DOCSLIB.ORG

Genetic Loss Or Pharmacological Blockade of Testes-Expressed Taste Genes Causes Male Sterility

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic Loss Or Pharmacological Blockade of Testes-Expressed Taste Genes Causes Male Sterility Genetic loss or pharmacological blockade of testes-expressed taste genes causes male sterility Bedrich Mosingera,1, Kevin M. Reddinga, M. Rockwell Parkera, Valeriya Yevshayevab, Karen K. Yeea, Katerina Dyominaa, Yan Lia, and Robert F. Margolskeea aMonell Chemical Senses Center, Philadelphia, PA 19104; and bDepartment of Neuroscience, Mount Sinai School of Medicine, New York, NY 10029 Edited by John J. Eppig, The Jackson Laboratory, Bar Harbor, ME, and approved June 3, 2013 (received for review February 22, 2013) TAS1R taste receptors and their associated heterotrimeric G protein nuclear peroxisome proliferator-activated receptor-α (PPAR-α), gustducin are involved in sugar and amino acid sensing in taste cells our results (10) show that clofibric and bezafibric acids also inhibit and in the gastrointestinal tract. They are also strongly expressed in TAS1R3 receptors at drug concentrations similar to those needed testis and sperm, but their functions in these tissues were pre- to activate PPAR-α (14). Thus, in humans, TAS1R3 receptors may viously unknown. Using mouse models, we show that the genetic be important biological targets of fibrates and could mediate some fi absence of both TAS1R3, a component of sweet and amino acid of their effects. Although no effects of brates on reproduction or fi taste receptors, and the gustducin α-subunit GNAT3 leads to male- fertility have been reported, no study has speci cally examined specific sterility. To gain further insight into this effect, we gener- fertility in patients receiving antilipid treatment. A second group ated a mouse model that expressed a humanized form of TAS1R3 of compounds structurally similar to lactisole are phenoxy-auxin susceptible to inhibition by the antilipid medication clofibrate. herbicides, which are used extensively in crop agriculture and in landscape turf management (17, 18). Approximately 55 million Sperm formation in animals without functional TAS1R3 and GNAT3 pounds of phenoxy herbicides are used annually in the United is compromised, with malformed and immotile sperm. Further- States (18). We have shown that these herbicides are the most more, clofibrate inhibition of humanized TAS1R3 in the genetic Tas1r3−/− Gnat3−/− potent TAS1R3 blockers known to date (10). The long-term bi- background of , doubly null mice led to inducible ological effects of these compounds in humans are not well known, male sterility. These results indicate a crucial role for these extrao- although some reports point to male infertility (19–21). ral “taste” molecules in sperm development and maturation. We Although once thought to function only in taste buds, TAS1R CELL BIOLOGY previously reported that blocking of human TAS1R3, but not mouse receptors are also expressed in gut enteroendocrine cells and TAS1R3, can be achieved by common medications or chemicals in pancreatic islet cells, where they contribute to nutrient sensing the environment. We hypothesize that even low levels of these and regulation of glucose metabolism (22–25). Additional compounds can lower sperm count and negatively affect human reports have shown their expression in brain, although their male fertility, which common mouse toxicology assays would not functional role there is unclear (26). The endogenous ligands of reveal. Conversely, we speculate that TAS1R3 and GNAT3 activa- TAS1R receptors in extraoral tissues remain unknown. tors may help infertile men, particularly those that are affected by Expression of Tas1rs and the associated “taste” G protein some of the mentioned inhibitors and/or are diagnosed with idio- α-subunit (α-gustducin, encoded by the Gnat3 gene) has been pathic infertility involving signaling pathway of these receptors. noted in testes and in spermatozoa (27–31). However, before our present study, no functional role has been determined for these phenoxy compounds | spermiogenesis testes-expressed taste genes. During our studies of these receptors and G proteins, we found