DOCSLIB.ORG

Pulmonary Epithelial Cells FRA-1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Pulmonary Epithelial Cells FRA-1 A JNK-Independent Signaling Pathway Regulates TNF α-Stimulated, c-Jun-Driven FRA-1 Protooncogene Transcription in Pulmonary Epithelial Cells This information is current as of September 27, 2021. Pavan Adiseshaiah, Dhananjaya V. Kalvakolanu and Sekhar P. Reddy J Immunol 2006; 177:7193-7202; ; doi: 10.4049/jimmunol.177.10.7193 http://www.jimmunol.org/content/177/10/7193 Downloaded from References This article cites 63 articles, 24 of which you can access for free at: http://www.jimmunol.org/content/177/10/7193.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 27, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology A JNK-Independent Signaling Pathway Regulates TNF␣-Stimulated, c-Jun-Driven FRA-1 Protooncogene Transcription in Pulmonary Epithelial Cells1 Pavan Adiseshaiah,* Dhananjaya V. Kalvakolanu,† and Sekhar P. Reddy2* 〈mong the several effectors that mediate TNF-␣ action is AP-1, which consists of transcription factors belonging to the JUN and FOS families. Although the effects of TNF-␣ in immune cells, such as the induction of NF-␬〉, are well known, the mechanisms by which it induces transcriptional activation of AP-1 in pulmonary epithelial cells are not well defined. In this study, we report that TNF-␣ stimulates the expression of the FRA-1 protooncogene in human pulmonary epithelial cells using c-Jun, acting via a ,12-O-tetradecanoylphorbol-13 acetate response element located at ؊318. Although TNF-␣ stimulates phosphorylation of c-Jun the inhibition of JNK activity had no significant effect on FRA-1 induction. Consistent with this result, ectopic expression of a c-Jun Downloaded from mutant lacking JNK phosphorylation sites had no effect on the TNF-␣-induced expression of the promoter. In contrast, inhibition of the ERK pathway or ectopic expression of an ERK1 mutant strikingly reduced FRA-1 transcription. ERK inhibition not only blocked phosphorylation of Elk1, CREB, and ATF1, which constitutively bind to the FRA-1 promoter, but also suppressed the recruitment of c-Jun to the promoter. We found that short interfering RNA-mediated silencing of FRA-1 enhances TNF-␣-induced IL-8 expression, whereas overexpression causes an opposite effect. Our findings collectively indicate that ERK signaling plays key roles in both Elk1, CREB, and ATF-1 activation and the subsequent recruitment of c-Jun to the FRA-1 promoter in response to http://www.jimmunol.org/ TNF-␣ in pulmonary epithelial cells. The Journal of Immunology, 2006, 177: 7193–7202. ronchial epithelium and its associated tissues act as a in other cell types in response to TNF-␣. AP-1 is a dimeric com- primary interface for the interaction of a plethora of en- plex composed mainly of Jun (c-Jun, JunB, and JunD), Fos (c-Fos, vironmental stressors in the vertebrates. Acute lung in- FosB, Fra-1, and Fra-2), and ATF family proteins. Fos/Jun dimers B 3 jury caused by pathogenic and toxic products activates the synthe- bind to 12-O-tetradecanoylphorbol-13-acetate (TPA) response el- sis of proinflammatory cytokines. These cytokines not only act ements (TREs, also known as AP-1 sites) and regulate the expres- directly on the lung cells themselves during the early phase of the sion of genes involved in cell proliferation, inflammation, and pul- response but also help recruit the cells of the immune system to monary defenses (7, 8). A combinatorial interaction among the by guest on September 27, 2021 alleviate the effects of the injury. Human pulmonary epithelial Jun, Fos, and ATF families of proteins has been shown (9) to cells are known (1) to secrete many proinflammatory cytokines. regulate gene expression in a signal, cell-type-, and stressor-spe- High-level expression of these cytokines has been (2) causally cific manner. The abundance and regulated autoinduction of cer- linked to the development of pulmonary diseases, such as chronic tain members of the AP-1 family in response to specific stimuli obstructive pulmonary disease and asthma. These proinflammatory control the duration and magnitude of a stress-related or mitogenic signals initiate intracellular signaling cascades, leading to an acti- response (10). Consistent with this observation, overexpression of vation of various immediate early