PLATINUM The Journal of Threatened Taxa (JoTT) is dedicated to building evidence for conservaton globally by publishing peer-reviewed artcles online OPEN ACCESS every month at a reasonably rapid rate at www.threatenedtaxa.org. All artcles published in JoTT are registered under Creatve Commons Atributon 4.0 Internatonal License unless otherwise mentoned. JoTT allows allows unrestricted use, reproducton, and distributon of artcles in any medium by providing adequate credit to the author(s) and the source of publicaton.
Journal of Threatened Taxa Building evidence for conservaton globally www.threatenedtaxa.org ISSN 0974-7907 (Online) | ISSN 0974-7893 (Print) Communication Revisiting genetic structure of Wild Buffaloes Bubalus arnee Kerr, 1792 (Mammalia: Artiodactyla: Bovidae) in Koshi Tappu Wildlife Reserve, Nepal: an assessment for translocation programs
Ram C. Kandel, Ram C. Poudel, Amir Sadaula, Prakrit Kandel, Kamal P. Gairhe, Chiranjibi P. Pokheral, Siddhartha B. Bajracharya, Mukesh K. Chalise & Ghan Shyam Solanki
26 December 2019 | Vol. 11 | No. 15 | Pages: 14942–14954 DOI: 10.11609/jot.4940.11.15.14942-14954
For Focus, Scope, Aims, Policies, and Guidelines visit htps://threatenedtaxa.org/index.php/JoTT/about/editorialPolicies#custom-0 For Artcle Submission Guidelines, visit htps://threatenedtaxa.org/index.php/JoTT/about/submissions#onlineSubmissions For Policies against Scientfc Misconduct, visit htps://threatenedtaxa.org/index.php/JoTT/about/editorialPolicies#custom-2 For reprints, contact
The opinions expressed by the authors do not refect the views of the Journal of Threatened Taxa, Wildlife Informaton Liaison Development Society, Zoo Outreach Organizaton, or any of the partners. The journal, the publisher, the host, and the part- Publisher & Host ners are not responsible for the accuracy of the politcal boundaries shown in the maps by the authors.
Partner Member
Threatened Taxa Journal of Threatened Taxa | www.threatenedtaxa.org | 26 December 2019 | 11(15): 14942–14954
Revisiting genetic structure of Wild Buffaloes
Communication Bubalus arnee Kerr, 1792 (Mammalia: Artiodactyla: Bovidae)
ISSN 0974-7907 (Online) in Koshi Tappu Wildlife Reserve, Nepal: an assessment for ISSN 0974-7893 (Print) translocation programs PLATINUM OPEN ACCESS Ram C. Kandel 1 , Ram C. Poudel 2 , Amir Sadaula 3 , Prakrit Kandel 4 , Kamal P. Gairhe 5 , Chiranjibi P. Pokheral 6 , Siddhartha B. Bajracharya 7 , Mukesh K. Chalise 8 & Ghan Shyam Solanki 9
1,5 Ministry of Forests and Environment, Department of Natonal Parks and Wildlife Conservaton, PO 860, Babarmahal, Nepal. 2 Nepal Academy of Science and Technology, Molecular Biotechnology Unit, PO 3323, Khumaltar, Nepal. 3,6,7 Natonal Trust for Nature Conservaton, PO 3712, Khumaltar, Nepal. 4 Kathmandu University, Department of Biotechnology, PO 6250, Dhulikhel, Nepal. 5 Chitwan Natonal Park, Headquarter, Kasara, Chitwan, Nepal. 8 Tribhuvan University, Central Department of Zoology, Kirtpur, Nepal. 9 Mizoram University, Department of Zoology, Mizoram, Aizawl, Mizoram 796009, India. 1 [email protected], 2 [email protected] (corresponding author), [email protected], 4 [email protected], 5 [email protected], [email protected], 7 [email protected], 8 [email protected], [email protected]
Abstract: Koshi Tappu Wildlife Reserve (KTWR) has the last remaining Nepalese populaton of the Endangered Asiatc Wild Bufalo (Bubalus arnee Kerr, 1792). Individual animals protected inside KTWR may be of purely wild, domestc or hybrid origin, and the wild populaton is under potental threat due to habitat loss and genetc introgression from feral backcrosses. Identfcaton of genetcally pure wild individuals is important for identfying animals for translocaton to other areas within their former range. In this study we have sequenced a highly variable 422bp region of the Cytochrome b gene of 36 animals, and added 61 published sequences of both River and Swamp Bufalo from Italy and some southern Asian countries including India. The haplotype diversites ranged from 0.286-0.589 with slightly higher diversites in domestcated individuals. The AMOVA analysis revealed that 97.217% of the genetc variaton was contained within
groups and 2.782% occurred among groups. An overall fxaton index (FST) was found to be 0.02782 (p>0.05). Phylogenetc relatonships derived through a reduced median network and maximum parsimony analyses reconfrmed the ancestral nature of the Wild Water Bufalo. Moreover, this study has reviewed recent achievements of molecular research in wild bufalo, assessed the technical capacites of research insttutes in Nepal to conduct molecular research required for identfying pure wild individual in KTWR and more importantly initated DNA bank and DNA sequence library of bufalos, which will enable an internatonal collaboraton for advanced molecular research in the future.
Keywords: Asian Wild Bufalo, conservaton, Cytochrome b, phylogenetcs.
DOI: htps://doi.org/10.11609/jot.4940.11.15.14942-14954
Editor: David Mallon, Manchester Metropolitan University, Derbyshire, UK. Date of publicaton: 26 December 2019 (online & print)
Manuscript details: #4940 | Received 01 March 2019 | Final received 16 November 2019 | Finally accepted 27 November 2019
Citaton: Kandel, R.C., R.C. Poudel, A. Sadaula, P. Kandel, K.P. Gairhe, C.P. Pokheral, S.B. Bajracharya, M.K. Chalise & G.S. Solanki (2019). Revisitng genetc structure of Wild Bufaloes Bubalus arnee Kerr, 1792 (Mammalia: Artodactyla: Bovidae) in Koshi Tappu Wildlife Reserve, Nepal: an assessment for translocaton programs. Journal of Threatened Taxa 11(15): 14942–14954. htps://doi.org/10.11609/jot.4940.11.15.14942-14954
Copyright: © Kandel et al. 2019. Creatve Commons Atributon 4.0 Internatonal License. JoTT allows unrestricted use, reproducton, and distributon of this artcle in any medium by adequate credit to the author(s) and the source of publicaton.
Funding: The blood and faecal sample collecton for this study was supported by Harioban Program. DNA sequencing was carried out in Nepal Academy of Science and Technology (NAST) under DNA Barcoding Program funded by Natonal Trust for Nature Conservaton (NTNC).
Competng interests: The authors declare no competng interests.
For Author details, Author contributon, Acknowledgements and Nepali abstract see end of this artcle.
