DOCSLIB.ORG

Reduction of Type V Collagen Using a Dominant-Negative

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Reduction of Type V Collagen Using a Dominant-Negative CORE Metadata, citation and similar papers at core.ac.uk Provided by PubMed Central Reduction of Type V Collagen Using a Dominant-negative Strategy Alters the Regulation of Fibrillogenesis and Results in the Loss of Corneal-Specific Fibril Morphology Jeffrey K. Marchant, Rita A. Hahn, Thomas F. Linsenmayer, and David E. Birk Department of Anatomy and Cellular Biology, Tufts University School of Medicine, Boston, Massachusetts 02111 Abstract. A number of factors have been implicated in synthesized the truncated or(V) protein, and this was the regulation of tissue-specific collagen fibril diameter. detectable only intracellularly, in a distribution that Previous data suggest that assembly of heterotypic colocalized with lysosomes. To assess endogenous fibrils composed of two different fibrillar collagens rep- etl(V) protein levels, infected cell cultures were as- resents a general mechanism regulating fibril diameter. sayed, and these consistently demonstrated reductions Specifically, we hypothesize that type V collagen is re- relative to control virus-infected or uninfected cultures. quired for the assembly of the small diameter fibrils ob- Analyses of corneal fibril morphology demonstrated served in the cornea. To test this, we used a dominant- that the reduction in type V collagen resulted in the as- negative retroviral strategy to decrease the levels of sembly of large-diameter fibrils with a broad size distri- type V collagen secreted by chicken corneal fibroblasts. bution, characteristics similar to fibrils produced in The chicken or(V) collagen gene was cloned, and ret- connective tissues with low type V concentrations. Im- roviral vectors that expressed a polycistronic mRNA munoelectron microscopy demonstrated the amino- encoding a truncated otl(V) minigene and the reporter terminal domain of type V collagen was associated with gene LacZ were constructed. The efficiency of viral in- the small-diameter fibrils, but not the large fibrils. fection was 30--40%, as determined by assaying I~-galac- These data indicate that type V collagen levels regulate tosidase activity. To assess the expression from the re- corneal fibril diameter and that the reduction of type V combinant provirus, Northern analysis was performed collagen is sufficient to alter fibril assembly so that ab- and indicated that infected fibroblasts expressed high normally large-diameter fibrils are deposited into the steady-state levels of retroviral mRNA. Infected cells matrix. HE characteristics of different extracellular matrices form collagen-proteoglycan heteropolymers (33, 39), or by derive in large part from the synthesis, assembly, the addition of fibril-associated collagens to fibrils (19). T and deposition of collagen molecules and their or- Alternative splicing of collagens also can occur in a tissue- ganization into unique macromolecular structures. These specific manner and confer different properties to fibrils collagen assemblies confer specialized properties to the (27, 32, 35, 37). Tissue-specific variations in all these extracellular matrix in which they are found. The cornea, events contribute to the diversity of collagen structures for example, has small, uniform diameter fibrils organized observed in different extracellular matrices. into orthogonal lamellae; these characteristics permit this Fibril assembly is a multistep process and, as such, there tissue to be strong yet transparent. are numerous points where fibril characteristics, i.e., diam- The synthesis of collagen molecules and their associa- eter, may be regulated. Propeptide processing represents tion to form fibrils requires a number of sequential post- one such checkpoint. The C-propeptides of procollagen translational events that are common to all fibrillar col- molecules are cleaved in the extracellular matrix before lagens (19). These include intracellular processes such as incorporation of collagen monomers into fibrils, and hydroxylation and glycosylation, and extracellular ones therefore C-propeptidase activity provides an early rate- such as procollagen processing and cross-linking (14, 19, limiting step in fibril formation (14, 30). N-propeptidase 30). Fibril assembly may be modified through the associa- activity varies with collagen substrates, being rapid with tion of different fibrillar collagens to form heterotypic type I