that male, but not female, gametes with Tas1r3 Gnat3 – nonfunctional and genes were unable to transmit family of three G protein coupled receptor (GPCR) genes, their genes to progeny. Using existing KO animals and unique A the TAS1Rs, encode type 1 taste receptors that mediate per- transgenic mice expressing a humanized form of Tas1r3 that, un- ception of sweet and umami (amino acid) tastes. TAS1R receptors like the mouse form of Tas1r3, can be pharmacologically blocked, assemble into heterodimers: TAS1R2+TAS1R3 form a sweet re- Gnat3 + we determined that inhibition of TAS1R3 in the absence of ceptor, and TAS1R1 TAS1R3 form an umami receptor. TAS1R3 results in male selective sterility. We report here that such treat- is the common subunit and may also serve as a low-affinity sweet – ment results in oligospermia, testis pathology with giant cells, and receptor alone, perhaps as a homodimer or homomultimer (1 3). exfoliation of seminiferous epithelium along with functional, yet Sugars and noncaloric sweeteners (e.g., saccharin and sucralose) reversible, sterility. Similar pathologies in testis are seen in the + are known ligands and agonists of the sweet TAS1R2 TAS1R3 genetic absence of these two molecules in Gnat3 and Tas1r3 receptor (1, 2, 4, 5). Likewise, amino acids such as monosodium double KO males. In addition, spermatozoa of these double KO + glutamate (MSG) are ligands of the umami TAS1R1 TAS1R3 re- males are immotile and mostly morphologically abnormal. ceptor. Pharmacologically blocking or genetically eliminating Tas1r3 Male infertility is a complex disorder that affects a significant results in loss of both sweet and umami taste in animals (2, 6, 7), proportion of the population. It is estimated that about 7% of men indicating that heteromers require the TAS1R3 subunit for function experience problems in conceiving a child because of sperm de- in vivo. Small differences in the primary amino acid sequence of fects (32). Fertility is decreasing worldwide, with the greatest TAS1R receptors among species are responsible for species selec- effects in Western countries (32–34). In most cases, the causes are tivity toward many sweeteners. For example, aspartame and cycla- unknown, although environmental factors are suspected (35–38). mate taste very sweet to humans, but are tasteless to mice (4, 8). In ∼30–50% of infertile men, oligozoospermia or azoospermia is A number of natural and synthetic anti-sweet or sweet-modi- fying substances/antagonists exist. They are suspected or proven ligands of the sweet receptor (7, 9, 10), and similar to sweeteners, Author contributions: B.M. designed research; B.M., K.M.R., M.R.P., V.Y., K.K.Y., K.D., and many are specific to human receptors. We recently identified Y.L. performed research; R.F.M. contributed new reagents/analytic tools; B.M., K.M.R., a group of potent antagonists of the human sweet receptor that M.R.P., V.Y., K.K.Y., K.D., Y.L., and R.F.M. analyzed data; and B.M., M.R.P., and R.F.M. share a common phenoxy motif (10) also present in lactisole, one wrote the paper. of the first sweet taste antagonists described (5, 11). Lactisole is in The authors declare no conflict of interest. common use as a food additive for its anti-sweet properties (12). This article is a PNAS Direct Submission. Among these widely used lactisole analogs are fibrates used to 1To whom correspondence should be addressed. E-mail: [email protected]. – treat certain forms of hyperlipidemia (13 16). Although the This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. therapeutic effect of fibrates on lipid metabolism is mediated via 1073/pnas.1302827110/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1302827110 PNAS Early Edition | 1of6 Downloaded by guest on September 27, 2021 present despite unimpaired reproductive hormone secretion and occurred at the expected frequency (Table 1). We obtained the a lack of other known determinants of infertility (35, 39, 40). We same failure to transmit in males by crossing compound homo/ +/− −/− −/− hypothesize that compounds present in the environment may act heterozygotes (e.g., Gnat3 ,Tas1r3 crossed with Gnat3 , +/− +/− to inhibit testes-expressed taste receptors and/or G proteins to Tas1r3 ) and