14942 Revisitng phylogenetcs of bufaloes in KTWR Kandel et al.
INTRODUCTION and widely accepted techniques. Therefore, selectng individuals for translocaton programs, identfcaton The domestcated Water Bufalo Bubalus bubalis Kerr, of wild individuals through detailed molecular study 1792 is one of the most important dairy and draf animals of the bufalo populaton protected in the reserve is a in southern Asia. Bufaloes are broadly categorized high priority for the Nepal government. In additon, into two general ‘breeds’ sometmes characterized as understanding the genetc makeup of Wild Bufalo subspecies: river (Bubalus bubalis bubalis) and swamp could be used as the basis for genetc improvement of bufalo (Bubalis bubalis carabanesis). Despite having domestc stock. Natonal capacity building to conduct distnct morphological and behavioural traits and advanced molecular studies should be initated from diferent karyotypes between these two categories of collectng blood and faecal samples, creatng a DNA bufalo, they interbreed easily and produce progeny reference library and carrying out genetc research on with intermediate chromosomes (Mishra et al. 2015). various aspects such as populaton genetcs, breeding Swamp and river bufalo have diferent purposes and are behaviours among diferent bufalo types, disease found in diferent geographical areas. The swamp type, dynamics, and food habits of bufalo populaton in the with wide-spreading horns and some white markings, is reserve. We present results of DNA sequence variaton more similar to Wild Bufalo Bubalus arnee (Kumar et al. in the partal but variable cytochrome b gene among 2007; Mishra et al. 2015). purely wild, feral and domestcated individuals and The Government of Nepal (GoN) established Koshi future prospects for advancing genetc research on Wild Tappu Wildlife Reserve (KTWR), an IUCN Category IV Bufaloes inhabitng KTWR in eastern Nepal. protected area (Heinen 1995), in 1976 primarily to conserve the last Nepalese populaton of Wild Bufalo (Heinen 1993). Wild Bufalo cohabit the reserve with MATERIAL AND METHODS highly backcrossed feral bufalo thought to have been released in the area in the 1950s (Dahmer 1978). Wild Identfcaton of organizatons Water Bufalo Bubalus arnee (Kerr, 1792) is considered Nepal Government, Ministry of Forest and Endangered globally (Kaul et al. 2019), with isolated Environment is working together with local communites populatons in KTWR and selected areas of Bhutan, India, and natonal and internatonal conservaton partners to Thailand and possibly Myanmar and Cambodia (Groves protect wild animals and restore their natural habitats. 1996; Heinen & Srikosamatara 2003; Choudhury & With the aim of establishing viable populatons of Barker 2014). In 2016, 433 Wild Bufaloes were counted endangered species in diferent areas and safeguarding in KTWR (2016). them from poaching and natural calamites such as Despite the possibility of interbreeding between wild food, fre and epidemics, the Ministry of Forests and and domestcated bufalo, it is important to assign extant Environment, Department of Natonal Parks and Wildlife individuals to wild and other types where possible to Reserve (DNPWC) has been regularly translocatng broaden our understanding of the genetc structure of species to their original natural habitats, viz.: One- diferent types and to maintain genetc fngerprintng horned Rhinoceros and Wild Water Bufalo. In 2016, 18 of wild breeds for their conservaton. The introgression individuals of Wild Water Bufaloes were translocated from domestc to wild populaton is female-mediated, from Koshi Tappu Wildlife Reserve (KTWR) to Chitwan therefore mitochondrial DNA (mtDNA) sequencing is Natonal Park. Translocaton was carried out by a team likely to be helpful in the identfcaton of group-specifc of 60 people including three veterinarians and 12 mitotypes. The presence of wild-specifc or domestc- wildlife technicians led by DNPWC with support from specifc haplotypes in either group would allow us to the World Wildlife Fund Nepal, the USAID-supported identfy hybrids (Lau et al. 1998; Flamand et al. 2003). Hariyo Ban Program, Natonal Trust for Nature Furthermore, mtDNA sequence variatons have been Conservaton, Biodiversity Conservaton Centre (NTNC- widely applied in mammals to study inter- and intra- BCC), and the Zoological Society of London (Nepal). species phylogenetc relatonships (Kikkawa et al. 1997; A series of consistent identfcaton criteria that are Lau et al. 1998; Conroy & Cook 1999; Kuwayama & based on phenotypic and behavioural characteristcs Ozawa 2000; Kumar et al. 2007). were used to choose Wild Bufaloes from diferent Conservaton decisions on translocaton should herds for translocaton. Given the availability of highly be based on putatve wild, feral and domestc genetc polymorphic genetc markers, the expert team strongly assignments reliably performed through standard recommended to adopt genetc translocaton as an
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 December 2019 | 11(15): 14942–14954 14943 Revisitng phylogenetcs of bufaloes in KTWR Kandel et al. efectve and reliable management strategy. For this Sampling and blood collecton management strategy to be implemented efectvely A total of 42 blood and faecal samples (Table 1) the team further emphasized the need for insttutonal were collected mainly from individuals residing in and strengthening and capacity building of natonal around KTWR located in the Terai of southeastern Nepal laboratories to conduct genetc research on bufalo (Figure 1). Animals were provisionally divided into before translocatng them from the reserve in future. three classes: domestc (D, n=11), hybrid (H, n=11), and Wildlife veterinarians, biologists and research scholars wild (W, n=20) based on the consistent phenotypic and from DNPWC and NTNC-BCC collected blood and faecal behavioural criteria (Dahmer 1978; Heinen & Paudel samples of bufaloes and initated a genetc study in 2015) and locaton of herds sampling (domestc bufalo the wildlife laboratory of NTNC-BCC and molecular were sampled from the villages nearby KTWR while wild biotechnology laboratory of the Nepal Academy of and feral were sampled using a locaton map of natal Science and Technology. herds prepared by the reserve) and behavioural and
Figure 1. Map of an extant distributon of Asian Water Bufalo Bubalus arnee and locaton of the study area in Koshi Tappu Wildlife Reserve, Nepal.
14944 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 December 2019 | 11(15): 14942–14954 Revisitng phylogenetcs of bufaloes in KTWR Kandel et al.
Table 1. Sample code, classifcaton and individual details of Wild Bufalo Bubalus arnee sampled from Koshi Tappu Wildlife Reserve, Nepal. Blood samples were taken from individuals if not mentoned in sample type.
Sex, age, date of Sex, age, date of Samples code Group collecton Sample type Samples code Group collecton Sample type Female, 10 month, Male, 2.5 years, BufH1 Hybrid BufD21 Domestc 02.vii.2017 27.vi.2017 Female, 6 years, Female, 1 year, BufH2 Hybrid BufD22 Domestc 29.vi.2017 01.vii.2017 Female, 2 years, Male, Adult, BufH3 Hybrid BufW23 Wild* 29.vi.2017 04.ii.2017 Female, 2 years, Male, Adult, BufH4 Hybrid BufW24 Wild* 02.vii.2017 26.i.2017 Male, 2 years, Female, Sub-adult, BufH5 Hybrid BufW25 Wild* 02.vii.2017 06.ii.2017 Male, 2 years, Female, Adult, BufH6 Hybrid BufW26 Wild* 02.vii.2017 01.ii.2017 Male, 2 years, BufH7 Hybrid BufW27 Wild Male, Adult Fecal Sample 29.vi.2017 Male, Adult, Female, 2 years, BufW28 Wild** BufH8 Hybrid 05.ii.2017 29.vi.2017 Female, Adult, Male, 10 month, BufW29 Wild** BufH9 Hybrid 01.ii.2017 02.vii.2017 Female, Adult, Male, 1.5 years, BufW30 Wild** BufH10 Hybrid 01.ii.2017 02.vii.2017 Female, Adult, Female, 8 month, BufW31 Wild** BufH11 Hybrid 06.ii.2017 02.vii.2017 Female, Adult, Female, 1.5 years, BufW32 Wild** BufD12 Domestc 05.i.2017 02.vii.2017 Female/2.5 years, Female, Adult , BufW33 Wild** BufD13 Domestc 06.i.2017 27.vi.2017 BufW34 Wild Female, Adult Fecal sample Female, 10 years, BufD14 Domestc 27.vi.2017 BufW35 Wild Male, Adult Fecal Sample Male, 2 years, BufD15 Domestc 01.vii.2017 BufW36 Wild Male, Adult Fecal sample Male, 2 years, BufW37 Wild Female, Adult Fecal Sample BufD16 Domestc 01.vii.2017 Female, Adult, Male, 1 years, BufW38 Wild* BufD17 Domestc 31.i.2017 01.vii.2017 Female, Adult, Female, 12 years, BufW39 Wild* BufD18 Domestc 29.i.2017 01.vii.2017 Female, Adult, Male, 1 year, BufW40 Wild* BufD19 Domestc 27.i.2017 29.vi.2017 BufW41 Wild Male, Adult Fecal sample Male, 1 year, BufD20 Domestc 29.vi.2017 BufW42 Wild Male, Adult Fecal sample
*—Translocated from KTWR | **—Collected from Central Zoo, Lalitpur | Wild— 20 | Hybrid—11 | Domestc—11.
anatomical phenotypic traits. All animals classifed as protocol. For the faecal samples, a Qiagen QIAMP DNA domestc were river type bufalo with black bodies and Stool Mini Kit was used following the manufacturer’s curled horns (as in the Murrah breed of river bufalo), instructons. Extracted DNA samples were stored at 4°C while those classifed as wild had white chevrons, socks untl they were used for molecular analyses. Aliquots and tail tps, and larger, relatvely straight, pale-coloured of extracted DNA were used for PCR and sequencing. horns (Image 1) similar to swamp bufalos (Heinen 2002). The mitochondrial partal Cytochrome b gene of Hybrid animals had intermediate phenotypes and may 422bp was amplifed using primer pairs (L14724: 5’- be frst generaton crosses or the result of various levels CGAAGCTTGATATGAAAAACCATCGTTG-3’ and H15149: of backcrossing to either wild or domestc. 5’- AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA -3’) (Kocher et al. 1989). PCR was carried out with 3µl DNA Extracton, Polymerase Chain Reacton and template DNA, 15µl of Hot Start Taq 2X Mastermix Sequencing (New England Biolab, UK), 1µl of each primer and 7µl Genomic DNA was extracted from blood using a of nuclease free water in a total reacton volume of 30µl Qiagen DNEasy Blood kit, according to the manufacturer’s using an ABI VeritTM Thermal Cycler (Model no. 9902). Of
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 December 2019 | 11(15): 14942–14954 14945 Revisitng phylogenetcs of bufaloes in KTWR Kandel et al.
