DOCSLIB.ORG

Thesis (Complete)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Thesis (Complete) UvA-DARE (Digital Academic Repository) Genome integrity maintenance during spermatogonial development Zheng, Y. Publication date 2018 Document Version Final published version License Other Link to publication Citation for published version (APA): Zheng, Y. (2018). Genome integrity maintenance during spermatogonial development. General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons). Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible. UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl) Download date:06 Oct 2021 Genome integrity maintenance during spermatogonial development Yi Zheng Genome integrity maintenance during spermatogonial development PhD Thesis, University of Amsterdam, The Netherlands © Yi Zheng 2018, Amsterdam All rights reserved. No parts of this dissertation may be reproduced, stored in a retrieval system of any nature, or transmitted in any form or by any means without written permission from the author. This thesis describes research performed in the Reproductive Biology Laboratory of the Center for Reproductive Medicine, Academic Medical Center, University of Amsterdam, The Netherlands. ISBN: 978-94-6332-307-9 Cover: SMC5/6 molecule by Dideke Emma Verver Printing: GVO drukkers & vormgevers B.V. Genome integrity maintenance during spermatogonial development ACADEMISCH PROEFSCHRIFT ter verkrijging van de graad van doctor aan de Universiteit van Amsterdam op gezag van de Rector Magnificus prof. dr. ir. K.I.J. Maex ten overstaan van een door het College voor Promoties ingestelde commissie, in het openbaar te verdedigen in de Agnietenkapel op donderdag 15 februari 2018, te 14.00 uur door Yi Zheng geboren te Sichuan, China Promotiecommissie Promotor: Prof. dr. S. Repping AMC-UvA Co-promotor: Dr. G. Hamer AMC-UvA Overige leden: Dr. ir. W.M. Baarends Erasmus Universiteit Rotterdam Prof. dr. N. Zelcer AMC-UvA Prof. dr. C.J.F. van Noorden AMC-UvA Dr. N.A.P. Franken AMC-UvA Prof. dr. D.G. de Rooij Universiteit Utrecht Faculteit der Geneeskunde Table of contents Chapte 1 7 General introduction and outline of the thesis Chapter 2 21 Non-SMC element 2 (NSMCE2) of the SMC5/6 complex helps to resolve topological stress Verver DE#, Zheng Y#, Speijer D, Hoebe R, Dekker HL, Repping S, Stap J, Hamer G #equal contribution International Journal of Molecular Sciences. 2016 Oct 26;17(11). pii: E1782 Chapter 3 49 Trivial role for NSMCE2 during in vitro proliferation and differentiation of male germline stem cells Zheng Y, Jongejan A, Mulder CL, Mastenbroek S, Repping S, Wang Y, Li J, Hamer G Reproduction. 2017 Sep;154(3):81-95 Chapter 4 77 On the increasing sensitivity of differentiating spermatogonia to DNA damage Zheng Y, Jongejan A, Mulder CL, van Daalen SKM, Mastenbroek S, Hwang G, Jordan P, Repping S, Hamer G Submitted Chapter 5 107 Spermatogonial stem cell autotransplantation and germline genomic editing: a future cure for spermatogenic failure and prevention of transmission of genomic diseases Mulder CL#, Zheng Y#, Jan SZ, Struijk RB, Repping S, Hamer G*, van Pelt AM #equal contribution, *corresponding author Human Reproduction Update. 2016 Sep;22(5):561-73 Chapter 6 139 General discussion and implications for future research Chapter 7 155 Summary Samenvatting Acknowledgements 160 PhD portfolio 162 About the author 163 List of publications 164 Chapter 1 General introduction and outline of the thesis 8 Chapter 1 Background Spermatogenic failure An estimated 10-15% of couples suffer from subfertility [1, 2], defined as the inability to conceive after one year of unprotected intercourse [3, 4]. Although the most important factor that affects human fertility is female age, in about half of these couples reduced semen quality is commonly observed [3, 5]. Reduced semen quality can be characterized by low sperm counts (oligozoospermia), low sperm motility (asthenozoospermia), low number of morphologically normal sperm (teratozoospermia) or the most extreme clinical presentation- a complete absence of sperm in the semen (azoospermia) [6]. Azoospermia can be subdivided into obstructive and non-obstructive azoospermia [2]. In the case of obstructive azoospermia, the process of spermatogenesis is most often not affected, but the spermatozoa cannot reach the semen due to a physical obstruction. In the case of non- obstructive azoospermia, the lack of sperm in the semen is caused by severely decreased or absent sperm production in the testis, often referred to as spermatogenic failure. Despite the clinical importance, very little is known about the etiology of spermatogenic failure. There are only a few established causes for spermatogenic failure, including DNA damage caused by chemo- or radiotherapy [7], structural or numerical