collagen yet limited with type III (28, 31). A unique fibrils (3, 5, 15, 18, 24), the addition of proteoglycans to example of this propeptidase regulation exists with hetero- typic type I/V fibrils. Type I collagen in these fibrils is fully Please address all correspondence to David E. Birk, Department of Anat- processed while type V is only partially processed, using a omy and Cellular Biology, Tufts University School of Medicine, 136 Har- distal cleavage site that leaves the bulk of the noncollage- rison Ave., Boston, MA 02111. Tel.: (617) 636-0301; Fax: (617) 636-8577. nous amino-terminal domain intact (20). © The Rockefeller University Press, 0021-9525/96/12/1415/12 $2.00 The Journal of Cell Biology, Volume 135, Number 5, December 1996 1415-1426 1415 Type V collagen is copolymerized into heterotypic type primer was used in the initial reverse-transcription reaction to generate I/V fibrils in a molecular arrangement that leaves the eDNA. This was followed by PCR amplification using the same 3' primer amino-terminal domain exposed on the surface and the and a 5' primer specific to a region within the triple-helical domain of the al (V) mRNA (5' GGGAAGACAGGCCCAATCGGCC 3'). PCR-ampli- major triple-helical portion of the molecule located within lied eDNA was cloned into the TA vector (Invitrogen, San Diego, CA), the fibril (20). Between the major triple helix and this and purified DNA was subjected to sequence analysis using the dsDNA amino-terminal domain lies a "hinge region" and three Cycle Sequencing System (GIBCO BRL, Gaithersburg, MD). small triple-helical domains that we have previously sug- gested permit the extension of the amino-propeptide Replication-defective Retroviral Vectors through the hole zone and onto the fibril surface (20). This Retroviral vectors were kindly provided by Dr. Takashi Mikawa (Cornell structural arrangement observed in heterotypic type I/V University Medical College, New York, NY). These vectors are derived fibrils exists with other fibrils as well. Type II collagen from spleen necrosis virus (SNV) 1, a member of the avian reticuloendo- fibrils, for example, contain type XI collagen molecules, theliosis virus group. The vectors are replication defective and, to produce infectious particles, must obtain missing proteins in trans from packaging and these are positioned in a way that the amino-terminal cells (10, 25). Once assembled in these cells, this virus is capable of infect- domains project onto the fibril surface. As with type V col- ing a wide variety of host cells. Since horizontal transmission of the virus is lagen, the triple-helical domains are within the fibril (24, not possible in nonpaekaging cells, only progeny of infected cells will ex- 29, 42). The similarities between collagen types V and XI press the proviral transcripts. The pCXIZ vector contains the SNV pro- moter as well as sequences required for encapsidation of viral transcripts, extend beyond a structural resemblance: in certain tissues reverse transcription, and proviral integration (26). In addition, this vector (e.g., vitreous, bone) type V collagen molecules can be contains an internal ribosome entry sequence followed by the bacterial comprised of both type V and type XI a chains, suggesting LacZ gene. For efficient expression of this reporter gene in eukaryotic that type XI chains are able to substitute for type V chains cells, a translation initiation sequence derived from the murine leukemia (12). Given these structural and functional similarities, it virus gag gene is present in the 5' flanking sequence. A cloning site is present upstream of the internal ribosome entry sequence region and was has been suggested that these two collagens comprise part used for insertion of the al(V) collagen eDNA. The pCXL vector is simi- of a larger fibrillar collagen family, one that has a predom- lar to pCXIZ, but lacks the internal ribosome-binding sequence (25). This inantly regulatory rather than structural function (12, 22). vector was used as a control. Fibril diameter is related to the concentration of type V collagen within heterotypic type I/V fibrils, and it is the Constructs amino-terminal domain that appears to confer this regula- PCR splicing by overlap extension was used to add myc and signal se- tory property. Previous self-assembly studies have demon- quences in frame to the al(V) carboxyl terminus. The myc sequence was strated that in vitro, the levels of type V collagen incorpo- also obtained from Dr. Takashi Mikawa. The al(V) signal sequence rated