Image 1. Translocaton of Wild Bufalo and collecton of blood samples from both domestc and Wild Bufalo: a–b—blood sample collecton from domestc bufalo | c—Wild Bufalo Bubalus arnee | d–e—blood collecton and translocaton of Wild Bufalo from Koshi Tappu Wildlife Reserve to Chitwan Natonal Park, Nepal.
the 42 samples, only 36 were amplifed successfully and Sequence alignment, haplotype identfcaton and rest of the six didn’t amplify even in multple atempts phylogeny due to poor DNA quality. The PCR conditons were an Raw sequence fragments were assembled, checked inital denaturaton at 94°C for 10 minutes, followed and edited with Sequencer 5.0 (Gene Codes Corp., by 35 cycles of denaturaton at 94°C for 30s, annealing Ann Arbor, MI, USA) and contgs of both reverse and at 55°C for 30s, elongaton at 72°C for 45s and a fnal forward primers were created. Sequences were aligned extension at 72°C for 10 minutes. The PCR products with ClustalX (Thompson et al. 1997) in BioEdit. In were electrophoresed at 100 volts for 30 minutes in additon to our 36 sequences (W=15, H=10 and D=11 ), 1.5% agarose gels, viewed in Gel Doc (Syngene InGenius) we included the 42 Nepalese samples (W=7, H=15 and afer staining with Sybr safe and photographed. D=20 ) of Flamand et al. (2003), sequenced and analysed Amplifed DNA fragments were purifed using ExoSap- by Zhang et al. (2016, KR009944-85), four Cytochrome IT Express PCR Product Clean up (Afymetrix Inc., Santa b haplotypes from Indian river bufalo identfed by Clara, CA, USA) following a cycle of 37°C for 15 minutes Kumar et al. (2007, EF409939 H1-4) and 15 Cytochrome and 80°C for 1 minute in a thermo-cycler. High quality b haplotypes defned by Kikkawa et al. (1997), eight river purifed PCR amplicons were subjected to Dideoxy bufalo from Bangladesh, Sri Lanka, Italy and Pakistan sequencing in a total volume of 10µl containing 1µl and seven swamp bufalo from Japan, Taiwan, Thailand, purifed PCR product, 1µl Big Dye terminator sequencing Philippines, Indonesia and Bangladesh (D34637–38, mixture (V3.1) (BIGDYE Terminator Cycle Sequencing Kit, D88627–38, D88983). Applied Biosystems, Foster, CA, USA), 1.5µl sequencing All sequences were aligned and mitochondrial bufer and 1.5µl primer (10µm). Sequencing was done haplotypes were defned in DnaSP v5, and haplotype (h) at Nepal Academy of Science and Technology, Molecular and nucleotde diversity (π) were estmated using DnaSP Biotechnology Laboratory, in an ABI 3500XL automated v5 (Librado & Rozas 2009). Genetc diferentaton within DNA sequencer (Applied Bio-systems, Forster City, and between bufalo groups (wild, hybrid and domestc) CA, USA). Sequencing for the majority samples was was estmated by an analysis of molecular variance performed for one tme but in the case sequence quality (AMOVA) using 10,000 permutatons in Arlequin v3.5 was low and/or polymorphism was observed then re- (Excofer & Lischer 2010). Similarly, pairwise genetc sequencing was done for confrmaton. Successful divergences between groups (FST) was also calculated sequences of 36 samples were deposited in GenBank and signifcances tested using 10,000 permutatons in (Accession no. MH718851–85) Arlequin v3.5. Phylogenetc relatonships among haplotypes were
14946 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 December 2019 | 11(15): 14942–14954 Revisitng phylogenetcs of bufaloes in KTWR Kandel et al. derived through a reduced median network v4.6 (Bandelt when compared with river bufalo sequence of Kikkawa et al. 1999). To identfy phylogenetc lineages, maximum et al. (1997), the divergence was slightly higher: 0.24 parsimony (MP) analysis was performed in PAUP 4.0b10 to 0.74 %. Sequence divergence within swamp bufalo (Swoford 2002) using the heuristc search opton was 0.24 to 0.98%. The sequence divergence between with 1,000 random additons and the tree bisecton- swamp and river bufalo was calculated to be 1.49 to reconnecton (TBR) swapping and the MULTrees opton 2.49%. on. Branch support was provided by a bootstrap analysis of 10,000 replicates of heuristc searches, with the Haplotype Identfcaton, Diferentatons, and MULTrees opton on and TBR swapping of. Consistency Phylogenetc relatons indices (CI) and retenton indices (RI) were obtained in The 97 partal cytochrome b sequences, including PAUP. In additon, a neighbor-joining (NJ) tree (Saitou 36 from this study, showed a total of 13 variable sites & Nei 1987) was produced using MEGA7 (Kumar et al. (Table 2, see Figure 2), which defned nine haplotypes. 2016). Nepalese bufalo had either haplotype H1, H2 or H3, but the three classes domestc (D), hybrid (H) and wild (W) were represented among both H1 and H2 RESULTS (H1: D=23,W=18, H=17; H2: H=8, D=7, W=2 and H3: W=2). The most common haplotype (H2) was widely Sequence Variaton and Divergence distributed among groups and represented by 66% of The lengths of the 36 partal cytochrome b sequences sequences (Nepal: D=23, W=18 and H=17; one of Kumar including primers at both ends for all the three types of et al. (2007); and fve of Kikkawa et al. (1997). The bufalo were 486bp. When primers on either end were second most common haplotype (H1) was represented removed the sequence lengths were 422bp. The aligned by 20% of the samples (H=8, D=7, and W=2) and one matrix without primers contained two variable sites each from Kumar et al. (2007) and Kikkawa et al. (1997). (Table 2), however, when our data set was compared Three sequences of Nepalese samples, two from this with the accession data of Zhang et al. (2016), Kumar et study and one each from Zhang et al. (2016) and Kumar al. (2007), and Kikkawa et al. (1997), base substtutons et al. (2007) were restricted to the third haplotype (H3). at 13 nucleotde positons (variable sites) were obtained Of the remaining six haplotypes, one was reported by and, among them, three nucleotde positons were Kumar et al. (2007; H4) while the remaining fve (H5 to specifc for river bufalo and 10 positons were specifc H9) were defned by Kikkawa et al. (1997). Haplotypes 4, for swamp bufalo. The sequence divergence within 6 and 7 were found in river animals from other countries bufalo of Nepal and India was 0.24 to 0.49 %; however, (i.e., not Nepal) and haplotypes 5, 8 and 9 were specifc
Table 2. Variable nucleotde positons for the partal Cytochrome b gene of the 36 accessions of the present study, 42 accessions of Zhang et al. (2016), four accessions of Kumar et al. (2007), and 15 accessions of Kikkawa et al. (1997).
Nucleotde positons
Haplotypes 30 61 79 81 87 99 147 234 240 375 379 411 417 Frequency Remarks Nepal sample, Kikkawa et al. (1997), Kumar et H1 T C G T T C T A G T T A A 64 al. (2007), Zhang et al. (2016)
H2 T C G T T T T A G T T A A 19 As above
H3 T C G T T C T A C T T A A 4 As above
H4 T C G T T C T A A T T A A 1 Kumar et al. (2007)
H5 C C G C T C C G G C C A G 2 Kikkawa et al. (1997)
H6 T C G T T C T A G T T A T 1 As above
H7 T C A T T T T A G T T A A 1 As above
H8 C C G C T C C G G C C A A 4 As above
H9 C G G C A C C G G C C G A 1 As above
Total 97
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 December 2019 | 11(15): 14942–14954 14947 Revisitng phylogenetcs of bufaloes in KTWR Kandel et al.