by crossing double heterozygotes Gnat3 , +/− cause infertility. Tas1r3 with WT animals. In each case, the Gnat3−, Tas1r3− haplotype was not transmitted from males but was transmitted Results from females (Table 1). Because the nontransmission from the Tas1r3 and Gnat3 Are Expressed in the Male Reproductive Organs. double-heterozygous parents seems unlikely to be caused by al- We found that Gnat3 and Tas1r3 were both expressed in testis, tered physiology or hormonal levels (all other genotypes are pro- primarily in developing haploid spermatids (Fig. 1; Fig. S1). duced normally, and animals are fertile), and double-heterozygous Expression of both molecules is strongest in the latest stages of pups are born from double-heterozygous females but not from development, in the elongating and elongated spermatids (Figs. double-heterozygous males, we concluded that the haploid double- S1 and S2). In agreement with a previous study (28), we found null sperm was either defective or not produced. This phenomenon that Tas1r2 mRNA is also expressed in the same cells (Fig. 1 B is known as transmission ratio distortion (41, 42). E Tas1r2 Tas1r3 Single KO lines lacking either Tas1r3 or Gnat3, or compound and ; Fig. S2). Interestingly, and mRNAs are −/− +/− +/− −/− present in epididymal sperm (Fig. 1 G and H). Tas1r2 expression homo/heterozygotes (e.g.,
Load more

Recommended publications
  • TAS1R1 (NM 138697) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG219286 TAS1R1 (NM_138697) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: TAS1R1 (NM_138697) Human Tagged ORF Clone Tag: TurboGFP Symbol: TAS1R1 Synonyms: GM148; GPR70; T1R1; TR1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 6 TAS1R1 (NM_138697) Human Tagged ORF Clone – RG219286 ORF Nucleotide >RG219286 representing NM_138697 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGCTCTGCACGGCTCGCCTGGTCGGCCTGCAGCTTCTCATTTCCTGCTGCTGGGCCTTTGCCTGCC ATAGCACGGAGTCTTCTCCTGACTTCACCCTCCCCGGAGATTACCTCCTGGCAGGCCTGTTCCCTCTCCA TTCTGGCTGTCTGCAGGTGAGGCACAGACCCGAGGTGACCCTGTGTGACAGGTCTTGTAGCTTCAATGAG CATGGCTACCACCTCTTCCAGGCTATGCGGCTTGGGGTTGAGGAGATAAACAACTCCACGGCCCTGCTGC CCAACATCACCCTGGGGTACCAGCTGTATGATGTGTGTTCTGACTCTGCCAATGTGTATGCCACGCTGAG AGTGCTCTCCCTGCCAGGGCAACACCACATAGAGCTCCAAGGAGACCTTCTCCACTATTCCCCTACGGTG CTGGCAGTGATTGGGCCTGACAGCACCAACCGTGCTGCCACCACAGCCGCCCTGCTGAGCCCTTTCCTGG TGCCCATGATTAGCTATGCGGCCAGCAGCGAGACGCTCAGCGTGAAGCGGCAGTATCCCTCTTTCCTGCG CACCATCCCCAATGACAAGTACCAGGTGGAGACCATGGTGCTGCTGCTGCAGAAGTTCGGGTGGACCTGG
    [Show full text]
  • Mismatches Between Feeding Ecology and Taste Receptor Evolution
    satisfactory explanation exists (2). Furthermore, Tas1r2 is absent LETTER in all bird genomes sequenced thus far (2), irrespective of their diet. Mismatches between feeding ecology Jiang et al. (1) further contended that sea lions and dolphins and taste receptor evolution: An need not sense the umami taste because they swallow food whole. Although it is true that Tas1r1 is pseudogenized in these inconvenient truth two species, the authors ignore the previous finding that Tas1r1 is also pseudogenized or missing in all bats examined, regardless Comparative and evolutionary biology can not only verify labo- of their diet (fruits, insects, or blood) (3). Although the pseu- ratory findings of gene functions but also provide insights into dogenization of Tas1r1 in the giant panda (4) occurred at ap- their physiological roles in nature that are sometimes difficult to proximately the same time as it switched from being a meat-eater discern in the laboratory. Specifically, if our understanding of the to a plant-eater (5), and thus may be related to the feeding physiological function of a gene is complete and accurate, the ecology, herbivorous mammals, such as the horse and cow, still gene should be inactivated or pseudogenized in and only in carry an intact Tas1r1 (5). organisms in which the presumed function of the gene has be- Clearly, the presence/absence of intact Tas1r2 and Tas1r1 in come useless or harmful. On the basis of multiple independent mammals and other vertebrates is sometimes inconsistent with pseudogenizations of the sweet taste receptor gene Tas1r2 in the known functions of these genes and the involved tastes.
