A Cascade of ER Exit Site Assembly That Is Regulated by P125a and Lipid Signals
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Mea6 Controls VLDL Transport Through the Coordinated Regulation of COPII Assembly
Cell Research (2016) 26:787-804. npg © 2016 IBCB, SIBS, CAS All rights reserved 1001-0602/16 $ 32.00 ORIGINAL ARTICLE www.nature.com/cr Mea6 controls VLDL transport through the coordinated regulation of COPII assembly Yaqing Wang1, *, Liang Liu1, 2, *, Hongsheng Zhang1, 2, Junwan Fan1, 2, Feng Zhang1, 2, Mei Yu3, Lei Shi1, Lin Yang1, Sin Man Lam1, Huimin Wang4, Xiaowei Chen4, Yingchun Wang1, Fei Gao5, Guanghou Shui1, Zhiheng Xu1, 6 1State Key Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China; 2University of Chinese Academy of Sciences, Beijing 100101, China; 3School of Life Science, Shandong University, Jinan 250100, China; 4Institute of Molecular Medicine, Peking University, Beijing 100871, China; 5State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China; 6Translation- al Medical Center for Stem Cell Therapy, Shanghai East Hospital, Tongji University School of Medicine, Shanghai 200120, China Lipid accumulation, which may be caused by the disturbance in very low density lipoprotein (VLDL) secretion in the liver, can lead to fatty liver disease. VLDL is synthesized in endoplasmic reticulum (ER) and transported to Golgi apparatus for secretion into plasma. However, the underlying molecular mechanism for VLDL transport is still poor- ly understood. Here we show that hepatocyte-specific deletion of meningioma-expressed antigen 6 (Mea6)/cutaneous T cell lymphoma-associated antigen 5C (cTAGE5C) leads to severe fatty liver and hypolipemia in mice. Quantitative lip- idomic and proteomic analyses indicate that Mea6/cTAGE5 deletion impairs the secretion of different types of lipids and proteins, including VLDL, from the liver. -
SEC23IP (NM 007190) Human Recombinant Protein – TP309056
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP309056 SEC23IP (NM_007190) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Recombinant protein of human SEC23 interacting protein (SEC23IP) Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 110.9 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_009121 Locus ID: 11196 UniProt ID: Q9Y6Y8 RefSeq Size: 7306 Cytogenetics: 10q26.11-q26.12 RefSeq ORF: 3000 Synonyms: iPLA1beta; MSTP053; P125; P125A Summary: This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011] This product is to be used for laboratory only. -
Genetic Variant in 3' Untranslated Region of the Mouse Pycard Gene
bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 2 3 Title: 4 Genetic Variant in 3’ Untranslated Region of the Mouse Pycard Gene Regulates Inflammasome 5 Activity 6 Running Title: 7 3’UTR SNP in Pycard regulates inflammasome activity 8 Authors: 9 Brian Ritchey1*, Qimin Hai1*, Juying Han1, John Barnard2, Jonathan D. Smith1,3 10 1Department of Cardiovascular & Metabolic Sciences, Lerner Research Institute, Cleveland Clinic, 11 Cleveland, OH 44195 12 2Department of Quantitative Health Sciences, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 13 44195 14 3Department of Molecular Medicine, Cleveland Clinic Lerner College of Medicine of Case Western 15 Reserve University, Cleveland, OH 44195 16 *, These authors contributed equally to this study. 17 Address correspondence to Jonathan D. Smith: email [email protected]; ORCID ID 0000-0002-0415-386X; 18 mailing address: Cleveland Clinic, Box NC-10, 9500 Euclid Avenue, Cleveland, OH 44195, USA. 19 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 20 Abstract 21 Quantitative trait locus mapping for interleukin-1 release after inflammasome priming and activation 22 was performed on bone marrow-derived macrophages (BMDM) from an AKRxDBA/2 strain intercross. -
Mechanisms of Synaptic Plasticity Mediated by Clathrin Adaptor-Protein Complexes 1 and 2 in Mice