Table 3. Haplotype diversity (h) and nucleotde diversity (π) estmated from partal mitochondrial Cytochrome b sequences of 78 Nepalese bufalo of three diferent groups (wild, domestcated, and hybrid).
No. of h (Haplotype π (nucleotde Bufalo haplotypes Sample size SD SD diversity) diversity) (H) Wild This study 3 15 0.362 0.145 0.00095 0.00041
Zhang et al. 2016 2 7 0.286 0.196 0.00071 0.00049
Total 3 22 0.329 0.121 0.00086 0.00034
Hybrid This study 2 10 0.467 0.132 0.000116 0.00033
Zhang et al. 2016 2 15 0.476 0.092 0.00119 0.00023
Total 2 25 0.453 0.072 0.00113 0.00018
Domestcated This study 2 11 0.509 0.101 0.00127 0.00025
Zhang et al. 2016 3 20 0.353 0.123 0.00092 0.00034
Total 3 31 0.411 0.087 0.00106 0.00024
All this study 3 36 0.438 0.082 0.00116 0.00024
All Zhang et al. (2016) 3 42 0.382 0.076 0.00098 0.00021
Total 3 78 0.403 0.055 0.00105 0.00016
conducted for 78 Nepalese bufaloes under three groups showed highest variaton (97.21%) parttoned within groups and very litle variaton (2.782%) parttoned
among them with an overall fxaton index FST of 0.0278 (p > 0.05) (Table 4). The pairwise genetc variatons
between groups also revealed non-signifcant low FST
scores (wild vs hybrid, FST - 0.055, p = 0.126; wild vs
domestc, FST - 0.002, p = 0.416 and hybrid vs domestc,
FST - 0.020, p = 0.546). The maximum parsimony analysis of the 97 sequences revealed four distnct clades (clades A through D) with moderate to high bootstrap values (Figure 3). The three most parsimonious trees (CI = 1.00, RI = 1.00, length = 15 steps) were recovered. Clade A contained all H1 sequences plus one H4 and
Figure 2. Reduced median network constructed with 422bp one H6, Clade B contained all 19 H2 sequences plus one sequences of 9 cytochrome b haplotypes of the bufalo from Nepal, H7, Clade C contained all four sequences of Haplotype India, Pakistan, Bangladesh, Sri Lanka, Japan, Indonesia, Philippines, H3 and Clade D, with a high bootstrap value (99%), and Italy. Circle sizes in the network are proportonal to the sequence frequencies over the data sets | colours of circles indicate diferent included all swamp animals (Haplotypes H5, H8, H9). haplotype | largest circles are the most abundant haplotypes | The strong separaton of swamp and river bufalo is slashes across the branches represent mutatonal steps. also shown by the median joining network, with six mutatons separatng H8 and H2. Neighbour-joining (NJ) phylogenetc analysis showed the same topology to swamp bufalo. (Supportng informaton, Appendix 1). Within groups, haplotype diversity was highest in hybrids followed by domestcated bufalo, and slightly lower in Wild Bufalo (Table 3). Overall haplotype DISCUSSION and nucleotde diversites were 0.403 and 0.00105, respectvely. Haplotypes were divided into two branches Conservaton status of Wild Bufalo populaton in Nepal corresponding to river and swamp bufalo by six Nepal is home to a populaton of the Endangered nucleotde mutatons. River bufalo were found to be Asiatc Wild Bufalo Bubalus arnee, the progenitor of less diverse genetcally than swamp bufalo. The AMOVA domestcated water bufalo (Lei et al. 2007). Recent
14948 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 December 2019 | 11(15): 14942–14954 Revisitng phylogenetcs of bufaloes in KTWR Kandel et al.
Table 4. Analysis of molecular variance (AMOVA) for the three groups of bufaloes based on partal cytochrome b region.
Percentance of Source of variaton df Sum of squares Variance components Fixaton indices (F ) variaton ST
Among populatons 2 0.716 0.00590 2.78237 0.02782* Within populatons 75 15.463 0.20618 97.21763
*p > 0.05
Figure 3. Maximum parsimony tree constructed using 422bp partal Cytochrome b sequences of 36 bufaloes of Nepal (this study), 42 additonal Nepalese sequences of Zhang et al. (2016), four sequences of Kumar et al. (2007), and 15 sequences of both river and swamp bufalo from Kikkawa et al. (1997). Numbers on the branches are bootstrap values.
censuses of Wild Bufalo in KTWR revealed that the Park, however, Wild Bufalo have been restricted to populaton increased to 433 individuals (KTWR 2016), KTWR for an estmated 60 years and they are under an increase of 105 individuals compared to 2014 (Khatri constant threat of extrpaton from foods, habitat et al. 2013 ). There were only 63 individuals at the tme deterioraton, hybridizaton, and the potental for of establishment of KTWR in 1976 (Dahmer 1978). The diseases and parasites transmited by domestc livestock historic range of this species extended further west (Heinen & Kandel 2006). Since Wild Bufalo have within Nepal, and at least as far as Chitwan Natonal been eliminated from the greater part of their former
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 December 2019 | 11(15): 14942–14954 14949 Revisitng phylogenetcs of bufaloes in KTWR Kandel et al. range, the Nepalese populaton is very important for share grazing areas, where crossbreeding between the survival of the species globally (Beyers et al. 1995; groups occurs frequently. Moreover, low genetc Hedges 1995, 2001; Choudhury & Barker 2014). variaton between groups is also atributed to local the Given the precarious existence of Wild Bufalo farmers’ practce of crossbreeding domestc females within KTWR, several wildlife conservatonists have with wild males (Heinen 2001). emphasized the need to translocate a sufcient number NJ and MP analysis performed (results not shown) with of individuals to sites within their indigenous range. the complete length (1,120bp) cytochrome b sequences Chitwan Natonal Park had this species at least untl the of Zhang et al. (2016, 42 Nepalese sequences), Kumar 1950s (Spillet & Tamang 1966; Aryal et al. 2011) and et al. (2007, four river bufalo haplotypes), and Kikkawa has extensive grassland areas, and much larger riverine et al. (1997, seven river and eight swamp haplotypes) habitats with sufcient upland areas that are not prone provided essentally the same topography of the tree to fooding, compared to KTWR (Heinen & Paudel 2015). but an additon of one more haplotype represented by For these reasons 18 Wild Bufaloes were translocated Genbank accession KR009945NP_D07 alone. to Chitwan Natonal Park from KTWR recently, and more Lau et al. (1998) using partal cytochrome b sequence need to be moved in the near future (Shah et al. 2017; (303bp) and D-loop (158bp) sequence suggested that Kandel et al. 2018). Wild Asian Water Bufalo (Bubulus arnee) in Assam, Nepal and Indo-China is the possible ancestor of both Identfcaton of wild individuals in KTWR river and swamp bufalo. The study by Tanaka et al. Translocaton of endangered species can restore (1996) also supports this hypothesis. Nepal’s Wild species, protect populatons from threats and reinstate Bufalo show swamp type phenotypic characteristcs but the local ecosystem functons (Tarszisz et al. 2014). Zhang et al. (2011) found them genetcally closer to river Adequate morphological and genetc studies should bufalo. Our study is consistent with Zhang et al. (2011) be carried out to distnguish putatve wild from feral in that our MP, NJ and Network analyses of swamp backcrossed animals for translocaton programs. During bufalo showed distnct variaton with a bootstrap translocaton enough purely wild individuals must value of almost 100% and six nucleotde diferences be moved to assure genetc variaton in the founding between these groups. Similar results were obtained populaton. Although the recent selecton of individuals by Mishra et al. (2015) in upper Assamese and Chilika for translocaton to Chitwan was based on phenotypic populatons of domestc bufalo, which show phenotypic and behavioural characteristcs widely recommended similarites to swamp bufalo but are also genetcally by Dahmer (1978), many individuals of mixed wild- closer to wild-type bufalo in the region. Our mult- domestc ancestry may not be correctly distnguished lineage MP and NJ trees and several previous studies from wild animals (Flamand et al. 2003). (Tanaka et al. 1996; Lau et al. 1998; Zhang et al. 2011, On the basis of the partal cytochrome b sequences, 2016; Mishra et al. 2015) inferred the ancestral nature we were able to defne only three haplotypes in Nepalese of Wild Water Bufalo including the remnant populaton bufalo. None of the haplotypes were specifc to wild, in Nepal. In this context, to determine genetcally pure domestc and hybrid types identfed here. These wild individuals in KTWR detailed and advanced genetc haplotypes had been identfed by Zhang et al. (2007, research is necessary. 