    [Show full text]
  • Activation Mechanism of the G Protein-Coupled Sweet Receptor Heterodimer with Sweeteners and Allosteric Agonists
    Supporting Information Activation mechanism of the G protein-coupled sweet receptor heterodimer with sweeteners and allosteric agonists Soo-Kyung Kim, *† Yalu Chen, † Ravinder Abrol, †, ‡ William A. Goddard III,*† and Brian Guthrie§ †Materials and Process Simulation Center (MC 139-74), California Institute of Technology, 1200 E. California Blvd., Pasadena, CA 91125; ‡Current address, Departments of Chemistry and Biochemistry, California State University, Northridge, CA 91330; §Cargill Global Food Research, 2301 Crosby Road, Wayzata, MN 55391 * CORRESPONDING AUTHOR Prof. William A. Goddard III California Institute of Technology MC 139-74, 1200 E. California Blvd., Pasadena, CA 91125; phone: 1-626-395-2731, e-mail: [email protected] Dr. Soo-Kyung Kim phone: 1-626-395-2724, e-mail: [email protected] 1 RESULTS Structures for Allosteric ligand bound at the TMD of all three TAS1Rs As described in the METHODS section, the DarwinDock procedure (1) involves sampling ~50,000 poses for each of ~10 diverse ligand conformations from which, we select finally two energetically favorable binding poses based on two scoring methods: UCav E: unified cavity energy for which we consider that interactions of the best 100 poses with the union of all residues involve in their separate binding sites (providing a uniform comparison) BE: snap binding energy considering all interactions of ligand with protein As a first validation of the predicted structures for the 7 helix TMD, we used DarwinDock to predict the binding site for the allosteric ligands to each TAS1R TMD in Table S10. Here we find, S819 [1-((1H-pyrrol-2-yl)methyl)-3-(4-isopropoxyphenyl)thiourea] is a sweet compound that interacts with the TAS1R2 TMD.(2) and Lactisole is a competitive inhibitor of the sweet taste receptor that binds to TAS1R3 TMD.(3, 4) These structures were further relaxed through annealing.
    [Show full text]
  • The Association of Bovine T1R Family of Receptors Polymorphisms with Cattle Growth Traits ⇑ C.L
    Research in Veterinary Science xxx (2012) xxx–xxx Contents lists available at SciVerse ScienceDirect Research in Veterinary Science journal homepage: www.elsevier.com/locate/rvsc The association of bovine T1R family of receptors polymorphisms with cattle growth traits ⇑ C.L. Zhang a, J. Yuan a, Q. Wang a, Y.H. Wang a, X.T. Fang a, C.Z. Lei b, D.Y. Yang c, H. Chen a, a Institute of Cellular and Molecular Biology, Xuzhou Normal University, Xuzhou, Jiangsu, PR China b College of Animal Science and Technology, Northwest Agriculture and Forestry University, Shaanxi Key Laboratory of Molecular Biology for Agriculture, Yangling, Shaanxi, PR China c College of Life Science, Dezhou University, Dezhou, Shandong 253023, PR China article info abstract Article history: The three members of the T1R class of taste-specific G protein-coupled receptors have been proven to Received 12 August 2011 function in combination with heterodimeric sweet and umami taste receptors in many mammals that Accepted 20 January 2012 affect food intake. This may in turn affect growth traits of livestock. We performed a comprehensive eval- Available online xxxx uation of single-nucleotide polymorphisms (SNPs) in the bovine TAS1R gene family, which encodes receptors for umami and sweet tastes. Complete DNA sequences of TAS1R1-, TAS1R2-, and TAS1R3-cod- Keywords: ing regions, obtained from 436 unrelated female cattle, representing three breeds (Qinchuan, Jiaxian Red, Taste receptors Luxi), revealed substantial coding and noncoding diversity. A total of nine SNPs in the TAS1R1 gene were SNP identified, among which seven SNPs were in the coding region, and two SNPs were in the introns.
    [Show full text]
  • G Protein-Coupled Receptors
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2015/16: G protein-coupled receptors. British Journal of Pharmacology (2015) 172, 5744–5869 THE CONCISE GUIDE TO PHARMACOLOGY 2015/16: G protein-coupled receptors Stephen PH Alexander1, Anthony P Davenport2, Eamonn Kelly3, Neil Marrion3, John A Peters4, Helen E Benson5, Elena Faccenda5, Adam J Pawson5, Joanna L Sharman5, Christopher Southan5, Jamie A Davies5 and CGTP Collaborators 1School of Biomedical Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK, 2Clinical Pharmacology Unit, University of Cambridge, Cambridge, CB2 0QQ, UK, 3School of Physiology and Pharmacology, University of Bristol, Bristol, BS8 1TD, UK, 4Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK, 5Centre for Integrative Physiology, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2015/16 provides concise overviews of the key properties of over 1750 human drug targets with their pharmacology, plus links to an open access knowledgebase of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. The full contents can be found at http://onlinelibrary.wiley.com/doi/ 10.1111/bph.13348/full. G protein-coupled receptors are one of the eight major pharmacological targets into which the Guide is divided, with the others being: ligand-gated ion channels, voltage-gated ion channels, other ion channels, nuclear hormone receptors, catalytic receptors, enzymes and transporters. These are presented with nomenclature guidance and summary information on the best available pharmacological tools, alongside key references and suggestions for further reading.