chromosomal abnormalities [5] and Y- chromosome deletions [8]. Nonetheless, the etiology of spermatogenic failure remains unknown in most cases. It is presumed that genetic mutations lie at the base of many cases of spermatogenic failure [9, 10]. Yet, no direct treatment options for spermatogenic failure are currently available to allow these men to achieve genetic parenthood. The only option to date is the use of testicular sperm extraction (TESE) in combination with intra-cytoplasmic sperm injection (ICSI). The drawback is however that the chance of finding spermatozoa upon TESE in men with non-obstructive azoospermia is roughly 50% and that ICSI implies ovarian hyperstimulation of the unaffected female partner as well as fertilization and culture of the resulting embryos in vitro. If indeed spermatogenic failure is genetic in origin, this would require a precisely patient-specific targeted therapeutic approach, or germline genome modification to restore the genome into its original ‘fertile’ state. This is currently not yet feasible. Spermatogenesis and spermatogonial stem cells (SSCs) Spermatogenesis is an intricate developmental process ultimately leading to the continuous production of spermatozoa. The whole process comprises three consecutive developmental stages: the spermatogonial stage (mitotic proliferation and differentiation), the spermatocyte stage (meiosis) and the spermatid stage (spermiogenesis) [11]. Specifically, General introduction 9 spermatogenesis initiates from type A spermatogonia that undergo multiple mitotic divisions and then differentiate into intermediate and type B spermatogonia. Type B spermatogonia will then divide to form pre-leptotene spermatocytes that replicate their DNA and enter meiosis. The spermatocytes will subsequently undergo two consecutive meiotic divisions (meiosis I and II) to generate round spermatids which then further develop into elongating spermatids and eventually mature sperm. The type A spermatogonia can be divided into undifferentiated and differentiating spermatogonia. The undifferentiated spermatogonia proliferate freely and maintain spermatogonial density in the testis. In contrast, the differentiating spermatogonia are irreversibly committed towards meiosis and their divisions are strictly regulated. An important subset of the undifferentiated spermatogonia are the spermatogonial stem cells (SSCs). These cells can be defined by their ability to generate and maintain donor-derived spermatogenesis when transplanted into infertile recipient testes [12]. To maintain lifelong male fertility, a perfect balance between SSC self-renewal and differentiation is essential. Too much self-renewal may lead to tumor-like germ cell clusters, while excessive differentiation will lead to germ cell depletion [13]. Despite the apparent importance of this balance, knowledge regarding the molecular mechanisms underlying SSC self-renewal and differentiation remains limited [11]. The spermatogonial response to DNA damage DNA damage, for instance caused by irradiation or chemotherapy, often results in germ cell apoptosis. Many cancer patients undergoing chemo- or radiotherapy are therefore confronted with reduced fertility [14-16]. Furthermore, DNA damage in germ cells that is not correctly repaired can lead to genetic mutations or chromosomal aberrations that can be transmitted to the offspring. For this reason it is thought that germ cells hold a unique response to DNA damage. Indeed, they are generally much more prone to undergo apoptosis in response to DNA damage than somatic cells [17, 18]. Even among the different types of spermatogonia differences in radiosensitivity exist. Differentiating spermatogonia are more radiosensitive and inclined to undergo apoptosis in response to irradiation than the undifferentiated spermatogonial population [19]. Even between the undifferentiated spermatogonia differences exist, with the self-renewing SSCs being the most resistant to DNA damage [20-22]. It seems that, while differentiating spermatogonia with DNA damage are readily eliminated, preservation of SSCs, and thus long-term male fertility,
Load more

Recommended publications
  • SEC23IP (NM 007190) Human Recombinant Protein – TP309056
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP309056 SEC23IP (NM_007190) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Recombinant protein of human SEC23 interacting protein (SEC23IP) Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 110.9 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_009121 Locus ID: 11196 UniProt ID: Q9Y6Y8 RefSeq Size: 7306 Cytogenetics: 10q26.11-q26.12 RefSeq ORF: 3000 Synonyms: iPLA1beta; MSTP053; P125; P125A Summary: This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011] This product is to be used for laboratory only.