2016), Kumar et al. (2007), and Kikkawa et al. (1997) in their Nepalese, Indian, and wider samples (Pakistan, Natonal capacity building and close collaboratons for Bangladesh, Thailand and Sri Lanka). Although we genetc translocaton have used the partal sequence of cytochrome b gene, Phylogenetc analysis of partal cytochrome b the complete length (1,120bp) of this gene sequence region revealed overlapping clusters of wild, feral and reported from other studies (Kikkawa et al. 1997; domestc bufalo types residing in KTWR. The fndings Kumar et al. 2007) including 42 Nepalese samples from of this study along with previous genetc studies on Zhang et al. (2016) did not show consistent distnctons water bufalo populatons distributed globally including between wild, hybrid, and domestc group of bufalos. Wild Bufaloes of KTWR suggest that, single marker Non-signifcant genetc variability observed between or partally overlapping markers are not sufcient three groups of bufaloes and the highest, i.e., 97.21% to show the level of admixture and introgression of total variatons found within group in AMOVA analysis, domestc in wild stock at the local level. Genome level clearly shows an evidence of gene fow between groups. assessments of source populaton offers specifc criteria In KTWR, most of the tme wild, feral and domestc herds and objectve means for translocaton of an appropriate
14950 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 December 2019 | 11(15): 14942–14954 Revisitng phylogenetcs of bufaloes in KTWR Kandel et al. group of bufalos. Over the past several years thousands in the translocaton program can ensure longer-term of Single Nucleotde Polymorphisms (SNPs) have been welfare and wellbeing of the re-introduced populaton. identfed in wild and farm animals (Ciani et al. 2014; Before embarking on a genetc translocaton program Decker et al. 2014; Edea et al. 2014) including river and for the bufalo of KTWR, Nepal should upscale its swamp bufalo (Imartno et al. 2017; Colli et al. 2018). laboratory facilites, design populaton-based advanced Axiom® Bufalo Genotyping Array that includes about genetc research and take the initatve to build a DNA 90K SNP loci covering the water bufalo genome-wide bank of all possible individuals counted in 2016. The was developed in collaboraton with the Internatonal DNA bank, reference DNA sequences and genotype Bufalo Genome Consortum. This 90K “SNP-Chip” was database are crucial for research and conservaton tested in several river bufalo populatons throughout its eforts, to enhance our understanding of genetc distributon and found to have about 70% high quality efects of introgression, the study of dietary paterns and polymorphic SNPs (Iamartno et al. 2017). This on diferent bufalo types and assess the status of chip provides tremendous opportunity for genome pathogens afectng the bufaloes with diferent genetc wide investgaton of genetc diversity and populaton backgrounds. Using the same blood samples collected structure in wild and feral bufalos, their genetc during this study we have reported the prevalence mapping and quantfcaton of the level of domestc of malaria parasites for the frst tme in bufaloes of introgression into wild happening in diferent herds of KTWR (Kandel et al. 2019). Given the lack of highly KTWR. This ability will further help to select genetcally technical laboratories and trained manpower in Nepal pure wild individuals for a translocaton. Few studies and the urgency to identfy wild individuals reliably, have proposed translocaton protocols focusing on collaboratve research with internatonal universites, how many and what individuals should be selected research insttutes and conservaton partners on representng diferent herds of putatve wild stock or advanced molecular studies are to be jointly conducted. feral backcrossed (Heinen 2002; Heinen & Kandel 2006; In conclusion this research sets a baseline to develop Heinen & Paudel 2015) bufalo in KTWR. Before planning well defned acton-oriented strategies that guide pre- a translocaton of bufaloes, the current protocol should translocaton genetc study of wild bufaloes in KTWR be revised thoroughly to decide on the selecton of an and their monitoring through post-translocaton genetc adequate number of appropriate individuals from each studies. Key actons highlighted in this paper such as herd and for SNP genotyping throughout the whole collaboraton between partners, establishment of DNA genome of those selected individual bufaloes. bank of all extant individuals in KTWR, involve experts Sufcient genetc diversity of wild individuals or feral from diferent disciplines, upscale and strengthen backcrossed as suggested by Heinen & Paudel (2015) present laboratories and build capacity of available should be represented from a source populaton of human resources for genomic level data management KTWR to the translocated populaton in the natve area are important steps to be taken by the Ministry of Forest such as Chitwan, Bardiya or other appropriate sites and Environment, Department of Natonal Parks and (Heinen 2002) in Nepal. Founding genetc diversity Wildlife Conservaton and its natonal and internatonal of translocated populaton will be determined by the conservaton partners for genetc translocaton of Wild number of genetcally variable wild individuals, the Bufalo including other threatened species of Nepal. proporton of diverse pure stocks, those that contribute genetcally to the next generaton and number and frequency of polymorphic alleles that represent whole REFERENCES genomes of the source populaton. Translocated Aryal, A., T.K. Shrestha, A. Ram, W. Frey, C. Groves, H. Hemmer, M. populatons are mostly small in size therefore they are Dhakal, R.K. Koirala, J.T. Heinen & D. Raubenheimer (2011). A call to prone to loss of genetc diversity very rapidly through save the wild water bufalo (Bubalus arnee) in Nepal. Internatonal genetc drif (Frankham et al. 2012). Genetc assessment Journal of Conservaton Science 2(4): 261–268. Bandelt, H.J., P. Forster & A. Röhl (1999). Median-joining networks for of source populatons in advance of translocaton (pre- inferring intraspecifc phylogenies. Molecular Biology and Evoluton translocaton) helps to guide translocaton plans and 16(1): 37–48. htps://doi.org/10.1093/oxfordjournals.molbev. inform post translocaton assessment or monitoring of a026036 Beyers, O., S. Hedges & U.S. Seal (1995). Asian wild catle conservaton genetc diversity in the founders (Groombridge et al. assessment and management plan working document. IUCN/SSC 2012). In additon to genetcists, actve involvement Conservaton Breeding Specialist Group: Apple Valley, MN. 121pp. of conservaton biologists, wildlife experts, wildlife Choudhury, A. & J.S.F. Barker (2014). Wild Water Bufalo Bubalus arnee (Kerr, 1792), pp. 255–301 In: Mellet, M. & J. Burton (eds). Ecology, veterinarians, ecologists, physiologists and local people Evoluton and Behaviour of Wild Catle. Cambridge University Press,
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 December 2019 | 11(15): 14942–14954 14951 Revisitng phylogenetcs of bufaloes in KTWR Kandel et al.