    [Show full text]
  • Multi-Functionality of Proteins Involved in GPCR and G Protein Signaling: Making Sense of Structure–Function Continuum with In
    Cellular and Molecular Life Sciences (2019) 76:4461–4492 https://doi.org/10.1007/s00018-019-03276-1 Cellular andMolecular Life Sciences REVIEW Multi‑functionality of proteins involved in GPCR and G protein signaling: making sense of structure–function continuum with intrinsic disorder‑based proteoforms Alexander V. Fonin1 · April L. Darling2 · Irina M. Kuznetsova1 · Konstantin K. Turoverov1,3 · Vladimir N. Uversky2,4 Received: 5 August 2019 / Revised: 5 August 2019 / Accepted: 12 August 2019 / Published online: 19 August 2019 © Springer Nature Switzerland AG 2019 Abstract GPCR–G protein signaling system recognizes a multitude of extracellular ligands and triggers a variety of intracellular signal- ing cascades in response. In humans, this system includes more than 800 various GPCRs and a large set of heterotrimeric G proteins. Complexity of this system goes far beyond a multitude of pair-wise ligand–GPCR and GPCR–G protein interactions. In fact, one GPCR can recognize more than one extracellular signal and interact with more than one G protein. Furthermore, one ligand can activate more than one GPCR, and multiple GPCRs can couple to the same G protein. This defnes an intricate multifunctionality of this important signaling system. Here, we show that the multifunctionality of GPCR–G protein system represents an illustrative example of the protein structure–function continuum, where structures of the involved proteins represent a complex mosaic of diferently folded regions (foldons, non-foldons, unfoldons, semi-foldons, and inducible foldons). The functionality of resulting highly dynamic conformational ensembles is fne-tuned by various post-translational modifcations and alternative splicing, and such ensembles can undergo dramatic changes at interaction with their specifc partners.
    [Show full text]
  • G Protein‐Coupled Receptors
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: G protein-coupled receptors. British Journal of Pharmacology (2019) 176, S21–S141 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: G protein-coupled receptors Stephen PH Alexander1 , Arthur Christopoulos2 , Anthony P Davenport3 , Eamonn Kelly4, Alistair Mathie5 , John A Peters6 , Emma L Veale5 ,JaneFArmstrong7 , Elena Faccenda7 ,SimonDHarding7 ,AdamJPawson7 , Joanna L Sharman7 , Christopher Southan7 , Jamie A Davies7 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Monash Institute of Pharmaceutical Sciences and Department of Pharmacology, Monash University, Parkville, Victoria 3052, Australia 3Clinical Pharmacology Unit, University of Cambridge, Cambridge, CB2 0QQ, UK 4School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 5Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 6Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 7Centre for Discovery Brain Sciences, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. Although the Concise Guide represents approximately 400 pages, the material presented is substantially reduced compared to information and links presented on the website.
    [Show full text]
  • Chemosensory Signalling Pathways Involved in Sensing of Amino Acids by the Ghrelin Cell L
    Chemosensory signalling pathways involved in sensing of amino acids by the ghrelin cell L. Vancleef, T. van den Broeck, T. Thijs, S. Steensels, Loïc Briand, J. Tack, I. Depoortere To cite this version: L. Vancleef, T. van den Broeck, T. Thijs, S. Steensels, Loïc Briand, et al.. Chemosensory signalling pathways involved in sensing of amino acids by the ghrelin cell. Scientific Reports, Nature Publishing Group, 2015, 5, pp.15725. 10.1038/srep15725. hal-01233907 HAL Id: hal-01233907 https://hal.archives-ouvertes.fr/hal-01233907 Submitted on 27 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License www.nature.com/scientificreports OPEN Chemosensory signalling pathways involved in sensing of amino acids by the ghrelin cell Received: 05 May 2015 1 1 1 1 2 1 1 Accepted: 01 October 2015 L. Vancleef , T. Van Den Broeck , T. Thijs , S. Steensels , L. Briand , J. Tack & I. Depoortere Published: 29 October 2015 Taste receptors on enteroendocrine cells sense nutrients and transmit signals that control gut hormone release. This study aimed to investigate the amino acid (AA) sensing mechanisms of the ghrelin cell in a gastric ghrelinoma cell line, tissue segments and mice.