    [Show full text]
  • Genetic Variant in 3' Untranslated Region of the Mouse Pycard Gene
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 2 3 Title: 4 Genetic Variant in 3’ Untranslated Region of the Mouse Pycard Gene Regulates Inflammasome 5 Activity 6 Running Title: 7 3’UTR SNP in Pycard regulates inflammasome activity 8 Authors: 9 Brian Ritchey1*, Qimin Hai1*, Juying Han1, John Barnard2, Jonathan D. Smith1,3 10 1Department of Cardiovascular & Metabolic Sciences, Lerner Research Institute, Cleveland Clinic, 11 Cleveland, OH 44195 12 2Department of Quantitative Health Sciences, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 13 44195 14 3Department of Molecular Medicine, Cleveland Clinic Lerner College of Medicine of Case Western 15 Reserve University, Cleveland, OH 44195 16 *, These authors contributed equally to this study. 17 Address correspondence to Jonathan D. Smith: email [email protected]; ORCID ID 0000-0002-0415-386X; 18 mailing address: Cleveland Clinic, Box NC-10, 9500 Euclid Avenue, Cleveland, OH 44195, USA. 19 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 20 Abstract 21 Quantitative trait locus mapping for interleukin-1 release after inflammasome priming and activation 22 was performed on bone marrow-derived macrophages (BMDM) from an AKRxDBA/2 strain intercross.
    [Show full text]
  • TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase
    Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted.
    [Show full text]
  • SEC23IP (NM 007190) Human Tagged ORF Clone – RG209056
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG209056 SEC23IP (NM_007190) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: SEC23IP (NM_007190) Human Tagged ORF Clone Tag: TurboGFP Symbol: SEC23IP Synonyms: iPLA1beta; MSTP053; P125; P125A Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 SEC23IP (NM_007190) Human Tagged ORF Clone – RG209056 ORF Nucleotide >RG209056 representing NM_007190 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGAGAGAAAACCTAACGGTGGCAGCGGCGGCGCCTCCACTTCCTCATCGGGCACTAACTTACTTT TCTCCTCCTCGGCCACGGAGTTCAGCTTCAATGTGCCCTTCATCCCAGTCACCCAGGCCTCCGCTTCTCC GGCCTCCCTGCTCTTACCGGGAGAGGATTCCACAGATGTTGGTGAGGAGGACAGCTTCCTTGGTCAGACT TCTATTCACACATCTGCCCCACAGACATTTAGTTACTTCTCTCAGGTATCAAGCAGCAGTGATCCTTTTG GGAATATTGGACAGTCACCATTAACAACTGCAGCAACCTCAGTTGGACAATCAGGATTCCCCAAGCCCCT GACTGCTCTCCCTTTTACAACTGGATCCCAAGATGTCTCGAATGCATTTTCACCATCCATTTCGAAGGCT CAACCTGGTGCTCCACCTTCCTCACTGATGGGAATAAATTCTTATCTGCCTTCTCAGCCAAGTAGTCTCC CTCCTTCATATTTTGGGAACCAACCCCAAGGAATTCCCCAACCAGGATACAATCCATATCGCCATACCCC TGGCAGCAGCAGGGCTAATCCTTACATTGCACCACCCCAGCTGCAGCAGTGCCAAACACCAGGCCCTCCT
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • SCAP/SREBP Pathway Is Required for the Full Steroidogenic Response To
    SCAP/SREBP pathway is required for the full PNAS PLUS steroidogenic response to cyclic AMP Masami Shimizu-Alberginea,b,c, Brian Van Yserloob,c, Martin G. Golkowskia, Shao-En Onga, Joseph A. Beavoa,1,2, and Karin E. Bornfeldtb,c,d,1,2 aSchool of Medicine, Department of Pharmacology, University of Washington, Seattle, WA 98195; bSchool of Medicine, Department of Medicine, Division of Metabolism, Endocrinology and Nutrition, University of Washington, Seattle, WA 98109; cUniversity of Washington Diabetes Institute, School of Medicine, University of Washington, Seattle, WA 98109; and dSchool of Medicine, Department of Pathology, University of Washington Diabetes Institute, University of Washington, Seattle, WA 98109 Contributed by Joseph A. Beavo, July 19, 2016 (sent for review May 14, 2016; reviewed by Marco Conti, Donald Maurice, and Timothy Osborne) Luteinizing hormone (LH) stimulates steroidogenesis largely through Cellular cholesterol levels are controlled in part by several a surge in cyclic AMP (cAMP). Steroidogenic rates are also critically transcription factors, including sterol-regulatory element-binding dependent on the availability of cholesterol at mitochondrial sites of proteins (SREBPs) 2 and 1a, that promote cholesterol bio- synthesis. This cholesterol is provided by cellular uptake of lipoproteins, synthetic gene expression when cellular cholesterol levels are too mobilization of intracellular lipid, and de novo synthesis. Whether low to meet demand (9, 10). The activities of the SREBPs are and how these pathways are coordinated by cAMP are poorly un- precisely controlled by an escort protein, SREBP cleavage-acti- derstood. Recent phosphoproteomic analyses of cAMP-dependent vating protein (SCAP), and the insulin-inducible gene product phosphorylation sites in MA10 Leydig cells suggested that cAMP (Insig) (11–13).