transcription factors, which then some AP-1 proteins results in various diseases associated with in- bind to target sequences commonly found in the regulatory regions flammation. For example, targeted expression of JunB in T lym- of various cytokine and cytokine receptor genes and activate their phocytes promotes high levels of Th2 cytokines (11). Abrogation transcription (3). of JunB in keratinocytes triggers chemokine/cytokine expression, One of the proinflammatory cytokines, TNF-␣, plays a critical leading to the development of psoriasis, whereas abrogation of role in diverse physiologic events and contributes to the develop- c-Jun has the opposite effect (12). A role for JunD in T lymphocyte ment of air pollutant-induced lung pathogenesis and airway re- proliferation and cell differentiation has been reported (13). Given modeling (4). Apart from NF-␬B, activation of immediate tran- that specific members of this family are rapidly induced and the scription factors such as AP-1 has been reported (3, 5, 6) to occur composition of AP-1 protein complex distinctly regulates gene ex- pression, an understanding of the mechanisms of activation of Jun *Department of Environmental Health Sciences, Johns Hopkins University, Balti- and Fos members is critical to our understanding of the molecular more, MD 21205; and †Greenbaum Cancer Center and Department of Microbiology pathogenesis promoted by inflammatory stimuli. and Immunology, University of Maryland School of Medicine, Baltimore, MD 21201 The mechanisms by which TNF-␣ induces effector functions in Received for publication April 17, 2006. Accepted for publication August 7, 2006. immune cells are well recognized. However, it is unclear how this The costs of publication of this article were defrayed in part by the payment of page cytokine stimulates the activation of immediate response genes, charges. This article must therefore be hereby marked advertisement in accordance such as transcription factors, that regulate subsequent expression with 18 U.S.C. Section 1734 solely to indicate this fact. of a variety of inflammatory mediators in pulmonary epithelial 1 This study was supported by National Institutes of Health Grants ES11863 and HL66109 and (to S.P.R.) and by National Cancer Institute Grants CA782282 and CA105005 (to D.V.K.). 2 Address correspondence and reprint requests to Dr. Sekhar P. Reddy, Department of 3 Abbreviations used in this paper: TPA, 12-O-tetradecanoylphorbol-13-acetate; TRE, Environmental Health Sciences, Johns Hopkins University, Bloomberg School of TPA response element; MMP, matrix metalloproteinases; WT, wild type; MEF, Public Health, 615 North Wolfe Street, Room E7610, Baltimore, MD 21205. E-mail mouse embryonic fibroblast; rRNA, rRNA-encoding DNA; ChIP, chromatin immu- address: [email protected] noprecipitation; siRNA, small interfering RNA; SRE, serum response element. Copyright © 2006 by The American Association of Immunologists, Inc. 0022-1767/06/$02.00 7194 INTERPLAY BETWEEN c-Jun AND Elk1 AT THE FRA-1 PROMOTER cells. The FRA-1 was isolated as a TPA-inducible gene from Real-time RT-PCR monocytes, suggesting a role for this transcription factor in cell TaqMan gene expression assays for mouse and human FRA-1, c-Jun, and differentiation (14). Human T cell leukemia virus type 1 Tax1 GAPDH were purchased from Applied Biosystems, and mRNA levels were activates the transcription of FRA-1 (15). Recently, we and others quantified in triplicate according to the supplier’s recommendations. The have shown that respiratory toxins that promote airway inflamma- absolute values for FRA-1 and c-Jun were normalized to that of GAPDH. tion, such as cigarette smoke (16), asbestos (17), and diesel ex- The relative value from the vehicle-treated control group was considered equal to one arbitrary unit. IL-8 and IL-6 expression was analyzed by a haust particles (18), strongly up-regulate the expression of FRA-1 LightCycler (Roche) using the SYBR Green QuantiTech RT-PCR kit in lung epithelial cells, suggesting a key role for this transcription (Qiagen).Primersequenceswere:IL-8sense,GTTTTTGAAGAGGGCTGA factor in airway inflammation, injury, and repair processes. FRA-1 GAATTC; IL-8 antisense, CATGAAGTGTTGAAGTAGATTTGC T; IL-6 up-regulates the expression of several matrix metalloproteinases sense, GGCAGAAAACAACCTGAACCT TC; IL-6 