into type IN fibrils is inversely proportional to fibril was obtained from the published chicken pro-~l(V) sequence (20). To add the myc sequence, a 5' 93-mer was made that encoded a SpeI site, the diameter: the higher the concentration of type V, the myc sequence, and the sequence overlapping the 5' end of the al(V) smaller the diameter. It also was shown that if the amino- eDNA (5'TCGATCACTAGTGC'ITGGGCGACCTCACCATGGAGC terminal domain is removed, diameter regulation is abol- AAAAGCTCAITrCTGAAGAGGACTTGAATGCCCITCCAGGA- ished. It is hypothesized that the presence of the amino- TCCCCTGGCCCAGATG 3'). A poly(T)a0 primer was used at the 3' end of the otl(V) eDNA, and PCR amplification
Load more

Recommended publications
  • Bruch's Membrane Abnormalities in PRDM5-Related Brittle Cornea
    Porter et al. Orphanet Journal of Rare Diseases (2015) 10:145 DOI 10.1186/s13023-015-0360-4 RESEARCH Open Access Bruch’s membrane abnormalities in PRDM5-related brittle cornea syndrome Louise F. Porter1,2,3, Roberto Gallego-Pinazo4, Catherine L. Keeling5, Martyna Kamieniorz5, Nicoletta Zoppi6, Marina Colombi6, Cecilia Giunta7, Richard Bonshek2,8, Forbes D. Manson1 and Graeme C. Black1,9* Abstract Background: Brittle cornea syndrome (BCS) is a rare, generalized connective tissue disorder associated with extreme corneal thinning and a high risk of corneal rupture. Recessive mutations in transcription factors ZNF469 and PRDM5 cause BCS. Both transcription factors are suggested to act on a common pathway regulating extracellular matrix genes, particularly fibrillar collagens. We identified bilateral myopic choroidal neovascularization as the presenting feature of BCS in a 26-year-old-woman carrying a novel PRDM5 mutation (p.Glu134*). We performed immunohistochemistry of anterior and posterior segment ocular tissues, as expression of PRDM5 in the eye has not been described, or the effects of PRDM5-associated disease on the retina, particularly the extracellular matrix composition of Bruch’smembrane. Methods: Immunohistochemistry using antibodies against PRDM5, collagens type I, III, and IV was performed on the eyes of two unaffected controls and two patients (both with Δ9-14 PRDM5). Expression of collagens, integrins, tenascin and fibronectin in skin fibroblasts of a BCS patient with a novel p.Glu134* PRDM5 mutation was assessed using immunofluorescence. Results: PRDM5 is expressed in the corneal epithelium and retina. We observe reduced expression of major components of Bruch’s membrane in the eyes of two BCS patients with a PRDM5 Δ9-14 mutation.
    [Show full text]
  • Vascular Phenotypes in Nonvascular Subtypes of the Ehlers-Danlos Syndrome: a Systematic Review
    SYSTEMATIC REVIEW Official journal of the American College of Medical Genetics and Genomics Vascular phenotypes in nonvascular subtypes of the Ehlers-Danlos syndrome: a systematic review Sanne D’hondt, MSc1, Tim Van Damme, MD1 and Fransiska Malfait, MD, PhD1 Purpose: Within the spectrum of the Ehlers-Danlos syndromes (53%), frequently reported in musculocontractural and classical- (EDS), vascular complications are usually associated with the like EDS; intracranial hemorrhages (18%), with a high risk in vascular subtype of EDS. Vascular complications are also observed dermatosparaxis EDS; and arterial dissections (16%), frequently in other EDS subtypes, but the reports are anecdotal and the reported in kyphoscoliotic and classical EDS. Other, more minor, information is dispersed. To better document the nature of vascular vascular complications were reported in cardiac-valvular, arthro- complications among “nonvascular” EDS subtypes, we performed chalasia, spondylodysplastic, and periodontal EDS. a systematic review. Conclusion: Potentially life-threatening vascular complications are Methods: We queried three databases for English-language a rare but important finding in several nonvascular EDS sub- studies from inception until May 2017, documenting both types, highlighting a need for more systematic documentation. This phenotypes and genotypes of patients with nonvascular EDS review will help familiarize clinicians with the spectrum of vascular subtypes. The outcome included the number and nature of vascular complications in EDS and guide follow-up and management. complications. Genet Med advance online publication 5 October 2017 Results: A total of 112 papers were included and data were collected from 467 patients, of whom 77 presented with a vascular Key Words: connective tissue disorder; Ehlers-Danlos syndrome; phenotype.
