAATCAGTC and reverse AGGCGTT- Microinjections of Embryos. Fertilized one- to two-cell stage embryos CGTAATGTTCAGG; whole-mount in situ hybridization (WISH) ∼ probe 1 (599 bp): forward TAATACGACTCACTATAGGGTA- were injected under a Leica MZ6 stereomicroscope with 2nLof CGAACCCGGAGAACCAAC and reverse AATTAACCCTCA- injection solution at the indicated concentrations using a mi- CTAAAGGGAACCAGGGCAGTCTGCAATAA (boldface letters croinjection apparatus (Narishige) and a micromanipulator correspond to T7 and T3 binding sequences, respectively); WISH (Narishige). For mRNA and minigene injections, the needle was probe 2 (790 bp): forward AATTAACCCTCACTAAAGGGCTG- positioned in the area of embryonic streaming from the yolk cell CCGTAGCCGAAA and reverse TAATACGACTCACTATAGG- to the fertilized blastocyst. Trace amounts of Phenol red were GGACCTGAGCGCTTG (boldface letters correspond to T3 and added to injection solutions as a visible tracer and rhodamine T7 binding sequences, respectively); sms U12in6_7: forward dextran was added to nonfluorescent injection solutions as a GCAGCGGCAAAGAGCACTATGCTG and reverse AATC- fluorescent tracer. CTTACCTCGTAACAATCTCC; mapk3 U12in2_3: forward Genotyping. Genomic DNA from single zebrafish embryos or adult AGACCTACTGCCAGCGCACCCTG and reverse AGCCCT- fin clips was extracted by incubation at 95 °C for 20 min in 100 μL CGCAGGATCTGATACAG; mapk12 U12in8_9: forward GA- of 50 mM sodium hydroxide (NaOH) using a thermocycler, CATCTGGTCAGTCGGGTGCATC and reverse TCTTCAG- followed by neutralization with 10 μLof1MTris·HCl (pH ACTGTAGCTTGGCTGTG; mapk12 U2in3_4: forward GTT- ZM 8.0). For clbn genotyping, 35 PCR cycles of 30 s at 95 °C, ATCGGACTTGTGGATGTGTTC and reverse CATCTGAT- s846 30 s at 58 °C, and 1 min at 72 °C were performed. For clbn , AGACCAGATACTGCAC; snrpe U12in1_2: forward CGTCA- allele-specific PCR was performed using the same conditions TTCTGTTTCCGGATT and reverse CAACCCTCTATCCG- as previously described (1). CATGTT; ppp2r2a U12in7_8: forward CCTATGGATCTCA- TGGTGGAG and reverse TGCTTGTCACAAAGTGCTGA; Histology. Larvae for histology or immunohistochemistry were fkbp3 U12in2_3: forward AGGGTCTGCTGACGATGAGT and fixedinBouin’s fixative overnight at 4 °C. After fixation, larvae reverse CAGGGTTTGTCTTATTTATTGTCG; U11 snRNA were rinsed three times with PBS containing 0.1% (vol/vol) northern: forward GCATCTGCTGTGAATAGCGTA and reverse Tween 20 (PBST) to remove residual fixative, and stored at 4 °C GAGGCACCAAGATAACAGATCA; U12 snRNA northern: for no more than 48 h. Larvae were aligned and embedded in forward TGCCTTAAACTGATGAGTAAGGAAAA and re- disposable plastic Tissue-Tek cryomolds (ProSciTech) in 1% low verse CGCGGCATCTCGCTAAAGTA; U5 snRNA northern: melting temperature agarose (SeaKem LE Agarose, Lonza) and forward TGTTTCTCTTCATATCGAATAAGTC and reverse stored in 70% (vol/vol) ethanol (EtOH). The blocks of larvae AAAATTAGTAAATACTCAAGGTGTTCC; U6atac snRNA were dehydrated through an ethanol series to 100%, embedded northern: forward CTGTTGTTTGAGAGGAGAGAAGGT and in paraffin and cut into 5-μm-thin sections, which were then reverse AAACCACCCCGATCATGG. U11 snRNA quantitative stainedwithH&E. RT-PCR (RT-qPCR): forward GCTGTGGAAGGGATTCTCT- GA and reverse TGGGGCGCCAAGACCAAC; U12 snRNA Microscopy. Brightfield and epifluorescence images were captured RT-qPCR: forward TGCCTTAAACTGATGAGTAAGGAAAA using a Leica MZ FLIII fluorescence microscope equipped with and reverse CGCGGCATCTCGCTAAAGTA; U2 snRNA an Olympus DP70 camera and Olympus DP controller software. RT-qPCR: forward CTCGGCCTTTTGGCTAAGAT and re- Live or fixed larvae were placed in 2% methyl cellulose to prevent verse TACTGCAATACCGGGTCGAT; U4atac snRNA RT- them from moving during image acquisition. Images were im- qPCR: forward CTTCCTTGTCTGGGGGTGGTT and reverse ported into ImageJ (National Institutes of Health) for image pro- GGTGTTAGCAGGGATGTTCTCAGTTA; elongation factor α cessing and CorelDRAW for figure preparation. For two-photon [elfa]: forward CTTCTCAGGCTGACTGTGC and reverse CC- microscopy, WT and clbns846 mutant larvae on the Tg(gutGFP)s854 GCTAGCATTACCCTCC; cyclin G1: forward GTGCGGAGA- background were fixed briefly in 2% (wt/vol) PFA/PBST to CGTTTTCTTT and reverse AAGACAGATGCTTGGGCTGA; preserve endogenous GFP fluorescence. Whole larvae were p53: forward TCCACTCTCCCACCAACATC and reverse GGG- embedded in 2% (wt/vol) low-melting temperature agarose