antisense, ACCTCAA ACTCCAAAAGACCAGTG; and 18S rRNA-encoding DNA (rRNA) sense, (MMPs), such as MMP-12 (19) and MMP-9 (18, 20–22), which GTAACCCGTTGAACCCCATT; 18S rRNA antisense, CCATCCAATC are known to promote airway inflammation. Although the activation GGTAGTAGCG. The reaction was performed in a 20-␮l final volume con- of c-Fos by cytokines has been investigated in great detail (23–25) in sisting of 25 ng of total RNA (IL-8 and IL-6) or 2.5 ng of total RNA (for 18S cells of the immune system, the induction of FRA-1 by cytokines and rRNA), 10 ␮l of QuantiTech SYBR Green PCR mastermix (Qiagen), and 1.5 its role in inflammatory responses in pulmonary epithelial cells are mM primers. Negative controls without template were included in all of the RT-PCR.
Load more

Recommended publications
  • Manual: Pathdetect Reporter Cell Lines
    PathDetect Reporter Cell Lines INSTRUCTION MANUAL Catalog #800050 (PathDetect HLR Cell Line) #800055 (HLR-Elk1 Cell Line) #800060 (HLR-CHOP Cell Line) #800065 (HLR-CREB Cell Line) Revision A BN #800050-12 For In Vitro Use Only 800050-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this product. No other warranties of any kind, express or implied, including without limitation, implied warranties of merchantability or fitness for a particular purpose, are provided by Agilent. Agilent shall have no liability for any direct, indirect, consequential, or incidental damages arising out of the use, the results of use, or the inability to use this product. ORDERING INFORMATION AND TECHNICAL SERVICES United States and Canada Agilent Technologies Stratagene Products Division 11011 North Torrey Pines Road La Jolla, CA 92037 Telephone (858) 373-6300 Order Toll Free (800) 424-5444 Technical Services (800) 894-1304 Internet [email protected] World Wide Web www.stratagene.com Europe Location Telephone Fax Technical Services Austria 0800 292 499 0800 292 496 0800 292 498 Belgium 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 15775 0800 15740 0800 15720 France 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 919 288 0800 919 287 0800 919 289 Germany 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 182 8232 0800 182 8231 0800 182 8234 Netherlands 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 023 0446 +31 (0)20 312 5700 0800 023 0448 Switzerland 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 563 080 0800 563 082 0800 563 081 United Kingdom 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 917 3282 0800 917 3283 0800 917 3281 All Other Countries Please contact your local distributor.
    [Show full text]
  • Expression of Oncogenes ELK1 and ELK3 in Cancer
    Review Article Annals of Colorectal Cancer Research Published: 11 Nov, 2019 Expression of Oncogenes ELK1 and ELK3 in Cancer Akhlaq Ahmad and Asif Hayat* College of Chemistry, Fuzhou University, China Abstract Cancer is the uncontrolled growth of abnormal cells anywhere in a body, ELK1 and ELK3 is a member of the Ets-domain transcription factor family and the TCF (Ternary Complex Factor) subfamily. Proteins in this subfamily regulate transcription when recruited by SRF (Serum Response Factor) to bind to serum response elements. ELK1 and ELK3 transcription factors are known as oncogenes. Both transcription factors are proliferated in a different of type of cancer. Herein, we summarized the expression of transcription factor ELK1 and ELK3 in cancer cells. Keywords: ETS; ELK1; ELK3; Transcription factor; Cancer Introduction The ETS, a transcription factor of E twenty-six family based on a dominant ETS amino acids that integrated with a ~10-basepair element arrange in highly mid core sequence 5′-GGA(A/T)-3′ [1-2]. The secular family alter enormous 28/29 members which has been assigned in human and mouse and similarly the family description are further sub-divided into nine sub-families according to their homology and domain factor [3]. More importantly, one of the subfamily members such as ELK (ETS-like) adequate an N-terminal ETS DNA-binding domain along with a B-box domain that transmit the response of serum factor upon the formation of ternary complex and therefore manifested as ternary complex factors [4]. Further the ELK sub-divided into Elk1, Elk3 (Net, Erp or Sap2) and Elk4 (Sap1) proteins [3,4], which simulated varied proportional of potential protein- protein interactions [4,5].