Cambridge, 512pp. Heinen, J.T. (1995). Nature Preserves, pp. 551–561. In: Nierenberg, Ciani, E., P. Crepaldi, L. Nicoloso, E. Lasagna, F.M. Sart, B. Moioli, W.A. (ed.). Encyclopedia of Environmental Biology. Academic Press, F. Napolitano, A. Carta, G. Usai, M. D’Andrea, D. Marleta, R. San Diego, California, USA. Ciampolini, V. Riggio, M. Occidente, D. Matassino, D. Kompan, Heinen, J.T. (2001). A translocaton proposal for Wild Bufalo (Bubalus P. Modesto, N. Macciota, P. Ajmone-Marsan & F. Pilla bubalis) in Nepal: recommended management acton in the face of (2014). Genome wide analysis of Italian sheep diversity reveals uncertainty for a critcally endangered species. Tiger Paper 28(3): a strong geographic patern and cryptc relatonships between 1–8. breeds. Animal Genetcs 45(2): 256–266. htps://doi.org/10.1111/ Heinen, J.T. (2002). Phenotypic and behavioural characteristcs used age.12106 to identfy Wild Bufalo (Bubalus bubalis) from feral backcrosses in Colli, L., M. Milanesi, E. Vajana, D. Iamartno, L. Bomba, F. Puglisi, Nepal. Journal of the Bombay Natural History Society 99: 173–183. M.D. Corvo, E.L. Nicolazzi, S.S.E. Ahmed, J.R.V. Herrera, L. Cruz, S. Heinen, J.T. & R.C. Kandel (2006). Threats to a small populaton: A Zhang, A. Liang, G. Hua, L. Yang, X. Hao, F. Zuo, S.J. Lai, S. Wang, census and conservaton acton plan for wild bufalo in Nepal. Oryx R. Liu, Y. Gong, M. Mokhber, Y. Mao, F. Guan, A. Vlaic, B. Vlaic, L. 40(3): 324–330. htps://doi.org/10.1017/S0030605306000755 Ramunno, G. Cosenza, A. Ahmad, I. Soysal, E.O. Ünal, M. Ketudat- Heinen, J.T. & P. Paudel (2015). On the translocaton of Asian bufalo Cairns, J.F. Garcia, Y.T. Utsunomiya, P.S. Baruselli, M.E.J. Amaral, Bubalus arnee in Nepal: are feral backcrosses worth conserving? R. Parnpai, M.G. Drummond, P. Galbusera, J. Burton, E. Hoal, Y. Conservaton Science 3: 11–19. Yusnizar, C. Sumantri, B. Moioli, A. Valentni, A. Stella, J.L. Williams Heinen, J.T. & S. Shrikosamatara (1996). Status and protecton of & P. Ajmone-Marsan (2018). New insights on water bufalo Asian wild catle and bufalo. Conservaton Biology 10(4): 931–934. genomic diversity and post-domestcaton migraton routes from htps://doi.org/10.1046/j.1523-1739.1996.10040931.x medium density SNP chip data. Fronter in Genetcs 9: 53. htps:// Iamartno, D., E.L. Nicolazzi, C.P. Van Tassell, J.M. Reecy, E.R. Fritz- doi.org/10.3389/fgene.2018.00053 Waters, J.E. Koltes, S. Bifani, T.S. Sonstegard, S.G. Schroeder, P. Conroy, C.J. & J.A. Cook (1999). MtDNA evidence for repeated Ajmone-Marsan, R. Negrini, R. Pasquariello, P. Ramelli, A. Coleta, pulses of speciaton within arvicoline and murid rodents. J.F. Garcia, A. Ali, L. Ramunno, G. Cosenza & D.A.A. de Oliveira Journal of Mammalian Evoluton 6(3): 221–245. htp://doi. (2017). Design and validaton of a 90K SNP genotyping assay for the org/10.1023/A:1020561623890 water bufalo (Bubalus bubalis). Plos ONE 12(10): e0185220. htps:// Corbet, G.B. & J.E. Hill (1992). Mammals of the Indomalayan Region. doi.org/10.1371/journal.pone.0185220 A Systematc Review. Oxford University Press, Oxford, UK, 488pp. IUCN (2013). IUCN Red List of Threatened Species. Version 2013.2. Dahmer, T. (1978). Status and Distributon of the Wild Bufalo (Bubalus www.iucnredlist.org, downloaded on 24 May, 2014 bubalis) in Nepal. MS Thesis, University of Montana, Missoula, Kandel, R.C., G.S. Solanki, M.K. Chalise & B.K. Sharma (2018). Montana, USA, 120pp. Populaton and Demography of Asian Wild Bufalo (Bubalus arnee Decker, J.E., S.D. McKay, M.M. Rolf, J.W. Kim, A.M. Alcalá, T. S. Kerr, 1792) at Koshi Tappu Wildlife Reserve, Nepal. Journal of Sonstegard, O. Hanote, A. Götherström, C.M. Seabury, L. Emerging Trends in Economics and Management Sciences 9(4): Praharani, M.E. Babar, L.C.A. Regitano, M.A. Yildiz, M.P. Heaton, 212–218. W.S. Liu, C.Z. Lei, J.M. Reecy, M. Saif-Ur-Rehman, R.D. Schnabel Kandel, R.C., M. Shrestha, A. Saduala, K.C. Medha, J. Maharjan, & J.F. Taylor (2014). Worldwide paterns of ancestry, divergence, G.S. Solanki, M.K. Chalise, M. Asada, O. Kaneko, R.C. Poudel & K. and admixture in domestcated catle. PLoS Genet. 10:e1004254. Pandey (2019). First report of malaria parasites in water bufalo in htps://doi.org/10.1371/journal.pgen.1004254 Nepal. Veterinary Parasitology: Regional Studies and Reports 18: Edea, Z., S.W. Kim, K.T. Lee, T.H. Kim & K.S. Kim (2014). Genetc Structure 100348. htps://doi.org/10.1016/j.vprsr.2019.100348 of and Evidence for Admixture between Western and Korean Natve Kaul, R., A.C. Williams, K. Rithe, R. Steinmetz, & R. Mishra Pig Breeds Revealed by Single Nucleotde Polymorphisms. Asian- (2019). Bubalus arnee. The IUCN Red List of Threatened Species 2019: Australasian Journal of Animal Sciences 27(9): 1263–1269. htps:// e.T3129A46364616. htps://doi.org/10.2305/IUCN.UK.2019-1.RLTS. doi.org/10.5713/ajas.2014.14096 T3129A46364616.en. Downloaded on 10 November 2019. Excofer, L. & H.E.L. Lischer (2010). Arlequin Suite Ver 3.5: a new Khatri, T.B., D.N. Shah & N. Mishra (2012). Wild Water Bufalo Bubalus series of programs to perform populaton genetcs analyses under arnee in Koshi Tappu Wildlife Reserve, Nepal: status, populaton and Linux and Windows. Molecular Ecology Resources 10: 564–567. conservaton importance. Journal of Threatened Taxa 4(14): 3294– htps://doi.org/10.1111/j.1755-0998.2010.02847.x 3301. htps://doi.org/10.11609/JoTT.o2990.3294-301 Flamand, J.R.B., D. Vankan, K.P. Gairhe, H. Duong & J.S.F. Barker Kikkawa, Y., H. Yonekawa, H. Suzuki & T. Amano (1997). Analysis (2003). Genetc identfcaton of wild Asian water bufalo in Nepal. of genetc diversity of domestc water bufalo and anoas based Animal Conservaton 6(3): 265–270. htps://doi.org/10.1017/ on variatons in the mitochondrial gene for cytochrome b. S1367943003003329 Animal Genetcs 28(3): 195–201. htps://doi.org/10.1111/j.1365- Frankham, R., J.D. Ballou & D.A. Briscoe (2012). Introducton to 2052.1997.00101.x conservaton genetcs. Cambridge University Press, UK, 618pp. Kocher, T.D., W.K. Thomas, A. Meyer, S.V. Edwards, S. Paabo, F.X. Groombridge, J.J., C. Raisin, R. Bristol & D.S. Richardson (2012). Villablanca & A.C. Wilson (1989). Dynamics of mitochondrial DNA Genetc consequences of reintroductons and insights from evoluton in animals: amplifcaton and sequencing with conserved populaton history, pp. 395–440. In: Ewen, J.G, D.P. Armstrong, primers. Proceeding of the Natonal Academy of Science USA 86(16): K.A. Parker & P.J. Seddon (eds.). Reintroducton Biology: Integratng 6196–6200. htps://doi.org/10.1073/pnas.86.16.6196 Science and Management. Wiley-Blackwell Publicaton. KTWR (2016). Census of Asiatc Water Bufalo (Bubalus arnee) at Koshi Groves, C.P. (1996). The taxonomy of the Asian wild bufalo from the Tappu Wildlife Reserve: 2016. Department of Natonal Parks and Asian mainland. Internatonal Journal of Mammalian Biology 61: Wildlife Reserve and Koshi Tappu Wildlife Reserve (KTWR), 78pp. 327–338. Kumar, S., M. Nagarajan, J.S. Sandhu, N. Kumar, V. Behl & G. Nishanth Hedges, S. (1995). Asian Wild Catle and Bufalo: Draf Status Report (2007). Mitochondrial DNA analyses of Indian water bufalo support and Conservaton Acton Plan (Part I and II). Gland, Switzerland, a distnct genetc origin of river and swamp bufalo. Animal Genetcs 310pp. 38(3): 227–232. htps://doi.org/10.1111/j.1365-2052.2007.01602.x Hedges, S. (2001). Asian Wild Catle Specialist Group Quadrennial Kumar, S., G. Stecher & K. Tamura (2016). MEGA7: Molecular Report. Gland Switzerland, 122pp. Evolutonary Genetcs Analysis version 7.0 for bigger datasets. Heinen, J.T. (1993). Populaton viability and management Molecular Biology and Evoluton 33(7): 1870–1874. htps://doi. recommendatons for wild water bufalo (Bubalus bubalis) org/10.1093/molbev/msw054 in Nepal. Biological Conservaton 65(1): 29–34. htps://doi. Kuwayama, R. & T. Ozawa (2000). Phylogenetc relatonships org/10.1016/0006-3207(93)90193-5 among European Red Deer, Wapit, and Sika Deer inferred from
14952 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 December 2019 | 11(15): 14942–14954 Revisitng phylogenetcs of bufaloes in KTWR Kandel et al.