    [Show full text]
  • Understanding the Basis of Ehlers–Danlos Syndrome in the Era of the Next-Generation Sequencing
    Archives of Dermatological Research (2019) 311:265–275 https://doi.org/10.1007/s00403-019-01894-0 REVIEW Understanding the basis of Ehlers–Danlos syndrome in the era of the next-generation sequencing Francesca Cortini1,2 · Chiara Villa3 · Barbara Marinelli1 · Romina Combi3 · Angela Cecilia Pesatori1 · Alessandra Bassotti4 Received: 29 July 2018 / Revised: 26 November 2018 / Accepted: 12 February 2019 / Published online: 2 March 2019 © Springer-Verlag GmbH Germany, part of Springer Nature 2019 Abstract Ehlers–Danlos syndrome (EDS) is a clinically and genetically heterogeneous group of heritable connective tissue disorders (HCTDs) defined by joint laxity, skin alterations, and joint hypermobility. The latest EDS classification recognized 13 sub- types in which the clinical and genetic phenotypes are often overlapping, making the diagnosis rather difficult and strength- ening the importance of the molecular diagnostic confirmation. New genetic techniques such as next-generation sequencing (NGS) gave the opportunity to identify the genetic bases of unresolved EDS types and support clinical counseling. To date, the molecular defects have been identified in 19 genes, mainly in those encoding collagen, its modifying enzymes or other constituents of the extracellular matrix (ECM). In this review we summarize the contribution of NGS technologies to the current knowledge of the genetic background in different EDS subtypes. Keywords Ehlers–Danlos syndrome · Heterogeneity · Heritable connective tissue disorders Introduction in 1988, represents the first attempt to classify EDS, recog- nizing 11 EDS subtypes [4], defined by Roman numerals and Ehlers–Danlos syndrome (EDS) comprises a clinically and classified according to clinical findings and the inheritance heterogeneous group of heritable connective tissue disor- pattern.
    [Show full text]
  • Collagen Tissue Engineering: Development of Novel Biomaterials and Applications
    0031-3998/08/6305-0492 Vol. 63, No. 5, 2008 PEDIATRIC RESEARCH Printed in U.S.A. Copyright © 2008 International Pediatric Research Foundation, Inc. Collagen Tissue Engineering: Development of Novel Biomaterials and Applications LIAN CEN, WEI LIU, LEI CUI, WENJIE ZHANG, AND YILIN CAO Department of Plastic and Reconstructive Surgery [W.L., L.C., W.Z., Y.C.], Shanghai 9th People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200011, China; National Tissue Engineering Center of China [L.C., W.L., L.C., W.Z., Y.C.], Shanghai 200235, China ABSTRACT: Scientific investigations involving collagen have in- regeneration is to restore both the structural integrity and the spired tissue engineering and design of biomaterials since collagen vivid remodeling process of native ECM, especially restoring the fibrils and their networks primarily regulate and define most tissues. delicate collagen networks under which normal physiologic re- The collagen networks form a highly organized, three-dimensional generation occurs. architecture to entrap other ingredients. Biomaterials are expected to Collagen molecules have a triple-helical structure and the function as cell scaffolds to replace native collagen-based extracel- lular matrix. The composition and properties of biomaterials used as presence of 4-hydroxyproline resulting from a posttransla- scaffold for tissue engineering significantly affect the regeneration of tional modification of peptide-bound prolyl residues provides neo-tissues and influence the conditions of collagen engineering. The a distinctive marker of these molecules (2). To date, 28 complex scenario of collagen characteristics, types, fibril arrange- collagen types have been identified; I, II, III, and V are the ment, and collagen structure-related functions (in a variety of con- main types that make up the essential part of collagen in bone, nective tissues including bone, cartilage, tendon, skin and cornea) are cartilage, tendon, skin, and muscle.