    [Show full text]
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • New Mechanism Based Approaches for Treating Prostate Cancer Rayna Rosati Wayne State University
    Wayne State University Wayne State University Dissertations 1-1-2017 New Mechanism Based Approaches For Treating Prostate Cancer Rayna Rosati Wayne State University, Follow this and additional works at: https://digitalcommons.wayne.edu/oa_dissertations Part of the Oncology Commons Recommended Citation Rosati, Rayna, "New Mechanism Based Approaches For Treating Prostate Cancer" (2017). Wayne State University Dissertations. 1865. https://digitalcommons.wayne.edu/oa_dissertations/1865 This Open Access Dissertation is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Dissertations by an authorized administrator of DigitalCommons@WayneState. NEW MECHANISM BASED APPROACHES FOR TREATING PROSTATE CANCER by RAYNA C. ROSATI DISSERTATION Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY 2017 MAJOR: CANCER BIOLOGY Approved By: Advisor Date DEDICATION This dissertation is dedicated to my family, who made me who I am today with all of their love and support. To my grandmother, Lucy, who just recently lost her battle with lung cancer and who would send me newspaper clippings in the mail about new topics of prostate cancer research. To my siblings, who have always been my best friends. To my father, Daniel, who has been my greatest mentor in life. To my mother, Nanci, who has been there for me through everything and who gave me my creative bone. ii ACKNOWLEDGEMENTS First off, I would like to thank my mentor, Dr. Manohar Ratnam, whose enthusiasm for science is undeniable. Thank you for always being so optimistic and believing I could accomplish this very challenging project.
    [Show full text]
  • Modulation of Transcriptional Activity in Brain Lower Grade Glioma by Alternative Splicing
    A peer-reviewed version of this preprint was published in PeerJ on 14 May 2018. View the peer-reviewed version (peerj.com/articles/4686), which is the preferred citable publication unless you specifically need to cite this preprint. Li J, Wang Y, Meng X, Liang H. 2018. Modulation of transcriptional activity in brain lower grade glioma by alternative splicing. PeerJ 6:e4686 https://doi.org/10.7717/peerj.4686 Modulation of transcriptional activity in brain lower grade glioma by alternative splicing Jin Li 1 , Yang Wang 1 , Xianglian Meng 1 , Hong Liang Corresp. 1 1 College of Automation, Harbin Engineering University, Harbin, Heilongjiang, China Corresponding Author: Hong Liang Email address: [email protected] Proteins that modify the activity of transcription factor (TF), often called modulators, play a vital role in gene transcriptional regulation. Alternative splicing is a critical step of gene processing and it can modulate gene function by adding or removing certain protein domains, and therefore influences the activity of a protein. The objective of this study is to investigate the role of alternative splicing in modulating the transcriptional regulation in brain lower grade glioma (LGG), especially transcription factor ELK1, which is closely related to various diseases, including Alzheimer’s disease and down syndrome. Results showed that changes in the exon inclusion ratio of proteins APP and STK16 are associated with changes in the expression correlation between ELK1 and its targets. Meanwhile, the structural features of the two modulators are strongly associated with the pathological impact of exon inclusion. Our analysis suggests, protein in different splicing level could play different functions on transcription factors, hence induces multiple genes dysregulation.