AACCTGAGCCTAAATCC; Δ113p53: forward ATATCCTGGC- for imaging. Imaging was performed on an Olympus FV1000 GAACATTTGG and reverse ACGTCCACCACCATTTGAAC. Confocal Microscope (BX61W upright) using a 20× XLUM- PlanFL NA0.95 objective and Olympus FV-10ASW v1.7c software. Zebrafish Husbandry and Strains. Animals were maintained at 28 °C Multiphoton excitation was provided by a Spectra Physics MaiTai on a 12 h-light/dark cycle under the standard zebrafish hus- DeepSee LD Ti:Sapphire Laser. Excitation wavelengths used bandry procedures of the Ludwig Institute for Cancer Research/ were 920 nm for GFP and 750 for autofluorescence of internal Walter and Eliza Hall Institute of Medical Research Zebrafish structures of zebrafish larvae, both were detected with a 490- to Facility. A commercial strain harboring an independent mutation 540-nm band-pass filter (Olympus Model FV10MPMG/R). in rnpc3 (clbnZM) was purchased from Znomics (this company terminated operations in 2009). The following WT strains of WISH. Zebrafish embryos and larvae were processed for WISH, as zebrafish were used: Tübingen/Tübingen long fin (Tü/TL), used described previously (2). To generate rnpc3 riboprobes, a cDNA to propogate the clbns846 mutant strain and for positional cloning; template was amplified by RT-PCR. For primer sequences see Markmiller et al. www.pnas.org/cgi/content/short/1305536111 1of12 Primer and Probe Sequences above. Antisense and sense probes TL software was used to quantify full-length signals for U11 or were then transcribed using the digoxigenin DNA Labeling Kit U12. Background was subtracted manually for each lane, and in (Roche Diagnostics) according to the manufacturer’s instruc- those lanes with >2× signal, background was expressed as a per- tions. Hybridized riboprobes were detected using an anti-DIG centage of the lane with the greatest signal intensity in a single antibody conjugated to alkaline phosphatase according to the gradient. Normalized intensities of bands across 24 fractions manufacturer’s instructions (Roche Diagnostics). Larvae were (fraction nos. 4–27) were plotted in Excel vs. fraction number. imaged on a Nikon SMZ 1500 microscope. Experimental Design for Microarray and RNAseq. Gene-expression Minigene Assay. A minigene spanning the U2-type intron 13, the data were obtained from two independent platforms, using DNA U12-type intron 14, and flanking exons, was amplified from WT microarrays as well as RNA sequencing of poly-A enriched RNA and clbns846 genomic DNA using primers carrying 5′ tails (23 bp) from clbns846 whole larvae. This approach combines advantages to allow specific amplification of the exogenous transgene after of both technologies (i.e., well-established experimental and injection into zebrafish embryos. WT and mutant minigenes were analysis procedures for microarrays and the independence of confirmed by sequencing to differ only in the T→Amutation RNAseq from a priori knowledge of the zebrafish transcriptome) observed in clbns846. but takes into account the cost of RNAseq experiments as well as limitations on microarray content imposed by incomplete Preparation of Larval Extracts for snRNP Analyses. Mutants were annotation of the zebrafish genome. For microarrays, three in- sorted based on phenotype at 150 h postfertilization (hpf) and ∼100 dependent biological replicates consisting of ∼20 pooled genotyped + + larvae each of WT and clbnZM were used per glycerol gradient ex- clbns846/s846 and clbn / larvae each were analyzed on the Agilent periment. Larvae were killed in benzocaine, rinsed several times in Zebrafish V2 gene expression platform. Biological replicates ice cold buffer G, and transferred into 1.5-mL microcentrifuge tubes. were then pooled and one single sequencing library each was Tubes were centrifuged for 1 min at 16,000 × g at 4 °C and buffer constructed for mutant and WT samples, respectively, allowing G removed completely, leaving a larval pellet. Larvae were then them to be sequenced on a single slide in the same sequencing resuspended in 4 volumes (microliter per larva) of buffer G con- run. Although the lack of technical or biological replicates in taining 8% (vol/vol) glycerol, 1 mM DTT, 0.5 mM PMSF, and 0.02% RNAseq data limits the statistical power of the analysis, the Nonidet P-40. Larvae were homogenized using a 1-mL dounce ho- experimental design still allows