    [Show full text]
  • Re-Evaluation of Lysyl Hydroxylation in the Collagen Triple Helix
    bioRxiv preprint doi: https://doi.org/10.1101/2019.12.16.877852; this version posted December 16, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Re-evaluation of lysyl hydroxylation in the collagen triple helix: lysyl hydroxylase 1 and prolyl 3- 2 hydroxylase 3 have site-differential and collagen type-dependent roles in lysine hydroxylation. 3 4 Short title: Two distinct mechanisms of LH1and P3H3 during collagen biosynthesis in the rER 5 6 Yoshihiro Ishikawa1,2,#,*, Yuki Taga3, Keith Zientek2, $, Nobuyo Mizuno2, ¶, Antti M. Salo4, Olesya 7 Semenova2, Sara Tufa2, Douglas R. Keene2, Paul Holden2, Kazunori Mizuno3, Johanna Myllyharju4 and 8 Hans Peter Bächinger1 9 10 1: Department of Biochemistry and Molecular Biology, Oregon Health & Science University, Portland, 11 Oregon, USA, 2: Shriners Hospital for Children, Research Department, Portland, Oregon, USA, 3: Nippi 12 Research Institute of Biomatrix, Ibaraki, Japan, 4: Oulu Center for Cell-Matrix Research, Biocenter Oulu 13 and Faculty of Biochemistry and Molecular Medicine, University of Oulu, Oulu, Finland. 14 15 Present address; #: Departments of Ophthalmology, University of California San Francisco, School of 16 Medicine, California, USA, $: Proteomics core facility, Oregon Health & Science University, Portland, 17 Oregon, USA, ¶: Vaccine and Gene Therapy Institute, Oregon Health and Science University, Portland, 18 Oregon, USA. 19 20 *: Corresponding author: Yoshihiro Ishikawa, Ph.D., Department of Ophthalmology, University of 21 California, San Francisco, School of Medicine, California, USA; 22 Tel: (503) 866-5940, E-mail: [email protected] 23 ORCID-ID: https://orcid.org/0000-0003-2013-0518 24 25 Competing Interests: The authors declare that they have no competing interests related to this work 1 bioRxiv preprint doi: https://doi.org/10.1101/2019.12.16.877852; this version posted December 16, 2019.
    [Show full text]
  • Lysyl Hydroxylases 1 and 2
    D 1159 OULU 2012 D 1159 UNIVERSITY OF OULU P.O.B. 7500 FI-90014 UNIVERSITY OF OULU FINLAND ACTA UNIVERSITATIS OULUENSIS ACTA UNIVERSITATIS OULUENSIS ACTA SERIES EDITORS DMEDICA Marjo Hyry ASCIENTIAE RERUM NATURALIUM Marjo Hyry Senior Assistant Jorma Arhippainen LYSYL HYDROXYLASES 1 AND 2 BHUMANIORA Lecturer Santeri Palviainen CHARACTERIZATION OF THEIR IN VIVO ROLES IN MOUSE AND THE MOLECULAR LEVEL CTECHNICA CONSEQUENCES OF THE LYSYL HYDROXYLASE 2 Professor Hannu Heusala MUTATIONS FOUND IN BRUCK SYNDROME DMEDICA Professor Olli Vuolteenaho ESCIENTIAE RERUM SOCIALIUM Senior Researcher Eila Estola FSCRIPTA ACADEMICA Director Sinikka Eskelinen GOECONOMICA Professor Jari Juga EDITOR IN CHIEF Professor Olli Vuolteenaho PUBLICATIONS EDITOR Publications Editor Kirsti Nurkkala UNIVERSITY OF OULU GRADUATE SCHOOL; UNIVERSITY OF OULU, FACULTY OF MEDICINE, INSTITUTE OF BIOMEDICINE, ISBN 978-951-42-9841-7 (Paperback) DEPARTMENT OF MEDICAL BIOCHEMISTRY AND MOLECULAR BIOLOGY; ISBN 978-951-42-9842-4 (PDF) BIOCENTER OULU; ISSN 0355-3221 (Print) CENTER FOR CELL-MATRIX RESEARCH ISSN 1796-2234 (Online) ACTA UNIVERSITATIS OULUENSIS D Medica 1159 MARJO HYRY LYSYL HYDROXYLASES 1 AND 2 Characterization of their in vivo roles in mouse and the molecular level consequences of the lysyl hydroxylase 2 mutations found in Bruck syndrome Academic dissertation to be presented with the assent of the Doctoral Training Committee of Health and Biosciences of the University of Oulu for public defence in Auditorium F101 of the Department of Physiology (Aapistie 7), on 8 June 2012, at 10 a.m. UNIVERSITY OF OULU, OULU 2012 Copyright © 2012 Acta Univ. Oul. D 1159, 2012 Supervised by Professor Johanna Myllyharju Reviewed by Professor Heather Yeowell Professor Helen Skaer ISBN 978-951-42-9841-7 (Paperback) ISBN 978-951-42-9842-4 (PDF) ISSN 0355-3221 (Printed) ISSN 1796-2234 (Online) Cover Design Raimo Ahonen JUVENES PRINT TAMPERE 2012 Hyry, Marjo, Lysyl hydroxylases 1 and 2.