    [Show full text]
  • Investigating the Role of the ETS Transcription Factor ELK1 in Stem Cell Transcription
    Investigating the role of the ETS transcription factor ELK1 in stem cell transcription A thesis submitted to the University of Manchester for the degree of Doctor of Philosophy in the Faculty of Biology, Medicine and Health 2017 Ian E. Prise Division of Molecular & Cellular Function School of Biological Sciences I. Table of Contents II. List of Figures ...................................................................................................................................... 5 III. Abstract .............................................................................................................................................. 7 IV. Declaration ......................................................................................................................................... 8 V. Copyright Statement ........................................................................................................................... 8 VI. Experimental Contributions ............................................................................................................... 9 VII. Acknowledgments .......................................................................................................................... 10 1. Introduction ...................................................................................................................................... 12 1.I Pluripotency ................................................................................................................................. 12 1.II Chromatin
    [Show full text]
  • A Flexible Microfluidic System for Single-Cell Transcriptome Profiling
    www.nature.com/scientificreports OPEN A fexible microfuidic system for single‑cell transcriptome profling elucidates phased transcriptional regulators of cell cycle Karen Davey1,7, Daniel Wong2,7, Filip Konopacki2, Eugene Kwa1, Tony Ly3, Heike Fiegler2 & Christopher R. Sibley 1,4,5,6* Single cell transcriptome profling has emerged as a breakthrough technology for the high‑resolution understanding of complex cellular systems. Here we report a fexible, cost‑efective and user‑ friendly droplet‑based microfuidics system, called the Nadia Instrument, that can allow 3′ mRNA capture of ~ 50,000 single cells or individual nuclei in a single run. The precise pressure‑based system demonstrates highly reproducible droplet size, low doublet rates and high mRNA capture efciencies that compare favorably in the feld. Moreover, when combined with the Nadia Innovate, the system can be transformed into an adaptable setup that enables use of diferent bufers and barcoded bead confgurations to facilitate diverse applications. Finally, by 3′ mRNA profling asynchronous human and mouse cells at diferent phases of the cell cycle, we demonstrate the system’s ability to readily distinguish distinct cell populations and infer underlying transcriptional regulatory networks. Notably this provided supportive evidence for multiple transcription factors that had little or no known link to the cell cycle (e.g. DRAP1, ZKSCAN1 and CEBPZ). In summary, the Nadia platform represents a promising and fexible technology for future transcriptomic studies, and other related applications, at cell resolution. Single cell transcriptome profling has recently emerged as a breakthrough technology for understanding how cellular heterogeneity contributes to complex biological systems. Indeed, cultured cells, microorganisms, biopsies, blood and other tissues can be rapidly profled for quantifcation of gene expression at cell resolution.
    [Show full text]
  • MEKK1/JNK Signaling Stabilizes and Activates P53
    Proc. Natl. Acad. Sci. USA Vol. 95, pp. 10541–10546, September 1998 Biochemistry MEKK1/JNK signaling stabilizes and activates p53 SERGE Y. FUCHS*, VICTOR ADLER*, MATTHEW R. PINCUS†, AND ZE’EV RONAI*‡ *Ruttenberg Cancer Center, Mount Sinai School of Medicine, New York, NY 10029; and †Department of Pathology and Laboratory Medicine, Brooklyn Veterans Affairs Medical Center and State University of New York Health Science, Brooklyn, NY 11203 Communicated by H. A. Scheraga, Cornell University, Ithaca, NY, July 7, 1998 (received for review May 4, 1998) ABSTRACT Activation of the tumor suppressor p53 by damage is preserved in cells from severe combined immunode- stress and damage stimuli often correlates with induction of ficient mice (10–12), we examined the role of JNK in this stress kinases, Jun-NH2 kinase (JNK). As JNK association response. with p53 plays an important role in p53 stability, in the JNKs are a family of stress kinases induced by change in redox present study we have elucidated the relationship between the potential, heat shock, osmotic shock, UV irradiation, and inflam- JNK-signaling pathway and p53 stability and activity. Expres- matory cytokines (13–16). JNK activity requires mitogen- sion of a constitutively active form of JNKK upstream kinase, activated protein kinases kinase (MEKK) 1–4 which phosphor- mitogen-activated protein kinase kinase kinase (DMEKK1), ylates MKK4/7. MKK4/7, in turn, phosphorylates JNK on resi- increased the level of the exogenously transfected form of p53 dues 183 and 185 (17–20). Activated JNK phosphorylates its in p53 null (10.1) cells as well as of endogenous p53 in MCF7 substrates, c-Jun, ATF2, ELK1, and p53 (3, 13–14, 21).