    [Show full text]
  • ID AKI Vs Control Fold Change P Value Symbol Entrez Gene Name *In
    ID AKI vs control P value Symbol Entrez Gene Name *In case of multiple probesets per gene, one with the highest fold change was selected. Fold Change 208083_s_at 7.88 0.000932 ITGB6 integrin, beta 6 202376_at 6.12 0.000518 SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 1553575_at 5.62 0.0033 MT-ND6 NADH dehydrogenase, subunit 6 (complex I) 212768_s_at 5.50 0.000896 OLFM4 olfactomedin 4 206157_at 5.26 0.00177 PTX3 pentraxin 3, long 212531_at 4.26 0.00405 LCN2 lipocalin 2 215646_s_at 4.13 0.00408 VCAN versican 202018_s_at 4.12 0.0318 LTF lactotransferrin 203021_at 4.05 0.0129 SLPI secretory leukocyte peptidase inhibitor 222486_s_at 4.03 0.000329 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 1552439_s_at 3.82 0.000714 MEGF11 multiple EGF-like-domains 11 210602_s_at 3.74 0.000408 CDH6 cadherin 6, type 2, K-cadherin (fetal kidney) 229947_at 3.62 0.00843 PI15 peptidase inhibitor 15 204006_s_at 3.39 0.00241 FCGR3A Fc fragment of IgG, low affinity IIIa, receptor (CD16a) 202238_s_at 3.29 0.00492 NNMT nicotinamide N-methyltransferase 202917_s_at 3.20 0.00369 S100A8 S100 calcium binding protein A8 215223_s_at 3.17 0.000516 SOD2 superoxide dismutase 2, mitochondrial 204627_s_at 3.04 0.00619 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 223217_s_at 2.99 0.00397 NFKBIZ nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta 231067_s_at 2.97 0.00681 AKAP12 A kinase (PRKA) anchor protein 12 224917_at 2.94 0.00256 VMP1/ mir-21likely ortholog
    [Show full text]
  • UNIVERSITY of CALIFORNIA Los Angeles a Sterile Alpha Motif
    UNIVERSITY OF CALIFORNIA Los Angeles A Sterile Alpha Motif Domain Network Involved in Kidney Development A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biochemistry and Molecular Biology by Catherine Nicole Leettola 2015 ABSTRACT OF THE DISSERTATION A Sterile Alpha Motif Domain Network Involved in Kidney Development by Catherine Nicole Leettola Doctor of Philosophy in Biochemistry and Molecular Biology University of California, Los Angeles, 2015 Professor James U. Bowie, Chair Cystic kidney diseases including polycystic kidney disease (PKD) and nephronophthisis (NPHP) are the most common genetic disorders leading to end-stage renal failure in humans. Animal models and human cases of PKD and NPHP have implicated the sterile alpha motif (SAM) domain containing proteins bicaudal C homolog 1 (BICC1) and ankyrin repeat and SAM- domain containing protein 6 (ANKS6) as being involved in these conditions and important for renal development. SAM domains are known protein-protein interaction domains that are capable of binding each other to form polymers and heterodimers. Using a negGFP native gel assay, we have identified the SAM domain of the previously uncharacterized protein ankyrin repeat and SAM-domain containing protein 3 (ANKS3) as a direct binding partner of the BICC1 and ANKS6 SAM domains. We found the ANKS3 SAM domain to polymerize with moderate affinity and determined the ANKS6 SAM domain can bind to a single end of this polymer. Crystal structures of the ANKS3 SAM domain polymer and the ANKS3 SAM-ANKS6 SAM ii heterodimer are presented to reveal typical ML-EH SAM domain interaction interfaces with a pronounced charge complementarity.