    [Show full text]
  • Collagens—Structure, Function, and Biosynthesis
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by University of East Anglia digital repository Advanced Drug Delivery Reviews 55 (2003) 1531–1546 www.elsevier.com/locate/addr Collagens—structure, function, and biosynthesis K. Gelsea,E.Po¨schlb, T. Aignera,* a Cartilage Research, Department of Pathology, University of Erlangen-Nu¨rnberg, Krankenhausstr. 8-10, D-91054 Erlangen, Germany b Department of Experimental Medicine I, University of Erlangen-Nu¨rnberg, 91054 Erlangen, Germany Received 20 January 2003; accepted 26 August 2003 Abstract The extracellular matrix represents a complex alloy of variable members of diverse protein families defining structural integrity and various physiological functions. The most abundant family is the collagens with more than 20 different collagen types identified so far. Collagens are centrally involved in the formation of fibrillar and microfibrillar networks of the extracellular matrix, basement membranes as well as other structures of the extracellular matrix. This review focuses on the distribution and function of various collagen types in different tissues. It introduces their basic structural subunits and points out major steps in the biosynthesis and supramolecular processing of fibrillar collagens as prototypical members of this protein family. A final outlook indicates the importance of different collagen types not only for the understanding of collagen-related diseases, but also as a basis for the therapeutical use of members of this protein family discussed in other chapters of this issue. D 2003 Elsevier B.V. All rights reserved. Keywords: Collagen; Extracellular matrix; Fibrillogenesis; Connective tissue Contents 1. Collagens—general introduction ............................................. 1532 2. Collagens—the basic structural module.........................................
    [Show full text]
  • Collagen Content and AHMED M
    Collagen content and AHMED M. ABU EL-ASRAR, KAREL GEBOES, types in trachomatous SOLIMAN A. AL-KHARASHI, KHALID F. TABBARA, LUC MISSOTTEN conjunctivitis Abstract chronic progressive conjunctival cicatrisation in trachoma that lead to blindness remain unclear. Purpose To study alterations in conjunctival However, previous immunohistochemical collagen in the conjunctiva of patients with studies demonstrated that the tissue damage active trachoma. might result from immunological Methods We studied conjunctival biopsy 3 s mechanisms. - specimens obtained from nine subjects with The metabolic alterations of extracellular active trachoma and from four control matrix components in trachoma may be the subjects. We used immunohistochemical result of cytokines released by resident techniques and a panel of monoclonal and conjunctival cells and by numerous polyclonal antibodies directed against types I, 6 inflammatory cell types infiltrating the tissue. III, IV and V collagen. The banded collagen fibrils are the most Results In normal conjunctiva, the staining for abundant and widely distributed matrix types I and III collagen was localised to the components. Increased collagen content is a substantia propria. Type IV collagen was feature of many inflammatory and located in the epithelial and capillary fibroproliferative diseases?-17 endothelial basement membranes. The We analysed conjunctival biopsy specimens staining for type V collagen was absent. In from patients with active trachoma in order to trachoma biopsy specimens, staining for types determine some of the mechanisms that control I and III collagen showed collagen fibrils conjunctival scarring. Using among epithelial cells, patchy increase in immunohistochemical methods we examined staining intensity in the upper stroma, and the ature and distribution of types I, III, IV thicker and irregularly arranged collagen n and A.M.