Mechanisms of synaptic plasticity mediated by Clathrin Adaptor-protein complexes 1 and 2 in mice Dissertation for the award of the degree “Doctor rerum naturalium” at the Georg-August-University Göttingen within the doctoral program “Molecular Biology of Cells” of the Georg-August University School of Science (GAUSS) Submitted by Ratnakar Mishra Born in Birpur, Bihar, India Göttingen, Germany 2019 1 Members of the Thesis Committee Prof. Dr. Peter Schu Institute for Cellular Biochemistry, (Supervisor and first referee) University Medical Center Göttingen, Germany Dr. Hans Dieter Schmitt Neurobiology, Max Planck Institute (Second referee) for Biophysical Chemistry, Göttingen, Germany Prof. Dr. med. Thomas A. Bayer Division of Molecular Psychiatry, University Medical Center, Göttingen, Germany Additional Members of the Examination Board Prof. Dr. Silvio O. Rizzoli Department of Neuro-and Sensory Physiology, University Medical Center Göttingen, Germany Dr. Roland Dosch Institute of Developmental Biochemistry, University Medical Center Göttingen, Germany Prof. Dr. med. Martin Oppermann Institute of Cellular and Molecular Immunology, University Medical Center, Göttingen, Germany Date of oral examination: 14th may 2019 2 Table of Contents List of abbreviations ................................................................................. 5 Abstract ................................................................................................... 7 Chapter 1: Introduction ............................................................................ -
TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase
Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. -
ER-To-Golgi Trafficking and Its Implication in Neurological Diseases
cells Review ER-to-Golgi Trafficking and Its Implication in Neurological Diseases 1,2, 1,2 1,2, Bo Wang y, Katherine R. Stanford and Mondira Kundu * 1 Department of Pathology, St. Jude Children’s Research Hospital, Memphis, TN 38105, USA; [email protected] (B.W.); [email protected] (K.R.S.) 2 Department of Cell and Molecular Biology, St. Jude Children’s Research Hospital, Memphis, TN 38105, USA * Correspondence: [email protected]; Tel.: +1-901-595-6048 Present address: School of Life Sciences, Xiamen University, Xiamen 361102, China. y Received: 21 November 2019; Accepted: 7 February 2020; Published: 11 February 2020 Abstract: Membrane and secretory proteins are essential for almost every aspect of cellular function. These proteins are incorporated into ER-derived carriers and transported to the Golgi before being sorted for delivery to their final destination. Although ER-to-Golgi trafficking is highly conserved among eukaryotes, several layers of complexity have been added to meet the increased demands of complex cell types in metazoans. The specialized morphology of neurons and the necessity for precise spatiotemporal control over membrane and secretory protein localization and function make them particularly vulnerable to defects in trafficking. This review summarizes the general mechanisms involved in ER-to-Golgi trafficking and highlights mutations in genes affecting this process, which are associated with neurological diseases in humans. Keywords: COPII trafficking; endoplasmic reticulum; Golgi apparatus; neurological disease 1. Overview Approximately one-third of all proteins encoded by the mammalian genome are exported from the endoplasmic reticulum (ER) and transported to the Golgi apparatus, where they are sorted for delivery to their final destination in membrane compartments or secretory vesicles [1]. -
SEC23IP (NM 007190) Human Tagged ORF Clone – RG209056
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG209056 SEC23IP (NM_007190) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: SEC23IP (NM_007190) Human Tagged ORF Clone Tag: TurboGFP Symbol: SEC23IP Synonyms: iPLA1beta; MSTP053; P125; P125A Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 SEC23IP (NM_007190) Human Tagged ORF Clone – RG209056 ORF Nucleotide >RG209056 representing NM_007190 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGAGAGAAAACCTAACGGTGGCAGCGGCGGCGCCTCCACTTCCTCATCGGGCACTAACTTACTTT TCTCCTCCTCGGCCACGGAGTTCAGCTTCAATGTGCCCTTCATCCCAGTCACCCAGGCCTCCGCTTCTCC GGCCTCCCTGCTCTTACCGGGAGAGGATTCCACAGATGTTGGTGAGGAGGACAGCTTCCTTGGTCAGACT TCTATTCACACATCTGCCCCACAGACATTTAGTTACTTCTCTCAGGTATCAAGCAGCAGTGATCCTTTTG GGAATATTGGACAGTCACCATTAACAACTGCAGCAACCTCAGTTGGACAATCAGGATTCCCCAAGCCCCT GACTGCTCTCCCTTTTACAACTGGATCCCAAGATGTCTCGAATGCATTTTCACCATCCATTTCGAAGGCT CAACCTGGTGCTCCACCTTCCTCACTGATGGGAATAAATTCTTATCTGCCTTCTCAGCCAAGTAGTCTCC CTCCTTCATATTTTGGGAACCAACCCCAAGGAATTCCCCAACCAGGATACAATCCATATCGCCATACCCC TGGCAGCAGCAGGGCTAATCCTTACATTGCACCACCCCAGCTGCAGCAGTGCCAAACACCAGGCCCTCCT -