    [Show full text]
  • The Potential Druggability of Chemosensory G Protein-Coupled Receptors
    International Journal of Molecular Sciences Review Beyond the Flavour: The Potential Druggability of Chemosensory G Protein-Coupled Receptors Antonella Di Pizio * , Maik Behrens and Dietmar Krautwurst Leibniz-Institute for Food Systems Biology at the Technical University of Munich, Freising, 85354, Germany; [email protected] (M.B.); [email protected] (D.K.) * Correspondence: [email protected]; Tel.: +49-8161-71-2904; Fax: +49-8161-71-2970 Received: 13 February 2019; Accepted: 12 March 2019; Published: 20 March 2019 Abstract: G protein-coupled receptors (GPCRs) belong to the largest class of drug targets. Approximately half of the members of the human GPCR superfamily are chemosensory receptors, including odorant receptors (ORs), trace amine-associated receptors (TAARs), bitter taste receptors (TAS2Rs), sweet and umami taste receptors (TAS1Rs). Interestingly, these chemosensory GPCRs (csGPCRs) are expressed in several tissues of the body where they are supposed to play a role in biological functions other than chemosensation. Despite their abundance and physiological/pathological relevance, the druggability of csGPCRs has been suggested but not fully characterized. Here, we aim to explore the potential of targeting csGPCRs to treat diseases by reviewing the current knowledge of csGPCRs expressed throughout the body and by analysing the chemical space and the drug-likeness of flavour molecules. Keywords: smell; taste; flavour molecules; drugs; chemosensory receptors; ecnomotopic expression 1. Introduction Thirty-five percent of approved drugs act by modulating G protein-coupled receptors (GPCRs) [1,2]. GPCRs, also named 7-transmembrane (7TM) receptors, based on their canonical structure, are the largest family of membrane receptors in the human genome.
    [Show full text]
  • Association of Taste Receptor Gene Polymorphisms with Dental Caries
    ORIGINAL RESEARCH Genetic and Pediatric Dentistry Association of taste receptor gene polymorphisms with dental caries Abstract: This study was performed to evaluate the interplay between dental caries, nutritional status, and genetic polymorphisms Juliana ARID(a) Lívia Azeredo Alves ANTUNES(b) in TAS1R1 and TAS1R2 (taste receptor, type 1, member 1 and 2) in Luiza Foltran de Azevedo KOCH(c) preschool children and pre-adolescents. We included 525 subjects (d) Silvane Silva EVANGELISTA (306 preschool children and 219 pre-adolescents). Parents/caregivers Katia Regina Felizardo VASCONCELOS(e) answered a self-administered questionnaire about their children’s João Armando BRANCHER(c) systemic health, characteristics, oral hygiene habits, and diet. Marilisa Carneiro Leão Clinical examination was performed to evaluate dental caries and GABARDO(c) Ana Julia MILANI(f) nutritional status. Saliva samples were collected for DNA extraction. André Luiz Tannus DUTRA(g) The genotyping of rs17492553 (TAS1R1), rs3935570, and rs4920566 (b) Leonardo Santos ANTUNES (TAS1R2) polymorphisms was performed using real-time PCR with Alexandre Rezende VIEIRA(h) Juliana FELTRIN-SOUZA(i) Taqman Genotyping Master Mix and SNP assay. Both univariate Erika Calvano KÜCHLER(a) and multivariate Poisson regression analyses with robust variance were used for the data analysis. In preschool children, consumption (a) Universidade de São Paulo – USP, Ribeirão Preto Dental School, Department of of sweets between meals increased the prevalence of dental Pediatric Dentistry, Ribeirão Preto, SP, Brazil. caries by 85% (PRc = 1.85; 95%CI 1.39–2.46; p < 0.001), whereas in (b) Universidade Federal Fluminense – UFF, School of Dentistry, Department of Specific pre-adolescents, this prevalence increased by 34% (PRa = 1.34; Formation, Nova Friburgo, RJ, Brazil.