    [Show full text]
  • The Epiligament-The Main Donor of Cells and Vessels During Healing of the Collateral Ligaments of the Knee Boycho Landzhov1*, Georgi P
    ogy: iol Cu ys r h re P n t & R y e s Anatomy & Physiology: Current m e o a t r a c n h Landzhov et al., Anat Physiol 2015, 5:S4 A Research ISSN: 2161-0940 DOI: 10.4172/2161-0940.S4-006 Special Issue Open Access The Epiligament-The Main Donor of Cells and Vessels during Healing of the Collateral Ligaments of the Knee Boycho Landzhov1*, Georgi P. Georgiev2 and Ilina Brainova3 1Department of Anatomy, Histology and Embryology, Medical University of Sofia, Bulgaria 2University Hospital of Orthopaedics “Prof. B. Boychev”, Medical University of Sofia, Bulgaria 3Department of Forensic Medicine and Deontology, Medical University of Sofia, Bulgaria *Corresponding author: Boycho Landzhov, Faculty of Medicine, Department of Anatomy, Histology and Embryology, 2 Zdrave Str, 1431 Sofia, Bulgaria; Tel: +35929172601; E-mail: [email protected] Rec date: Jul 14, 2015; Acc date: Aug 01, 2015; Pub date: Aug 03, 2015 Copyright: © 2015 Landzhov B. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract Ligaments are composed of dense connective tissue and attach bones in joints. The thin connective tissue sheath, covering these fascicles is called endoligament and is connected to a more vascular connective tissue structure that envelopes the entire ligament and is referred to as epiligament. The tissue of the epiligaments is composed of different cell types such as: fibroblasts, fibrocytes, adipocytes, neurovascular bundles, and a multitude of collagen fibers, disposed in different directions.
    [Show full text]
  • Articular Cartilage Collagen: an Irreplaceable Framework?
    DREuropean Eyre et Cells al. and Materials Vol. 12. 2006 (pages 57-63) Articular DOI: 10.22203/eCM.v012a07 Cartilage Collagen: An Irreplaceable ISSN Framework? 1473-2262 ARTICULAR CARTILAGE COLLAGEN: AN IRREPLACEABLE FRAMEWORK? David R. Eyre, Mary Ann Weis and Jiann-Jiu Wu University of Washington, Seattle Abstract Introduction Adult articular cartilage by dry weight is two-thirds Osteoarthritis (OA) has multiple causes and risk factors, collagen. The collagen has a unique molecular phenotype. but once the articular cartilage is lost, the joint fails. The The nascent type II collagen fibril is a heteropolymer, with collagen framework of adult cartilage is turned over very collagen IX molecules covalently linked to the surface and slowly and any severe damage appears to be irreversible collagen XI forming the filamentous template of the fibril and a critical step in the process of joint failure. There is as a whole. The functions of collagens IX and XI in the growing evidence that proteolytic damage to cartilage heteropolymer are far from clear but, evidently, they are collagen can occur very soon after joint injury (Lohmander critically important since mutations in COLIX and COLXI et al., 2003). genes can result in chondrodysplasia syndromes. Here we The material strength and biological properties of review what is known of the collagen assembly and present articular cartilage depend heavily on its uniquely and new evidence that collagen type III becomes covalently extensively cross-linked collagen network and added to the polymeric fabric of adult human articular characteristic fibrillar organization that varies with tissue cartilage, perhaps as part of a matrix repair or remodelling depth and proximity to the cells.