    [Show full text]
  • Diagnostic Yield and Novel Candidate Genes by Exome Sequencing in 152 Consanguineous Families with Neurodevelopmental Disorders
    Research JAMA Psychiatry | Original Investigation Diagnostic Yield and Novel Candidate Genes by Exome Sequencing in 152 Consanguineous Families With Neurodevelopmental Disorders Miriam S. Reuter, MD; Hasan Tawamie, MA; Rebecca Buchert, MA; Ola Hosny Gebril, MD; Tawfiq Froukh, PhD; Christian Thiel, MD; Steffen Uebe, PhD; Arif B. Ekici, PhD; Mandy Krumbiegel, PhD; Christiane Zweier, MD; Juliane Hoyer, MD; Karolin Eberlein, MD; Judith Bauer, MD; Ute Scheller, MD; Tim M. Strom, MD; Sabine Hoffjan, MD; Ehab R. Abdelraouf, MD; Nagwa A. Meguid, MD, PhD; Ahmad Abboud, MD; Mohammed Ayman Al Khateeb, MD; Mahmoud Fakher, MD; Saber Hamdan, MD; Amina Ismael, MD; Safia Muhammad, MD; Ebtessam Abdallah, MD, PhD; Heinrich Sticht, PhD; Dagmar Wieczorek, MD; André Reis, MD; Rami Abou Jamra, MD Supplemental content IMPORTANCE Autosomal recessive inherited neurodevelopmental disorders are highly heterogeneous, and many, possibly most, of the disease genes are still unknown. OBJECTIVES To promote the identification of disease genes through confirmation of previously described genes and presentation of novel candidates and provide an overview of the diagnostic yield of exome sequencing in consanguineous families. DESIGN, SETTING, AND PARTICIPANTS Autozygosity mapping in families and exome sequencing of index patients were performed in 152 consanguineous families (the parents descended from a same ancestor) with at least 1 offspring with intellectual disability (ID). The study was conducted from July 1, 2008, to June 30, 2015, and data analysis was conducted from July 1, 2015, to August 31, 2016. RESULTS Of the 152 consanguineous families enrolled, 1 child (in 45 families [29.6%]) or multiple children (107 families [70.4%]) had ID; additional features were present in 140 of the families (92.1%).
    [Show full text]
  • Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase
    BASIC RESEARCH www.jasn.org Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase † ‡ Yifei Zhong,* Edward Y. Chen, § Ruijie Liu,*¶ Peter Y. Chuang,* Sandeep K. Mallipattu,* ‡ ‡ † | ‡ Christopher M. Tan, § Neil R. Clark, § Yueyi Deng, Paul E. Klotman, Avi Ma’ayan, § and ‡ John Cijiang He* ¶ *Department of Medicine, Mount Sinai School of Medicine, New York, New York; †Department of Nephrology, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai, China; ‡Department of Pharmacology and Systems Therapeutics and §Systems Biology Center New York, Mount Sinai School of Medicine, New York, New York; |Baylor College of Medicine, Houston, Texas; and ¶Renal Section, James J. Peters Veterans Affairs Medical Center, New York, New York ABSTRACT The Connectivity Map database contains microarray signatures of gene expression derived from approximately 6000 experiments that examined the effects of approximately 1300 single drugs on several human cancer cell lines. We used these data to prioritize pairs of drugs expected to reverse the changes in gene expression observed in the kidneys of a mouse model of HIV-associated nephropathy (Tg26 mice). We predicted that the combination of an angiotensin-converting enzyme (ACE) inhibitor and a histone deacetylase inhibitor would maximally reverse the disease-associated expression of genes in the kidneys of these mice. Testing the combination of these inhibitors in Tg26 mice revealed an additive renoprotective effect, as suggested by reduction of proteinuria, improvement of renal function, and attenuation of kidney injury. Furthermore, we observed the predicted treatment-associated changes in the expression of selected genes and pathway components. In summary, these data suggest that the combination of an ACE inhibitor and a histone deacetylase inhibitor could have therapeutic potential for various kidney diseases.