    [Show full text]
  • 1 Loss of ELK1 Has Differential Effects on Age-Dependent Organ Fibrosis
    bioRxiv preprint doi: https://doi.org/10.1101/755694; this version posted September 5, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Loss of ELK1 has differential effects on age-dependent organ fibrosis and integrin expression Running title Aged, ELK1 deficient mice develop fibrosis and altered integrin expression Jennifer T Cairns1, Anthony Habgood1, Rochelle C Edwards-Pritchard1, Chloe Wilkinson1, Iain D Stewart1, Jack Leslie2, Burns C Blaxall3, Katalin Susztak4, Siegfried Alberti5, Alfred Nordheim5, Fiona Oakley2, R Gisli Jenkins1, Amanda L Tatler1. 1 Division of Respiratory Medicine, University of Nottingham, Nottingham University Hospitals, City Campus, Nottingham, NG5 1PB, UK and Respiratory Research Unit, NIHR Biomedical Research Centre, Nottingham University Hospitals Nottingham, UK. 2 Newcastle Fibrosis Research Group, Institute of Cellular Medicine, Faculty of Medical Sciences, 4th Floor, William Leech Building, Newcastle University, Framlington Place, Newcastle upon Tyne, NE2 4HH, UK 3 Department of Precision Medicine and Pharmacogenetics, The Christ Hospital Health Network, Cincinnati, Ohio, USA 4 Renal Electrolyte and Hypertension Division, Department of Medicine, Department of Genetics, University of Pennsylvania, Perelman School of Medicine, Philadelphia, PA, USA 5 Interfaculty Institute of Cell Biology, Tuebingen University, Germany and 6 Leibniz Institute on Aging (FLI), Jena, Germany 1 bioRxiv preprint doi: https://doi.org/10.1101/755694; this version posted September 5, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Comparing Subtypes of Breast Cancer Using a Message-Passing Network
    Dana-Farber Cancer Institute Comparing Subtypes of Breast Cancer Using a Kamrine Poels Message-Passing Network Outline ❖ Breast cancer and its molecular subtypes ❖ Passing Attributes between Networks for Data Assimilation (PANDA) ❖ Luminal A vs. Luminal B breast cancer ❖ Basal-like vs. Luminal B breast cancer Gene Sets ❖ Future goals Molecular Subtypes of Breast Cancer ❖ Four recognized molecular subtypes of breast cancer: ❖ Luminal A ❖ Luminal B ❖ Basal (also called Triple Negative BC) ❖ HER2-positive (ERBB2) ❖ 198 samples came from Bioconductor public website, data is Breast Cancer TRANSBIG ❖ Samples were separated according to molecular subtype using the Subtype Clustering Model[1] 71 samples were Luminal A, 60 samples were Luminal B, 45 samples were Basal-like breast cancer, and 22 samples were HER2+. Luminal A and Luminal B are distinguished by level of proliferation. PANDA Algorithm[2] ❖ Main objective of PANDA is to find agreement between data represented by multiple networks: ❖ Protein-protein interaction ❖ Gene-expression (co-regulation network) ❖ TF-gene interaction (regulatory network) TF-Motif Scan PP interaction0 Network0 Co-regulation0 Responsibility Availability PP interaction1 Network1 Co-regulation1 PANDA estimates the probability that an edge exists in a network and returns that estimate in terms of Z-score units ❖ Responsibility(Rij): information flowing from TF i to gene j TF-Motif Scan (t) (t) Pim Wmj PP interaction0 Network0 Co-regulation0 (t) m Rij = 2 P 2 P (t) + W (t) P (t)W (t) im mj − im mj s m m m Responsibility
    [Show full text]
  • Distinct Roles of Jun : Fos and Jun : ATF Dimers in Oncogenesis