mitochondrial DNA sequences. Molecular Phylogenetcs and Evoluton 15: 115–123. htps://doi.org/10.1006/mpev.1999.0731 Lau, C.H., R.D. Drinkwater, K. Yusof, S.G. Tan, D.J.S. Hetzel & J.S.F. Barker (1998). Genetc diversity of Asian Water Bufalo (Bubalus bubalis): Mitochondrial DNA D-loop and cytochrome b sequence variaton. Animal Genetcs 29(4): 253–264. htps://doi.org/10.1046/ j.1365-2052.1998.00309.x Lei, C.Z., W. Zhang, H. Chen, F. Lu, R.Y. Liu, X.Y. Yang, H.C. Zhang, Z.G. Liu, L.B. Yao, Z.F. Lu & Z.L. Zhao (2007). Independent maternal origin of Chinese Swamp Bufalo (Bubalus bubalis). Animal Genetcs 38(2): 97–102. htps://doi.org/10.1111/j.1365-2052.2007.01567.x Librado, P. & J. Rozas (2009). DnaSP v5: A sofware for comprehensive analysis of DNA polymorphism data. Bioinformatcs 25(11): 1451– 1452. htps://doi.org/10.1093/bioinformatcs/btp187 Mishra, B.P., P.K. Dubey, B. Prakash, P. Kathiravan, S. Goyal, D.K. Sadana, G.C. Das, R.N. Goswami, V. Bhasin, B.K. Joshi & R.S. Kataria (2015). Genetc analysis of river, swamp and hybrid bufalo of north-east India throw new light on phylogeography of Water Bufalo (Bubalus bubalis). Journal of Animal Breeding and Genetcs 132(6): 454–456. htps://doi.org/10.1111/jbg.12141 Saitou, N. & M. Nei (1987). The neighbor-joining method: a new method for reconstructng phylogenetc trees. Molecular Biology and Evoluton 24(4): 406–425. htp://doi.org/10.1093/ oxfordjournals.molbev.a040454 Shah, R., S. Tripathi & B. Bhata (2017). Translocaton of Wild Asian Bufalo (Bubalus arnee): a way forward to conservaton in Nepal, pp. 175–178. In: Proceedings of the Internatonal Bufalo Symposium, 242pp. Spillet, J.J. & K.M. Tamang (1966). Wildlife Conservaton in Nepal. Journal of the Bombay Natural History Society 63: 557–572 Swoford, D.L. (2002). PAUP* Version 4.0 b10. Phylogenetc Analysis Using Parsimony (* and Other Methods) Tanaka, K., C.D. Solis, J.S. Masangkay, K. Maeda, Y. Kawamoto & T. Namikawa (1996). Phylogenetc relatonship among all living species of the genus Bubalis based on DNS sequences of the cytochrome b gene. Biochemical Genetcs 34(11): 443–452. htps:// doi.org/10.1007/BF00570125 Tarszisz, E., C.R. Dickman & A.J. Munn (2014). Physiology in conservaton translocatons. Conservaton Physiology 2(1): 1–19. htps://doi.org/10.1093/conphys/cou054 Thompson, J.D., T.J. Gibson, F. Plewniak, F. Jeanmougin & D.G. Higgins (1997). The CLUSTAL X windows interface: Flexible strategies for multple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25(24): 4876–4882. htps://doi.org/10.1093/ nar/25.24.4876 Zhang, Y., Y. Lu, M. Yindee, K.Y. Li, H.Y. Kuo, Y.T. Ju, S. Ye, M.O. Faruque, Q. Li, Y. Wang, V.C. Cuong, L.D. Pham, B. Bouahom, B. Yang, X. Liang, Z. Cai, D. Vankan, W. Manatchaiworakul, N. Kowlim, S. Duangchantrasiri, W. Wajjwalku, B. Colenbrander, Y. Zhang, P. Beerli, J.A. Lenstra & J.S. Barker (2016). Strong and stable geographic diferentaton of swamp bufalo maternal and paternal lineages indicates domestcaton in the China/Indochina border region. Molecular Ecology 25(7): 1530–1550. htps://doi. org/10.1111/mec.13518 Zhang, Y., D. Sun, Y. Yu and Y. Zhang (2007). Genetc diversity and diferentaton of Chinese domestc bufalo based on 30 microsatellite markers. Animal Genetcs 38: 569–575. htps://doi. org/10.1111/j.1365-2052.2007.01648.x Zhang, Y., D. Vankan, Y. Zhang & J.S. Barker (2011). Genetc diferentaton of water bufalo (Bubalus bubalis) populatons in China, Nepal and South East Asia: inferences on the region of domestcaton of the swamp bufalo. Animal Genetcs 42(4): 366– 377. htps://doi.org/10.1111/j.1365-2052.2010.02166.x
Appendix 1. Neighbour-joining tree for 97 partal Cytochrome b sequences of river and swamp Water Bufalo. Numbers on the nodes are percentage bootstrap values from 10000 replicatons. Color of the clade correspond to diferent haplotypes as depicted in Figure 2.
Journal of Threatened Taxa | www.threatenedtaxa.org | 26 December 2019 | 11(15): 14942–14954 14953 Revisitng phylogenetcs of bufaloes in KTWR Kandel et al.
Authors details: Ram Chandra Kandel has served in protected areas of Nepal for 22 years and currently actng as joint secretary in Ministry of Forests and Environment, Department of Natonal Parks and Wildlife Conservaton. He has published dozens of papers in the natonal and internatonal journals and few book chapters on habitat ecology, mega-fauna and animal behavior. Ram Chandra Poudel is interested in conservaton genetcs and phylogeography of threatened fora and fauna natve to Himalaya region. He is actvely involved in creatng DNA reference library of endangered species naturally distributed in Nepal Himalaya. He has published on conservaton genetcs, traditonal use and community management of Himalayan plants. Amir Sadaula is Wildlife Veterinarian working in Natonal Trust for Nature Conservaton-Biodiversity Conservaton Center in Sauraha Chitwan. He is interested in molecular research focused on phylogentc study of wildlife and wildlife disease surveillance. He had major role in rescue and major translocaton of wildlife across Nepal. Prakriti Kandel has keen interest in the feld of molecular biology as well as Wildlife Conservaton. She carried out a research on assessment of the glucocortcoid hormones in Asiatc Elephants Elephas maximus of Nepal. She is determined to conserve the endangered animals through using latest molecular tools. Kamal Prasad Gairhe was statoned in Chitwan Natonal Park as Wildlife veterinarian for more than 25 years. He contributed to several wildlife translocatons and genetc studies; captve elephant health, breeding, and diseases (Tuberculosis and EEHV). He has played a key role to atract young researchers on wildlife health issues. Chiranjibi Prasad Pokheral is a wildlife biologist, currently working as the Chief of the NTNC- Central Zoo, Nepal. He has over two decade-long feld experience and his research interest includes the human wildlife confict, interacton with predator-prey relaton, wildlife habitats and the conservaton biology of large carnivores. Siddhartha Bajra Bajracharya is associated with the Natonal Trust for Nature Conservaton since 1989. At present, he is the Executve Director (Programme) of NTNC. He made a substantal contributon in development and management of Annapurna Conservaton Area Project of NTNC. His specialized felds of expertse are community based conservaton, ecotourism, protected area management and sustainable development. Mukesh Kumar Chalise has specialized on feeding ecology and behavior of Hanuman Langurs. He is extensively involved in biodiversity researches especially on mammals and on their ecology and behavior. He supervises MSc and PhD researchers and has published more than 75 internatonal and natonal scientfc papers and books on wildlife species. Ghan Shyam Solanki focuses his research on ecology of wildlife species, conservaton biology of primates, buterfies, lizards in partcular and biodiversity conservaton in general. He is also addressing all theses aspects in his teaching. He has published more than hundred research papers in natonal and internatonal journals and supervises many PhD students.