    [Show full text]
  • Report Classical Ehlers-Danlos Syndrome Caused by a Mutation In
    Am. J. Hum. Genet. 66:1398±1402, 2000 Report Classical Ehlers-Danlos Syndrome Caused by a Mutation in Type I Collagen Lieve Nuytinck,1 Margarida Freund,2 Lieven Lagae,3 Gerald E. Pierard,4 Trinh Hermanns-Le,4 and Anne De Paepe1 1Center for Medical Genetics, University Hospital Gent, Gent, Belgium; 2Centre de GeÂneÂtique Humaine, Universite Catholique de Louvain, Brussels; 3Department of Pediatric Neurology, University Hospital Leuven, Leuven, Belgium; and 4Laboratory of Experimental Dermatology and Dermatopathology, University of LieÁge, LieÁge, Belgium Classical Ehlers-Danlos syndrome (EDS) is characterized by skin hyperelasticity, joint hypermobility, increased tendency to bruise, and abnormal scarring. Mutations in type V collagen, a regulator of type I collagen ®brillogenesis, have been shown to underlie this type of EDS. However, to date, mutations have been found in only a limited number of patients, which suggests genetic heterogeneity. In this article, we report two unrelated patients with typical features of classical EDS, including excessive skin fragility, in whom we found an identical argininercysteine substitution in type I collagen, localized at position 134 of the a1(I) collagen chain. The arginine residue is highly conserved and localized in the X position of the Gly-X-Y triplet. As a consequence, intermolecular disul®de bridges are formed, resulting in type I collagen aggregates, which are retained in the cells. Whereas substitutions of glycine residues in type I collagen invariably result in osteogenesis imperfecta, substitutions of nonglycine residues in type I collagen have not yet been associated with a human disease. In contrast, argininercysteine substitutions in type II collagen have been identi®ed in a variety of chondrodysplasias.
    [Show full text]
  • Collagen Type Specificity of Defective Lysyl Hydroxylation in Various Tissues
    0022-202X/84/8303-0161 $02.00/ 0 THE JOURNAL Of" I NVESTIGATIVE DERMATOLOGY, 8:1 :161- 165, 1984 Vol. 83, No. 3 Copyright © 1984 by The Williams & Wilkins Co. Printed in U.S.A. Ehlers-Danlos Syndrome Type VI: Collagen Type Specificity of Defective Lysyl Hydroxylation in Various Tissues ANNEGRET lHME, M.D.: THOMAS KRIEG, M.D., ANDREAS NERLICH, M.D., URSULA FELDMANN, M.D., JORGEN RAUTERBERG, PH.D., ROBERT W. GLANVILLE, PH.D., GEORG EDEL, M.D., AND PETER K. MOLLER, PH.D. Max-Planck-l nstitut fur Biochemie, Abt. Bindegewebsforschung (AN, RWG, PKM), Mimchen; Derm.alologische Klinik der Ludwig-Max.imillians­ Uniue rsitdt (TK), Munchen; Humangenetisches lnstitut der Um:uersitiit (UF), Mu.nster; lnstitut fu.r Arteriosk.leroseforschung (JR), Munster; and Pathologisches ln.Btitut der Un.iuersitiit (GE), Munster, F.R.G. The Ehlers-Danlos syndrome type VI is an inherited in the expression of t he defect in different cells, differential disorder of collagen metabolism characterized by a de­ susceptibility of certain collagen types to a mutant lysyl hy­ fective lysyl h y droxylase. The resulting lack of hy­ droxylase, or the presence of enzymes specific for different droxylysine has been found in several connective tis­ collagen types may explain the varying degree of involvement sues, all of which show varying degrees of clinical symp­ of the tissues found in patients with EDS type VI. The aim of toms. In the present study, collagen was isolated from our study was to determine whether the collagen types found different connective tissues and the degree of hydrox­ in different tissues are equally deficient in hydroxylysyl resi­ ylation of lysy l residues was determined.
    [Show full text]