Cryo-Tomography of Coat Complexes ISSN 2059-7983
research papers Visualizing membrane trafficking through the electron microscope: cryo-tomography of coat complexes ISSN 2059-7983 Evgenia A. Markova and Giulia Zanetti* Institute of Structural and Molecular Biology, Birkbeck College, Malet Street, London WC1E 7HX, England. Received 8 March 2019 *Correspondence e-mail: [email protected] Accepted 12 April 2019 Coat proteins mediate vesicular transport between intracellular compartments, Keywords: cryo-electron tomography; which is essential for the distribution of molecules within the eukaryotic cell. three-dimensional reconstruction; coat proteins; The global arrangement of coat proteins on the membrane is key to their vesicular transport; COPII; subtomogram function, and cryo-electron tomography and subtomogram averaging have been averaging. used to study membrane-bound coat proteins, providing crucial structural insight. This review outlines a workflow for the structural elucidation of coat proteins, incorporating recent developments in the collection and processing of cryo-electron tomography data. Recent work on coat protein I, coat protein II and retromer performed on in vitro reconstitutions or in situ is summarized. These studies have answered long-standing questions regarding the mechanisms of membrane binding, polymerization and assembly regulation of coat proteins. 1. Introduction Recent advances in cryo-electron microscopy (cryo-EM) have enabled numerous high-resolution studies which have addressed long-standing structural biology questions. The large body of cryo-EM work carried out for protein structure characterization has utilized single-particle electron micro- scopy (Cheng, 2018). Recently, developments in hardware, data collection and data processing have placed cryo-electron tomography (cryo-ET) and subtomogram averaging (STA) at the forefront of structural studies of repetitive assemblies, reaching resolutions comparable to those of single-particle EM (Schur et al., 2016; Wan et al., 2017; Hutchings et al., 2018; Dodonova et al., 2017; Himes & Zhang, 2018). -
Supplementary Table 1
Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7 -
SCAP/SREBP Pathway Is Required for the Full Steroidogenic Response To
SCAP/SREBP pathway is required for the full PNAS PLUS steroidogenic response to cyclic AMP Masami Shimizu-Alberginea,b,c, Brian Van Yserloob,c, Martin G. Golkowskia, Shao-En Onga, Joseph A. Beavoa,1,2, and Karin E. Bornfeldtb,c,d,1,2 aSchool of Medicine, Department of Pharmacology, University of Washington, Seattle, WA 98195; bSchool of Medicine, Department of Medicine, Division of Metabolism, Endocrinology and Nutrition, University of Washington, Seattle, WA 98109; cUniversity of Washington Diabetes Institute, School of Medicine, University of Washington, Seattle, WA 98109; and dSchool of Medicine, Department of Pathology, University of Washington Diabetes Institute, University of Washington, Seattle, WA 98109 Contributed by Joseph A. Beavo, July 19, 2016 (sent for review May 14, 2016; reviewed by Marco Conti, Donald Maurice, and Timothy Osborne) Luteinizing hormone (LH) stimulates steroidogenesis largely through Cellular cholesterol levels are controlled in part by several a surge in cyclic AMP (cAMP). Steroidogenic rates are also critically transcription factors, including sterol-regulatory element-binding dependent on the availability of cholesterol at mitochondrial sites of proteins (SREBPs) 2 and 1a, that promote cholesterol bio- synthesis. This cholesterol is provided by cellular uptake of lipoproteins, synthetic gene expression when cellular cholesterol levels are too mobilization of intracellular lipid, and de novo synthesis. Whether low to meet demand (9, 10). The activities of the SREBPs are and how these pathways are coordinated by cAMP are poorly un- precisely controlled by an escort protein, SREBP cleavage-acti- derstood. Recent phosphoproteomic analyses of cAMP-dependent vating protein (SCAP), and the insulin-inducible gene product phosphorylation sites in MA10 Leydig cells suggested that cAMP (Insig) (11–13). -