    Oncogene (2001) 20, 2453 ± 2464 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc Distinct roles of Jun : Fos and Jun : ATF dimers in oncogenesis Hans van Dam*,1 and Marc Castellazzi2 1Department of Molecular Cell Biology, Leiden University Medical Center, Sylvius Laboratories, PO Box 9503, 2300 RA Leiden, The Netherlands; 2Unite de Virologie Humaine, Institut National de la Sante et de la Recherche MeÂdicale (INSERM-U412), Ecole Normale SupeÂrieure, 46 alleÂe d'Italie, 69364 Lyon Cedex 07, France Jun : Fos and Jun : ATF complexes represent two classes dimers with emphasis on their roles in oncogenic of AP-1 dimers that (1) preferentially bind to either transformation in avian model systems. Previous heptameric or octameric AP-1 binding sites, and (2) are reviews on AP-1 and cell transformation include dierently regulated by cellular signaling pathways and references: (Angel and Karin, 1991; Wisdom, 1999; oncogene products. To discriminate between the func- Vogt, 1994; Karin et al., 1997; van Dam and van der tions of Jun : Fos, Jun: ATF and Jun : Jun, mutants were Eb, 1994; Hagmeyer et al., 1995). developed that restrict the ability of Jun to dimerize either to itself, or to Fos(-like) or ATF(-like) partners. Introduction of these mutants in chicken embryo Jun : Fos and Jun : ATF transcription factors: dimeric ®broblasts shows that Jun : Fra2 and Jun : ATF2 dimers complexes with variable composition and activities play distinct, complementary roles in in vitro oncogenesis by inducing either anchorage independence or growth AP-1 sub-units: members of the bZip protein family factor independence, respectively.
    [Show full text]
  • The EWS/ATF1 Fusion Protein Contains a Dispersed Activation Domain That Functions Directly
    Oncogene (1998) 16, 1625 ± 1631 1998 Stockton Press All rights reserved 0950 ± 9232/98 $12.00 The EWS/ATF1 fusion protein contains a dispersed activation domain that functions directly Shu Pan, Koh Yee Ming, Theresa A Dunn, Kim KC Li and Kevin AW Lee Department of Biology, Hong Kong University of Science & Technology, Clear Water Bay, Kowloon, Hong Kong, P.R.C. Naturally occurring chromosomal fusion of the Ewings 1994). For all of the above malignancies, the EWS Sarcoma Oncogene (EWS) to distinct cellular transcrip- fusion proteins function as potent transcriptional tion factors, produces aberrant transcriptional activators activators (May et al., 1993b; Ohno et al., 1993; that function as dominant oncogenes. In Malignant Bailly et al., 1994; Brown et al., 1995; Lessnick et al., Melanoma of Soft Parts the N-terminal region of 1995; Fujimura et al., 1996) in a manner that is EWS is fused to C-terminal region of the cAMP- dependent on the EWS N-terminal region, hereafter inducible transcription factor ATF1. The EWS/ATF1 referred to as the EWS Activation Domain (EAD). It is fusion protein binds to ATF sites present in cAMP- envisioned that distinct tumors arise via de-regulation responsive promoters via the ATF1 bZIP domain and of dierent genes, depending on the fusion partner for activates transcription constitutively in a manner that is EWS. In cases where it has been examined, agents that dependent on an activation domain (EAD) present in antagonise EWS-fusion proteins also inhibit cellular EWS. To further de®ne the requirements for trans- proliferation (Ouchida et al., 1995; Kovar et al., 1996; activation we have performed mutational analysis of Yi et al., 1997; Tanaka et al., 1997), indicating that EWS/ATF1 in mammalian cells and report several new EWS fusions can play a role in both tumor formation ®ndings.
    [Show full text]