    [Show full text]
  • Allelic Variation of the Tas1r3 Taste Receptor Gene Affects Sweet Taste Responsiveness And
    PLOS ONE RESEARCH ARTICLE Allelic variation of the Tas1r3 taste receptor gene affects sweet taste responsiveness and metabolism of glucose in F1 mouse hybrids Vladimir O. Murovets☯, Ekaterina A. Lukina☯, Egor A. Sozontov☯, Julia V. Andreeva☯, ☯ ☯ Raisa P. Khropycheva , Vasiliy A. ZolotarevID* Pavlov Institute of Physiology, Russian Academy of Sciences, Saint Petersburg, Russia a1111111111 ☯ These authors contributed equally to this work. a1111111111 * [email protected] a1111111111 a1111111111 a1111111111 Abstract In mammals, inter- and intraspecies differences in consumption of sweeteners largely depend on allelic variation of the Tas1r3 gene (locus Sac) encoding the T1R3 protein, a sweet taste receptor subunit. To assess the influence of Tas1r3 polymorphisms on feeding OPEN ACCESS behavior and metabolism, we examined the phenotype of F1 male hybrids obtained from Citation: Murovets VO, Lukina EA, Sozontov EA, Andreeva JV, Khropycheva RP, Zolotarev VA crosses between the following inbred mouse strains: females from 129SvPasCrl (129S2) (2020) Allelic variation of the Tas1r3 taste receptor bearing the recessive Tas1r3 allele and males from either C57BL/6J (B6), carrying the domi- gene affects sweet taste responsiveness and nant allele, or the Tas1r3-gene knockout strain C57BL/6J-Tas1r3tm1Rfm (B6-Tas1r3-/-). The metabolism of glucose in F1 mouse hybrids. PLoS hybrids 129S2B6F1 and 129S2B6-Tas1r3-/-F1 had identical background genotypes and dif- ONE 15(7): e0235913. https://doi.org/10.1371/ journal.pone.0235913 ferent sets of Tas1r3 alleles. The effect of Tas1r3 hemizygosity was analyzed by comparing the parental strain B6 (Tas1r3 homozygote) and hemizygous F hybrids B6 × B6-Tas1r3-/-. Editor: Keiko Abe, The University of Tokyo, JAPAN 1 Data showed that, in 129S2B6-Tas1r3-/-F1 hybrids, the reduction of glucose tolerance, Received: February 24, 2020 along with lower consumption of and lower preference for sweeteners during the initial lick- Accepted: June 25, 2020 ing responses, is due to expression of the recessive Tas1r3 allele.
    [Show full text]
  • TAS1R1 and TAS1R3 Polymorphisms Relate to Energy and Protein-Rich Food Choices from a Buffet Meal Respectively
    nutrients Communication TAS1R1 and TAS1R3 Polymorphisms Relate to Energy and Protein-Rich Food Choices from a Buffet Meal Respectively Pengfei Han 1,2 , Russell Keast 3 and Eugeni Roura 1,* 1 Centre for Nutrition and Food Sciences, Queensland Alliance for Agriculture and Food Innovation, The University of Queensland, St. Lucia QLD 4072, Australia; [email protected] 2 Interdisciplinary Centre Smell and Taste, Department of Otorhinolaryngology, Technische Universität Dresden, Fetscherstrasse 74, 01307 Dresden, Germany 3 School of Exercise and Nutritional Sciences, Centre for Advanced Sensory Science, Deakin University, Burwood VIC, 3126, Australia; [email protected] * Correspondence: [email protected]; Tel.: +61-7-3365-2526 Received: 4 November 2018; Accepted: 30 November 2018; Published: 4 December 2018 Abstract: Eating behaviour in humans is a complex trait that involves sensory perception. Genetic variation in sensory systems is one of the factors influencing perception of foods. However, the extent that these genetic variations may determine food choices in a real meal scenario warrants further research. This study investigated how genetic variants of the umami taste receptor (TAS1R1/TAS1R3) related to consumption of umami-tasting foods. Thirty normal-weight adult subjects were offered “ad libitum” access to a variety of foods covering the full range of main taste-types for 40 min using a buffet meal arrangement. Buccal cell samples were collected and analysed for six single nucleotide polymorphisms (SNPs) reported previously related to the TAS1R1/TAS1R3 genes. Participants identified with the CC alleles of the TAS1R3 rs307355 and rs35744813 consumed significantly more protein from the buffet than T carriers.
    [Show full text]