Author contributon: RCK, RCP, MKC and GSS conceived the research idea. RCK, AS, PK, CPP and SBB collected feld samples. RCP and AS performed DNA extracton, PCR, Sequencing and data analyses. All the authors contributed equally in preparing the manuscript.
Acknowledgements: We are grateful to the Ministry of Forests and Environment and the Department of Natonal Parks and Wildlife Conservaton for issuing research permits to collect samples and do feldwork in KTWR. Field work for blood and faecal sample collecton and molecular work were supported by the Hariyo Ban Program of World Wildlife Fund, Nepal and Natonal Trust for Nature Conservaton, Nepal, respectvely. We are thankful to stafs of Koshi Tappu Wildlife Reserve (KTWR), Department of Natonal Parks and Wildlife Reserve, and the local people for their cooperaton in sample collecton and research visits in KTWR. We express our sincere thanks to Prof. J. Stuart F. Barker, University of New England, Australia and Prof. Joel T. Heinen, Florida Internatonal University, USA for their keen interest on the characterizaton and conservaton of Wild Bufalos of Nepal.. We express our thanks to Dr. Jyot Maharjan, Dr. Deegendra Khadka, and Mr. Mitesh Shrestha of NAST for their help in PCR and DNA sequencing of bufalo samples. Lastly, but not least, we show appreciaton and express grattude to three unknown reviewers for their constructve comments and precious inputs, which helped to improve this manuscript substantally.
Threatened Taxa
14954 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 December 2019 | 11(15): 14942–14954
PLATINUM The Journal of Threatened Taxa (JoTT) is dedicated to building evidence for conservaton globally by publishing peer-reviewed artcles online every month at a reasonably rapid rate at www.threatenedtaxa.org. OPEN ACCESS All artcles published in JoTT are registered under Creatve Commons Atributon 4.0 Internatonal License unless otherwise mentoned. JoTT allows allows unrestricted use, reproducton, and distributon of artcles in any medium by providing adequate credit to the author(s) and the source of publicaton.
ISSN 0974-7907 (Online) | ISSN 0974-7893 (Print)
December 2019 | Vol. 11 | No. 15 | Pages: 14927–15090 Date of Publicaton: 26 December 2019 (Online & Print) www.threatenedtaxa.org DOI: 10.11609/jot.2019.11.15.14927-15090
Peer Commentary First record in 129 years of the Tamil Treebrown Lethe drypets todara Moore, 1881 (Lepidoptera: Nymphalidae: Satyrinae) from Odisha, India by Observatons on the ex situ management of the Sumatran Rhinoceros fruit-baitng Dicerorhinus sumatrensis (Mammalia: Perissodactyla: Rhinocerotdae): – Anirban Mahata, Sudheer Kumar Jena & Sharat Kumar Palita, Pp. 15047– present status and desiderata for conservaton 15052 – Francesco Nardelli, Pp. 14927–14941 A review of the leafopper tribe Agalliini (Hemiptera: Cicadellidae: Communicatons Megophthalminae) with a revised key to the known Pakistani genera and species Revisitng genetc structure of Wild Bufaloes Bubalus arnee Kerr, 1792 – Hassan Naveed, Kamran Sohail, Waqar Islam & Yalin Zhang, Pp. 15053– (Mammalia: Artodactyla: Bovidae) in Koshi Tappu Wildlife Reserve, Nepal: 15060 an assessment for translocaton programs – Ram C. Kandel, Ram C. Poudel, Amir Sadaula, Prakrit Kandel, Kamal P. Gairhe, The windowpane oyster family Placunidae Rafnesque, 1815 with additonal Chiranjibi P. Pokheral, Siddhartha B. Bajracharya, Mukesh K. Chalise & descripton of Placuna quadrangula (Philipsson, 1788) from India Ghan Shyam Solanki, Pp. 14942–14954 – Rocktm Ramen Das, Vijay Kumar Deepak Samuel, Goutham Sambath, Pandian Krishnan, Purvaja Ramachandran & Ramesh Ramachandran, A review on status of mammals in Meghalaya, India Pp. 15061–15067 – Adrian Wansaindor Lyngdoh, Honnavalli Nagaraj Kumara, P.V. Karunakaran & Santhanakrishnan Babu, Pp. 14955–14970 Notes
A comparatve analysis of hair morphology of wild and domestc ungulate prey Recent records of the rare Mountain Tortoiseshell Aglais rizana species of Leopard Panthera pardus fusca (Mammalia: Carnivora: Felidae) (Moore, 1872) (Lepidoptera: Nymphalidae) in the upper Garhwal, from Goa, India western Himalaya, India, afer 100 years – Bipin S. Phal Desai, Avelyno H. D’Costa & S.K. Shyama, Pp. 14971–14978 – Arun Pratap Singh & Tribhuwan Singh, Pp. 15068–15071
Understanding people’s percepton and attudes towards mammalian fauna First report of Dicranocentroides indica (Handschin, 1929) (Collembola: using qualitatve data: a case study in Barail Wildlife Sanctuary, India Paronellidae) from Odisha, India – Amir Sohail Choudhury, Rofk Ahmed Barbhuiya & Parthankar Choudhury, – Ashirwad Tripathy, Pp. 15072–15073 Pp. 14979–14988 Additons to the knowledge of darkling beetles (Coleoptera: Tenebrionidae) An assessment of bird communites across Ujjani and its fve satellite wetlands from the Indo-Burma Biodiversity Hotspot, Meghalaya, India in Solapur District of Maharashtra, India – Vishwanath Datatray Hegde, Pp. 15074–15078 – Shraddha Prabhakar Karikar, Subhash Vithal Mali, Kulkarni Prasad & Aphale Prit, Pp. 14989–14997 Bhutan Asiabell Codonopsis bhutanica Ludlow (Asterales: campanulaceae): a new additon to the Indian fora Growth rate of captve Gharials Gavialis gangetcus (Gmelin, 1789) – Samiran Panday, Vikas Kumar, Sudhansu Sekhar Dash, Bipin Kumar Sinha & (Reptlia: Crocodylia: Gavialidae) in Chitwan Natonal Park, Nepal Paramjit Singh, Pp. 15079–15082 – Bed Bahadur Khadka & Ashish Bashyal, Pp. 14998–15003 Gentana urnula Harry Sm. (Gentanaceae), a new record for the fora of Amphibian abnormalites and threats in pristne ecosystems in Sri Lanka Arunachal Pradesh, India – G.K.V.P.T. Silva, W.A.D. Mahaulpatha & Anslem de Silva, Pp. 15004–15014 – Khilendra Singh Kanwal, Umeshkumar Lalchand Tiwari, Lod Yama & Mahendra Singh Lodhi, Pp. 15083–15086 Diversity and distributon of orchids of Goa, Western Ghats, India – Jeewan Singh Jalal, Pp. 15015–15042 Carex phacota, Spreng. (Cyperaceae): a new record for the central Western Ghats of Karnataka, India Short Communicatons – E.S.K. Udupa, H.U. Abhijit & K.G. Bhat, Pp. 15087–15088
Efcacy of oxyclozanide and levamisole treatment on the gastrointestnal Book review parasites in captve Lions Panthera leo – Dhareppa Ganager, Gotakanapura Sanjeevamurthy Mamatha, Asoor Compendium of Traded Indian Medicinal Plants Muralidhara, Nagappa Lakkundi Jaya & Beechagondahalli Papanna Shivashankar, – Reviewed by A. Rajasekaran, Pp. 15089–15090 Pp. 15043–15046
Publisher & Host
Partner Member
Threatened Taxa