Craniofacial Diseases Caused by Defects in Intracellular Trafficking
G C A T T A C G G C A T genes Review Craniofacial Diseases Caused by Defects in Intracellular Trafficking Chung-Ling Lu and Jinoh Kim * Department of Biomedical Sciences, College of Veterinary Medicine, Iowa State University, Ames, IA 50011, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-515-294-3401 Abstract: Cells use membrane-bound carriers to transport cargo molecules like membrane proteins and soluble proteins, to their destinations. Many signaling receptors and ligands are synthesized in the endoplasmic reticulum and are transported to their destinations through intracellular trafficking pathways. Some of the signaling molecules play a critical role in craniofacial morphogenesis. Not surprisingly, variants in the genes encoding intracellular trafficking machinery can cause craniofacial diseases. Despite the fundamental importance of the trafficking pathways in craniofacial morphogen- esis, relatively less emphasis is placed on this topic, thus far. Here, we describe craniofacial diseases caused by lesions in the intracellular trafficking machinery and possible treatment strategies for such diseases. Keywords: craniofacial diseases; intracellular trafficking; secretory pathway; endosome/lysosome targeting; endocytosis 1. Introduction Citation: Lu, C.-L.; Kim, J. Craniofacial malformations are common birth defects that often manifest as part of Craniofacial Diseases Caused by a syndrome. These developmental defects are involved in three-fourths of all congenital Defects in Intracellular Trafficking. defects in humans, affecting the development of the head, face, and neck [1]. Overt cranio- Genes 2021, 12, 726. https://doi.org/ facial malformations include cleft lip with or without cleft palate (CL/P), cleft palate alone 10.3390/genes12050726 (CP), craniosynostosis, microtia, and hemifacial macrosomia, although craniofacial dys- morphism is also common [2]. -
ID AKI Vs Control Fold Change P Value Symbol Entrez Gene Name *In
ID AKI vs control P value Symbol Entrez Gene Name *In case of multiple probesets per gene, one with the highest fold change was selected. Fold Change 208083_s_at 7.88 0.000932 ITGB6 integrin, beta 6 202376_at 6.12 0.000518 SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 1553575_at 5.62 0.0033 MT-ND6 NADH dehydrogenase, subunit 6 (complex I) 212768_s_at 5.50 0.000896 OLFM4 olfactomedin 4 206157_at 5.26 0.00177 PTX3 pentraxin 3, long 212531_at 4.26 0.00405 LCN2 lipocalin 2 215646_s_at 4.13 0.00408 VCAN versican 202018_s_at 4.12 0.0318 LTF lactotransferrin 203021_at 4.05 0.0129 SLPI secretory leukocyte peptidase inhibitor 222486_s_at 4.03 0.000329 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 1552439_s_at 3.82 0.000714 MEGF11 multiple EGF-like-domains 11 210602_s_at 3.74 0.000408 CDH6 cadherin 6, type 2, K-cadherin (fetal kidney) 229947_at 3.62 0.00843 PI15 peptidase inhibitor 15 204006_s_at 3.39 0.00241 FCGR3A Fc fragment of IgG, low affinity IIIa, receptor (CD16a) 202238_s_at 3.29 0.00492 NNMT nicotinamide N-methyltransferase 202917_s_at 3.20 0.00369 S100A8 S100 calcium binding protein A8 215223_s_at 3.17 0.000516 SOD2 superoxide dismutase 2, mitochondrial 204627_s_at 3.04 0.00619 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 223217_s_at 2.99 0.00397 NFKBIZ nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta 231067_s_at 2.97 0.00681 AKAP12 A kinase (PRKA) anchor protein 12 224917_at 2.94 0.00256 VMP1/ mir-21likely ortholog