    [Show full text]
  • Diagnosis of Metastatic Melanoma and Monitoring
    (19) TZZ ZZ_Z_T (11) EP 2 080 140 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: G06F 19/00 (2011.01) 24.04.2013 Bulletin 2013/17 (86) International application number: (21) Application number: 07871360.9 PCT/US2007/083555 (22) Date of filing: 03.11.2007 (87) International publication number: WO 2008/100352 (21.08.2008 Gazette 2008/34) (54) DIAGNOSIS OF METASTATIC MELANOMA AND MONITORING INDICATORS OF IMMUNOSUPPRESSION THROUGH BLOOD LEUKOCYTE MICROARRAY ANALYSIS DIAGNOSE VON METASTASIERENDEM MELANOM UND ÜBERWACHUNG VON IMMUNSUPPRESSIONSINDIKATOREN MITTTELS LEUKOZYTEN-MIKROARRAY DIAGNOSTIC DE MELANOME METASTATIQUE ET SURVEILLANCE D’INDICATEURS D’IMMUNOSUPPRESSION PAR ANALYSE DE MICRORESEAUX DE LEUCOCYTES SANGUINS (84) Designated Contracting States: • PAVEY SANDRA ET AL: "Microarray expression AT BE BG CH CY CZ DE DK EE ES FI FR GB GR profiling in melanoma reveals a BRAF mutation HU IE IS IT LI LT LU LV MC MT NL PL PT RO SE signature", ONCOGENE, vol. 23, no. 23, 20 May SI SK TR 2004 (2004-05-20), pages 4060-4067, XP002644753, ISSN: 0950-9232 (30) Priority: 03.11.2006 US 856406 P • ZHOU YOUWEN ET AL: "Osteopontin expression correlates with melanoma invasion", JOURNAL (43) Date of publication of application: OF INVESTIGATIVE DERMATOLOGY, vol. 124, 22.07.2009 Bulletin 2009/30 no. 5, May 2005 (2005-05), pages 1044-1052, XP002644754, ISSN: 0022-202X (60) Divisional application: • BITTNER M ET AL: "MOLECULAR 12152482.1 / 2 506 172 CLASSIFICATION OF CUTANEOUS MALIGNANT 12196231.0 / 2 579 174 MELANOMA BY GENE EXPRESSION 12196232.8 / 2 570 951 PROFILING", NATURE, NATURE PUBLISHING GROUP, LONDON, GB, vol.
    [Show full text]
  • Gene Identification in Hereditary Spastic Paraplegias and Characterization of Spastic Paraplegia Type 58 (SPG58)
    Gene identification in Hereditary Spastic Paraplegias and characterization of spastic paraplegia type 58 (SPG58) Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften der Mathematisch-Naturwissenschaftlichen Fakultät und der Medizinischen Fakultät der Eberhard-Karls-Universität Tübingen vorgelegt von Andrés Caballero García de Oteyza aus Madrid, Spanien Oktober - 2016 Tag der mündlichen Prüfung: 14 Oktober 2016 Dekan der Math.-Nat. Fakultät: Prof. Dr. W. Rosenstiel Dekan der Medizinischen Fakultät: Prof. Dr. I. B. Autenrieth 1. Berichterstatter: Prof. Dr. Ludger Schöls 2. Berichterstatter: Prof. Dr. Doron Rapaport Prüfungskommission: Prof. Dr. Peter Heutink Prof. Dr. Thomas Gasser Prof. Dr. Ludger Schöls Dr. Michela Deleidi 2 I hereby declare that I have produced the work entitled: “Gene Identification in Hereditary Spastic Paraplegias and Characterization of spastic paraplegia type 58 (SPG58)”, submitted for the award of a doctorate, on my own (without external help), have used only the sources and aids indicated and have marked passages included from other works, whether verbatim or in content, as such. I swear upon oath that these statements are true and that I have not concealed anything. I am aware that making a false declaration under oath is punishable by a term of imprisonment of up to three years or by a fine. Tübingen, October 21st 2016 Andrés Caballero García de Oteyza Date Signature 3 Acknowledgements I would like to start thanking Dr. Rebecca Schüle for having given me the opportunity to start such an exciting project together. I also thank her because she believed in me even though I had little experience when I started. She has guided and taught me patiently as much as I have asked for.
    [Show full text]